Co-cultivation method for production of a target molecule

Abstract

Provided herein is a method of producing a target product, comprising co-culturing a producer cell and a recycler cell in a culture media comprising a first nutrient source, wherein the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source. Also provided herein are cells, nucleic acids, methods, and kits associated with the said method of producing a target product.

Description

[0001] CO-CULTIVATION METHOD FOR PRODUCTION OF A TARGET MOLECULE

[0002] Field of the invention

[0003] The invention is in the field of precision fermentation and biomanufacturing.

[0004] Acknowledgement of government funding

[0005] The project leading to this application has received funding from the European Union's Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie grant agreement No 101022536.

[0006] Background

[0007] Microorganisms' widespread production of food, biochemicals, biofuels, and biomaterials using renewable feedstocks is increasingly considered a sustainable alternative to conventional chemical synthesis, significantly reducing greenhouse gas emissions and environmental pollution.

[0008] One of the significant challenges in bioprocesses is the accumulation of undesired metabolic byproducts, which detrimentally impact the yields of the main product (Zentou et al., ACS Omega 6:4137-4146 (2021); Lin et al. Microb Cell Fact 16: 106 (2017)). Byproduct generation occurs naturally, redirecting carbon flux from the main product's metabolic pathway into other metabolic pathways. Additionally, the accumulation of certain byproducts can also exhibit inhibitory effects on microbial growth and bioproduction. Moreover, the most common byproducts (acetic acid, ethanol, citric acid, etc) are also found in complex feedstocks, and their efficient use by microbial cultures is essential for sustainable bioproduction (Roukas & Kotzekidou, Rev Environ Sci Biotechnol, 21 :299-329 (2022); Gomes et al., Renew Energy 157:332-341 (2020)). While many strain engineering approaches attempt to reduce the generation of byproducts by overexpressing or downregulating the expression of metabolic genes (Zhou et al., J Agric Food Chem 69:7572-7580 (2021); Zhu et al., Appl Environ Microbiol 74:6649-6655 (2008); Zhou et al., Bioresour Technol 391 : 130004 (2024); Gu et al., Microb Biotechnol 17, (2024)), it is generally difficult to fully reduce byproducts as they are often required to balance redox molecules Pinu et al., Metabolomics 14:43 (2018); van Hoek et al., BMC Syst Biol 6:22 (2012)), generating ATP (Hara & Kondo, Microb Cell Fact 14: 198 (2015); Fina et al., Microb Cell Fact 22: 117 (2023)), osmo-control and extracellular pH control (Heyland, Microbiology 155:3827-3837 (2009)). In addition, most of these approaches are designed for specific products, byproducts, feedstocks, and organisms and are difficult to translate to other systems. There therefore exists a need to develop improved bioprocesses with decreased metabolic byproducts and improved main product yields. Brief description of the invention The inventors have developed a robust fermentation method of producing target products with improved yields and reduced bioproduct accumulation. The inventors have surprisingly found that by deleting a gene responsible for the metabolism of a first nutrient source in yeast, it is possible to create a yeast strain (known as the “recycler cell”, “upcycler cell”, or “upcycler strain”) that is incapable of metabolising the first nutrient source, but which is capable of growing exclusively on the metabolic by-product (or “second nutrient source”) produced by a first strain (known as the “producer cell”) utilising the first nutrient source in co-culture. The recycler cell is also capable of growing exclusively on the second nutrient source in the absence of the producer strain, when the culture media is supplemented with the second media source. The inventors have further surprisingly found that co-culture of a “recycler cell” and a “producer cell” that have both been genetically engineered to produce a main product (or “target” product) on a first nutrient source, produces a significantly improved yield and significantly improved bioconversion yield of the target product compared to culture of the “producer cell” alone. Production of the main product (or “target” product) can be further improved by altering the carbon / nitrogen (C / N) ratio of the media used to culture the cells; and by altering the time at which the recycler cell is added to the culture post-inoculation with the producer strain. The inventors have also developed methods and tools for making a recycler cell. Detailed description of the invention In a first aspect, provided herein is a method of producing a target product, comprising co-culturing a producer cell and a recycler cell in a culture media comprising a first nutrient source, wherein the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source. As will be understood, the first nutrient source may be any primary nutrient source typically provided to a cell in culture, that is usually metabolised by the cell for growth and / or the production of target products. The second nutrient source is typically required to be present in the culture in order for the recycler cell to grow and / or to produce the target product. The second nutrient source may be provided from any suitable source, for example, the second nutrient source may be generated by the producer cell or may be added into the culture media from an exogenous source. In some embodiments, the second nutrient source is a by-product generated by the producer cell in the production of the target product. As used herein, the term “by-product” includes a molecule that is generated as part of the biosynthetic pathway of the target product, that is not metabolised by the producer cell or is metabolised by the producer cell at a lower rate than the first carbon source. The first carbon source may be metabolised by the producer cell in preference to the second carbon source. In the absence of the recycler cell or another cell that is capable of metabolising the second carbon source, the second carbon source may typically accumulate in the culture over time. As used herein, the term “capable of metabolising” with respect to a particular nutrient source indicates that an organism or cell can use said nutrient source for growth and / or for the production of target products. As used herein, the term “not capable of metabolising” with respect to a particular nutrient source indicates that an organism or cell cannot utilise said nutrient source for growth and / or for the production of target products. In some embodiments, the second nutrient source is not metabolised by the producer cell, or wherein the first nutrient source is metabolised by the producer cell in preference to the second nutrient source. In this way, the second nutrient source produced by the producer cell will typically accumulate over time in the culture media during the culture and / or growth of the producer cell, in the absence of the recycler cell. When the recycler cell is present, metabolism of the second nutrient source by the recycler cell reduces the level of the second nutrient source, compared to the level in a culture of the producer cell alone. As used herein, the term “metabolised” with respect to a particular nutrient source indicates that said nutrient source is used by an organism or cell for growth and / or for the production of target products. As used herein, the term “not metabolised” with respect to a particular nutrient source indicates that said nutrient source is not used or is not substantially used by an organism or cell for growth and / or for the production of target products. Methods of determining whether a particular nutrient source is metabolised or is not metabolised by an organism or cell for growth are known in the art, and include for example culturing the cell or organism in a culture medium comprising the nutrient source (optionally as the sole nutrient source) and determining whether the cell or organism grows, using methods known in the art such as measuring the change in optical density of the culture medium at fixed intervals throughout the culture period. If the organism or cell is determined to grow in the medium comprising the nutrient source – for example, if the optical density of the culture medium increases during the culture period – the organism or cell is determined to metabolise the nutrient source. If the organism or cell is determined not to grow in the medium comprising the nutrient source – for example, if the optical density of the culture medium does not increase or does not significantly increase during the culture period – the organism or cell is determined not to metabolise the nutrient source. Any suitable method of co-culturing the producer cell and the recycler cell may be used, provided the recycler cell can access the second nutrient source. For example, the producer cell and the recycler cell may be co-cultured together in the same vessel, or may be cultured in separate vessels, where the media from the producer cell vessel is perfused into the recycler cell vessel. Alternatively, one vessel may be used, but the producer cell and the recycler cell may be present in separate compartments within said vessel, where media can flow between said compartments, for example through a semi-permeable membrane or a microporous membrane. Accordingly, in some embodiments the producer cell and the recycler cell are cultured together in a first vessel. In some embodiments, the producer cell and the recycler cell are not in direct contact, but the recycler cell is exposed to the nutrient carbon source produced by the producer cell. In some optional embodiments, the producer cell is cultured in a first vessel and the recycler cell is cultured in a second vessel, arranged so that the recycler cell is exposed to at least a portion of the second nutrient source produced by the producer cell, optionally wherein culture media comprising the second nutrient source is perfused from the first vessel into the second vessel. In further optional embodiments, the producer cell and the recycler cell are cultured in the same vessel comprising two compartments separated by a semi-permeable membrane, wherein the producer cell and the recycler cell are each in a separate compartment. The skilled person is aware of culture techniques suitable for culturing the producer cell and recycler cell together in one vessel or culturing the cells not in direct contact. By “direct contact” it is meant that the cells are cultured together admixed in a culture medium. The cells may not be separated by a barrier or membrane. In “direct contact”, actual contact between the cells may be possible but is not required. The producer cell and the recycler cell may be added to the culture at any suitable time point. In some embodiments, the producer cell and the recycler cell are added to the culture at the same time point. It may be advantageous to add the producer cell and the recycler cell to the culture at different time points. In some embodiments, the recycler cell is added to the culture after the producer cell. In some embodiments, the recycler cell is added to the culture: i) at least 6 h after the producer cell, such as at least 12 h, at least 18 h, at least 24 h, at least 30 h, at least 36 h, at least 42 h, at least 48 h, at least 54 h, at least 60 h, at least 66 h, at least 72 h or later after the producer cell; ii) about 6 h after the producer cell, such as about 12 h, about 18 h, about 24 h, about 30 h, about 36 h, about 42 h, about 48 h, about 54 h, about 60 h, about 66 h, or about 72 h after the producer cell; and / or iii) 6 h after the producer cell, such as 12 h, 18 h, 24 h, 30 h, 36 h, 42 h, 48 h, 54 h, 60 h, 66 h, or 72 h after the producer cell. The producer cell and the recycler cell may be co-cultured for any suitable timer period. In some embodiments, the producer cell and the recycler cell are co-cultured for: a) at least 48 h, at least 72 h, at least 96 h, at least 120 h, at least 144 h, at least 168 h, at least 192 h, at least 216 h, at least 240 h, or more h; b) about 48 h, about 72 h, about 96 h, about 120 h, about 144 h, about 168 h, about 192 h, about 216 h, or about 240 h; and / or c) 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h, or 240 h. In some embodiments, the co-culture is a batch-fed co-culture. In some embodiments, the co-culture is a repeated or cyclic culture. In come embodiments, the co-culture is a fixed-volume fed-batch culture. In some embodiments, the co-culture is a repeated or cyclic fed-batch culture. In some embodiments, the co-culture is a single-fed batch culture. In some embodiments, the co-culture is a variable-volume fed-batch culture. In some embodiments, the co-culture is cultured in a continuous stirred-tank fermenter. In some embodiments, the co-culture is cultured in an airlift fermenter. In some embodiments, the co-culture is cultured in a packed bed fermenter. In some embodiments, the co-culture is cultured in a fluidised bed fermenter. In some embodiments, the co-culture is cultured in a membrane fermenter. In some embodiments, the co-culture is cultured in a bubble column fermenter. As disclosed herein, the second nutrient source may be provided from any suitable source. In some embodiments, the culture media is supplemented with exogenous second nutrient source. In some embodiments, the exogenous second nutrient source is added to the culture media at the same time as the recycler cell. As will be understood, the exogenous second nutrient source is supplementary to the second nutrient source produced by the producer cell, which is already present in the culture media. The nutrient source may be any suitable nutrient source, for example any nutrient source that is typically required for normal cell growth and / or production of the target product by a cell. In some embodiments, the first nutrient source is a first carbon source. In some embodiments, the first carbon source is: a) a sugar; optionally wherein the sugar is selected from the group comprising or consisting of: glucose, xylose, sucrose, lactose, and arabinose; optionally wherein the first carbon source is glucose; b) a lipid, optionally wherein the lipid is canola oil; c) an organic acid; optionally wherein the organic acid is selected from the group comprising or consisting of: acetic acid, butyric acid, propionic acid, and lactic acid; d) an alcohol; optionally wherein the alcohol is selected from the group comprising or consisting of: glycerol, ethanol, and erythritol; or e) carbon dioxide. In some embodiments, the first carbon source is glucose. In some embodiments, the first carbon source is not carbon dioxide. In some embodiments, the first carbon source is not carbon monoxide. In some embodiments, the first carbon source is not CD2. In some embodiments, the first carbon source is not acetate. In some embodiments, the first carbon source is not ethanol. In some embodiments, the first carbon source is not acetoin. In some embodiments, the first carbon source is not acetone. In some embodiments, the second nutrient source is a second carbon source. In some embodiments, the second carbon source is selected from the group comprising or consisting of: an organic acid, acetic acid, butyric acid, propionic acid, lactic acid, caproic acid, valeric acid, glycerol, ethanol, erythritol, carbon dioxide, and citric acid. In some embodiments, the second carbon source is citric acid. In some embodiments, the second carbon source is not carbon dioxide. In some embodiments, the second carbon source is not carbon monoxide. In some embodiments, the second carbon source is not CD2. In some embodiments, the second carbon source is not acetate. In some embodiments, the second carbon source is not ethanol. In some embodiments, the second carbon source is not acetoin. In some embodiments, the second carbon source is not acetone. In some embodiments, the media is supplemented with exogenous citric acid. In some embodiments, the media is supplemented with exogenous citric acid at a concentration of: a) at least 0.1 g / L, at least 1g / L, at 2 g / L, at least 3 g / L, at least 4 g / L, at least 5 g / L, at least 6 g / L, at least 7 g / L, at least 8 g / L, at least 9 g / L, at least 10 g / L, at least 11 g / L, at least 12 g / L, at least 13 g / L, at least 14 g / L, at least 15 g / L, or more; b) about 0.1 g / L, about 1g / L, at 2 g / L, about 3 g / L, about 4 g / L, about 5 g / L, about 6 g / L, about 7 g / L, about 8 g / L, about 9 g / L, about 10 g / L, about 11 g / L, about 12 g / L, about 13 g / L, about 14 g / L, or about 15 g / L; c) 0.1 g / L, 1g / L, at 2 g / L, 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, or 15 g / L. In some embodiments where the first nutrient source is a first carbon source and / or the second nutrient source is a second carbon source, the culture media further comprises a nitrogen source; optionally wherein the ratio of carbon to nitrogen in the culture media (C / N ratio) is: a) between 5 and 400, such as between 15 and 200, 35 and 100, or 60 and 80; b) at least 15, at least 35, at least 70, at least 100, at least 200, or at least 400, or more; c) about 15, about 35, about 70, about 100, about 200, or about 400; and / or d) 15, 35, 70, 100, 200, or 400. In some embodiments, the first nutrient source is a first nitrogen source. In some embodiments, the first nitrogen source is selected from the group comprising or consisting of: ammonia; ammonium; diammonium; nitrogen; nitrate; nitrite; urea; peptone; and an amino acid or amino acids, optionally selected from arginine, histidine, lysine, pyrrolysine, aspartic acid, glutamic acid, serine, threonine, asparagine glutamine, cysteine, selenocysteine, glycine, proline, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. In some embodiments, the second nutrient source is a second nitrogen source. In some embodiments, the second nitrogen source is selected from the group comprising or consisting of: nitrite, nitrate, ammonia, nitric oxide, nitrogen, nitrous oxide, and urea. In some embodiments,: a) i) the first nutrient source is a first carbon source; and / or ii) the second nutrient source is a second carbon source; and / or b) i) the first nutrient source is a first nitrogen source; and / or ii) the second nutrient source is a second nitrogen source. In some embodiments, the first nutrient source is a first carbon source and the second nutrient source is a second carbon source. In some embodiments the first nutrient source is a first nitrogen source and the second nutrient source is a second nitrogen source. In some embodiments, the first nutrient source is a first carbon source and the second nutrient source is a second nitrogen source. In some embodiments, the first nutrient source is a first nitrogen source and the second nutrient source is a second carbon source. The person skilled in the art is capable of selecting culture media that is appropriate for supporting the growth of a given cell type, for example, is aware of culture media that is appropriate for supporting the growth of fungal cells, bacterial cells, archaeal cells, plant cells, insect cells, and / or mammalian cells. In some embodiments, for example where the cell is a yeast cell, the culture media is selected from: a) YPD; b) YNB; or c) lignocellulosic hydrolysate; optionally wherein the lignocellulosic hydrolysate comprises glycose, citric acid, acetic acid, and xylose; optionally wherein the lignocellulosic hydrolysate further comprises furfural, hydroxymethylfurfural, benzoic acid, fructose, and / or arabinose. As described herein, in some embodiments the first nutrient source is a first carbon source that is glucose. Any suitable concentration of glucose may be used. In some embodiments, the culture media has a glucose concentration of: a) at least 10 g / L, at least 20 g / L, at least 30 g / L, at least 40 g / L, at least 50 g / L, at least 60 g / L, at least 70 g / L, at least 80 g / L, at least 90 g / L, at least 100 g / L, or more; b) about 10 g / L, about 20 g / L, about 30 g / L, about 40 g / L, about 50 g / L, about 60 g / L, about 70 g / L, about 80 g / L, about 90 g / L, or about 100 g / L; and / or c) 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, 80 g / L, 90 g / L, or 100 g / L. The composition of YPD media is shown in Table 1. The composition of YNB media is shown in Table 2. The composition of lignocellulosic hydrolysate media is shown in Table 3. Table 1 – YPD media Component Final concentration (g / L) Yeast extract 10 Peptone 20 Dextrose (Glucose) 20 Table 2 – YNB media Component Concentration in the medium (g / L) YNB glc (2%) YNB glc (10%) YNB cit (1%) Glucose 20 100 0 Ammonium 0.05-4 0.25-20 5 chloride YNB without 1.7 1.7 1.7 amino acids and ammonium sulphate Phosphate buffer 50 mM 50mM 50mM Citric acid 0 0 10 Table 3 – Lignocellulosic hydrolysate (waste hydrolysate) media Component (g / L) y edidi lht ldis c a t e a e a c e e W se c ras s o oa as r ciilum c cofyufct riothydrolysateulr y r x o cnib Gtie X u o F rufz u c n r ar C A dle F y A B H UP 89.79 11.64 0.19 1.2 0.085 0.116 0.052 0 0 DM 15.99 1.58 0.66 0.11 0 0 0 14.15 1.44 Yeast may be cultured in or on solid (agar) media, or in liquid media. Preferably the method comprises culturing the recombinant yeast cell of the invention in a liquid media. Preferably the liquid culture is incubated with some agitation, such as shaking in a shaking incubator. The producer cell and / or recycler cell provided herein may be any suitable type of cell. In some embodiments, the producer cell and / or the recycler cell is a cell selected from: a eukaryotic cell and a prokaryotic cell. In some embodiments, the producer cell and / or the recycler cell is a cell selected from the group comprising or consisting of: a yeast cell, a bacterial cell, an archaeal cell, an algal cell, a plant cell, a mammalian cell, a protist cell, and an amoeba cell. In some embodiments: a) the producer cell and / or the recycler cell is a fungal cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: a Yarrowia cell, a Saccharomyces cell, a Komagataella cell (a Pichia cell), a Schizosaccharomyces cell, an Ashbya cell, a Blastobotrys cell, a Cryptococcus cell, a Debaromyces cell, a Dekkera cell, a Hansuela cell, a Kluveromyces cell, a Lipomyces cell, a Rhodosporidium cell, a Rhodotorula cell, and a Candida cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia cell optionally selected from the group comprising or consisting of a Yarrowia bubula cell, a Yarrowia deformans cell, a Yarrowia lipolytica cell, a Yarrowia porcina cell, a Yarrowia yakushimensis cell, a Yarrowia parophonii cell, a Yarrowia galli cell, a Yarrowia oslonensis cell, a Yarrowia alimentaria cell, a Yarrowia hollandica cell, and a Yarrowia phangngaensis cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia lipolytica cell; and / or b) the producer cell and / or the recycler cell is a bacterial cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: an Escherichia cell, a Pseudomonas cell, a Vibrio cell, a Bacillus cell, a Clostridium cell, a Lactobacillus cell, a Komagataeibacter cell, a Gluconacetobacter cell, an Acetobacter cell, a Sarcina cell, an Agrobacterium cell, an Azobacter cell, a Rhizobium cell, a Salmonella cell, an Alcaligenes cell, and a Eubacterium cell. In some embodiments, the producer cell and / or the recycler cell is not a bacterial cell. In some embodiments, the producer cell and / or the recycler cell is not a Clostridium cell. In some embodiments, the producer cell and / or the recycler cell is not a cell selected from the group comprising or consisting of: Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium tyrobutyricum, Clostridium pasteurianum, Clostridium butylicum, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium butyricum, Clostridium cellulovorans, Clostridium kluyveri, Clostridium carboxidivorans, Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium algidicarnis, Clostridium arbusti, Clostridium argentinense, Clostridium aurantibutylicum, Clostridium Clostridium neopropionicum, Clostridium ragsdalei, Clostridium saccharoacetobutylicum, Clostridium sporogenes, Clostridium tetanomorphum, Clostridium thermoaceticum, Clostridium thermocellum, Clostridium aurantibutyricum, Clostridium thermobutyricum, and solventogenic Clostridia from the NRRL, DSMZ, NCIMB, and JCM culture collections. In some embodiments, the producer cell and / or the recycler cell is not an Acetobacterium cell. In some embodiments, the producer cell and / or the recycler cell is not an Acetobacterium woodii cell. In some embodiments, the producer cell and / or the recycler cell is not a Moorella cell. In some embodimetns, the producer cell and / or the recycler cell is not a Moorella thermoaceitica cell. In some embodiments, the producer cell and / or the recycler cell is not a Eubacterium cell. In some embodiments, the producer cell and / or the recycler cell is not a Eubacterium limosum cell. In some embodiments, the producer cell and / or the recycler cell is not a Bacillus cell. In some embodiments, the producer cell and / or the recycler cell is not a Lactobacillus cell. In some embodiments, the producer cell and / or the recycler cell is not a Lactococcus cell. In some embodiments, the producer cell and / or the recycler cell is not an Escherichia cell. In some embodiments, the producer cell and / or the recycler cell is not an Escherichia coli cell. In some embodiments, the producer cell and / or the recycler cell is not a cell from a species or strain selected from the group comprising or consisting of: Acetitomaculum ruminis, Acetoanaerobium noterae, Acetoanaerobium romashkovii, Acetobacterium bakii, Acetobacterium carbinolicum, Acetobacterium dehalogenans, Acetobacterium fimetarium, Acetobacterium malicum, Acetobacterium paludosum, Acetobacterium psammolithicum, Acetobacterium tundra, Acetobacterium wieringae, Acetobacterium woodii, Acetobacterium sp. AmMan1, Acetobacterium sp. B10, Acetobacterium sp. HA1, Acetobacterium sp. HP4, Acetobacterium sp. KoB58, Acetobacterium sp. LuPhet1, Acetobacterium sp. LuTria3, Acetobacterium sp. MrTac1, Acetobacterium sp. OyTac1, Acetobacterium sp, RMMac1, Acetobacterium sp. 69, Acetohalobium arabaticum, Acetonema longum, Bryantella formatexigens, Butyribacterium methylotrophicum, Caloramator fervidus, Clostridium aceticum, Clostridium autoethanogenum, Clostridium carboxidivorans, Clostridium coccoides, Clostridium difficile AA1, Clostridium drakei, Clostridium formicaceticum, Clostridium glycolicum 22, Clostridium glycolicum RD-1, Clostridium ljungdahlii, Clostridium magnum, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium scatologenes, Clostridium ultunense, Clostridium sp. CV-AA1, Clostridium sp. M5a3, Clostridium sp. F5a15, Clostridium sp. Ag4f2, Clostridium sp. TLN2, Eubacterium aggregans, Eubacterium limosum, Holophaga foetida, Moorella glycerini, Moorella mulderi, Moorella thermoacetica, Moorella thermoautotrophica, Moorella sp. F21 , Moorella sp. HUC22-l, Natroniella acetigena, Natronincola histidinovorans, Oxobacter pfennigii, Ruminococcus hydrogenotrophicus, Ruminococcus productus, Ruminococcus productus, Ruminococcus schinkii, Ruminococcus sp. TLFl, Sporomusa acidovorans, Sporomusa aerivorans, Sporomusa malonica, Sporomusa ovate, Sporomusa paucivorans, Sporomusa silvacetica, Sporomusa sphaeroides, Sporomusa termitida, Sporomusa sp. DR6, Sporomusa sp. DRl / 8, Syntrophococcus sucromutans, Thermoacetogenium phaeum, Thermoanaerobacter kivui, Tindallia califomiensis, Treponema azotonutricium, and Treponema primitia. In some embodiments, the producer cell is not a Clostridium acetobutylicum cell and the recycler cell is not a Clostridium ljungdahlii cell. In some embodiments, the producer cell is not a Clostridium ljungdahlii cell and the recycler cell is not a Clostridium acetobutylicum cell. In some embodiments, the producer cell is not a Clostridium acetobutylicum cell, the recycler cell is not a Clostridium ljungdahlii cell, and the second carbon source is not carbon dioxide. The genus and / or species of the producer cell and the recycler cell may be same or may be different. In some embodiments, the producer cell and the recycler cell are the same species. In some embodiments, the producer cell and the recycler cell are each a Yarrowia lipolytica cell. In some embodiments, the producer cell and the recycler cell are derived from a Yarrowia lipolytica H222 cell (GenBank accession number: GCA_900537225). By “derived from” it is meant that the producer cell and / or the recycler cell are modified versions of the Yarrowia lipolytica H222 cell, comprising genetic modifications (such as, for example, single nucleotide polymorphism(s), gene deletion(s), indel(s), microdeletion(s), gene insertion(s), and the like) to the genome and / or comprising a vector, for example a vector as described herein. In some embodiments, the producer cell is RLA 3656 as provided herein. In some embodiments, the producer cell is RLA 3657 as provided herein. In some embodiments, the recycler cell is RLA 1072 as provided herein. In some embodiments, the recycler cell is RLA 3014 as provided herein. In some embodiments, the recycler cell is Yarrowia lipolytica RLA 3014, deposited by Imperial College of Science, Technology, and Medicine, Exhibition Road South Kensington, London, SW72AZ at NCIMB Ltd. Wellheads Place, Dyce Aberdeen, AB21 7GB, Scotland as NCIMB 44420 on 23 August 2024. Genotypes of Yarrowia lipolytica cells as described and provided herein are set out in Table 4. Table 4 – Genotypes of Yarrowia lipolytica cells described and provided herein Strain name Description H222 WT RLA 1072 Po1d, ΔHXT RLA 1717 Po1d, Δyht1-4 RLA 3014 ΔHXT, evolved on CA (deposited as NCIMB 44420 on 23 August 2024) RLA 3656 H222, Hyg::8UAS pTEF-GGS1-TLip2+ pTEF-CarB-TLip+pTEF-CarRP- TLip2 RLA 3657 RLA 3014, Hyg::8UAS pTEF-GGS1-TLip2+ pTEF-CarB-TLip+pTEF- CarRP-TLip2 As is known in the art, Yarrowia lipolytica previously had the taxonomic name Candida lipolytica. Accordingly, the taxonomic names Yarrowia lipolytica and Candida lipolytica as used herein are interchangeable. Methods of genetically modifying a cell such as a yeast cell are known to the person skilled in the art. In some embodiments, the recycler cell comprises a deletion of: a) a glucose metabolism gene, optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: i) has the sequence of SEQ ID NO: 4; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase. In some embodiments, the recycler cell is an evolved recycler cell has been obtained by directed evolution from an ancestral recycler cell. The term “directed evolution” as used herein includes any process that mimics the process of natural selection to alter the coding sequence of a gene or the coding sequence of a protein to alter the activity of said gene or protein sequence, or to alter any characteristic of a cell, to a defined goal. Directed evolution is typically performed by subjecting the cell to conditions that promote genetic mutations to arise within the cell, and that select for the defined goal or characteristic. In some embodiments, the conditions that promote genetic mutation comprise contacting the cell with: a) a chemical mutagen such as a DNA alkylating agent, a crosslinking agent, an intercalating agent, a deaminating agent, a polycyclic aromatic hydrocarbon, an aromatic amine, an acetylaminofluorene, an alkaloid, bromine, sodium azide, psoralen, benzene, a base analog, arsenic, chromium, nickel, and / or cobalt; b) a physical mutagen such as UV light, X-rays, gamma rays, and / or alpha particles; and / or c) a genetic mutagen such as a transposable element, a transposon, a retrotransposon, a viral genome or a portion of a viral genome, such as an integrating viral genome or integrating portion of a viral genome, a phage genome or a portion of a phage genome such as an integrating or lysogenic phage genome or portion of an integrating or lysogenic phage genome, and / or a gene edit performed with a gene editing system such as CRISPR, TALEN, and / or zinc finger nuclease. As is known in the art, it is typical for a genome of a cell to accrue mutations at random locations during normal genome replication and cell growth, in the absence of a chemical, physical, or genetic mutagen. Accordingly, in some embodiments, the conditions that promote genetic mutation comprise culturing the cell in culture media. Directed evolution may typically involve multiple rounds of culturing, for example by sub- culturing an initial culture into a subsequent culture. The subsequent culture may itself be sub-cultured, and each subsequent culture itself sub-cultured. This process allows the accumulation of mutations and / or the selection for the defined goal. At any point during directed evolution, individual clones may be isolated from the culture using methods known in the art. Isolated clones may optionally be subjected to (further) directed evolution. Any characteristic of the cell may be altered by directed evolution. Exemplary characteristics may be selected from the group comprising or consisting of: doubling time (including decreasing the doubling time of the cell); utilisation of a nutrient source (including improving the utilisation of a nutrient source by the cell); sensitivity to an antimicrobial agent (including improving resistance of the cell to an antimicrobial agent); and pathogenicity (including decreasing the pathogenicity of the cell). In some embodiments, the directed evolution comprises: a) culturing an ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutrient for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source, thereby identifying an evolved recycler cell. In some embodiments, the method further comprises b) i) sub-culturing the sub-cultured plurality of recycler cells in a culture medium comprising the second nutrient source for a third period to obtain a sub-cultured plurality of recycler cells. Any suitable method of identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source may be used, for example determining the growth of the recycler cell of the sub-cultured plurality on the second nutrient source. In some embodiments, a recycler cell of the sub-cultured plurality or the sub-cultured plurality is cultured in media comprising the second nutrient source as a sole nutrient source for a pre-defined period, and the growth of the recycler cell of the sub- cultured plurality or the sub-cultured plurality is determined. In some embodiments, growth of the recycler cell of the sub-cultured plurality or the sub-cultured plurality is determined by measuring the optical density (OD) of the culture medium. In some embodiments, the optical density (OD) of the culture medium is measured at the end of the pre-defined period. In some embodiments, the optical density (OD) of the culture medium is measured at defined intervals throughout the pre-defined period. By measuring the optical density (OD) of the culture medium at defined intervals throughout the pre- defined period, it is also possible to determine the doubling time of the recycler cell using methods known to the person skilled in the art. Accordingly, in some embodiments, step c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second nutrient source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second nutrient source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second nutrient source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. As discussed herein, directed evolution may be used to alter the coding sequence of a gene or the coding sequence of a protein to alter the activity of said gene or protein sequence. The characteristic of the cell that is altered may be due to an alteration in the coding sequence of a gene or the coding sequence of a protein to alter the activity of said gene or protein sequence. Accordingly, in some embodiments, the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell. The one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene may be identifies using methods known to the person skilled in the art, for example using DNA sequencing, RNA sequencing, whole genome sequencing, whole exome sequencing, and the like. The target product may be any product that can be produced by a producer cell and / or a recycler cell as provided herein. Accordingly, in some embodiments, the target product is selected from the group comprising or consisting of: a small molecule, a peptide, a polypeptide, a nucleic acid, and a lipid. In some embodiments, the target product is produced in an intracellular compartment of the producer cell and / or recycler cell. In some embodiments, once produced the target product is retained in an intracellular compartment of the producer cell and / or recycler cell. In some embodiments, the target product is not secreted from the producer cell and / or recycler cell; optionally is not secreted from the producer cell and / or recycler cell into the extracellular mileu or culture media. In some embodiments, the target product is a product that is produced naturally by the producer cell and / or the recycler cell. The term “produced naturally” includes production of the target product by a producer cell and / or recycler cell that has not been genetically engineered, for example by a wild-type producer cell and / or recycler cell or a wild-type producer cell and / or recycler cell that has been subjected to directed evolution. In some embodiments, the target product is a product that is not naturally produced by the producer cell and / or the recycler cell. Accordingly, in some embodiments, the producer cell and / or the recycler cell has been engineered to produce the target product. In some embodiments, for example wherein the target molecule is a peptide, a polypeptide, or a nucleic acid, the producer cell and / or the recycler cell comprise a nucleic acid comprising a nucleotide sequence encoding said peptide, polypeptide, or nucleic acid. In some embodiments, the nucleotide sequence encoding the peptide, polypeptide, or nucleic acid is operably linked to a promoter. In some embodiments, for example where the target product is a small molecule or a lipid, the producer cell and / or the recycler cell comprise a nucleic acid comprising a nucleotide sequence encoding one or more genes and / or proteins required for the biosynthesis of the target product, also known as biosynthetic genes and / or proteins. The nucleotide sequence encoding the biosynthetic genes and / or proteins may encode an operon of biosynthetic genes and / or proteins. Each nucleotide sequence encoding a biosynthetic gene and / or protein may be operably linked to a promoter. Each operon may be operably linked to a promoter. In some embodiments, the target product is a carotene. In some embodiments, the target product is β-carotene. In some embodiments, the producer cell comprises a nucleic acid required to produce the target, optionally comprising a β-carotene biosynthesis cassette. In some embodiments, the recycler cell comprises a nucleic acid required to produce the target, optionally comprising a β-carotene biosynthesis cassette. In some embodiments, the producer cell and the recycler cell each comprise a nucleic acid required to produce the target, optionally comprising a β-carotene biosynthesis cassette. In some embodiments, the nucleic acid is endogenous. In some embodiments, the nucleic acid is heterologous. In some embodiments, the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / or c) a CarPR gene. In some embodiments: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3. In some embodiments, at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to a promoter. In some embodiments, all three of the GSS1, CarB, and CarPR genes are operably linked to a promoter. In some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are arranged in an operon that is operably linked to one promoter. In some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. In some embodiments, all three of the GSS1, CarB, and CarPR genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. Any suitable promoter may be used. In some embodiments, the promoter is capable of driving expression of a gene or protein in a Yarrowia cell, optionally wherein the Yarrowia cell is a Yarrowia lipolytica cell. In some embodiments, the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is a constitutive promoter. In some embodiments, the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is an inducible promoter. In some embodiments, every promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is a constitutive promoter. In some embodiments, every promotor to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is linked is an inducible promoter. In some embodiments the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is selected from the group comprising or consisting of: a) a constitutive promoter selected from the group comprising or consisting of: an ATP1 promoter [SEQ ID NO: 5], an ATP2 promoter [SEQ ID NO: 6], an FBAin promoter [SEQ ID NO: 7], a PGK1 promoter [SEQ ID NO: 8], a GPM1 promoter [SEQ ID NO: 9], a HHF1 promoter [SEQ ID NO: 10], a CYC1 promoter [SEQ ID NO: 11], an HHT1 promoter [SEQ ID NO: 12], an HTB1 promoter [SEQ ID NO: 13], an EXP1 promoter [SEQ ID NO: 14], a TDH1 promoter [SEQ ID NO: 15], an RPL25 promoter [SEQ ID NO: 16], a TEF1 promoter [SEQ ID NO: 17], a TEFin promoter [SEQ ID NO: 18], a TEF2UAS promoter [SEQ ID NO: 19], a TEF4UAS promoter [SEQ ID NO: 20], and a TEF8UAS promoter [SEQ ID NO: 21], a pTEF promoter [SEQ ID NO: 22 and 23], a GAP promoter [SEQ ID NO: 24]; or: i) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the said sequences; ii) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the said sequences; iii) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the said sequences; or b) an inducible promoter selected from the group comprising or consisting of: a pPOX2 promoter [SEQ ID NO: 25], a pXPR2 promoter [SEQ ID NO: 26], a pFBP1 promoter [SEQ ID NO: 27], a pMDH1a promoter [SEQ ID NO: 28], an ACL2 promoter [SEQ ID NO: 29], an XPR2 promoter [SEQ ID NO: 30], , a POT1 promoter [SEQ ID NO: 31], a LIP2 promoter[SEQ ID NO: 32], an ICL promoter [SEQ ID NO: 33], a YAT1 promoter [SEQ ID NO: 34], a CTR1 promoter [SEQ ID NO: 35], a CTR2 promoter [SEQ ID NO: 36], a pYALI0B18194 promoter [SEQ ID NO: 37], a pYALI0C11165 promoter [SEQ ID NO: 38], a pYALI0C15004 promoter [SEQ ID NO: 39], a pYALI0E14256 promoter [SEQ ID NO: 40], and a pYALI0F13937 promoter [SEQ ID NO: 41]; or or: i) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the said sequences; ii) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the said sequences; iii) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the said sequences. These promoters are described in “A DNA assembly toolkit to unlock the CRISPR / Cas9 potential for metabolic engineering” Tigran Yuzbashev, Evgeniya Yuzbasheva, Olga Melkina, Davina Patel, Dmitrii Bubnov, Heiko Dietz, and Rodrigo Ledesma-Amaro Version 1 posted 04 Apr, 2023 https: / / www.researchsquare.com / article / rs-2738543 / v1, and International Patent Application No. PCT / GB2024 / 051506 (each of which is herein incorporated by reference in its entirety). In some embodiments, the inducible promoter is a pTEF promoter. In some embodiments, the pTEF promoter has a sequence that is: a) the sequence of SEQ ID NO: 22 or SEQ ID NO: 23; b) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to SEQ ID NO: 22 or SEQ ID NO: 24; c) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% identical to SEQ ID NO: 22 or SEQ ID NO: 23; or; d) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 or SEQ ID NO: 24. The skilled person will also appreciate that appropriate terminator sequences are required for proper protein expression. Accordingly, in some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence. In some embodiments, the terminator sequence is a tLIP2 terminator. In some embodiments, the tLIP2 terminator has a nucleotide sequence of SEQ ID NO: 42. The skilled person will understand that nucleic acids that express desired proteins, such as the target product or the genes and / or proteins required for the biosynthesis of the target product described here, can be expressed from a chromosomal location, or can be expressed extra-chromosomally, for example from a plasmid. Accordingly, in some embodiments, the nucleic acid comprising the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is integrated into the genome. Methods of integrating a nucleic acid into the genome of a cell are known to the skilled person. For example, a nucleic acid may be suitable integrated into a genome of a cell by targeted integration by homologous recombination or random genomic integration. In some embodiments, the nucleic acid comprising the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is comprised by a vector. In some embodiments, the vector is selected from the group comprising or consisting of: a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome. In some embodiments, the vector is a plasmid, optionally is the ZHygA2 plasmid. In some embodiments, the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; and chloramphenicol. In some embodiments, the target product is indigoidine. Cells capable of producing indigoidine, genetic constructs that may be used to produce indigoidine, and methods of producing indigoidine are disclosed in International Patent Application No. PCT / GB2024 / 051506 (herein incorporated by reference in its entirety). As discussed herein, the method provided herein provides a significantly improved yield and / or bioconversion yield of the target product, compared to production of the target product by the producer cell alone. Accordingly, in some embodiments, the method provides a bioconversion yield of: a) at least 0.02 g of target product per g of first nutrient source (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; b) about 0.02 g of target product per g of first nutrient source (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; c) 0.02 g of target product per g of first nutrient source (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g. In some embodiments, wherein the first nutrient source is glucose, the method provides a bioconversion yield of: i) at least 0.02 g of β-carotene per g of glucose (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; ii) about 0.02 g of β-carotene per g of glucose (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; iii) 0.02 g of β-carotene per g of glucose (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g. In some embodiments, wherein the first nutrient source is glucose, the method provides a bioconversion yield of 0.11 g of β-carotene per g of glucose. In some embodiments, wherein the first nutrient source is glucose, the method provides a β-carotene yield of: i) at least 100 mg / L, at least 200 mg / L, at least 300 mg / L, at least 400 mg / L, at least 500 mg / L, at least 600 mg / L, at least 700 mg / L, at least 800 mg / L at least 900 mg / L, at least 1000 mg / L, at least 1200 mg / L, at least 1400 mg / L, at least 1600 mg / L, at least 1800 mg / L, at least 2000 mg / L, at least 2500 mg / L, at least 3000 mg / L, at least 3500 mg / L, at least 4000 mg / L, or more; ii) about 100 mg / L, about 200 mg / L, about 300 mg / L, about 400 mg / L, about 500 mg / L, about 600 mg / L, about 700 mg / L, about 800 mg / L about 900 mg / L, about 1000 mg / L, about 1200 mg / L, about 1400 mg / L, about 1600 mg / L, about 1800 mg / L, about 2000 mg / L, about 2500 mg / L, about 3000 mg / L, about 3500 mg / L, about 4000 mg / L, or about 4100 mg / L; iii) 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L 900 mg / L, 1000 mg / L, 1200 mg / L, 1400 mg / L, 1600 mg / L, 1800 mg / L, 2000 mg / L, 2500 mg / L, 3000 mg / L, 3500 mg / L, 4000 mg / L, 4100 mg / L, or 4101 mg / L. In one aspect, the invention provides a method of producing a target product, comprising co-culturing a producer cell and a first plurality of recycler cells in a culture media comprising a first nutrient source, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the cells of the first plurality of recycler cells is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source. In some embodiments, the method is the method provided herein. In some embodiments, the producer cell is a producer cell provided herein. More than one plurality of recycler cells may be employed as part of the method. Accordingly, in some embodiments, the method further comprises co-culturing the producer cell and first plurality of recycler cells with a second, a third, a fourth, a fifth, a sixth, a seventh, an eighth, a ninth, and / or a tenth plurality of recycler cells. Any suitable method of co-culturing the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells may be used, provided the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells can access the second nutrient source. For example, the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells may be co- cultured together in the same vessel, or may be cultured in separate vessels, where the media from the producer cell vessel is perfused into the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells vessel. Alternatively, one vessel may be used, but the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells may be present in separate compartments within said vessel, where media can flow between said compartments, for example through a semi-permeable membrane or a microporous membrane. Accordingly, in some embodiments the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are cultured together in a first vessel. In some embodiments, the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are not in direct contact, but the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are exposed to the nutrient carbon source produced by the producer cell. In some optional embodiments, the producer cell is cultured in a first vessel and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are cultured in a second vessel, arranged so that the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are exposed to at least a portion of the second nutrient source produced by the producer cell, optionally wherein culture media comprising the second nutrient source is perfused from the first vessel into the second vessel. In further optional embodiments, the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are cultured in the same vessel comprising two compartments separated by a semi-permeable membrane, wherein the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are each in a separate compartment. The skilled person is aware of culture techniques suitable for culturing the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells and recycler cell together in one vessel or culturing the cells not in direct contact. By “direct contact” it is meant that the cells are cultured together admixed in a culture medium. The cells may not be separated by a barrier or membrane. In “direct contact”, actual contact between the cells may be possible but is not required. The producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells may be added to the culture at any suitable time point. In some embodiments, the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are added to the culture at the same time point. It may be advantageous to add the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells to the culture at different time points. In some embodiments, the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are added to the culture after the producer cell. In some embodiments, the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are added to the culture: i) at least 6 h after the producer cell, such as at least 12 h, at least 18 h, at least 24 h, at least 30 h, at least 36 h, at least 42 h, at least 48 h, at least 54 h, at least 60 h, at least 66 h, at least 72 h or later after the producer cell; ii) about 6 h after the producer cell, such as about 12 h, about 18 h, about 24 h, about 30 h, about 36 h, about 42 h, about 48 h, about 54 h, about 60 h, about 66 h, or about 72 h after the producer cell; and / or iii) 6 h after the producer cell, such as 12 h, 18 h, 24 h, 30 h, 36 h, 42 h, 48 h, 54 h, 60 h, 66 h, or 72 h after the producer cell. The producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells may be co-cultured for any suitable timer period. In some embodiments, the producer cell and the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality or pluralities of recycler cells are co-cultured for: a) at least 48 h, at least 72 h, at least 96 h, at least 120 h, at least 144 h, at least 168 h, at least 192 h, at least 216 h, at least 240 h, or more h; b) about 48 h, about 72 h, about 96 h, about 120 h, about 144 h, about 168 h, about 192 h, about 216 h, or about 240 h; and / or c) 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h, or 240 h. In some embodiments, the producer cell is capable of producing a third, a fourth, a fifth, a sixth, a seventh, an eight, a ninth, or a tenth nutrient source. Each plurality of recycler cells may be capable of producing the same product; or may produce a different product. Similarly, each plurality of recycler cells may be capable of metabolising the same second nutrient source, or may be capable of metabolising different nutrient sources. These arrangements are particularly advantageous, as they may allow the production of multiple different target products in one co-culture, and / or the utilisation of multiple different by-products (which would otherwise be discarded) in one co-culture. As will be understood, these arrangements provide further increased bioconversion yields. Accordingly, in some embodiments: a) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of producing the target product; b) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is: i) capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; and / or ii) not capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; c) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source; and / or d) at least one of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source to at least one other of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells. In some embodiments, each cell of each plurality of recycler cells is a recycler cell provided herein. The invention also provides a method of improving the improve the ability of an ancestral recycler cell to metabolise a second nutrient source, the method comprising: a) culturing the ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutrient for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying an evolved recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source; optionally wherein: the second carbon source is a second nutrient source provided herein; and / or the recycler cell is a recycler cell provided herein. Accordingly, in one aspect, the invention provides a method of performing directed evolution to improve the ability of an ancestral recycler cell to metabolise a second nutrient source. Directed evolution and directed evolution methods are discussed herein. In some embodiments, the method further comprises b) i) sub-culturing the sub-cultured plurality of recycler cells in a culture medium comprising the second nutrient for a third period to obtain a sub-cultured plurality of recycler cells. In some embodiments, step c) identifying an evolved recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second nutrient source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second nutrient source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second nutrient source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. In one aspect, the invention provides a producer cell, wherein the producer cell is a producer cell provided herein. In one aspect, the invention provides a recycler cell, wherein the recycler cell is a recycler cell provided herein. In one aspect, the invention provides a Yarrowia lipolytica cell that is capable of utilising citric acid as a sole carbon source. In some aspects, the Yarrowia lipolytica cell comprises a deletion of: a) a glucose metabolism gene; optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: i) has the sequence of SEQ ID NO: 4; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase. In some embodiments, the Yarrowia lipolytica cell is an evolved Yarrowia lipolytica cell has been obtained by directed evolution from an ancestral Yarrowia lipolytica cell. The directed evolution may be any directed evolution or directed evolution method provided herein. In some embodiments, the directed evolution comprises: a) culturing an ancestral Yarrowia lipolytica cell in a culture medium comprising the second carbon source for a first period to obtain a plurality of Yarrowia lipolytica cells; b) sub-culturing the plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a second period to obtain a sub-cultured plurality of Yarrowia lipolytica cells; and c) identifying a Yarrowia lipolytica cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source, thereby identifying an evolved Yarrowia lipolytica cell. In some embodiments, the directed evolution further comprises b) i) sub-culturing the sub- cultured plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a third period to obtain a sub-cultured plurality of Yarrowia lipolytica cells. In some embodiments, step c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second carbon source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second carbon source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second carbon source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. In some embodiments, the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell. In some embodiments, the evolved recycler cell is derived from a Yarrowia lipolytica H222 cell (GenBank accession number: GCA_900537225). By “derived from” it is meant that the producer cell and / or the recycler cell are modified versions of the Yarrowia lipolytica H222 cell, comprising genetic modifications (such as, for example, single nucleotide polymorphism(s), gene deletion(s), indel(s), microdeletion(s), gene insertion(s), and the like) to the genome and / or comprising a vector, for example a vector as described herein. In some embodiments, the producer cell is RLA 3656 as provided herein. In some embodiments, the evolved recycler cell is RLA 3014 as provided herein and deposited by Imperial College of Science, Technology, and Medicine, Exhibition Road, South Kensington, London, SW7 2AZ as NCIMB 44420 on 23 August 2024 at NCIMB Ltd. Wellheads Place, Dyce Aberdeen, AB217GB, Scotland as NCIMB 44420. In some embodiments, the evolved recycler cell is RLA 3657. Genotypes of Yarrowia lipolytica cells as described and provided herein are set out in Table 4. In one aspect, the invention provides a culture medium comprising lignocellulosic hydrolysate, wherein the medium comprises glycose, citric acid, acetic acid, and xylose; optionally wherein the lignocellulosic hydrolysate further comprises furfural, hydroxymethylfurfural, benzoic acid, fructose, and / or arabinose. In some embodiments, the medium comprises: a) i) about 90 g / L glucose, about 11.6 g / L citric acid, about 0.19 g / L acetic acid, about 1.2 g / L xylose, about 0.085 g / L furfural, about 0.12 g / L hyroxymethyl furfural, and / or about 0.05 g / L benzoic acid; or ii) 89.79 g / L glucose, 11.64 g / L citric acid, 0.19 g / L acetic acid, 1.2 g / L xylose, 0.085 g / L furfural, 0.116 g / L hydroxymethyl furfural, and / or 0.052 g / L benzoic acid; or b) i) about 16 g / L glucose, about 1.6 g / L citric acid, about 0.6 g / L acetic acid, about 0.1 g / L xylose, about 14.2 g / L fructose, and / or about 1.4 g / L arabinose; or ii) 15.99 g / L glucose, 1.58 g / L citric acid, 0.66 g / L acetic acid, 0.11 g / L xylose, 14.15 g / L fructose, and / or 1.44 g / L arabinose. The invention also provides a nucleic acid comprising a β-carotene biosynthesis cassette. In some embodiments, the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / or c) a CarPR gene. In some embodiments: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3. In some embodiments, at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to a promoter. In some embodiments, all three of the genes are operably linked to a promoter. In some embodiments, the at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are arranged in an operon that is operably linked to one promoter. In some embodiments, the at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. In some embodiments, all three of the genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. In some embodiments, at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to a promoter. In some embodiments, all three of the GSS1, CarB, and CarPR genes are operably linked to a promoter. In some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are arranged in an operon that is operably linked to one promoter. In some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. In some embodiments, all three of the GSS1, CarB, and CarPR genes in the β-carotene biosynthesis cassette are each independently operably linked to a promoter. Any suitable promoter may be used. In some embodiments, the promoter is capable of driving expression of a gene or protein in a Yarrowia cell, optionally wherein the Yarrowia cell is a Yarrowia lipolytica cell. In some embodiments, the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is a constitutive promoter. In some embodiments, the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is an inducible promoter. In some embodiments, every promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is a constitutive promoter. In some embodiments, every promotor to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is linked is an inducible promoter. In some embodiments the promoter to which the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is operably linked is selected from the group comprising or consisting of: a) a constitutive promoter selected from the group comprising or consisting of: an ATP1 promoter [SEQ ID NO: 5], an ATP2 promoter [SEQ ID NO: 6], an FBAin promoter [SEQ ID NO: 7], a PGK1 promoter [SEQ ID NO: 8], a GPM1 promoter [SEQ ID NO: 9], a HHF1 promoter [SEQ ID NO: 10], a CYC1 promoter [SEQ ID NO: 11], an HHT1 promoter [SEQ ID NO: 12], an HTB1 promoter [SEQ ID NO: 13], an EXP1 promoter [SEQ ID NO: 14], a TDH1 promoter [SEQ ID NO: 15], an RPL25 promoter [SEQ ID NO: 16], a TEF1 promoter [SEQ ID NO: 17], a TEFin promoter [SEQ ID NO: 18], a TEF2UAS promoter [SEQ ID NO: 19], a TEF4UAS promoter [SEQ ID NO: 20], and a TEF8UAS promoter [SEQ ID NO: 21], a pTEF promoter [SEQ ID NO: 22 and 23], a GAP promoter [SEQ ID NO: 24]; or: i) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the said sequences; ii) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the said sequences; iii) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the said sequences; or b) an inducible promoter selected from the group comprising or consisting of: a pPOX2 promoter [SEQ ID NO: 25], a pXPR2 promoter [SEQ ID NO: 26], a pFBP1 promoter [SEQ ID NO: 27], a pMDH1a promoter [SEQ ID NO: 28], an ACL2 promoter [SEQ ID NO: 29], an XPR2 promoter [SEQ ID NO: 30], , a POT1 promoter [SEQ ID NO: 31], a LIP2 promoter[SEQ ID NO: 32], an ICL promoter [SEQ ID NO: 33], a YAT1 promoter [SEQ ID NO: 34], a CTR1 promoter [SEQ ID NO: 35], a CTR2 promoter [SEQ ID NO: 36], a pYALI0B18194 promoter [SEQ ID NO: 37], a pYALI0C11165 promoter [SEQ ID NO: 38], a pYALI0C15004 promoter [SEQ ID NO: 39], a pYALI0E14256 promoter [SEQ ID NO: 40], and a pYALI0F13937 promoter [SEQ ID NO: 41]; or or: i) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the said sequences; ii) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the said sequences; iii) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the said sequences. These promoters are described in “A DNA assembly toolkit to unlock the CRISPR / Cas9 potential for metabolic engineering” Tigran Yuzbashev, Evgeniya Yuzbasheva, Olga Melkina, Davina Patel, Dmitrii Bubnov, Heiko Dietz, and Rodrigo Ledesma-Amaro Version 1 posted 04 Apr, 2023 https: / / www.researchsquare.com / article / rs-2738543 / v1, and International Patent Application No. PCT / GB2024 / 051506 (each of which is herein incorporated by reference in its entirety). In some embodiments, the inducible promoter is a pTEF promoter. In some embodiments, the pTEF promoter has a sequence that is: a) the sequence of SEQ ID NO: 22 or SEQ ID NO: 23; b) a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to SEQ ID NO: 22 or SEQ ID NO: 24; c) a sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% identical to SEQ ID NO: 22 or SEQ ID NO: 23; or; d) a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23 or SEQ ID NO: 24. The skilled person will also appreciate that appropriate terminator sequences are required for proper protein expression. Accordingly, in some embodiments, the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence. In some embodiments, the terminator sequence is a tLIP2 terminator. In some embodiments, the tLIP2 terminator has a nucleotide sequence of SEQ ID NO: 42. The skilled person will understand that nucleic acids that express desired proteins, such as the target product or the genes and / or proteins required for the biosynthesis of the target product described here, can be expressed from a chromosomal location, or can be expressed extra-chromosomally, for example from a plasmid. Accordingly, in some embodiments, the nucleic acid comprising the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is integrated into the genome. Methods of integrating a nucleic acid into the genome of a cell are known to the skilled person. For example, a nucleic acid may be suitable integrated into a genome of a cell by targeted integration by homologous recombination or random genomic integration. In some embodiments, the nucleic acid comprising the at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette is comprised by a vector. In some embodiments, the vector is selected from the group comprising or consisting of: a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome. In some embodiments, the vector is a plasmid, optionally is the ZHygA2 plasmid. In some embodiments, the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; and chloramphenicol. In one aspect, the invention provides a cell comprising the nucleic acid provided herein. The cell may be any suitable cell. In some embodiments, the cell is a cell selected from: a eukaryotic cell and a prokaryotic cell. In some embodiments, the cell is a cell selected from the group comprising or consisting of: a yeast cell, a bacterial cell, an archaeal cell, an algal cell, a plant cell, a mammalian cell, a protist cell, and an amoeba cell. In some embodiments: a) the cell is a fungal cell; optionally wherein the fungal cell is selected from the group comprising or consisting of: a Yarrowia cell, a Saccharomyces cell, a Komagataella cell (a Pichia cell), a Schizosaccharomyces cell, an Ashbya cell, a Blastobotrys cell, a Cryptococcus cell, a Debaromyces cell, a Dekkera cell, a Hansuela cell, a Kluveromyces cell, a Lipomyces cell, a Rhodosporidium cell, a Rhodotorula cell, and a Candida cell; optionally wherein the cell is a Yarrowia cell optionally selected from the group comprising or consisting of: Yarrowia bubula cell, a Yarrowia deformans cell, a Yarrowia lipolytica cell, a Yarrowia porcina cell, a Yarrowia yakushimensis cell, a Yarrowia parophonii cell, a Yarrowia galli cell, a Yarrowia oslonensis cell, a Yarrowia alimentaria cell, a Yarrowia hollandica cell, and a Yarrowia phangngaensis cell; optionally wherein the cell is a Yarrowia lipolytica cell; and / or b) the cell is a bacterial cell; optionally wherein the bacterial cell is selected from the group comprising or consisting of: an Escherichia cell, a Pseudomonas cell, a Vibrio cell, a Bacillus cell, a Clostridium cell, a Lactobacillus cell, a Komagataeibacter cell, a Gluconacetobacter cell, an Acetobacter cell, a Sarcina cell, an Agrobacterium cell, an Azobacter cell, a Rhizobium cell, a Salmonella cell, an Alcaligenes cell, and a Eubacterium cell. In some embodiments, the cell is a producer cell or a recycler cell as defined and provided herein. In some embodiments, the cell is a Yarrowia lipolytica cell provided herein. In some embodiments, the cell is a cell obtained by the directed evolution method provided herein. In some embodiments, the cell is derived from a Yarrowia lipolytica H222 cell (GenBank accession number: GCA_900537225). By “derived from” it is meant that the cell is a modified version of the Yarrowia lipolytica H222 cell, comprising genetic modifications (such as, for example, single nucleotide polymorphism(s), gene deletion(s), indel(s), microdeletion(s), gene insertion(s), and the like) to the genome and / or comprising a vector, for example a vector as described herein. In some embodiments, the cell is RLA 3656 as provided herein. In some embodiments, the cell is RLA 3657 as provided herein. In some embodiments, the cell is RLA 1072 as provided herein. In some embodiments, the cell is RLA 3014 as provided herein and as deposited by Imperial College of Science, Technology, and Medicine, Exhibition Road, South Kensington, London, SW7 2AZ as NCIMB 44420 on 23 August 2024 at NCIMB Ltd. Wellheads Place, Dyce Aberdeen, AB21 7GB, Scotland as NCIMB 44420. In some embodiments, the cell is RLA 3657. Genotypes of Yarrowia lipolytica cells as described and provided herein are set out in Table 4. The invention also provides in one aspect a composition comprising a producer cell and a recycler cell, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first carbon source. In some embodiments: a) the producer cell is a producer cell as defined and provided herein; b) the recycler cell is a recycler cell as defined and provided herein, the Yarrowia lipolytica cell provided herein, or that has been obtained from the directed evolution method provided herein; c) the first nutrient source is a first nutrient source as defined herein; and / or d) the second nutrient source is a second nutrient source as defined herein. In one aspect, the invention provides a kit comprising: a) a producer cell as provided herein; b) a recycler cell provided herein; c) the Yarrowia lipolytica cell provided herein; d) a cell that has been obtained from the method provided herein; e) a first nutrient source is a first nutrient source as defined herein; f) a second nutrient source is a second nutrient source as defined herein; g) a culture medium as defined and provided herein; h) the culture medium provided herein; g) the nucleic acid provided herein; h) the vector provided herein; i) the cell provided herein; and / or j) the composition provided herein. In one aspect, the invention provides a kit comprising one or more components as described substantially herein. The invention is also illustrated by the following numbered paragraphs: 1. A method of producing a target product, comprising co-culturing a producer cell and a recycler cell in a culture media comprising a first nutrient source, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source. 2. The method of paragraph 1, wherein the second nutrient source is a by-product generated by the producer cell in the production of the target product. 3. The method of paragraph 1 or 2, wherein the second nutrient source is not metabolised by the producer cell, or wherein the first nutrient source is metabolised by the producer cell in preference to the second nutrient source. 4. The method of any one of paragraphs 1-3, wherein: a) the producer cell and the recycler cell are cultured together in a first vessel; or b) the producer cell and the recycler cell are not in direct contact, but the recycler cell is exposed to the nutrient source produced by the producer cell; optionally wherein: i) the producer cell is cultured in a first vessel and the recycler cell is cultured in a second vessel, arranged so that the recycler cell is exposed to at least a portion of the second nutrient source produced by the producer cell, optionally wherein culture media comprising the second nutrient source is perfused from the first vessel into the second vessel; or ii) the producer cell and the recycler cell are cultured in the same vessel comprising two compartments separated by a semi-permeable membrane, wherein the producer cell and the recycler cell are each in a separate compartment. 5. The method of any one of paragraphs 1-4, wherein: a) the producer cell and the recycler cell are added to the culture at the same time point; or b) the recycler cell is added to the culture after the producer cell; optionally wherein the recycler cell is added to the culture: i) at least 6 h after the producer cell, such as at least 12 h, at least 18 h, at least 24 h, at least 30 h, at least 36 h, at least 42 h, at least 48 h, at least 54 h, at least 60 h, at least 66 h, at least 72 h or later after the producer cell; ii) about 6 h after the producer cell, such as about 12 h, about 18 h, about 24 h, about 30 h, about 36 h, about 42 h, about 48 h, about 54 h, about 60 h, about 66 h, or about 72 h after the producer cell; and / or iii) 6 h after the producer cell, such as 12 h, 18 h, 24 h, 30 h, 36 h, 42 h, 48 h, 54 h, 60 h, 66 h, or 72 h after the producer cell. 6. The method of any one of paragraphs 1-5, wherein the producer cell and the recycler cell are co-cultured for: a) at least 48 h, at least 72 h, at least 96 h, at least 120 h, at least 144 h, at least 168 h, at least 192 h, at least 216 h, at least 240 h, or more h; b) about 48 h, about 72 h, about 96 h, about 120 h, about 144 h, about 168 h, about 192 h, about 216 h, or about 240 h; and / or c) 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h, or 240 h. 7. The method of any one of paragraphs 1-6, wherein the culture media is supplemented with exogenous second nutrient source; optionally wherein the exogenous second nutrient source is added to the culture media at the same time as the recycler cell. 8. The method of any one of paragraphs 1-7, wherein the first nutrient source is a first carbon source and / or the second nutrient source is a second carbon source, and the culture media further comprises a nitrogen source; optionally wherein the ratio of carbon to nitrogen in the culture media (C / N ratio) is: a) between 5 and 400, such as between 15 and 200, 35 and 100, or 60 and 80; b) at least 15, at least 35, at least 70, at least 100, at least 200, or at least 400, or more; c) about 15, about 35, about 70, about 100, about 200, or about 400; and / or d) 15, 35, 70, 100, 200, or 400. 9. The method of any one of paragraphs 1-8, wherein the first nutrient source is a first carbon source that is: a) a sugar; optionally wherein the sugar is selected from the group comprising or consisting of: glucose, xylose, sucrose, lactose, and arabinose; optionally wherein the first carbon source is glucose; b) a lipid, optionally wherein the lipid is canola oil; c) an organic acid; optionally wherein the organic acid is selected from the group comprising or consisting of: acetic acid, butyric acid, propionic acid, and lactic acid; d) an alcohol; optionally wherein the alcohol is selected from the group comprising or consisting of: glycerol, ethanol, and erythritol; or e) carbon dioxide. 10. The method of any one of claims 1-9, wherein the first nutrient source is a first carbon source that is not: a) carbon dioxide; b) carbon monoxide; c) CD2; d) acetate; e) ethanol; f) acetoin; and / or g) acetone. 11. The method of any one of paragraphs 1-10, wherein the culture media is selected from: a) YPD; b) YNB; or c) lignocellulosic hydrolysate; optionally wherein the lignocellulosic hydrolysate comprises glycose, citric acid, acetic acid, and xylose; optionally wherein the lignocellulosic hydrolysate further comprises furfural, hydroxymethylfurfural, benzoic acid, fructose, and / or arabinose. 12. The method of any one of paragraphs 1-11, wherein the culture media has a glucose concentration of: a) at least 10 g / L, at least 20 g / L, at least 30 g / L, at least 40 g / L, at least 50 g / L, at least 60 g / L, at least 70 g / L, at least 80 g / L, at least 90 g / L, at least 100 g / L, or more; b) about 10 g / L, about 20 g / L, about 30 g / L, about 40 g / L, about 50 g / L, about 60 g / L, about 70 g / L, about 80 g / L, about 90 g / L, or about 100 g / L; and / or c) 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, 80 g / L, 90 g / L, or 100 g / L. 13. The method of any one of paragraphs 1-12, wherein the second nutrient source is a second carbon source selected from the group comprising or consisting of: … and citric acid; optionally wherein the second carbon source is citric acid. 14. The method of any one of paragraphs 1-13, wherein the second nutrient source is a second carbon source that is not: a) carbon dioxide; b) carbon monoxide; c) CD2; d) acetate; e) ethanol; f) acetoin; and / or g) acetone. 15. The method of paragraph 1-14 wherein the producer cell and / or the recycler cell is a cell selected from: a eukaryotic cell and a prokaryotic cell; optionally wherein the producer cell and / or the recycler cell is a cell selected from the group comprising or consisting of: a yeast cell, a bacterial cell, an archaeal cell, an algal cell, a plant cell, a mammalian cell, a protist cell, and an amoeba cell. 16. The method of any one of paragraphs 1-15, wherein: a) the producer cell and / or the recycler cell is a fungal cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: a Yarrowia cell, a Saccharomyces cell, a Komagataella cell (a Pichia cell), a Schizosaccharomyces cell, an Ashbya cell, a Blastobotrys cell, a Cryptococcus cell, a Debaromyces cell, a Dekkera cell, a Hansuela cell, a Kluveromyces cell, a Lipomyces cell, a Rhodosporidium cell, a Rhodotorula cell, and a Candida cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia cell optionally selected from the group comprising or consisting of a Yarrowia bubula cell, a Yarrowia deformans cell, a Yarrowia lipolytica cell, a Yarrowia porcina cell, a Yarrowia yakushimensis cell, a Yarrowia parophonii cell, a Yarrowia galli cell, a Yarrowia oslonensis cell, a Yarrowia alimentaria cell, a Yarrowia hollandica cell, and a Yarrowia phangngaensis cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia lipolytica cell; and / or b) the producer cell and / or the recycler cell is a bacterial cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: an Escherichia cell, a Pseudomonas cell, a Vibrio cell, a Bacillus cell, a Clostridium cell, a Lactobacillus cell, a Komagataeibacter cell, a Gluconacetobacter cell, an Acetobacter cell, a Sarcina cell, an Agrobacterium cell, an Azobacter cell, a Rhizobium cell, a Salmonella cell, an Alcaligenes cell, and a Eubacterium cell. 17. The method of any one of paragraphs 1-16, wherein the producer cell and / or the recycler cell: a) is not a bacterial cell; b) is not a Clostridium cell; optionally is not a cell selected from the group comprising or consisting of: Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium tyrobutyricum, Clostridium pasteurianum, Clostridium butylicum, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium butyricum, Clostridium cellulovorans, Clostridium kluyveri, Clostridium carboxidivorans, Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium algidicarnis, Clostridium arbusti, Clostridium argentinense, Clostridium aurantibutylicum, Clostridium Clostridium neopropionicum, Clostridium ragsdalei, Clostridium saccharoacetobutylicum, Clostridium sporogenes, Clostridium tetanomorphum, Clostridium thermoaceticum, Clostridium thermocellum, Clostridium aurantibutyricum, Clostridium thermobutyricum, and solventogenic Clostridia from the NRRL, DSMZ, NCIMB, and JCM culture collections; c) is not an Acetobacterium cell; optionally is not an Acetobacterium woodii cell; d) is not a Moorella cell; optionally is not a Moorella thermoaceitica cell; e) is not a Eubacterium cell; optionally is not a Eubacterium limosum cell; f) is not a Bacillus cell; g) is not a Lactobacillus cell; h) is not a Lactococcus cell; i) is not an Escherichia cell; optionally is not an Escherichia coli cell; and / or j) is not a cell from a species or strain selected from the group comprising or consisting of: Acetitomaculum ruminis, Acetoanaerobium noterae, Acetoanaerobium romashkovii, Acetobacterium bakii, Acetobacterium carbinolicum, Acetobacterium dehalogenans, Acetobacterium fimetarium, Acetobacterium malicum, Acetobacterium paludosum, Acetobacterium psammolithicum, Acetobacterium tundra, Acetobacterium wieringae, Acetobacterium woodii, Acetobacterium sp. AmMan1, Acetobacterium sp. B10, Acetobacterium sp. HA1, Acetobacterium sp. HP4, Acetobacterium sp. KoB58, Acetobacterium sp. LuPhet1, Acetobacterium sp. LuTria3, Acetobacterium sp. MrTac1, Acetobacterium sp. OyTac1, Acetobacterium sp, RMMac1, Acetobacterium sp. 69, Acetohalobium arabaticum, Acetonema longum, Bryantella formatexigens, Butyribacterium methylotrophicum, Caloramator fervidus, Clostridium aceticum, Clostridium autoethanogenum, Clostridium carboxidivorans, Clostridium coccoides, Clostridium difficile AA1, Clostridium drakei, Clostridium formicaceticum, Clostridium glycolicum 22, Clostridium glycolicum RD-1, Clostridium ljungdahlii, Clostridium magnum, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium scatologenes, Clostridium ultunense, Clostridium sp. CV-AA1, Clostridium sp. M5a3, Clostridium sp. F5a15, Clostridium sp. Ag4f2, Clostridium sp. TLN2, Eubacterium aggregans, Eubacterium limosum, Holophaga foetida, Moorella glycerini, Moorella mulderi, Moorella thermoacetica, Moorella thermoautotrophica, Moorella sp. F21 , Moorella sp. HUC22-l, Natroniella acetigena, Natronincola histidinovorans, Oxobacter pfennigii, Ruminococcus hydrogenotrophicus, Ruminococcus productus, Ruminococcus productus, Ruminococcus schinkii, Ruminococcus sp. TLFl, Sporomusa acidovorans, Sporomusa aerivorans, Sporomusa malonica, Sporomusa ovate, Sporomusa paucivorans, Sporomusa silvacetica, Sporomusa sphaeroides, Sporomusa termitida, Sporomusa sp. DR6, Sporomusa sp. DRl / 8, Syntrophococcus sucromutans, Thermoacetogenium phaeum, Thermoanaerobacter kivui, Tindallia califomiensis, Treponema azotonutricium, and Treponema primitia. 18. The method of any one of paragraphs 1-17, wherein: a) the producer cell is not a Clostridium acetobutylicum cell and the recycler cell is not a Clostridium ljungdahlii cell; b) the producer cell is not a Clostridium ljungdahlii cell and the recycler cell is not a Clostridium acetobutylicum cell; and / or c) the producer cell is not a Clostridium acetobutylicum cell, the recycler cell is not a Clostridium ljungdahlii cell, and the second carbon source is not carbon dioxide. 19. The method of paragraph 1-18, wherein the producer cell and the recycler cell are the same species. 20. The method of paragraph 19, wherein the producer cell and the recycler cell are each a Yarrowia lipolytica cell. 21. The method of any one of paragraphs 1-20, wherein the recycler cell comprises a deletion of: a) a glucose metabolism gene, optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: i) has the sequence of SEQ ID NO: 4; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase. 22. The method of any one of paragraphs 1-21, wherein the recycler cell is an evolved recycler cell has been obtained by directed evolution from an ancestral recycler cell. 23. The method of paragraph 22, wherein the directed evolution comprises: a) culturing an ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutreint for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source, thereby identifying an evolved recycler cell. 24. The method of paragraph 23, wherein the method further comprises b) i) sub- culturing the sub-cultured plurality of recycler cells in a culture medium comprising the second nutrient source for a third period to obtain a sub-cultured plurality of recycler cells. 25. The method of paragraph 23 or 24, wherein c) identifying a recycler cell of the sub- cultured plurality that has an improved ability to metabolise the second nutrient source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second nutrient source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second nutrient source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second nutrient source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. 26. The method of any one of paragraphs 23-25, wherein the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell. 27. The method of any one of paragraphs 1-26, wherein the target product is selected from the group comprising or consisting of: a small molecule, a peptide, a polypeptide, a nucleic acid, and a lipid. 28. The method of any one of paragraphs 1-27, wherein the target product is a carotene, optionally wherein the target product is β-carotene. 29. The method of any one of paragraphs 1-28, wherein the target product is indigoidine. 30. The method of paragraph 28, wherein the producer cell and the recycler cell each comprise a nucleic acid required to produce the target, optionally comprising a β-carotene biosynthesis cassette; optionally wherein the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / or c) a CarPR gene. 31. The method of paragraph 30, wherein: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3. 32. The method of paragraph 30 or 31, wherein at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to an inducible promoter; optionally wherein the inducible promoter is a pTEF promoter. 33. The method of paragraph 30-32, wherein at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence; optionally wherein the terminator is a tLIP2 terminator. 34. The method of any one of paragraphs 30-33, wherein the nucleic acid comprising the β-carotene biosynthesis cassette is: a) integrated into the genome; b) comprised by a vector; optionally wherein the vector is a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome; optionally wherein the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; and chloramphenicol. 35. The method of any one of paragraphs 1-34 wherein the method provides a bioconversion yield of: a) at least 0.02 g of target product per g of first nutrient source (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; b) about 0.02 g of target product per g of first nutrient source (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; c) 0.02 g of target product per g of first nutrient source (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g. 36. The method of any one of paragraphs 28-35, wherein the first nutrient source is glucose, and the method: a) provides a bioconversion yield of: i) at least 0.02 g of β-carotene per g of glucose (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; ii) about 0.02 g of β-carotene per g of glucose (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; iii) 0.02 g of β-carotene per g of glucose (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g; optionally wherein the method provides a bioconversion yield of 0.11 g of β-carotene per g of glucose; and / or b) provides a β-carotene yield of: i) at least 100 mg / L, at least 200 mg / L, at least 300 mg / L, at least 400 mg / L, at least 500 mg / L, at least 600 mg / L, at least 700 mg / L, at least 800 mg / L at least 900 mg / L, at least 1000 mg / L, at least 1200 mg / L, at least 1400 mg / L, at least 1600 mg / L, at least 1800 mg / L, at least 2000 mg / L, at least 2500 mg / L, at least 3000 mg / L, at least 3500 mg / L, at least 4000 mg / L, or more; ii) about 100 mg / L, about 200 mg / L, about 300 mg / L, about 400 mg / L, about 500 mg / L, about 600 mg / L, about 700 mg / L, about 800 mg / L about 900 mg / L, about 1000 mg / L, about 1200 mg / L, about 1400 mg / L, about 1600 mg / L, about 1800 mg / L, about 2000 mg / L, about 2500 mg / L, about 3000 mg / L, about 3500 mg / L, about 4000 mg / L, or about 4100 mg / L; iii) 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L 900 mg / L, 1000 mg / L, 1200 mg / L, 1400 mg / L, 1600 mg / L, 1800 mg / L, 2000 mg / L, 2500 mg / L, 3000 mg / L, 3500 mg / L, 4000 mg / L, 4100 mg / L, or 4101 mg / L. 37. The method of any one of paragraphs 1-36, wherein: a) i) the first nutrient source is a first carbon source; and / or ii) the second nutrient source is a second carbon source; and / or b) i) the first nutrient source is a first nitrogen source; and / or ii) the second nutrient source is a second nitrogen source. 38. The method of any one of paragraphs 1-37, wherein the first nutrient source is a first carbon source and the second nutrient source is a second carbon source. 39. A method of producing a target product, comprising co-culturing a producer cell and a first plurality of recycler cells in a culture media comprising a first nutrient source, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the cells of the first plurality of recycler cells is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source. 40. The method of paragraph 39, wherein the method is the method according to any one of paragraphs 1-38. 41. The method of paragraph 39 or 40, wherein the producer cell is a producer cell according to any one of paragraphs 1-38. 42. The method of any one of paragraphs 39-41, wherein the method further comprises co-culturing the producer cell and first plurality of recycler cells with a second, a third, a fourth, a fifth, a sixth, a seventh, an eighth, a ninth, and / or a tenth plurality of recycler cells. 43. The method of any one of paragraphs 39-41, wherein the producer cell is capable of producing a third, a fourth, a fifth, a sixth, a seventh, an eight, a ninth, or a tenth nutrient source. 44. The method of paragraph 42 or 43, wherein: a) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of producing the target product; b) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is: i) capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; and / or ii) not capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; c) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source; and / or d) at least one of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source to at least one other of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells. 45. The method of any one of paragraphs 39-44, wherein each cell of each plurality of recycler cells is a recycler cell as defined in any one of paragraphs 1-38. 46. A method of improving the improve the ability of an ancestral recycler cell to metabolise a second nutrient source, the method comprising: a) culturing the ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutrient for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying an evolved recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source; optionally wherein: the second carbon source is a second nutrient source as defined in any one of paragraphs 1-38; and / or the recycler cell is a recycler cell as defined in any one of paragraphs 1-38. 47. The method of paragraph 46, wherein the method further comprises b) i) sub- culturing the sub-cultured plurality of recycler cells in a culture medium comprising the second nutrient for a third period to obtain a sub-cultured plurality of recycler cells. 48. The method of paragraph 46 or 47, wherein c) identifying an evolved recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second nutrient source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second nutrient source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second nutrient source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. 49. A producer cell, wherein the producer cell is as defined in any one of paragraphs 1- 38. 50. A recycler cell, wherein the recycler cell is as defined in any one of paragraphs 1- 38. 51. A Yarrowia lipolytica cell that is capable of utilising citric acid as a sole carbon source. 52. The Yarrowia lipolytica cell of paragraph 51, wherein the Yarrowia lipolytica cell comprises a deletion of: a) a glucose metabolism gene; optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: a) has the sequence of SEQ ID NO: 4; b) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or c) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase. 53. The Yarrowia lipolytica cell of paragraph 51 or 52, wherein the Yarrowia lipolytica cell is an evolved Yarrowia lipolytica cell has been obtained by directed evolution from an ancestral Yarrowia lipolytica cell. 54. The Yarrowia lipolytica cell of paragraph 53, wherein the directed evolution comprises: a) culturing an ancestral Yarrowia lipolytica cell in a culture medium comprising the second carbon source for a first period to obtain a plurality of Yarrowia lipolytica cells; b) sub-culturing the plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a second period to obtain a sub-cultured plurality of Yarrowia lipolytica cells; and c) identifying a Yarrowia lipolytica cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source, thereby identifying an evolved Yarrowia lipolytica cell. 55. The Yarrowia lipolytica cell of paragraph 54, wherein the directed evolution further comprises b) i) sub-culturing the sub-cultured plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a third period to obtain a sub-cultured plurality of Yarrowia lipolytica cells. 56. The Yarrowia lipolytica cell of paragraph 54 or 55, wherein c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second carbon source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second carbon source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second carbon source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell. 57. The Yarrowia lipolytica cell of any one of paragraphs 51-56, wherein the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell. 58. A culture medium comprising lignocellulosic hydrolysate, wherein the medium comprises glycose, citric acid, acetic acid, and xylose; optionally wherein the lignocellulosic hydrolysate further comprises furfural, hydroxymethylfurfural, benzoic acid, fructose, and / or arabinose. 59. The culture medium of paragraph 58, wherein the medium comprises: a) i) about 90 g / L glucose, about 11.6 g / L citric acid, about 0.19 g / L acetic acid, about 1.2 g / L xylose, about 0.085 g / L furfural, about 0.12 g / L hyroxymethyl furfural, and / or about 0.05 g / L benzoic acid; or ii) 89.79 g / L glucose, 11.64 g / L citric acid, 0.19 g / L acetic acid, 1.2 g / L xylose, 0.085 g / L furfural, 0.116 g / L hydroxymethyl furfural, and / or 0.052 g / L benzoic acid; or b) i) about 16 g / L glucose, about 1.6 g / L citric acid, about 0.6 g / L acetic acid, about 0.1 g / L xylose, about 14.2 g / L fructose, and / or about 1.4 g / L arabinose; or ii) 15.99 g / L glucose, 1.58 g / L citric acid, 0.66 g / L acetic acid, 0.11 g / L xylose, 14.15 g / L fructose, and / or 1.44 g / L arabinose. 60. A nucleic acid comprising a β-carotene biosynthesis cassette; optionally wherein the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / or c) a CarPR gene. 61. The nucleic acid of paragraph 60, wherein: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3. 62. The nucleic acid of paragraph 60 or 61, wherein at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to an inducible promoter; optionally wherein the inducible promoter is a pTEF promoter. 63. The nucleic acid of any one of paragraphs 60-62, wherein at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence; optionally wherein the terminator is a tLIP2 terminator. 64. A vector comprising the nucleic acid of any one of paragraphs 60-63, wherein the vector is a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome; optionally wherein the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; chloramphenicol. 65. A cell comprising the nucleic acid of any one of paragraphs 60-63 or the vector of paragraph 64. 66. The cell of paragraph 65, wherein the cell is a cell selected from: a eukaryotic cell and a prokaryotic cell; optionally wherein the cell is a cell selected from the group comprising or consisting of: a yeast cell, a bacterial cell, an archaeal cell, an algal cell, a plant cell, a mammalian cell, a protist cell, and an amoeba cell. 67. The cell of paragraph 65 or 66, wherein: a) the cell is a fungal cell; optionally wherein the fungal cell is selected from the group comprising or consisting of: a Yarrowia cell, a Saccharomyces cell, a Komagataella cell (a Pichia cell), a Schizosaccharomyces cell, an Ashbya cell, a Blastobotrys cell, a Cryptococcus cell, a Debaromyces cell, a Dekkera cell, a Hansuela cell, a Kluveromyces cell, a Lipomyces cell, a Rhodosporidium cell, a Rhodotorula cell, and a Candida cell; optionally wherein the cell is a Yarrowia cell optionally selected from the group comprising or consisting of: Yarrowia bubula cell, a Yarrowia deformans cell, a Yarrowia lipolytica cell, a Yarrowia porcina cell, a Yarrowia yakushimensis cell, a Yarrowia parophonii cell, a Yarrowia galli cell, a Yarrowia oslonensis cell, a Yarrowia alimentaria cell, a Yarrowia hollandica cell, and a Yarrowia phangngaensis cell; optionally optionally wherein the cell is a Yarrowia lipolytica cell; and / or b) the cell is a bacterial cell; optionally wherein the bacterial cell is selected from the group comprising or consisting of: an Escherichia cell, a Pseudomonas cell, a Vibrio cell, a Bacillus cell, a Clostridium cell, a Lactobacillus cell, a Komagataeibacter cell, a Gluconacetobacter cell, an Acetobacter cell, a Sarcina cell, an Agrobacterium cell, an Azobacter cell, a Rhizobium cell, a Salmonella cell, an Alcaligenes cell, and a Eubacterium cell. 68. The cell of any one of paragraphs 65-67, wherein the producer cell and / or the recycler cell: a) is not a bacterial cell; b) is not a Clostridium cell; optionally is not a cell selected from the group comprising or consisting of: Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium tyrobutyricum, Clostridium pasteurianum, Clostridium butylicum, Clostridium saccharobutylicum, Clostridium saccharoperbutylacetonicum, Clostridium butyricum, Clostridium cellulovorans, Clostridium kluyveri, Clostridium carboxidivorans, Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium algidicarnis, Clostridium arbusti, Clostridium argentinense, Clostridium aurantibutylicum, Clostridium Clostridium neopropionicum, Clostridium ragsdalei, Clostridium saccharoacetobutylicum, Clostridium sporogenes, Clostridium tetanomorphum, Clostridium thermoaceticum, Clostridium thermocellum, Clostridium aurantibutyricum, Clostridium thermobutyricum, and solventogenic Clostridia from the NRRL, DSMZ, NCIMB, and JCM culture collections; c) is not an Acetobacterium cell; optionally is not an Acetobacterium woodii cell; d) is not a Moorella cell; optionally is not a Moorella thermoaceitica cell; e) is not a Eubacterium cell; optionally is not a Eubacterium limosum cell; f) is not a Bacillus cell; g) is not a Lactobacillus cell; h) is not a Lactococcus cell; i) is not an Escherichia cell; optionally is not an Escherichia coli cell; and / or j) is not a cell from a species or strain selected from the group comprising or consisting of: Acetitomaculum ruminis, Acetoanaerobium noterae, Acetoanaerobium romashkovii, Acetobacterium bakii, Acetobacterium carbinolicum, Acetobacterium dehalogenans, Acetobacterium fimetarium, Acetobacterium malicum, Acetobacterium paludosum, Acetobacterium psammolithicum, Acetobacterium tundra, Acetobacterium wieringae, Acetobacterium woodii, Acetobacterium sp. AmMan1, Acetobacterium sp. B10, Acetobacterium sp. HA1, Acetobacterium sp. HP4, Acetobacterium sp. KoB58, Acetobacterium sp. LuPhet1, Acetobacterium sp. LuTria3, Acetobacterium sp. MrTac1, Acetobacterium sp. OyTac1, Acetobacterium sp, RMMac1, Acetobacterium sp. 69, Acetohalobium arabaticum, Acetonema longum, Bryantella formatexigens, Butyribacterium methylotrophicum, Caloramator fervidus, Clostridium aceticum, Clostridium autoethanogenum, Clostridium carboxidivorans, Clostridium coccoides, Clostridium difficile AA1, Clostridium drakei, Clostridium formicaceticum, Clostridium glycolicum 22, Clostridium glycolicum RD-1, Clostridium ljungdahlii, Clostridium magnum, Clostridium mayombei, Clostridium methoxybenzovorans, Clostridium scatologenes, Clostridium ultunense, Clostridium sp. CV-AA1, Clostridium sp. M5a3, Clostridium sp. F5a15, Clostridium sp. Ag4f2, Clostridium sp. TLN2, Eubacterium aggregans, Eubacterium limosum, Holophaga foetida, Moorella glycerini, Moorella mulderi, Moorella thermoacetica, Moorella thermoautotrophica, Moorella sp. F21 , Moorella sp. HUC22-l, Natroniella acetigena, Natronincola histidinovorans, Oxobacter pfennigii, Ruminococcus hydrogenotrophicus, Ruminococcus productus, Ruminococcus productus, Ruminococcus schinkii, Ruminococcus sp. TLFl, Sporomusa acidovorans, Sporomusa aerivorans, Sporomusa malonica, Sporomusa ovate, Sporomusa paucivorans, Sporomusa silvacetica, Sporomusa sphaeroides, Sporomusa termitida, Sporomusa sp. DR6, Sporomusa sp. DRl / 8, Syntrophococcus sucromutans, Thermoacetogenium phaeum, Thermoanaerobacter kivui, Tindallia califomiensis, Treponema azotonutricium, and Treponema primitia. 69. The cell of any one of paragraphs 65-68 wherein the cell is a producer cell or a recycler cell as defined in any one of paragraphs 1-38; 49, or 50; a Yarrowia lipolytica cell according to any one of paragraphs 51-57; or a cell obtained by the method of any one of paragraphs 45-48. 70. A composition comprising a producer cell and a recycler cell, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first carbon source. 71. The composition of paragraph 70, wherein: a) the producer cell is a producer cell as defined in any one of paragraphs 1-38 and 49; b) the recycler cell is a recycler cell as defined in any one of paragraphs 1-38 and 41, the Yarrowia lipolytica cell of any one of paragraphs 51-57, or that has been obtained from the method of paragraphs 45-48; c) the first nutrient source is a first nutrient source as defined in any one of paragraphs 1-38; and / or d) the second nutrient source is a second nutrient source as defined in any one of paragraphs 1-38. 72. A kit comprising: a) a producer cell as defined in any one of paragraphs 1-38 and 49; b) a recycler cell as defined in any one of paragraphs 1-38 and 50; c) the Yarrowia lipolytica cell according to any one of paragraphs 51-57; d) a cell that has been obtained from the method of paragraphs 45-48; e) a first nutrient source is a first nutrient source as defined in any one of paragraphs 1-38; f) a second nutrient source is a second nutrient source as defined in any one of paragraphs 1-38; g) a culture medium as defined in any one of paragraphs 1-38; h) the culture medium of any one of paragraphs 58-59; g) the nucleic acid of any one of paragraphs 60-63; h) the vector of paragraph 64; i) the cell of any one of paragraphs 65-69; and / or j) the composition of paragraph 70 or 71. 67. A kit comprising one or more components as described substantially herein. Figure legends Figure 1 A) Scheme of a typical bioproduction process, where a yeast strain consumes a substrate S to produce the desired product P and the byproduct B; B) The methodology applied in the present study, combining metabolic engineering, adaptive laboratory evolution, and synthetic co-cultures; and C) the proposed co-culture system developed in this work for the upcycling of the byproduct B and produce more of the desired product P. Figure 2 – a) Schematic of the adaptive laboratory evolution approach, b) growth of the evolved and non-evolved glucose-non-consuming strain (Y.lipolytica ΔHXT) on YNBcit (1%), and c) OD600, glucose, and CA concentrations in WT monoculture (H222) and co- cultures comprised WT(H222) and evolved ΔHXT strains grown on YNB glc (2%). The error bars presented in the figures correspond to the standard deviation around the mean of n = 3 independent biological replicates. Figure – a) Growth of glucose-non-consuming strains on YNB minimal medium supplemented with 10 g / l CA, b) plates of evolved and non-evolved ΔHXT strain on YP citrate (1%) after 72 h. OD600 of ΔHXT during 15 passages of adaptive evolution on YNB minimal medium supplemented with 10 g / l CA in deep-well plates. OD600 were measured at the end of each passage (72 h). 4 – a) Growth of individual strains co-cultivated on YNBglc (2%) using Cerillo duet co-culture system. H222-H222 refers to the condition that both wells were inoculated with WT (H222), ΔHXT- ΔHXT refers to the condition that both wells were inoculated with citrate-consuming strain (ΔHXT), and H222- ΔHXT refers to the condition that one well is inoculated with the WT (H222) and the other one with the citrate consuming strain (ΔHXT). b) Citric acid concentrations at the end point in coculture and controls, and c) photo of the Cerillo duet co-culture system, showing two experiments, each with two wells connected by a permeable membrane. – Final OD600 values of Y.lipolytica WT and co-cultures (WT+ ΔHXT (evl)) using YNBglc(10%) under different C / N ratios. Culture A: shake flasks were initially inoculated with WT and ΔHXT (evl) strain was added after 48 h , Culture B: shake flasks were initially inoculated with WT and ΔHXT (evl) strain was added after 72 h, Culture C: monoculture of WT used as control. The error bars presented in the figures correspond to the standard deviation around the mean of n = 3 independent biological replicates. The OD600 values for co-culture A and B were significantly different with monocultures. Statistically significant differences between co-cultures containing WT and byproduct upcycler strain (ΔHXT) and WT monoculture as control were tested by two-tailed Student's t-test, and significance levels are shown as p < 0.05 (*) and p < 0.01 (**). Figure 6 – a) Growth of the evolved and non-evolved glucose-non-consuming strain (Y.lipolytica ΔHXT) on lignocellulosic hydrolysate (UP), b) OD600 values in WT monoculture (H222) and co-cultures comprised WT(H222) and non-evolved ΔHXT strains grown in UP, c) OD600 values in WT monoculture (H222) and co-cultures comprised WT(H222) and evolved ΔHXT strains grown in UP. Figure 7 – a) OD600 values, b) glucose consumption, and c) citric acid concentrations for monocultures and co-culture grown in YNB minimal medium supplemented with 100 g / l glucose and 5 g / L CA, d) OD600 values, e) glucose consumption, and f) citric acid concentrations for monocultures and co-culture grown in UP hydrolysate. The error bars presented in the figures correspond to the standard deviation around the mean of n = 3 independent biological replicates. Statistically significant differences between co-cultures containing WT and byproduct upcycler strain (ΔHXT) and WT monoculture as control were tested by two-tailed Student's t-test, and significance levels are shown as p < 0.05 (*) and p < 0.01 (**). Figure 8 – Schematic illustration of the steps outlining an exemplary method as provided herein. Figure 9 – a) WT and ΔHXT (evl) with expression of β-carotene cassette; Growth and metabolic profiles of monocultures and co-cultures of H222 and ΔHXT (evl) expressing the β-carotene cassette: WT-cart growing in b) YNB glc(10%)+cit (0.5%) and c) UP; ΔHXT (evl)-cart monoculture growing in d) YNB glc(10%)+cit (0.5%) and e) UP, WT-cart+ ΔHXT (evl)-cart growing in f) YNB glc(10%)+cit (0.5%) and g) waste hydrolysate (UP). The error bars presented in the figures correspond to the standard deviation around the mean of n = 3 independent biological replicates. Figure 10 – a) Microscopic images showing β-carotene autofluorescence in WT monoculture and co-culture, b) heterogeneity in WT monoculture and coculture, and c) percentages of budding and filamentous cells in coculture and WT monoculture. Figure 11 - β-carotene production by WT monoculture (left) and after co-cultivation of WT with the byproduct recycler strain (right) Figure 12 – a) β-carotene, glucose, and citric acid concentration after 120 h in WT- cart+ΔHXT (evl)-cart co-cultures under different C / N ratios, and b) β-carotene yields using YNBglc (2%). The error bars presented in the figures correspond to the standard deviation around the mean of n = 3 independent biological replicates. Figure 13 – OD600values after 120 h for WT-cart+ΔHXT (evl)-cart co-cultures grown in YNBglc (2%) under different C / N ratios. Figure 14 – Theoretical β-carotene yield from glucose by WT strain obtained using iYli21 model after addition of the β-carotene pathway. Figure 15 – Deposit receipt for Yarrowia lipolytica RLA 3014 deposited by Imperial College of Science, Technology, and Medicine, Exhibition Road, South Kensington, London, SW7 2AZ at NCIMB Ltd. Wellheads Place, Dyce Aberdeen, AB217GB, Scotland as NCIMB 44420 on 23 August 2024. Figure 16 – Viability statement for Yarrowia lipolytica RLA 3014 deposited by Imperial College of Science, Technology, and Medicine, Exhibition Road, South Kensington, London, SW7 2AZ at NCIMB Ltd. Wellheads Place, Dyce Aberdeen, AB21 7GB, Scotland as NCIMB 44420 on 23 August 2024. Examples Example 1 – Introduction The present invention addresses the need to develop improved bioprocesses with decreased metabolic byproducts and improved main product yields. The inventors have surprisingly found that by deleting a gene responsible for the metabolism of a first nutrient source in yeast, it is possible to create a yeast strain (known as the “recycler cell”, “upcycler cell”, or “upcycler strain”) that is incapable of metabolising the first nutrient source, but which is capable of growing exclusively on the metabolic by- product (or “second nutrient source”) produced by a first strain (known as the “producer cell” or “producer strain”) utilising the first nutrient source in co-culture. The recycler cell is also capable of growing exclusively on the second nutrient source in the absence of the producer cell, when the culture media is supplemented with the second media source. The inventors have further surprisingly found that co-culture of a “recycler cell” and a “producer cell” that have both been genetically engineered to produce a main product (or “target” product) on a first nutrient source, produces a significantly improved yield and significantly improved bioconversion yield of the target product compared to culture of the “producer cell” alone. In this work, the inventors designed a strategy based on synthetic communities to address the challenge of byproduct (B) accumulation during microbial synthesis of products of interest (P) from a given substrate (S) (Figure 1). The strategy starts with the creation of the “upcycler strain” (also known herein as a “recycler cell”), a strain unable to utilise S and therefore compete with the producer strain for the substrate (typically achieved by knock outs in transporters or consumption pathways of S) but which can consume B as efficiently as possible (typically achieved by overexpressing transporters or consumption pathways of B and / or adaptive laboratory evolution) upcycling it into further P. When both strains are co-cultured together, the upcycler strain will only grow when B accumulates and to a level proportional to the concentrations of B. Both strains will make P, increasing the conversion yields of S into P as B is converted into additional P. While this strategy ideally requires our capacity to remove S consumption and allow the utilisation of B as the sole carbon source, strategies only showing some of the described features can still be advantageous. Such a strategy would, therefore, improve feedstock utilization, reduce downstream process costs, and improve product yields. Additionally, in cases where the byproduct molecule is also present in complex feedstocks, the co-culture system could combine substrate co-utilisation with byproduct upcycling, resulting in dual benefits. Yarrowia lipolytica is an industrial yeast amenable to metabolic engineering and which has been modified to produce a variety of products from a wide range of feedstocks (Park & Ledesma-Amaro, Trends Biotechnol 41:242–254 (2023)). Citric acid (CA) is synthesized as a byproduct by Y. lipolytica, as well as many other microorganisms, diverting carbon flux away from the main product synthesis. CA is extensively used for the hydrolysis of lignocellulosic feedstocks and remains a component in hydrolysates. Therefore, the inventors selected Y. lipolytica as a proof of concept for developing a co-culture that can utilise both glucose and CA and has the potential to enhance bioprocess efficiency, ultimately leading to a significant increase in the production of desired products. Considering these points, the inventors first designed a Y. lipolytica co-culture by combining adaptive evolution and metabolic engineering. The inventors then tested the co- culture for byproduct (CA) upcycling and glucose / CA co-utilisation using both minimal medium and lignocellulosic hydrolysates. Finally, the inventors selected the orange pigment and antioxidant β-carotene as the product of interest since it is industrially relevant, easy to detect and has already been produced at significant amounts in this host (Ma, et al. Nat Commun 13:572 (2022), Larroude, et al., Biotechnol Bioeng 115:464–472 (2018)), and tested the performance of the co-culture and the monoculture on β-carotene production. Example 2 – Construction of a Y. lipolytica strain to utilise CA as a preferred carbon source To construct an “upcycler” Y. lipolytica strain capable of utilising the main Yarrowia byproduct, citric acid (CA), as its preferred carbon source, the inventors decided to generate a strain that grows in CA but not in the most widely used carbon source, glucose (Figure 2a). To achieve this goal, the inventors decided to test the ability of glucose-non- consuming strains to utilise CA as a sole carbon source and further improve the best- performing strain through adaptive laboratory evolution (ALE). First, the inventors evaluated the growth capabilities on CA of two different glucose-non-consuming strains, RLA 1072, with knocked-out hexokinase (ΔHXT), and RLA 1717 with knocked-out hexose transporters (Δyht1-4; Lazar et al., Metab Eng 26:89–99 (2014)). The strains were cultivated in YNB minimal medium without glucose, supplemented with 1% CA (YNBcit) as the sole carbon source (Table 2). Growth assays revealed that RLA 1717 Δyht1-4 was unable to grow on CA. Although RLA 1072 ΔHXT could grow on CA, the lag phase exceeded 40 hours (Figure 2b and Figure 3a and b). Consequently, the inventors decided to perform ALE to improve its growth (Figure 3c). After 15 passages, the evolved strain, compared to the non-evolved strain, showed a significantly shorter lag phase (10h vs 40h), along with a higher maximum OD600 (0.28 vs 0.18). Example 3 – Cocultures with a byproduct upcycler strain enable higher cell densities The above results showing enhanced CA utilisation by the evolved ΔHXT strain led us to investigate the effect of its co-cultivation with the WT strain in glucose-based YNB minimal medium. As shown in Figure 2c, glucose is similarly consumed in both the monoculture and co-culture. In the monoculture, growth is highly reduced after 120 h, coinciding with a stop in the production of citric acid, which remains constant until the end of the culture. However, in the coculture, OD600 values keep increasing after 120 h, showing higher final values than the monoculture. This further biomass increase correlates with the complete consumption of the accumulated citric acid, which takes place between 120 and 196 h. These results suggest that the increase in the overall growth of the coculture could come from the growth of the upcycler strain, ΔHXT (evl), which uses the CA present in the hydrolysates. The next experiments were designed to validate this hypothesis. Example 4 – The byproduct upcycler strain can grow on the byproduct as a sole carbon source Using the Cerillo co-culture duet system, which uses a semi-permeable membrane that can separate both strains while allowing media exchange, permitted us to monitor the growth of individual strains, the WT and the upcycler strain ΔHXT (evl), during co- cultivation on YNBglc (2%) and when grown separately (controls) (Figure 4). Due to the inability of ΔHXT (evl) to utilise the only available carbon source in the medium (glucose), its growth would require the uptake of a byproduct produced by the WT. This was confirmed by observing no growth in the ΔHXT (evl) control. Co-cultivation of WT and the upcycler strain ΔHXT (evl) resulted in the growth of both strains, with the upcycler strain exhibiting a prolonged lag phase (approximately 30 h). To confirm that the growth of the upcycler strain was due to the consumption of CA, the inventors measured the CA concentration at the end of the experiment (48h). CA concentration in the co-culture was significantly lower (68 mg / l) compared to WT monoculture (570 mg / l). These results suggest that the upcycler strain can utilise the byproduct CA produced by the WT as a carbon source. Example 5 - Cell densities in co-cultures are affected by carbon-to-nitrogen ratios Encouraged by the co-cultivation results between the WT and the upcycler strain in microplate, the inventors decided to test the co-culture in shake flasks, which provide better aeration, an important factor for this obligate aerobic yeast (Mirończuk, et al., Microb Cell Fact, 18:176 (2019). CA production by Y. lipolytica was observed as being low in the first 48 hours of the culture (Figure 2c). Therefore, the shake flasks were initially inoculated with WT, followed by the addition of the upcycler strain, either after 48 hours or 72 h (Figure 5). This was done to ensure the sufficient production of CA for the growth of glucose-non-consuming strain and to maintain optimal inoculation ratios. Since nitrogen limitation triggers CA production, the effect of different carbon-to-nitrogen (C / N) ratios on the final OD600 was studied and compared with the WT monoculture. Interestingly, the highest OD600 values were obtained in culture A (initial inoculation with WT and addition of the upcycler strain after 48 h) and culture B (initial inoculation with WT and addition of the upcycler strain after 72 h) when the C / N ratio was set at 70. In contrast, culture C (WT monoculture) achieved its highest OD600 at a C / N ratio of 100. Notably, the final OD600 values for the co-cultures (80.03 for culture A and 76.4 for culture B) with a C / N ratio of 70 were significantly greater than that of the WT monoculture (38.36). These results demonstrate the growth advantages of co-cultures over the monoculture. It also suggests that the proposed strategy of using a co-culture to upcycle bioprocess by-products could be used for the enhanced production of high-value metabolites. Example 6 - Co-cultivation with the byproduct upcycler strain enhances growth and substrate utilisation in lignocellulosic hydrolysates Lignocellulosic hydrolysates are preferred substrates for biotechnology because they are abundant, inexpensive, and renewable, which are all crucial factors for the development of sustainable bioprocesses (de Medeiros et al., Food Chem X 13:100223 (2022)). However, they are often difficult to utilise for microbes due to their complex composition and the presence of inhibitory compounds (Usmani et al., Renewable and Sustainable Energy Reviews 148:111258 (2021)). In addition, it has been reported that single-strain cultures exhibit limited capabilities in mixed-substrate fermentation compared to microbial communities due to the inherent inability of individual strains to simultaneously consume multiple substrates (Lindemann, Curr Opin Chem Eng 30:96–102 (2020); Wang et al., Bioresour Technol 273:269–276 (2019)). In contrast, the consumption of one carbon source by each strain in a microbial community, driven by division of labor (DOL), can allow for more efficient substrate utilisation (Verhoeven et al., FEMS Yeast Res 18, 75 (2018); Rafieenia, et al., Curr Opin Biotechnol 75:102706 (2022)). In this work, the inventors obtained lignocellulosic hydrolysates from urban pruning (UP), which contain mostly glucose (89.79 g / L) and CA (11.74 g / L), the latter coming from the pre-treatment process (Table 3). First, the inventors tested the growth of the evolved upcycler strain alone in UP hydrolysate and found that it reached a higher maximum OD600 (0.5) compared to the non-evolved strain (0.26) (Figure 6a). The inventors then tested that the coculture was also able to perform better than the monoculture in this feedstock, which was only the case when the evolved upcycler strain was used but not when the non- evolved strain was tested as a control (Figure 6c). Next, the inventors decided to study the co-culture using a synthetic minimal medium mimicking the UP hydrolysate. Therefore, the inventors created YNB with high glucose content (100 g / L) and added CA (5g / L). Both strains were co-inoculated on day 0 and the tests were performed for 10 days. As depicted in Figure 7a, there was no significant difference in the OD600 values between the co-culture and monocultures at day 4. However, by day 6, the OD600 values for the co-culture reached 55.1, surpassing those of the single-strain cultures (30.4 and 22.9 for WT and ΔHXT (evl), respectively). By day 10, the OD600 in the co-culture had nearly doubled that of the WT monoculture. Notably, the OD600 values for both the WT monoculture and co-culture continued to increase until day 10, while the ΔHXT (evl) monoculture exhibited a declining trend in OD600. This was expected due to CA depletion and the inability of ΔHXT (evl) to consume glucose. In the co-culture, CA concentration was 18.1 g / L at day 10, whereas the WT monoculture accumulated 33.6 g / L (Figure 7c). The higher OD600 values in the co-culture, coupled with lower CA levels, likely result from the utilization of CA by the upcycler strain. To further study the growth and utilisation of complex substrates by the co-culture, the inventors conducted shake flask experiments using UP hydrolysate as the substrate. The OD600 values in the co-culture were 12.9 and 42.9% higher than WT monoculture at day 4 and day 6, respectively (Figure 7d). On day 10, a significant increase in the OD600 values was observed in the co-culture, reaching 112.6, which exceeded the OD600 values of the WT monocultures (67.37). CA accumulation in the co-culture was considerably lower than in monocultures throughout the experiment. At the end of the experiment, CA concentrations were 31.1 and 12.2 g / L in WT monoculture and co-culture, respectively, once again suggesting an efficient CA utilisation by the upcycler strain (Figure 7f). Similar to the YNB medium, co-cultivation resulted in a significant enhancement in glucose utilisation, with the increase being even higher. After 10 days, the WT monoculture had only consumed 23.2 g / L of the initial glucose, whereas the glucose utilisation by the co- culture reached 45.62 g / L (Figure 7e). This could be explained by the multiple benefits of DOL, which are amplified using complex substrates. These include reduced sensitivity towards the inhibitors present in lignocellulosic substrates (Perez et al., Pathog Dis 70:280–288 (2014)), reduced resource competition (Verhoeven et al., FEMS Yeast Res 18:75 (2018)) and improved utilisation of complex substrates Deng & Wang, Journal of Microbiology 54:23–30 (2016)). Example 7 - The co-culture strategy with a upcycler strain enhanced β-carotene production Given the enhanced substrate utilisation and increased biomass achieved by the co-culture, the inventors decided to investigate whether this strategy can be used to enhance bioproduction, using β-carotene as a proof of concept (Figure 8). To achieve this, a carotenoid expression cassette (Larroude et al., Biotechnol Bioeng 115:464–472 (2018)) was expressed in both WT and the upcycler strain (ΔHXT (evl)) strains to make the strains WT-cart and ΔHXT (evl)-cart (Figure 9). The production of β-carotene was initially evaluated using synthetic media mimicking the hydrolysate as described above (YNB with 100 g / L of glucose and 5 g / l of CA) and, subsequently, lignocellulosic hydrolysate (UP). Similar to our previous results, the co-cultivation on synthetic media significantly influenced total growth and maximum OD600 values. By day 3, the OD600 values were nearly identical in the co-culture and WT-cart monoculture (10.2 and 9.3, respectively). However, an increase in OD600values occurred in the co-culture, reaching 63.1 by day 10, whereas the OD600 value in the WT-cart monoculture was only 23.4 (Figure 9). The increased cell densities observed in the co-culture were also correlated with an enhanced production of β-carotene. β-carotene production by the co-culture (998 mg / L), was significantly higher than the monocultures (427 and 198 mg / L for WT-cart and ΔHXT (evl), respectively). The inventors also looked at the cells under the fluorescent microscope and found that 1) the co-culture was significantly less heterogeneous than the WT monoculture, judged by the intensity of β-carotene autofluorescence, and 2) the proportion of filamentous to budding cells was significantly reduced after co-cultivation (Figure 10). As both production heterogeneity and filamentation are associated with nutrient limitation, these differences suggest a lower stress response in co-cultures versus monocultures, highlighting the benefits of using synthetic cocultures Ruiz-Herrera & Sentandreu, Arch Microbiol 178, 477–483 (2002).; Takhaveev & Heinemann, Curr Opin Microbiol 45, 30–38 (2018)). In the ΔHXT (evl)-cart monoculture, complete utilisation of the initial CA (5 g / L) was observed within 5 days of incubation. This coincided with a decrease in OD600 values, which was attributed to the strain's inability to consume glucose, the only available carbon source. In addition, lower CA was accumulated by the co-culture (12.9 g / L) compared to the WT-cart monoculture (24.8 g / L). Further investigation into β-carotene production was conducted using UP as an example of low-cost, complex substrates (Figure 11). While the hydrolysate mainly consisted of glucose and CA, the presence of other compounds, including potentially toxic ones (furfural, Hydroxymethyl furfural, and benzoin acid) (Table 3), could impact growth and bioproduction. As depicted in Figure 9c, CA accumulation in the WT-cart monoculture exhibited a steady increase from 11.6 g / L (day 0) to 35.3 g / L (day 10), whereas its concentration in the co-culture was notably lower at 16.9 g / L by day 10 (Figure 9g). Co- cultivation also resulted in improved glucose utilisation. By day 10, the glucose consumption by the co-culture reached 51.5 g / L, outperforming the glucose consumption of the WT-cart monoculture (37.3 g / L). The overall growth in co-cultures and the WT-cart monoculture was similar by day 3, with OD600 values of 33.2 and 36.3, respectively. A consistent increase in OD600 values was observed for both the co-culture and WT-cart monoculture until day 7, reaching 79.8 and 98.2, respectively. The growth in the co-culture continuously increased at the same rate, reaching 137.8 by day 10, surpassing the final OD600 value observed in the WT-cart monoculture (92.1). Interestingly, β-carotene production by the co-culture (4101 mg / L) at day 10 was nearly double that of WT-cart (2009 mg / L). Example 8 – Maximising bioconversion of glucose into β-carotene by using the co-culture strategy While using lignocellulosic hydrolysates is a great strategy to reduce production costs, their use is sometimes limited by their chemical complexity, which makes downstream processes difficult. Therefore, the inventors decided to test the performance of beta carotene production by coculture in defined, minimal media at different CN ratios to identify conditions that maximise yields, an alternative way to reduce production costs. In this experiment, the C / N ratio was adjusted within the range of 5 to 400, with carbon levels held constant (20 g / L) while nitrogen was varied. It should be emphasised that the optimisation of the C / N ratio may impact not only β-carotene production but also efficient substrate utilisation and CA formation. As shown in Figure 12, when the C / N ratio was at or below 100, all the initial glucose was consumed. However, increasing the C / N ratio above 100, resulted in incomplete glucose utilisation within 120 h. As shown in Figure 13, OD600 values were significantly affected when nitrogen was too limited (C / N ratio above 100) to sustain normal growth, consequently leading to incomplete glucose utilisation. At C / N ratios of 200 and 400, 2.73 and 5.14 g / L of the initial glucose remained unutilised, respectively. For the C / N ratios ranging from 5 to 70, no detectable CA remained at the end of the experiment. This agreed with the previous results obtained in Figure 1c, where the WT control and the co-culture were cultivated with a fixed C / N ratio of 15. In that case, WT accumulated about 8 g / l CA at the end of the experiment, while no CA was detected in the coculture at the same time point. Increasing the C / N ratio from 5 to 70 led to a substantial increase in β-carotene titer, raising it from 0.68 g / L to 2.26 g / L. However, further elevating the C / N ratio beyond 70 resulted in a decline in β-carotene production. The highest β-carotene content obtained in the present study (0.20 g / g DCW) was significantly greater than those reported by Y. lipolytica in the literature in shake flasks (ranging from 0.01 to 0.05 g / g DCW) (Larroude et al., Biotechnol Bioeng 115:464–472 (2018); Liu et al., Front Microbiol 12, (2021); Jing et al., J Ind Microbiol Biotechnol 50, (2023); Xu et al., J Agric Food Chem (2023) doi:10.1021 / acs.jafc.3c03033; Gao et al., Metab Eng 41:192–201 (2017). To the best of the inventors’ knowledge, the study performed by Ma et al. Nat Commun 13:572 (2022) is the only report achieving a higher β-carotene content than this study (0.36 g / g DCW). However, they used a rich medium (10 g / L yeast extract, 10 g / L peptone, and 50 g / L glucose), and their strategy involved extensive metabolic engineering, including the introduction of a synthetic isopentenol pathway to enhance precursor flux, removal of lycopene cyclase inhibition through protein engineering, and partitioning of carbon flux between lipid and isoprenoid synthesis. When it comes to the bioconversion of glucose into β-carotene, the inventors’ co-culture achieved a maximum yield of 0.11 g / g glucose. This achievement is particularly noteworthy given the theoretical yield of 0.199 g / g glucose calculated using the iYli21 genome-scale metabolic model for the WT Y. lipolytica (Guo et al., Comput Struct Biotechnol, J20:2503–2511 (2022)) after integrating the β-carotene pathway (Figure 14). This represents the highest β-carotene yield reported by Y. lipolytica to date using minimal medium. Reported glucose bioconversion yields, either using minimal or rich media, have ranged from 0.003 g / g glucose to 0.05 (Table 5) (Larroude et al., Biotechnol Bioeng 115:464–472 (2018); Liu et al., Front Microbiol 12, (2021); Xu et al., J Agric Food Chem (2023) doi:10.1021 / acs.jafc.3c03033; Bruder et al., European Journal of Lipid Science and Technology 122 (2020)) except the study performed by Ma et al. using rich media and extensive metabolic engineering, which achieved 0.15 g / g glucose (Ma et al., Nat Commun 13:572 (2022)). Table 5 – β-carotene production by Y.lipolytica using shake flasks Strategy Medium Titre Bioconversion reference (g / l) Yield (g β- carotene / g glucose) Develop a synthetic co- YNB + 20 g / L 2.26 0.113 This study culture with the capacity glucose to recycle the major byproduct and convert it to β-carotene Develop a synthetic co- Lignocellulosic 4.10 - This study culture with the capacity hydrolysate to recycle the major (urban byproduct and convert it pruning to β-carotene waste) screening the best YNB + 60 g / L 0.9 0.015 Larroude et al., combination of glcuose Biotechnol Bioeng promoters for each of the 115:464–472 carotenoids genes (2018). screening the best YP + 10 g / L 1.5 0.050 Larroude et al., combination of glucose Biotechnol Bioeng promoters for each of the 115:464–472 carotenoids genes (2018). Overexpression of DID2 YP + 10 g / L 0.225 0.022 Yang et al., gene, a subunit of the glucose Biotechnol Lett endosomal sorting 43:1799–1807 complex required for (2021). transport Introducing bi-functional YP + 80 g / L 0.797 0.009 Kildegaard et al., phytoene glucose Synth Syst synthase / lycopene Biotechnol 2:287– cyclase (crtYB) and 294 (2017). phytoene desaturase (crtI), optimizing HMG1 and GGS1 / crtE activities; down-regulated squalene biosynthesis Overexpressing Hxk YP + 20 g / L 0.045 0.002 Qiang et al., Front genes glucose Microbiol 11, (2020). Developed a homology- YP + 20 g / L 0.180 0.009 Cui et al., Appl independent and glucose Environ Microbiol CRISPR / Cas9-mediated 87, (2021). tool for targeted genome integration Using lipid-derive YP + 2 g / L 0.121 - Worland et al., feedstock canola oil Metab Eng Commun 11:e00130 (2020). overexpression of key YP + 30 g / L 0.117 0.003 Jing et al., J Ind gene in the mevalonate glucose Microbiol pathway, enhanced Biotechnol 50, expression of the fatty (2023). acid synthesis pathway, and expression of tHMGR deleting CLA4 and MHY1 YP + 70 g / L 2.7 0.038 Liu et al., ACS genes to convert the glucose Synth Biol mycelium back to the 10:3551–3560 yeast form, (2021). Introducing IUP YP + 50 g / L 7.5 0.150 Ma et al., Nat pathway; Expressing glucose Commun 13:572 variant Y27R and (2022). GGPPsa Example 9 – Discussion Byproduct accumulation is widely recognised as one of the greatest challenges in bioprocessing, leading to decreased product yields and increased downstream costs. In this study, the inventors developed a synthetic co-culture capable of upcycling a major byproduct into the desired product. First, through a combination of metabolic engineering and ALE, the inventors engineered a CA upcycler strain that could utilise CA as a sole carbon source but was unable to grow on glucose. Subsequently, the inventors co- cultivated this CA-consuming strain with a WT strain, which typically produces CA while growing in glucose. The inventors evaluated the performance of the co-culture in both YNB minimal medium and waste hydrolysates, demonstrating improved glucose utilization, higher cell densities, and reduced CA accumulation compared to WT monocultures. The inventors further investigated the performance of the co-culture in bioproduction, using β-carotene as a proof-of-concept. The expression of the β-carotene cassette in both members of the co-culture maintained the trends in OD600 values, glucose consumption, and CA accumulation in the co-culture. Considering both the OD600 values and β-carotene production, the co-culture exhibited a superior capacity for β-carotene accumulation, both using YNB minimal medium and lignocellulosic hydrolysate. By adjusting the C / N ratio, the inventors were able to achieve complete glucose and CA bioconversion into β-carotene, resulting in a β-carotene yield of 0.11 g / g glucose and a β-carotene content of 0.20 g / g DCW, which are remarkably high, especially considering the lack of optimisation of the β- carotene production pathway or disruption of competitive pathways. Various metabolic engineering strategies have been proposed to increase β-carotene production, including an increased supply of acetyl-CoA, a precursor to the mevalonate pathway (Xu et al., Proceedings of the National Academy of Sciences 113:10848–10853 (2016)), increasing the mevalonate pathway flux (Yan et al., Curr Microbiol 64:159–163 (2012); Kildegaard et al., Synth Syst Biotechnol 2:287–294 (2017)), downregulating the flux toward squalene (Gao et al., Metab Eng 41:192–201 (2017)), introducing an artificial isopentenol pathwayto enhance precursor flux (Ma et al., Nat Commun 13:572 (2022)), increase the intracellular lipid content for β-carotene storage (Luo et al., Metab Eng 61:344–351 (2020)), and morphological engineering (Liu et al., ACS Synth Biol 10:3551–3560 (2021)). In the future, these strategies can be combined with a upcycler strain to evaluate a further increase in yield. Another important consideration in bioproduction is that microbial cultures need to be designed to enable the efficient use of inexpensive complex substrates. It has been documented that microbial communities have advantages over monocultures, including increased tolerance towards toxins, enhanced substrate utilization, and the ability to grow in extreme environments, all of which are essential for bioproduction with complex substrates (Perez et al., Pathog Dis 70:280–288 (2014); Lilja & Johnson, ISME J 10:1568– 1578 (2016); McCarty & Ledesma-Amaro, Trends Biotechnol 37:181–197 (2019); Gestel et al., Microbial Biofilms 67–97 (2015) doi:10.1128 / 9781555817466.ch4; Giri et al., J Mol Biol 431:4712–4731 (2019)). Interestingly, the inventors’ data show reduced filamentation and bioproduction heterogeneity, likely due to altered carbon consumption. Notably, CA is a known inducer of filamentation, which in turn is associated with cell stress (Ruiz-Herrera & Sentandreu, Arch Microbiol 178:477–483 (2002)). Therefore, the construction of synthetic microbial consortia with controllable functions can be considered a promising approach to enhance biotechnology-based processes. Another approach to improving the utilisation of complex substrates and wastes is ALE (Mavrommati et al., Biotechnol Adv 54:107795 (2022); Wang et al., Appl Microbiol Biotechnol 105:1745–1758 (2021); Phommachan et al., Energies (Basel) 15:561 (2022)). In biotechnology, ALE is considered a powerful tool for selecting strains with desired characteristics, such as increased resistance to toxic compounds present in hydrolysates, the ability to grow at low pH (Narisetty et al., ACS Sustain Chem Eng 10:10858–10869 (2022)), high or low temperatures, and enhanced substrate co-utilisation (Sandberg et al., Metab Eng 56:1–16 (2019); Long & Antoniewicz, Curr Opin Chem Eng 22:209–215 (2018)). In this research, the inventors apply a unique combination of ALE, metabolic engineering, and synthetic co-cultures to propose an efficient strategy for improving both product and biomass yields by upcycling major byproducts. Further investigations might consider other organisms or products or might test the inventors’ proof-of-concept in bioreactors under optimised conditions. For example, previous studies showed that the production of various chemicals, including β-carotene, could be improved in fed-batch mode (Lv et al., Sci Rep 10:17114 (2020); Rish et al., Biotechnol Prog 38, (2022)). Overall, this study demonstrates the advantages of synthetic microbial communities containing byproduct upcycling strains in bioproduction processes compared to monocultures. Example 10 – Methods Strains, media, and growth conditions The Y. lipolytica strains used in the present study were a wild-type strain (Y. lipolytica H222) and two glucose-non-consuming strain, RLA 1072 with knocked-out hexokinases (ΔHXT) and RLA 1717 with knockout in transporters (Δyht1-4). The minimal medium used for inoculation of monocultures and co-cultures was YNB media containing 50 mM phosphate buffer (pH 6.8), 1.7 g / L yeast nitrogen base without amino acids, and ammonium sulphate (Sigma Aldrich), and 100 g / L glucose. NH4Cl was used as nitrogen source and added to the YNB minimal medium depending on the final carbon to nitrogen (C / N) ratios selected. All the chemicals were purchased from Sigma Aldrich. Waste hydrolysates obtained by steam explosion (urban pruning waste pre-treated with CA and discarded mix of vegetables) was kindly provided by the Advanced Biofuels and Bioproducts Unit, Department of Energy, CIEMAT, Madrid). The composition of hydrolysates used in the present study is shown in Supplementary Table 2. Growth assays Growth curves of Y. lipolytica co-cultures and monocultures were monitored using a Synergy HT Microplate Reader (Biotek, USA). The strains to be used in co-cultures were grown separately for 24 h in a YPD medium, centrifuged at 4000 rpm for 5 min, and washed three times with sterile Milli-Q water. The experiments were carried out in triplicate at 30 °C using 96-well plates, with constant orbital agitation for 72 h. The optical cell densities were measured at 600 nm every 30 min. Each well contained 200 µl media (YNB with 100 g / L glucose, or hydrolysates) with an initial OD600 of 0.01. The growth analysis for ΔHXT subjected to ALE, was performed by adding 180 µl of medium (YNB with 10 g / L CA) to each well and the inoculation cultures taken from running experiments were used after washing three times. All the experiments were carried out in triplicate. The initial OD600 for all the experiments was set at 0.01. Cultivation in deep-well plate Deep-well plates were used to optimise the factors affecting biomass and CA production by monocultures and co-cultures. Inoculates were grown in 2^mL YPD (1% yeast extract, 2% peptone) to the early-stationary phase and then transferred to the media to an initial OD of 0.5 after washing three times. Deep-well plate experiments were performed using 24-well plates containing 2 mL of media in each well. The initial OD was standardized for monocultures (WT) and co-cultures (WT- ΔHXT) and set at 0.5. All the experiments were conducted in triplicate. Shake flask studies Shake flasks experiments were performed in 50 mL Erlenmeyer flasks with 10 mL minimal media inoculated with cells to an initial OD600 of 0.5 and incubated at 30 °C on a rotary shaker with 300 rpm. All the experiments were conducted in triplicate. Adaptive laboratory evolution for enhanced citric acid utilisation Two glucose-non-consuming strains available in the lab collection, Y. lipolytica (ΔHXT) and Y.lipolytica Δyht1-4 (with knocked-out hexose transporters) were used as candidates for preliminary experiments to evaluate their ability to grow on CA as the sole carbon source (Table 4). The preliminary experiments were performed using 96-well plates, with constant orbital agitation for 72 h, and the growth curves were monitored using a Synergy HT Micro-plate Reader (Biotek, USA). The optical cell densities were measured at 600 nm every 30 min. Glucose non-consuming Y. lipolytica strains are suitable candidates as the parental strains for ALE to ensure the evolved strains could utilise the CA produced by the WT strain. Among the two strains tested, only Y. lipolytica ΔHXT could grow on CA as a sole carbon source. Therefore, it was selected as the parental strain for ALE. To improve the cell growth on CA, Y. lipolytica ΔHXT was subjected to ALE, by subculturing the cells (every 72 h) in deep-well plates containing 2 mL of YNB medium initially supplemented with 10 g / L CA. Growth assays using Cerillo co-culture duet system To further explore the interactions among co-culture members and validate the proof-of- concept, we used a Cerillo co-culture duet system (Cerillo, USA). In a duet system, the wells are separated using a semi-permeable membrane divider filter enabling the monitoring of individual strain growth within the co-culture. The experiment was conducted in triplicate. Expression of carotenoids cassette in Y.lipolytica In order to further study the proof-of-concept, the production of β-carotene was evaluated using monocultures and co-cultures. Carotenoids cassette was expressed in WT, and CA- consuming strain (evolved ΔHXT) using a zUA backbone with a hygromycin marker. In order to construct Y.lipolytica strains for carotene production, the parental strains were first grown overnight and then transformed. single colonies of Y.lipolytica strains (WT and CA-consuming) were picked and replated in fresh YPD plates, 24-48 h before transformation. 500-1000 ng of the multigene cassette containing the carotene genes were digested for 4 h using 0.3 μl NotI, 1 μl CutSmart Buffer, and ultrapure H2O up to 10 μl. The digested DNA together with a whole loop biomass of Y.lipolytica were added to the transformation mixture (100 μL 50% polyethylene glycol, 15 μL 2M lithium acetate pH 6.0,15 μL 2M DTT, and 5 μl of salmon sperm career DNA carrier). The mixture was first incubated at 30 °C (30 min) and then at 42°C (10 min). The transformed WT and evolved ΔHXT strains were then selected on YNBglc(2%) and YNBcit 2% plates, respectively, containing 300 µg / L hygromycin antibiotic. Microscopy Producer mono- and co-cultures were harvested after 5 days and washed in phosphate- buffered saline (PBS). Live cells were then transferred to standard glass slides and microscopy analysis was performed using an inverted Nikon Ti2 fluorescence microscope equipped with a dual camera system (Prime BSI Express, Teledyne Photometrics). Intracellular β-carotene levels between mono- and co-culture were evaluated by β- carotene autofluorescence, using a blue LED (460nm) and GFP-excitation / emission filters. Exposure times for brightfield (5ms) and autofluorescence (100ms) were kept consistent for all samples. Images were acquired as 11 Z-stacks spanning 5µm in 0.5µm steps, to capture the entire β-carotene accumulation within cells and cells out of focus were excluded during downstream analysis. Image preparation and single-cell β-carotene quantification were performed using Fiji / ImageJ. Analytical methods Dry cell weight (DCW) was measured in 0.5 ml culture samples taken at different time points. The cells were extracted from the cultures by centrifugation at 10000 for 10 min. After discarding the supernatant, the residual biomass in Eppendorf tubes was stored in an oven at 60°C until a consistent weight was achieved. The DCW (g / L) were calculated by deducting the weight of the cells from the initial weight of the tube. The supernatant was diluted 10 times and stored at -20°C for further analysis. Concentrations of residual glucose and CA in the cultures were assessed using High-Performance Liquid Chromatography (HPLC). Samples obtained from the culture flasks were subjected to centrifugation at 10000 rpm for 10 minutes. To determine the intracellular β-carotene content, a 200 μl aliquot of the culture samples was utilised. The culture samples were subjected to centrifugation at 13000 rpm for 3 min. Subsequently, the harvested cells were mixed with 500 μl of glass beads (0.75 to 1 mm; Roth) and 1 ml of dodecane (extraction solvent). The mixture underwent six rounds of vortexing for 30 s each at 6000 rpm employing a homogenizer, followed by centrifugation to precipitate cell debris and collect the extract. β-carotene content was measured spectrophotometrically at 453 nm after appropriate dilution and its concentrations were calculated using a standard curve plotted with 1 to 50 mg / L β-carotene. Statistical analysis Statistical analysis for wet-lab experimental data was carried out using Microsoft Excel 365. Statistical analyses were conducted using a two-tailed Student's t-test, with 95% (p < 0.05 and 99% (p < 0.01) confidence interval. Statistical analysis to compare the significance of heterogeneity or budding / filamentous cells was carried out using R-Studio. Prophetic Example 11 – Genetic characterisation of an evolved upcycler strain (Yarrowia lipolytica RLA 3014) The upcycler (RLA 3014) and non-evolved strains will be grown in shake flasks (48 h) using YP medium supplemented with 20 g / l CA. The cells will be collected by centrifugation at 13,000 x g (5 min), washed twice with distilled water and will be sent to Novogene company (UK) or similar genomics facilities for whole genome sequencing to identify the mutations across genome resulting in enhanced CA utilisation. Sequences of the disclosure >SEQ_ID_NO:_1_GGS1 atggattataacagcgcggatttcaaggagatatggggcaaggccgccgacaccgcgctgctgggaccgtacaactacctcgccaacaaccggg gccacaacatcagagaacacttgatcgcagcgttcggagcggttatcaaggtggacaagagcgatctcgagacTatttcgcacatcaccaagat tttgcataactcgtcgctgcttgttgatgacgtggaagacaactcgatgctccgacgaggcctgccggcagcccattgtctgtttggagtcccc caaaccatcaactccgccaactacatgtactttgtggctctgcaggaggtgctcaagctcaagtcttatgatgccgtGtccattttcaccgagg aaatgatcaacttgcatagaggtcagggtatggatctctactggagagaaacactcacttgcccctcggaagacgagtatctggagatggtggt gcacaagaccggtggactgtttcggctggctctgagacttatgctgtcggtggcatcgaaacaggaggaccatgaaaagatcaactttgatctc acacaccttaccgacacactgggagtcatttaccagattctggatgattacctcaacctgcagtccacggaattgaccgagaacaagggattct gcgaagatatcagcgaaggaaagttttcgtttccgctgattcacagcatacgcaccaacccggataaccacgagattctcaacattctcaaaca gcgaacaagcgacgcttcactcaaaaagtacgccgtggactacatgagaacagaaaccaagagtttcgactactgcctcaagaggatacaggcc atgtcactcaaggcaagttcgtacattgatgatctagcagcagctggccacgatgtctccaagctacgagccattttgcattattttgtgtcca cctctgactgtgaggagagaaagtactttgaggatgcgcagtga >SEQ_ID_NO:_2_CarB atgtccaagaaacacattgtcattatcggtgctggcgtgggtggcacggctacagctgctcgtttggcccgcgaaggcttcaaggtcactgtgg tggagaaaaacgactttggtggcggccgAtgctccttgatccatcaccagggccatcgctttgatcagggcccgtcgctctacctgatgcccaa gtactttgaggacgcctttgccgatctggacgagcgcattcaagaccacctggagctgctgcgatgcgacaacaactacaaggtgcactttgac gacggtgagtcgatccagctgtcgtctgacttgacacgcatgaaggctgaattggaccgcgtggagggcccccttggttttggccgattcctgg atttcatgaaagagacacacatccactacgaaagcggcaccctgattgcgctcaagaagaatttcgaatccatctgggacctgattcgcatcaa gtacgctccagagatctttcgcttgcacctgtttggcaagatctacgaccgcgcttccaagtacttcaagaccaagaagatgcgcatggcattc acgtttcagaccatgtatatgggcatgtcgccctacgatgcgcctgctgtctacagcctgttgcagtacaccgagttcgctgaaggcatctggt atccccgtggcggcttcaacatggtggttcagaagctagaggcgattgcaaagcaaaagtacgatgccgagtttatctacaatgcgcctgttgc caagattaacaccgatgatgccaccaaacaagtgacaggtgtaaccttggaaaatggccacatcatcgatgccgatgcggttgtgtgtaacgca gatctggtctatgcttatcacaatctgttgcctccctgccgatggacgcaaaacacactggcttccaagaaattgacgtcttcttccatttcct tctactggtccatgtccaccaaggtgcctcaattggacgtgcacaacatctttttggccgaggcttatcaggagagctttgacgaaatcttcaa ggactttggcctgccttctgaagcctccttctacgtcaatgtgccctctcgcatcgatccttctgctgctcccgacggcaaggactctgtcatt gtcttggtgcctattggtcatatgaagagcaagacgggcgatgcttccaccgagaactacccggccatggtggacaaggcacgcaagatggtgc tggctgtgattgagcgtcgtctgggcatgtcgaatttcgccgacttgattgagcatgagcaagtcaatgatcccgctgtatggcagagcaagtt caatctgtggagaggctcaattctgggtttgtctcatgatgtgcttcaggtgctgtggttccgtcccagcacaaaggattctaccggtcgttat gataacctattctttgtgggtgcaagcacgcatcccggaactggtgttcccattgtccttgcaggaagcaagctcacctctgaccaagttgtca agagctttggaaagacgcccaagccaagaaagatcgagatggagaacacgcaagcacctttggaggagcctgatgctgaatcgacattccctgt gtggttctggttgcgcgctgccttttgggtcatgtttatgttcttttacttcttccctcaatccaatggccaaacgcccgcatcttttatcaat aatttgttacctgaagtattccgcgttcataactctaatgtcatttaa >SEQ_ID_NO:_3_CarRP atgctgctcacctacatggaagtccacctctactacacgctgcctgtgctgggcgtcctgtcctggctgtcgcggccgtactacacagccaccg atgcgctcaaattcaaatttctgacactggttgccttcacgaccgcctccgcctgggacaactacattgtctaccacaaggcgtggtcctactg ccccacctgcgtcaccgctgtcattggctacgtgcccttggaggagtacatgttcttcatcatcatgactctgttgaccgtggcattcaccaat ctggtgatgcgctggcacctgcacagcttctttatcaggcctgaaacgcccgtcatgcagtccgtcctggtccgtcttgtccccataacagcct tattaatcactgcatacaaggcttggcatttggcggtccctggaaagccactgttctacggatcatgcattttgtggtacgcctgtccggtttt ggccttattgtggtttggtgctggcgagtacatgatgcgtcgtccgctggcggtgctcgtGtccattgcgctgcccacgctgtttctctgctgg gtcgatgtcgtcgctattggcgccggcacatgggacatttcgctggccacaagcaccggcaagttcgtcgtgccccacctgcccgtggaggaat tcatgttctttgcgctaattaataccgttttggtatttggtacgtgtgcgatcgatcgcacgatggcgatcctccacctgttcaaaaacaagag tccttatcagcgcccataccagcacagcaagtcgttcctccaccagatcctcgagatgacctgggccttctgtttacccgaccaagtgctgcat tcagacacattccacgacctgtccgtcagctgggacatcctgcgcaaggcctccaagtccttttacacggcctctgctgtctttcccggcgacg tgcgccaagagctcggtgtgctatacgccttttgcagagccacggacgatctctgcgacaacgagcaggtccctgtgcagacgcgaaaggagca gctgatactgacacatcagttcgtcagcgatctgtttggccaaaagacaagcgcgccgactgccattgactgggacttttacaacgaccaactg cctgcctcgtgcatctctgccttcaagtcgttcacccgtttgcgccatgtgctggaagctggagccatcaaggaactgctcgacgggtacaagt gggatttggagcgtcgctccatcagggatcaggaggatctcagatattactcagcttgtgtcgccagcagtgttggtgaaatgtgcactcgcat catactggcccacgccgacaagcccgcctcccgccagcaaacacagtggatcattcagcgtgcgcgtgaaatgggtctggtactccaatataca aacattgcaagagacattgtcaccgacagcgaggaactgggcagatgctacctgcctcaggattggcttaccgagaaggaggtggcgctgattc aaggcggccttgcccgagaaattggcgaggagcgattgctctcactgtcgcatcgcctcatctaccaggcagacgagctcatggtggttgccaa caagggcatcgacaagctgcccagccattgtcaaggcggcgtgcgtgcggcctgcaacgtctatgcttccattggcaccaagctcaagtcttac aagcaccactatcccagcagagcacatgtcggcaattcgaaacgagtggaaattgctcttcttagcgtatacaacctttacaccgcgccaattg cgactagtagtaccacacattgcagacagggaaaaatgagaaatctaaataccatttaa >SEQ_ID_NO:_4_HXT_YALI0B22308g atggttcatcttggtccccgaaaacccccgtcccgaaagggctcaatggcagacgtcccgcgggacctgctggagcaaatctcccagcttgaaa ccatcttcaccgtttcgcccgaaaagctgcgtcaaatcaccgaccactttgtgtccgagctcgctaaaggcctcacaaaggagggtggagatat ccccatgaaccccacctggattctgggatggcccaccggaaaggagagcggctgctatctggctctcgacatgggtggcaccaacctgcgagtt gtcaaggtgactctggacggcgaccgaggcttcgacgtcatgcagtccaagtaccacatgccccccaacatcaaggtcggcaagcaagaggagc tgtgggagtacattgccgaatgtctgggcaagttcttggccgacaattatcctgaggctcttgatgcccatgagcgaggacgagatgtcgacag aaccgctgcgcagagcttcactcgagacaagtctcctcctccccacaaccagcacatttcgtgttctcctggcttcgacatccacaagattcct ctcggtttcaccttttcatatccctgctctcagcccgccgtcaaccgaggtgtactgcagcgatggaccaagggtttcgacattgagggagtcg agggcgaggacgtggtccccatgctggaagctgccctcgaaagaaagaacattcctatttccatcaccgccctgatcaacgacaccaccggaac tatggtggcctccaactaccacgacccccagatcaagctgggtaacatctttggtactggtgtcaacgccgcctactacgagaaggtcaaggac attcccaagctcaagggtctcatccccgacagcattgatcccgagacccccatggccgtcaattgcgagtatggagccttcgacaatgagcaca aggttctccctagaaccaagtgggacatcatcatcgatgaggagtctccccgacccggtcagcagaccttcgagaagatgagtgctggctacta cctgggagaattgcttcgtctggttcttctggacctgtacaaggacgggtttgtgttcgagaaccagggcaagaacggtcaggagcttggaaac ggcaacatcaacaagtcgtatttcttcgacacctctttcctgtctctgattgaggaggatccctgggagaacttgactgatgtcgagattctct tcaaggagaagcttggtattaacaccactgagcccgagcgaaagctcattcgtcgactggccgagctcattggtactcgatccgctcgaatctc tgcctgtggtgtcgctgccatctgtaagaaggctggctacaaggaggctcacgctggagctgacggatccgtgttcaacaagtaccccggattc aaggagcgaggcgcccaggctctcaacgagatttttgagtggaacctgcccaaccctaaggaccaccccatcaaaatcgttcccgctgaggatg gtagcggtgttggagctgctctgtgcgctgctctcaccatcaagcgagtcaagcagggtcttcccgttggtgtcaagcccggtgtcaagtacga tatttag >SEQ_ID_NO:_5_ATP1_promoter Tttttttgtattcgggttaggtgttctgctttggataatagggttggggttaatggaatgacgcgctgccccctaactaggtttagggttgctc cgattaggacaaacttgctccatgtgtaaactgaacaagaacaaatgattgaggcagcaacaggtgtgctgatcgtggtttataaaacggtggc atcaatttgaaggctattttcatcttttaatcttcagtattcaccaattatactcttttattccttcggaaaatgttacacaggcgggattcga actggtgtggtgggtttctgaggctgattctttatggaggtacatttcccggcgtcgatcagaagaagaaatgcgaccagtaatgtcgcagtag tgccttttccgtaacccaaccttttaaatccccccatatcttccgtaatcgcccccaatcacctattttcgcttacccagggcacgaccccagt ttctgagttcccggctaataagctttagggttagggcgagttgggagtggttgggaggtaaccaagtctcaaaattggcatatggtgaagtgtc aaaatttgggagcgatgtaaaagcctcgcattttgtgtggtatttccggtcccagcaccacgtagtgcagcatatcacagcacggcatgtatat cagggaccggttgataggaaacgcctaattgggagccccccccacaacacaaaacagacccaagggagaggcaaaaaaatatataagaccagcc ggcccctcccaaaggtcttgcttcccacacacacaacaaatactaaac >SEQ_ID_NO:_6_ATP2_promoter Gtggccggcagcattatggacggtgtaaacggccggggaaattctcgtcgcggcaattccacgtgccccaaacctcttgctccctaccccagaa actgaccactcacggctaaaaggccccgggtgagaaagtgtatgcacatccgggctcggtcgggacagttagggagcggtatatttgggggttg ctaggggcgaattgacaaagaagagatatatttgcaatctgcgcgctgttgtggctctgaatccaccttctccgaaccaattgcgtgtcgggaa cgtgcacaaaaacagcccgccataaaatggaccctcaactggccacgaaaataccgtgcactgcagagtctggcgaaatttgggtttcgggcgt aaagagcaatttgaaatggcgcattgggggattcgggtcattgtggacgttgtagacactcaatggagaagctgaaatatcagccgagctcgga gcgcaccatagagtatttctaggtgccgaaaaacaacaattttggccggcaacggcgcgattgcaactgtctccaaccccgagatagctcccaa ggttgcaaaaggttccttgtttacatgcattctcagatatgtgcagtgccccaaaatacgctggcaaagtcccaactcgcccgctgattggctg cgtttgctcccagctccattttgctacaaccttttcatctcgtgtcgcttcctctctttttctcctcgttagcctctagccagagaacacactg ttacacacacagagaagctcctctttttaacaggcacgattgaacac >SEQ_ID_NO:_7_FBAin_promoter Aacaattgccccggagaacacggccaggccgcctagatgacaaattcaacaactcacagctgactttctgccattgccactaggggggggcctt tttatatggccaagccaagctctccacgtcggttgggctgcacccaacaataaatgggtagggttgcaccaacaaagggatgggatggggggta gaagatacgaggataacggggctcaatggcacaaataagaacgaatactgccattaagactcgtgatccagcgactgacaccattgcatcatct aagggcctcaaaactacctcggaactgctgcgctgatctggacaccacagaggttccgagcactttaggttgcaccaaatgtcccaccaggtgc aggcagaaaacgctggaacagcgtgtacagtttgtcttagcaaaaagtgaaggcgctgaggtcgagcagggtggtgtgacttgttatagccttt agagctgcgaaagcgcgtatggatttggctcatcaggccagattgagggtctgtggacacatgtcatgttagtgtacttcaatcgccccctgga tatagccccgacaataggccgtggcctcatttttttgccttccgcacatttccattgctcggtacccacaccttgcttctcctgcacttgccaa ccttaatactggtttacattgaccaacatcttacaagcggggggcttgtctagggtatatataaacagtggctctcccaatcggttgccagtct cttttttcctttctttccccacagattcgaaatctaaactacacatcacac >SEQ_ID_NO:_8_PGK1_promoter Tgtgcacacttggcgaacggtttagccccaaagttggactgccaccaaggataccttggcaacaagggtgtaaggtgttattatagcgacttgg cagacagtgacgagtcatacattctccgtataatatcgtgtatgtccagacgatagtcgtactcgtactcgttactgtaactactgtgcgagta ctcgtgcatgtatcgtaggtattgtatgttcgagtacatacacatacgataccaaacactgcccactgttctgtcatgttagatcatggccaat ccacgtgacttgcatgcaggtttggcattgaatattcagcgtggctactacaagtagtacatactgtatcaatacgattgtacatacggtactc accctttgctacagtatgtacatacaagggcgcacatggcagaataccatgggagaattggcccgcatggagttcagatgagccctaacaacgc ccctgttcggcttcagaagcaattggcttttggaaattatttggcgagtgaacaatggcgtgtatggagccgtattcgtgctggtgcttgttga atcagcccattgcgcgaaattgttggctctcacaactcaaccctctcttttaccctgtcgtgaccagacgctactgtagcgcttgtcggtcgga ccacaccaaaactgggcctgtattgcattgtactcagatgtaagcaccaagagctgggatccacgtgatcgcccccacacaagacgcgtccatc tgtctattgctcattctccccggcgctctccgatctcttccgacgaa >SEQ_ID_NO:_9_GPM1_promoter AGCAGGCACCCTTGACAACCTTTACAGTATGTACAGTAGCGACAGTATCTTCCATACTTCACTTTACAGTAAATTAAAGAATACACCAAAACTC GTTCTCAAGCTCTGTCAAACAGCTCCAAAAAATATAAAATATATATATATATATATCGCGATACCTCATTAATTCTCACGTGACACAGATTATT AACGTCTCGTACCAACCACAGATTACGACCCATTCGCAGTCACAGTTCACTAGGGTTTGGGTTGCATCCGTTGAGAGTGGTTTGTTTTTAACCT TCTCCATGTGCTCACTCAGGTTTTGGGTTCAGATCAAATCAAGGCGTGAACCACTGTTTGAGGACAAATGTGACACAACCAACCAGTGTCAGGG GCAAGTCCGTGACAAAGGGGAAGATACAATGCAATTACTGACAGTTACGGACTGCCTCGATGCCCTAACCTTGCCCCAAAATAAGACAACTGTC CTCGTTTAAGCGCAACCCTATTCAGCGTCACGTCATAATAGCGTTTGGATAGCACTAGTCTATGAGGAGCGTTTTATGTTGCGGTGAGGGCGAT TGGTGCTCATATGGGTTCAATTGAGGTGGTGGAACGAGCTTAGTCTTCAATTGAGGTGCGAGCGACACAATTGGGTGTCACGTGGCCTAATTGA CCTCGGATCGTGGAGTCCCCAGTTATACAGCAACCACGAGGTGCATGAGTAGGAGACGTCACCAGACAATAGGGTTTTTTTGGACTGGAGAGGG TAGGGCAAAAGCGCTCAACGGGCTGTTTGGGGAGCTATGGGGGAGGAATTGGCGATATTTGTGAGGTTGACGGCTCCGATTTGCGTGTTTTGTC GCTTCTGCATCTCCCCATACCCATATCTTCCCTCCCCACCTCTTTCCACGATAATTTTACGGATCAGCAATAAGGTTCCTTCTCCTAGTTTCCA CGTCCATATATATCTATGCTGCGTCGTCCTTTTCGTGACATCACCAAAACACATACAAAA >SEQ_ID_NO:_10_HHF1_promoter Tttttttgtattcgggttaggtgttctgctttggataatagggttggggttaatggaatgacgcgctgccccctaactaggtttagggttgctc cgattaggacaaacttgctccatgtgtaaactgaacaagaacaaatgattgaggcagcaacaggtgtgctgatcgtggtttataaaacggtggc atcaatttgaaggctattttcatcttttaatcttcagtattcaccaattatactcttttattccttcggaaaatgttacacaggcgggattcga actggtgtggtgggtttctgaggctgattctttatggaggtacatttcccggcgtcgatcagaagaagaaatgcgaccagtaatgtcgcagtag tgccttttccgtaacccaaccttttaaatccccccatatcttccgtaatcgcccccaatcacctattttcgcttacccagggcacgaccccagt ttctgagttcccggctaataagctttagggttagggcgagttgggagtggttgggaggtaaccaagtctcaaaattggcatatggtgaagtgtc aaaatttgggagcgatgtaaaagcctcgcattttgtgtggtatttccggtcccagcaccacgtagtgcagcatatcacagcacggcatgtatat cagggaccggttgataggaaacgcctaattgggagccccccccacaacacaaaacagacccaagggagaggcaaaaaaatatataagaccagcc ggcccctcccaaaggtcttgcttcccacacacacaacaaatactaaac >SEQ_ID_NO:_11_CYC1_promoter Tgtgtgttgttgttgttgttagataaaagtgttagtgaggagtggaaataaaagtgattttatttcgcagattgtgcacttgaattggttgtgg aatgaaaagggtagaaagagggggacacgagcaggtatatataagtttggggggcgtgaggaagggtggcgcacggtagcttgggggttcaatg ttatttcctgtttggtgcacgtggaatgtaatgttgggagggggttaccgccaggagtctgtgtgttacgtgttgatgcgtggtgttgctatca actgctatcaggtttctttgtctcgtcatttcctatttgggacagtggtgggaatacttttgatgcagctctaaatgccatagtatgcgtggcg ctgtaatttgggagaaatggagcctattgtgctcgcgttgggagtttgtgcgtcgtgctgtaaaatttacactcctctgcatatcagagaacgg ctgttagcgattaaggttctatccaaagtcacctggctagcacgcccaaaactcccaattgtgcatacaccatggccacgcacgtcgagtctaa cccacatcgtgcacaaatccattcacaggacaaaagttattataaataaccccccctccccatcacatcaccttctttcgatacacacctttat catccgcctcaaatcgagataaaagttacacactttcaaccaacacacacagaacac >SEQ_ID_NO:_12_HHT1_promoter Gtggccggcagcattatggacggtgtaaacggccggggaaattctcgtcgcggcaattccacgtgccccaaacctcttgctccctaccccagaa actgaccactcacggctaaaaggccccgggtgagaaagtgtatgcacatccgggctcggtcgggacagttagggagcggtatatttgggggttg ctaggggcgaattgacaaagaagagatatatttgcaatctgcgcgctgttgtggctctgaatccaccttctccgaaccaattgcgtgtcgggaa cgtgcacaaaaacagcccgccataaaatggaccctcaactggccacgaaaataccgtgcactgcagagtctggcgaaatttgggtttcgggcgt aaagagcaatttgaaatggcgcattgggggattcgggtcattgtggacgttgtagacactcaatggagaagctgaaatatcagccgagctcgga gcgcaccatagagtatttctaggtgccgaaaaacaacaattttggccggcaacggcgcgattgcaactgtctccaaccccgagatagctcccaa ggttgcaaaaggttccttgtttacatgcattctcagatatgtgcagtgccccaaaatacgctggcaaagtcccaactcgcccgctgattggctg cgtttgctcccagctccattttgctacaaccttttcatctcgtgtcgcttcctctctttttctcctcgttagcctctagccagagaacacactg ttacacacacagagaagctcctctttttaacaggcacgattgaacac >SEQ_ID_NO:_13_HTB1_promoter Tgtgtgttgttgttgttgttagataaaagtgttagtgaggagtggaaataaaagtgattttatttcgcagattgtgcacttgaattggttgtgg aatgaaaagggtagaaagagggggacacgagcaggtatatataagtttggggggcgtgaggaagggtggcgcacggtagcttgggggttcaatg ttatttcctgtttggtgcacgtggaatgtaatgttgggagggggttaccgccaggagtctgtgtgttacgtgttgatgcgtggtgttgctatca actgctatcaggtttctttgtctcgtcatttcctatttgggacagtggtgggaatacttttgatgcagctctaaatgccatagtatgcgtggcg ctgtaatttgggagaaatggagcctattgtgctcgcgttgggagtttgtgcgtcgtgctgtaaaatttacactcctctgcatatcagagaacgg ctgttagcgattaaggttctatccaaagtcacctggctagcacgcccaaaactcccaattgtgcatacaccatggccacgcacgtcgagtctaa cccacatcgtgcacaaatccattcacaggacaaaagttattataaataaccccccctccccatcacatcaccttctttcgatacacacctttat catccgcctcaaatcgagataaaagttacacactttcaaccaacacacacagaacac >SEQ_ID_NO:_14_EXP1_promoter Tataaggagtttggcgcccgttttttcgagccccacacgtttcggtgagtatgagcggcggcagattcgagcgtttccggtttccgcggcggga cgagagcccatgatgggggctcccaccaccagcaatcagggccctgattacacacccacctgtaatgtcatgctgttcatcgtggttaatgctg ctgtgtgctgtgtgtgtgtgttgtttggcgctcattgttgcgttatgcagcgtacaccacaatattggaagcttattagcctttctattttttc gtttgcaaggcttaacaacattgctgtggagagggatggggatatggaggccgctggagggagtcggagaggcgttttggagcggcttggcctg gcgcccactcgcgaaacgcacctaggaccctttggcacgccgaaatgtgccacttttcagtctagtaacgccttacctacgtcattccatgcat gcatgtttgcgccttttttcccttgcccttgatcgccacacagtacagtgcactgtacagtggaggttttgggggggtcttagatgggagctaa aagcggcctagcggtacactagtgggattgtatggagtggcatggagcctgggtggagcctgacaggacgcacgaccggctagcccgtgacaga cgatgggtggctcctgttgtccaccgcgtacaaatgtttgggccaaagtcttgtcagccttgcttgcgaacctaattcccaattttgtcacttc gcacccccattgatcgagccctaacccctgcccatcaggcaatccaattaagctcgcattgtctgccttgtttagtttggctcctgcccgtttc ggcgtccacttgcacaaacacaaacaagcattatatataaggctcctctctccctcccaaccacactcacttttttgcccgtcttgccttgcta acacaaaagtcaagaacacaaacaaccaccccaacccccttacacacaagacatatctacagc >SEQ_ID_NO:_15_TDH1_promoter Tgtgtgttgttgttgttgttagataaaagtgttagtgaggagtggaaataaaagtgattttatttcgcagattgtgcacttgaattggttgtgg aatgaaaagggtagaaagagggggacacgagcaggtatatataagtttggggggcgtgaggaagggtggcgcacggtagcttgggggttcaatg ttatttcctgtttggtgcacgtggaatgtaatgttgggagggggttaccgccaggagtctgtgtgttacgtgttgatgcgtggtgttgctatca actgctatcaggtttctttgtctcgtcatttcctatttgggacagtggtgggaatacttttgatgcagctctaaatgccatagtatgcgtggcg ctgtaatttgggagaaatggagcctattgtgctcgcgttgggagtttgtgcgtcgtgctgtaaaatttacactcctctgcatatcagagaacgg ctgttagcgattaaggttctatccaaagtcacctggctagcacgcccaaaactcccaattgtgcatacaccatggccacgcacgtcgagtctaa cccacatcgtgcacaaatccattcacaggacaaaagttattataaataaccccccctccccatcacatcaccttctttcgatacacacctttat catccgcctcaaatcgagataaaagttacacactttcaaccaacacacacagaacac >SEQ_ID_NO:_16_RPL25_promoter Accgggttggcggcgtatttgtgtcccaaaaaacagccccaattgccccaattgaccccaaattgacccagtagcgggcccaaccccggcgaga gcccccttcaccccacatatcaaacctcccccggttcccacacttgccgttaagggcgtagggtactgcagtctggaatctacgcttgttcaga ctttgtactagtttctttgtctggccatccgggtaacccatgccggacgcaaaatagactactgaaaatttttttgctttgtggttgggacttt agccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcattt ccttctgagtataagaatcattcaa >SEQ_ID_NO:_17_TEF1_promoter Accgggttggcggcgtatttgtgtcccaaaaaacagccccaattgccccaattgaccccaaattgacccagtagcgggcccaaccccggcgaga gcccccttcaccccacatatcaaacctcccccggttcccacacttgccgttaagggcgtagggtactgcagtctggaatctacgcttgttcaga ctttgtactagtttctttgtctggccatccgggtaacccatgccggacgcaaaatagactactgaaaatttttttgctttgtggttgggacttt agccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcattt ccttctgagtataagaatcattcaa >SEQ_ID_NO:_18_TEFin_promoter Gaccgggttggcggcgtatttgtgtcccaaaaaacagccccaattgccccaattgaccccaaattgacccagtagcgggcccaaccccggcgag agcccccttcaccccacatatcaaacctcccccggttcccacacttgccgttaagggcgtagggtactgcagtctggaatctacgcttgttcag actttgtactagtttctttgtctggccatccgggtaacccatgccggacgcaaaatagactactgaaaatttttttgctttgtggttgggactt tagccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcatt tccttctgagtataagaatcattcaaaatggtgagtttcagaggcagcagcaattgccacgggctttgagcacacggccgggtgtggtcccatt cccatcgacacaagacgccacgtcatccgaccagcactttttgcagtactaacc >SEQ_ID_NO:_19_TEF2UAS_promoter Ctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgccca cctcgatccgggtcgacctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgag accgttgttcccgcccacctcgatccgggcatgcctgcagcctagaagcttttgtggttgggactttagccaagggtataaaagaccaccgtcc ccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcatttccttctgagtataagaatcattcaaa >SEQ_ID_NO:_20_TEF4UAS_promoter Ctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgccca cctcgatccggtctagactgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgag accgttgttcccgcccacctcgatccggggatccctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagt gtacgtacattatcgagaccgttgttcccgcccacctcgatccgggtcgacctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgc ttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccgggcatgcctgcagcctagaagcttttgtggttg ggactttagccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgtta agcatttccttctgagtataagaatcattcaaa >SEQ_ID_NO:_21_TEF8UAS_promoter Ctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgccca cctcgatccggtctagactgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgag accgttgttcccgcccacctcgatccggggatccctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagt gtacgtacattatcgagaccgttgttcccgcccacctcgatccgggtcgacctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgc ttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccgggagctcctgaggtgtctcacaagtgccgtgca gtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatccggtctagactgaggtgt ctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgttcccgcccacctcgatcc ggggatccctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtacattatcgagaccgttgtt cccgcccacctcgatccgggtcgacctgaggtgtctcacaagtgccgtgcagtcccgcccccacttgcttctctttgtgtgtagtgtacgtaca ttatcgagaccgttgttcccgcccacctcgatccgggcatgcctgcagcctagaagcttttgtggttgggactttagccaagggtataaaagac caccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcatttccttctgagtataagaatc attcaaa >SEQ_ID_NO:_22_pTEF(V1) Accgggttggcggcgtatttgtgtcccaaaaaacagccccaattgccccaattgaccccaaattgacccagtagcgggcccaaccccggcgaga gcccccttcaccccacatatcaaacctcccccggttcccacacttgccgttaagggcgtagggtactgcagtctggaatctacgcttgttcaga ctttgtactagtttctttgtctggccatccgggtaacccatgccggacgcaaaatagactactgaaaatttttttgctttgtggttgggacttt agccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaaatcgttaagcattt ccttctgagtataagaatcattcaa >SEQ_ID_NO:_23_pTEF(V2) cgatagagaccgggttggcggcgtatttgtgtcccaaaaaacagccccaattgccccaattgaccccaaattgacccagtagcggacccaaccc cggcgagagcccccttcaccccacatatcaaacctcccccggttcccacacttgccgttaagggcgtagggtactgcagtctggaatctacgct tgttcagactttgtactagtttctttgtctggccatccgggtaacccatgccggacgcaaaatagactactgaaaatttttttgctttgtggtt gggactttagccaagggtataaaagaccaccgtccccgaattacctttcctcttcttttctctctctccttgtcaactcacacccgaag >SEQ_ID_NO:_24_GAP_Promoter_ GGTTGAAATGAATCGGCCGACGCTCGGTAGTCGGAAAGAGCCGGGACCGGCCGGCGAGCATAAACCGGACGCAGTAGGATGTCCTGCACGGGTC TTTTTGTGGGGTGTGGAGAAAGGGGTGCTTGGAGATGGAAGCCGGTAGAACCGGGCTGCTTGGGGGGATTTGGGGCCGCTGGGCTCCAAAGAGG GGTAGGCATTTCGTTGGGGTTACGTAATTGCGGCATTTGGGTCCTGCGCGCATGTCCCATTGGTCAGAATTAGTCCGGATAGGAGACTTATCAG CCAATCACAGCGCCGGATCCACCTGTAGGTTGGGTTGGGTGGGAGCACCCCTCCACAGAGTAGAGTCAAACAGCAGCAGCAACATGATAGTTGG GGGTGTGCGTGTTAAAGGAAAAAAAAAGAAGCTTGGGTTATATTCCCGCTCTATTTAGAGGTTGCGGGATAGACGCCGACGGAGGGCAATGGCG CCATGGAACCTTGCGGATATCGATACGCCGCGGCGGACTGCGTCCGAACCAGCTCCAGCAGCGTTTTTTCCGGGCCATTGAGCCGACTGCGACC CCGCCAACGTGTCTTGGCCCACGCACTCATGTCATGTTGGTGTTGGGAGGCCACTTTTTAAGTAGCACAAGGCACCTAGCTCGCAGCAAGGTGT CCGAACCAAAGAAGCGGCTGCAGTGGTGCAAACGGGGCGGAAACGGCGGGAAAAAGCCACGGGGGCACGAATTGAGGCACGCCCTCGAATTTGA GACGAGTCACGGCCCCATTCGCCCGCGCAATGGCTCGCCAACGCCCGGTCTTTTGCACCACATCAGGTTACCCCAAGCCAAACCTTTGTGTTAA AAAGCTTAACATATTATACCGAACGTAGGTTTGGGCGGGCTTGCTCCGTCTGTCCAAGGCAACATTTATATAAGGGTCTGCATCGCCGGCTCAA TTGAATCTTTTTTCTTCTTCTCTTCTCTATATTCATTCTTGAATTAAACACACATCAACA >SEQ_ID_NO:_25_pPOX2 Attcccacaagacgaacaagtgataggccgagagccgaggacgaggtggagtgcacaaggggtaggcgaatggtacgattccgccaagtgagac tggcgatcgggagaagggttggtggtcatgggggatagaatttgtacaagtggaaaaaccactacgagtagcggatttgataccacaagtagca gagatatacagcaatggtgggagtgcaagtatcggaatgtactgtacctcctgtactcgtactcgtacggcactcgtagaaacggggcaatacg ggggagaagcgatcgcccgtctgttcaatcgccacaagtccgagtaatgctcgagtatcgaagtcttgtacctccctgtcaatcatggcaccac tggtcttgacttgtctattcatactggacaagcgccagagttagctagcgaatttcgccctcggacatcaccccatacgacggacacacatgcc cgacaaacagcctctcttattgtagctgaaagtatattgaatgtgaacgtgtacaatatcaggtaccagcgggaggttacggccaaggtgatac cggaataaccctggcttggagatggtcggtccattgtactgaagtgtccgtgtcgtttccgtcactgccccaattggacatgtttgtttttccg atctttcgggcgccctctccttgtctccttgtctgtctcctggactgttgctaccccatttctttggcctccattggttcctccccgtctttca cgtcgtctatggttgcatggtttcccttatacttttccccacagtcacatgttatggaggggtctagatggacatggtgcaaggcccgcagggt tgattcgacgcttttccgcgaaaaaaacaagtccaaatacccccgtttattctccctcggctctcggtatttcacatgaaaactataacctaga ctacacgggcaaccttaaccccagagtatacttatataccaaagggatgggtcctcaaaaatcacacaagcaacg >SEQ_ID_NO:_26_pXPR2 GGTTCTGGCCGTACAGACCTCGGCCGACAATTATGATGACAGTTAGAGCAGCAACGCGTGGAGAGTTTGGGTTTTGGGTTACGTACGTAGAGCC GTTTGATAGATGGTACATCCACCGGCTAGCGGAACACAGTGTCAAGACAAGCCTGCAACACAGTCATAATATTTGCGATATTCAGGCGTATCAG GTACAATCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTC CCGCCCACCTCGATCCGGGGTCCTATGCATCCCTGAAACATTGATTGGAAATTAACATATGAGCTGCGTGCTTTTTGCATTCAAGGGCGCAGCT TATCTTGTATCCTTAATTACACATGACCTCTTGAGCGCCACGGTACATTCCTGGCGTCAGTTCGGTGGAGCGGACACTTTTCTCTCCTTTGTCT GACATGTTGGTTAAGTTGTAGTCCAGGGACACAAGGGGTTCCAACGGCAGTGGCAGCCTACCCCACGCTACCCACCACTGGCCCTGGTCTAACT TCGACGATCGGCATCAGGGTTCATGGATAGGCGGTGTGATTTACGATGTGATGGACAATGTTAGAGAGATCCCACTACTTGTAGTCAGGCCATC TTTTACGTACGCACTGTACCATGATGTCAATGGAGTATGATGAACCGACTTTGAGAGACTCACATCTGCACAACACCATGTTTCAGCGGAATCC GACTTCCAACCCAAACCCAAGCCCCTGTCAGATATCGTGAGAAGGCACGGCACCAACTAATGCACACACTCCACCTGTATTGCACCAAGATAAT GAGGGCATCGTCTTGGCGCGTCTTGGCGAGAGCCGTGTTTCGTGACGCAATCAGAGCAGTTTCTGGATAGTATCTTGTCCAGAAACACGATATA AACCCCATCGACGGGCCCGTTGAAGAGCACCAACCCACTATCCAATCCTCCAATCCAACA >SEQ_ID_NO:_27_pFBP1 TCACCCTACAAAAAGTCGCGTTCGGTGCTACAATACTCACTGGAGGTTGCTTTTGCGGGGATAGACTATGAACCAGGTCAGACCATCCATTCAA GTGAGACCAAATCAGGTGTCTGGAGCATACGGGCGGGGTAATGGCGTCATTTCAGCCCAGTATTGAAGTCGAGTGTACACGTGGTTATGTGGTT GTATGGAGTGTGAGTGGGGAGCGAGTTGGAGCAATCTACAAGTAGCACATGGTCAAGTAAGTGCAAGTAAAGGTATGAACTAAGATGTGTACGA TACTTAAAGATCCTTCAGTAGTCAACACAGCAGTAGCAATCCAAGCACTCTCAAACCGCCTCTATCGCCACCTCCATCGCCACCTCCATCGCCT CCACCGCTCCATCACCACCACCTCCACTCCACCCCCGCCACGTGATAATCCAAAACCGCGTGAAATAGTAAAGGTTGAAAAAACAGACAACTGA GGTAATTGAGCTTAGGTGTCGTGTGATCTGGTGAGCCAATGCGGCGACGGAAAACAATCGCAAAACCCCGGTTGCCACAGACCACATGCTACGT CACGTACACAGTCACGTGACCCCCTCACTCCCGCCGTTTTCTCGCAAAACACGTTGCTACAACCATCACAGCCGAGCTTTACATTTTGGACATA CATGTCGCAGGCCGACTCGGAGATTTTTAGCTTTGCGAGAGGGGCGTTAAATGTGGCTCGATGGAGGTGTTTGGGGGTCACATGGGCCGTGTGG CGGGGCTCAGTGTATTGTACAAACGACCAGCTAGAAAATGGTATAAATATCTCTGCTACCGCCGGCTTATTTCCCCACACAAACCCCACAATAT GTGGTGTTCCGGACGGTTCCGAACCACGGCAATTTCCCGGCCAACCTTAACCACTTAAACCTTCGGCACGGGGGTACAAGACACTTGGAGCGTG TCGTCATCTCCCCTTCTGCCCCAATCCCCCCCTCTCTCAACAAGTCCATCACATTTCACA >SEQ_ID_NO:_28_pMDH1a acatgcgtccagtgtaccccggataacaccattagtgtggctaatagcgaggatggggacttggagggatgggttcgcagggatggactcggag ggatggacgcgaatggcgtggagggctcggatggcgcggagggttcggagatgggtccagggccaaaaatccggtttaaaaaggtggatatggt cgattgtaggctcaatggctagatcgatacattggtttgtgtgttgtgagtgggtccgacccgatacatgtgtgaacatgatgtaaccgtggtg tatatggtatagcttatagacgatacggaaatatcggagatagagcgaaggggccattgacgggaggacaccgggagaatcggtggtgacatgg gataattgcaggttgacaaccgtcgccaacgcttttgcccgcccattatctcctctaaacagctcaattaaatgtctctgttttttcgagtcca cgccaaagtggtccttctgttcataaacttcacatgcacatctgagcggatgtgtgggagatgttatcgccgaggcagttcagaacggcgaata atgatcggaatggcgcgggaaaaaggcgaaatgaattcgattctcgggaagagtccggttatcgacccagatgtctctccgctcctccatttgc gcccccatctccctctccatcctgcattgcgccattaactctaaaacccattgagttgtgtctgcacgctggcctctcatttgccatttaaacc cgtccagtcccacccagcgaccttccccaactccacatcacatcaaa >SEQ_ID_NO:_29_ACL2 GCACTTTACCTGCACCTCCTCTCCTGCAGCTCGCTGAGAGTACAGAAGCTATTTACGCACATTTTTTTTTAACGGCGGCGATTTGGGGCTGAGA AAAATAGAGTTGCGACGAACCCGAAGGATAAGACGTTAGCGAGAGATAGCGAAAAGGGGGTTTGGAGCGGTGCAGAAAATCGGAGGAAATTAGG GAAAATCGGGGAAAATGACGACAATTCGAACCGAGGCCAATTGAGCACGCCGAAGCAGTTTCAACGCAATCGGCCGCGATTCGGACCAGTTGGG CCGCTCTTAGGCAGTCACCAACCAGATGTTCTGCACGGATTTCCCCGATTGTGGAAATGAAATCGACGCCGGCGTCATGGCAATCGACAGTTGG GGGAGAGATAAATCGGTGGTCACGTGTACACCCCCCACGAGCGTCTCCCGTGCCACTTTCTCCCCAGCGACCGTTATCTCAACTCACTTCCCCT CTCTCAACAGTTAACCCAACCCTCAACCAAATTGACGTGGTTAGCGGTTTGGCAGGCGACAAGCGAAATTGACTTTTCCAACAAACTCAGCACG CCACCACGCCCGTTCGCCATGCATGTTGTACCCCTCACCGAGGCCACCAGGATTGGGTCAAAGTGAGGGGGAGTATCAACAAGAAGGAAAAAGG GTCTTTTGGGAGCTCCAAAATAGTTGGGGAGGCGGACCAACAGAGACATATATAGACTCGAAACCAATGTCACAAATCCATCTTTACCAAATAA AGTTAGGGACACAAAACCGCTCTCCAAACAGGATATAATTGTCCCACCACCACCACACACACACACCACCCAACCCAACATTTAGCCTCCGTCT GCTACAACTTAATCAGGCACGACTCACTCTTCTTTCTACGTGACACAAACAGAGCGACACCTACGGAGCGACACCCCCCTCGACCGACACAGAA ACAGCGTCGATCACACACACACACACACACACACCGAATCCGACACTCACCAGATCAATC >SEQ_ID_NO:_30:_pXPR2_promoter TGTATAGTACTGTACCTTCAGTAGACTATTGTAGCTAACATGTCGTTGCGTGGCGTATGTACCAAGCCACAGAAATTATGTCAGAGATAAGGTC GCGACAGTTAGAGCAGCAACGCGTGGAGAGTTTGGGTTTTGGGTTACGTACGTAGAGCCGTTTGATAGATGGTACATCCACCGGCTAGCGGAAC ACAGTGTCAAGACAAGCCTGCAACACAGTCATAATATTTGCGATATTCAGGCGTATCAGGTACAATCTGAGGTGTCTCACAAGTGCCGTGCAGT CCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGGGTCCTATGCATCCCTG AAACATTGATTGGAAATTAACATATGAGCTGCGTGCTTTTTGCATTCAAGGGCGCAGCTTATCTTGTATCCTTAATTACACATGACCTCTTGAG CGCCACGGTACATTCCTGGCGTCAGTTCGGTGGAGCGGACACTTTTCTCTCCTTTGTCTGACATGTTGGTTAAGTTGTAGTCCAGGGACACAAG GGGTTCCAACGGCAGTGGCAGCCTACCCCACGCTACCCACCACTGGCCCTGGTCTAACTTCGACGATCGGCATCAGGGTTCATGGATAGGCGGT GTGATTTACGATGTGATGGACAATGTTAGAGAGATCCCACTACTTGTAGTCAGGCCATCTTTTACGTACGCACTGTACCATGATGTCAATGGAG TATGATGAACCGACTTTGAGAGACTCACATCTGCACAACACCATGTTTCAGCGGAATCCGACTTCCAACCCAAACCCAAGCCCCTGTCAGATAT CGTGAGAAGGCACGGCACCAACTAATGCACACACTCCACCTGTATTGCACCAAGATAATGAGGGCATCGTCTTGGCGCGTCTTGGCGAGAGCCG TGTTTCGTGACGCAATCAGAGCAGTTTCTGGATAGTATCTTGTCCAGAAACACGATATAA >SEQ_ID_NO:_31_POT1 CACAATACCCCACAGTGTGCATATCAAACCTACCGGTTGTTGCTCTCTCCAGCCTTACTAAGAAGGAGGCGACGTGGCAGTGGCTCGCGGGAGG ATCGGCGGGAAACTCCGGGATATCCGTCGAGAGTTTACACGTGAATGGGCAGCGCAATCCGTTGACGACGATACGACTGGCAAAGTAGCGACGA TACCTGCCAGACAGGTGACATGTGCAGGCCGCACTAACAAGGAAACGGGCGCTGGGGGGGGCGGGCTTCTAGACTTTGCCCTTGAACAGGAATC TAGTGGGGGCTTGTCTTTCCGCCAATGGGGGAGCGCCTGTTGAGCGACCGTGCATGCTGGAACGCCAAGTGTATGTACAGCTGGTGGTCTCGCA GCGGTATGTGACGGGACTTACATCTCTCGTTTTTTCATGACCACGTTTTCACAGGCTCGGAGGTACGTTAAAGTTTTGAAGGCTGCATCTGAAC CGAGGTATGGGGGAGTTTGAAGAGCAACAGTGTTGGGGCTGAGGGGGCCAAGATCGGGGCAAGCAGAGGTCTTAGATCAATTGTGGGGATCCCA AAGGGCTCGTTATCACCTTTTTCCACCCAATTCGGGTCCCAATTGATCCACTACTGGCTTGCCCAAGTTACCCCAGAAATGCCGCCCCGGATTT CTCCAAAAACCTAATAAGCTTCATGGAACTTGGTGGAAGTGACTTTCTACAGAGTGGAGAGAACCGTGGACACGTGGCAATGGCGCTGACCGTG TCCCCGAGCCGAATCGACGTGAGGGGAGAACGGAGTATCTGCGGTCATGTGACCTTCCAGAGCGGCGTCGCCAGTGTGCACGCGGTGACCCCCA GTTTGGGTCTCTGTCACACGCATACTACCTCGGCTCTCCACATGCTGAACTTTATCTTTCGTGGGGATCATACCGAAAGTTGCAACTACCAGGT GTATATAAAGCCTGGTAGACTCCCCCCACTTTGGACCTCATCCAACCAAGACACACAAAA >SEQ_ID_NO:_32_LIP2_promoter AAACTTCTCCGAGTCTGTGCCTTCAGGTGGGCATAGTTGATGGGTGTTTTGAAGTTAATAGTGGGGAAGAACTATGGCAAACAAGCAGATGCAG GCACCTTGTAACTGCAGACCGGTTCTTGTCTACCGACTCCGCTGCACCTGTGCCGCGGTACATGTCGTCACAGGCTGCGGGGTTCGGAGGCCCC CTTGCAACCTCCTTTGATAGTTGCTATGGCCCCAAAGAGTTATACGAGATAGACCCACAGATCTACTTGACTGTTGTCACAGAACCTGCTAGGT TTGCTTATTGTACCCGCTTTGTAGCTACTGTACAACGACAACGTCAAAAATTGAGACGCGAACAAACTCCAGATGCAGAACCCAAACCTCTCTC TCAGAGTTTCGAGTGCTTCTACCTCACAGTAAAGTGGAGGTGGACCTGCAAGGGAATTCAGTCACAAGGCCCCGAATGTCTCCGAAACTCCAAT CGGACCGTTTAAACAGACTAATATCACGTCATTGATTGATATTAGCATCCGGCAAGAGCCGCAAGGTTATCTCCTCACCAATGAGCCTGTTGTA CGGCTCATTCCGCATCTGCGGCTGATTCAGTTTCGAGTGGGGATGGTAGACTTCATTGCAGCATTCCTAACCTTCTACTTGGTCCGTGGAGATG TCATGGACATCGATTTTGGGCTGAGAAGCCTTTTGACGATGTTGATATCACTGACCGCTAATTTACTCTGGCAGTTTCTCCGGCTCTCGAGGCA TCGTCGATCACCAAACACTATCTGCTAGTCTAAATGTCCGACACGACAGCTTTTGATCGCCGTGAACGGCGCAGACCTCATGCACCATGCACCA GGGCCAAATCAATTACGGGTCGCTTAGCGTTGCAGTCGGGGCATTATGGTGGAAGTTCCGATACGGCACAGACACATTCCATAGTGGGGGGATT GGATTATAAAAGGGCCATAGAAAGCCCTCAATTGATACCCAAGTACCAGCTCTCCTCACT >SEQ_ID_NO:_33_ICL1_promoter CCTTTTGCCAGTATATCCACCGCAGCACCCACCATGAGCGACATCTGATATCGTGCCGCGACCACTACCCCAAATAAGCTCCAACTAATATGCC GAGGCAGGTGGGAAACTATGCACTCCAGTTGACGCTGTAGAAGCACATGGAAGGTGCGGAGGCGGTGGCAACGAGGGGCATGAGCCATCAACGA GGAACCACAGACAAGGCAAGGGGGGAAACGCGACCGGAATCTCTCGCGGTCACGTGACCCGCCCGGGTTCACTCGTCCATGTTGTGTCTCTGGT GTCTTCGGCCGACTCGCATTGGTTAAACTTCCACCACCGCAATCACGTCCCACTGGCCAAACTTTTTCTGCTTTCTCTGACTTTTTCTGGCCAA AAGGCAACGTCGGAAAGGGTCGGGAGGATTCGGAACCGACGAAAATCGGCCGGCTCCAGCGGGGGTAGTTCGGCAGTCCTGGTGGGAGCTCTAG GGGAGCTGTGGTCTGTGTAGGGCGCGGGTCCGGGTTTGTTGGGTGTCAAATCACGTGTTTTTGCCCCCCCGCTGAGCCGGACTCCGACAACCGT GTCTCCAACGGCCTGACTAAGCTGCTCCCAGCACTCTGCCGTAGCGTTGGTCTGTCCTGTCGCACTCTGTTCAAAGACAGAAGAAAGAAAAAGC TAACCTCCACGTCAGAGACAATGGTAGAAGGCTTGTTCCTTGCAACCGAGGAGAGTGAGTGTTCTCGGCACGAGCATCATGGGCGATCTGGAGG GTATTTTTGAGGGGAAAAAACGGGATCAGGACAAACAGAGGCCACAGACCGGGAATCTGGGCCCCAAAACGGCCTTTTCCCGTCGCAAAACCGG TCTACATACACCCCTTCGGCCCGCCACAGGCCGGTGTGAAAAACCCTAAAGCTTGCTTCAAACCAGACGGACGCACAGCAAGACACATCATGAA GAGTCACCTGCAGTATATATAGATCTGGGGATCCCCAGTAGACTGACCAAGCATACAAAA >SEQ_ID_NO:_34_YAT1_promoter GCCGCGATTTCCGTAAGTGAAAGTGGTATGAGGAGCTCTGTCACTGAACCTGTAAGTACTGTACCCCGATAGTTCGTTGATCGTGCCCCAGACT GCTAAGGTTGCTGATCCCCGCTACCCCAGACTGTCCCGCAAGAAGCAAGTCAGTTTTTACCTCTCTTTTTCTTCCTCGTTATGTCATATGTCTC ACAAGATAGGTCATGATACTGGCATGCACAAACCAAGCACAAAGTGCATCAGCCGCAATTTGAATCCCTTGTGCACCCGTTGTTTCATAGAACT ACTTGTTCAACTATGTTTTGCCTCGGCACCGTTGTACCGTCCAGTTCAACACTATAGTACATACTAGCCCACCGGTCCCGTGCCCTACACAGGA ATATATGACTATGGGAACCTCAAGAACCTACTTTACGAACCTAACGTCGTGGCTTTTACCCGAATATTGTACCAGCTGTAATAATGTTACCCCG GACAAGCGGAGACCAAGAGAAAGGCAAAGGAAAAGGCAAAGTAGGACAATACAGGACCAAATAGCGATAGCCATTGCAGTCAACCTAATTGGAG AGTGTAGGAGTGGGTGGATGGGCTGTGACTGCTTGCAGTGGAGGTGCTCAAAATCAATTTTCATGACACAGTATACTTGATTCTAACCACACTA GTCTTGTTTACTTGTTTCCATCCGGTTGTATCTGTTGTCACTTATTACAGCTCCCCTAGAAAGCGTTCCGGTGATCCGACTTTAGCTCGGCCAG CATATGCACCCCGGACTTCTGAACCTTTGACTTTGTTTGCAAAAGTTGGTTTGCAAACCCTGTCGCATCATCATGACTGCAACCTGAGCGAGAT ATAAGTGTCCACCAGTCCGTCGTCAAAACACACACCCCACCAGCAGTCTATCAAACTAACACTAGCGGTACCAGCGCACAGAAAACTGCCACTC GCACACTAACCTCACGCCCACACTACCCGTAACTACACAATCGCTTATTACACATCCACC >SEQ_ID_NO:_35_CTR1_promoter_GCCGCGATTTCCGTAAGTGAAAGTGGTATGAGGAGCTCTGTCACTGAACCTGTAAGTACTGTACC CCGATAGTTCGTTGATCGTGCCCCAGACTGCTAAGGTTGCTGATCCCCGCTACCCCAGACTGTCCCGCAAGAAGCAAGTCAGTTTTTACCTCTC TTTTTCTTCCTCGTTATGTCATATGTCTCACAAGATAGGTCATGATACTGGCATGCACAAACCAAGCACAAAGTGCATCAGCCGCAATTTGAAT CCCTTGTGCACCCGTTGTTTCATAGAACTACTTGTTCAACTATGTTTTGCCTCGGCACCGTTGTACCGTCCAGTTCAACACTATAGTACATACT AGCCCACCGGTCCCGTGCCCTACACAGGAATATATGACTATGGGAACCTCAAGAACCTACTTTACGAACCTAACGTCGTGGCTTTTACCCGAAT ATTGTACCAGCTGTAATAATGTTACCCCGGACAAGCGGAGACCAAGAGAAAGGCAAAGGAAAAGGCAAAGTAGGACAATACAGGACCAAATAGC GATAGCCATTGCAGTCAACCTAATTGGAGAGTGTAGGAGTGGGTGGATGGGCTGTGACTGCTTGCAGTGGAGGTGCTCAAAATCAATTTTCATG ACACAGTATACTTGATTCTAACCACACTAGTCTTGTTTACTTGTTTCCATCCGGTTGTATCTGTTGTCACTTATTACAGCTCCCCTAGAAAGCG TTCCGGTGATCCGACTTTAGCTCGGCCAGCATATGCACCCCGGACTTCTGAACCTTTGACTTTGTTTGCAAAAGTTGGTTTGCAAACCCTGTCG CATCATCATGACTGCAACCTGAGCGAGATATAAGTGTCCACCAGTCCGTCGTCAAAACACACACCCCACCAGCAGTCTATCAAACTAACACTAG CGGTACCAGCGCACAGAAAACTGCCACTCGCACACTAACCTCACGCCCACACTACCCGTAACTACACAATCGCTTATTACACATCCACC >SEQ_ID_NO:_36_CTR2_promoter TTCAGCCGCCATTTTAGATGGAAGGGACGTCAATCTTTTGGCAGAAGGCCTTGCATGTGCTGAAGGAAGTCATACCCGGTAGTGTAATACCTGG CTAATTCCTCACATAATGGTGAGATGTCACCACATAGTGATGAGAGAAATCAGCTGGGTCGTAGACGACGAGATGTCCATCCTGTAGATAGTTT TATCCACTGATCTAGTCTTTTCTGGCGAATGAGCAAGCACACACCCTTCTGGTGTGTGCTACTATCGGAGTGGGTTGTAAGTTGTTAACTATAT CACATCAATAATACTTATGATCTTCAATAGGATGTTGGACAATTGACATAAAGATGCTCGTGAAAATAAAAATAAATAAATAAAATAAAATAAA ATAAAATAAATAATAATATATATATAAATAACCCTAGGGAAATACGTGATCTGCAGTCATCATCGGACCCTCAAGTGAATAGCCGCTGCACAAT CCACAGCCTTACGAAGTTCGATTCCCTCCTGCACTTAACGGCCAAACCACACGGAATAGGGAGTAACAGCGGGGCGAGAATACCGAAAGAAAGG AAAAGAAAGACAAAAAAGGAAAGAAAGACCAAAAGGAACCCTTCCGCATTCATACAACTTGCCGATTCATTGAATCGAGCATGTACGTACTCCC CGATAAGCGATACAGCAGTTGACTCTAGATACACTTGCGGGGACATCATACTCTGTACAGACTTGACAAGTGATCAGGATCAGACTTGACAAGT GATCAGGACCTTATCCAGCAAACGACATGAACCGCAATTGCCACACAATATTCCGGTACAAGTGTTCGCACTCGAACTGTGCGCCTCAAGCTAG TTTTCCGGGTGGCGCCAGCCACATTTGCCCTCTATCTCCATGCAGGTTCGAGCATTTTTGAAGCGTGTGTGAGATGGCTATTTAATTAACCCAC TCCCAACCCAGAGAACATCAGATAACACAACCTCACACGTCCACACGTCCACACAAAAAA >SEQ_ID_NO:_37_pYALI0B18194_promoter GATTTGTGTCTCCACTCCATCTCCAAGGGCCGAAAACCTGTTGCTGACACTCTCCCCATCACGAGAAACTATCTACTCCCGGAAATGCTGAACC GCATCTGGAAATCCCATGCATCGTGACGCATATCTGTTTTACAGATCGTAAATGCTCCCGTATACACTCTGCAGGGCTTTTTGTACACCTGCAG CCCGTATGCAGGCTATCTACTACTGCGGGAGCTTCCGCTCGTTGGGTGGAAGGACTTGTCCAAAATGTCCTGGCATCCTTGTGCTAATATCTCT ACATAGATCAGCACTGAAAAGTCCACCCAACCACATAGATTAGCAGATTTCCAGAGGACACATGGAAATACCCACTGTTGGGCATCCAACCGTA CCCTTGATTACCCCACCAACAACCCCTGTGGTTTCTTGTATCGTACTGTACTTGTACATGTACAAAGCCGGCATTGAGATCCCGTATTCCGCGT GCCGCGCATTTGCTCAATACACTGTTGCAAATTTGGTTTTCTCAACAATACGGCCCTGCACAATATCCAAACCAGAGCAAAGTGACTGTGAGAT TGGCGAACATGGACAGCAACATCTTCAAGACTATCCGCGAATGCTATGCAGAGAGTTGGACAACTTGACGATCCAATGGACCCGGACCCAGCTT TGATAGATAATATACCATATCAAATGACACTCGATATATCTCTCGACCGCTTCAAAATGCTTGACAAGCGCGTCGCAGTTTGTCAATGTTCACG AAGACAAAGCCGCTGTACCTTACAGTACAGTAGGTAAACTGCAGCCGCTTCCGGCTTGCGAAATTTCCCATCAACCTTCGTACATTCCGGGAAT GGACCAGTTGGGAAGGGCAACTTCTGCAAGGTGCCAGCTCGAGATGGCAGTCTATATAACCGCTCACATCTGCTTGTTTGGAGGTTAGAATCAA AAGCTTCCCCACCCACCACAGTCTCTCGTTATGAAGTTCTCAGTCCTCACTCTCGCCGCC >SEQ_ID_NO:_38_pYALI0C11165_promoter GCAACACGAACAAGACAGTTAAAACTGCCGCCAACACTTTTCCTACTCCCACAACTCCCCAAAACACATCCATTTGAAGACCTCAGTACAGTAC TAACTGGATGCAAATATTGCAGGACCCTGCACCGTGACGCACCCCTTTGGAGATCGGTGTGTAAAGCCCCGTATACACGCTGCAGGGCGGTCCG TATGCCTGCAGCTCTCACGCAGGCCATTTGTACCCTGCGGGAGCTTCCGCTTCTCGTCTAGACATTTCTCGAAGGTCGAACGATTGTCGACACT TGTCTACATGGTTCGATGTCAATACCACGGCGGAACGACACTAACCGACAACGTCCCCAGGAAACACGGGAAAATGATGTTGTTGTCATCATCT GTTCCTGGTTCCGTCATGAATACCCCTGAGACCCCCCAAAGTCGACCCGCATGTACGCCGCCGAGATGTACGGCGTGCCGCGCATTTGCTCACA ATGCTGAGCTGAATTTCCTTCTTTCAGGAGTACTGTACGTCTGCGGACCGTGAGAGATTGCGCGATATCTTGTATACAGTACCAAGATAACTTC CTTCGAACGTGAGCTGTTTGGTGAAAGAAGTCCGCCTAGTGGTTGGTACCTCGAGTCTATCATACCAAAATATGTTCAACCGAAACACGTCTGG ATATATATCCTTGTTAAACACATACATTTGACATGACGGACAATACGAGCGCGCGCGCCGTTGTCAAACGCTCGTGAAGACAAAGATACAGCCT GGCACAGTACAGGAACGTACAGGGGTTGCCGGCTTCAGCCGCTTCCCGCTTCGGAAATCTTTTACCAACTTACTTGCGCGCACATTCCAAGAAT GGAACTGGTGCACGTTGGAAATTCCCACAAGATAGCAGGGGTCTCGCTCCCGTCTATATAAACACATGCCATCCCTTCTCTGCAGTTCAGAATC AACATCCTCACCCCACCCTAGTCTTTCGTTATGAAGTTCTCAGTCCTCGCGCTCGCCACC >SEQ_ID_NO:_39_pYALI0C15004_promoter TACAGTACATACGGTACAGTACATACATTACAGGACAAGTACCGTCATGGATCGGAACGACGTCTGGTCGATAAACCTGTAGAGATAGAGCAAT TACATCACCAGGGAGCGTCCCAGTACCTTCCACCAACCAGACAGTTGCTTTCCACATCTGCATCGTGACGCAACTGCCTTTTTGATTTTTTTTT TGAATTTTTTAGAGATCGTAAAATTTCCGTATATACCCTGCAGGGCTTTTCGTACACCTGCAGCAGGAATGCAGACTCAATCTCGTTGCGGAAG ATTCCGTCCCTTACAAAAAATATTGTGCTAATTGAACGATAGTCGTCGTATTTCTTTATGGAATTGAAAGAATGATGCAGATCGAGCTCCTTAG GAGAATATCCTAGGATGTGACATACATGGAAGGTGGGGGCATCGTGATGGGGAAGGCATTGCACCCTCATTTTTCATCGTGAAGAACCACCATT ATATTCACTGATAAGAAAACTGCAACTCATTCCCGGAGACCGCATGCCGTGCGTTTGCTCAGTATATCTGCAGAGTCATGGTTTTCTCAACAAT ACGTGCGGAACGCAGAGGTTGACAATGGCTGTTCGGGCCCAAACGCTTTCCCAACTTCGATACTGCTCTGCACCCGTAGTGAGCACGTTTGCTA GGGCCTTACCGGTGAGAAAAAAAAAAACGATGACAGAACTCGTGAAAAGTCTCAGTAGCGCCGATCTTAGACTCATTGCGACAACGGTTTTCAA GCGTCTTTGCAAACAAAGGCATCGTACCTTACAGTACAGGAGGTTAACTTCAGCCGCTTCGGTGTGAGTGAGGAACGTTTCCGCAACTGGCGCA CATTCCAGGAGTGGAAAAGTTGCACATGAACGGGATATCTGCATGAAAATTGCTCCCGGTCTGCCCCTATCCAATCTATATAAACCCATGGAAG ACCCTGACTACTTCTTTAGAATCAACAGCCTCAGCTTCTCTCTTACCAAAGTCTCTCATT >SEQ_ID_NO:_40_pYALI0E14256_promoter ACTTGTTTGACAAGAGCCAAACGATACACCAATGTGTATGAAACCTACGCACTCTTGGCATATCTACTGGTACTGTAGCGACAGATTCACTTGT TGAGAGCTGTGCTTCCGAGCATCGGATGTACCTCTTTCTCATATAATTATCGTCAATAATACCGCGCATAACCCAGGCACTCATCAGGGCTGTA CACCCTCCTCTCCAATGGCAGGCGCTCGTAGCAGCAACTAAACCTTGGGGAGGGGGCGTGATCGAGGAAAGGGCTTCCAGTGCGTACCACACAC GTATATCGACGTAATCGTGCCATGCAGACGGCGTGAGATAGTGTAGTTTGAGCTGTATTCTGAAGCCGGTCTGCCACCGTATGTATAGGATCCA CGTCCAAGAAGCCGCCTCGCTGGAGCCACCGGATCATACCCCATGTTCCAATACCCCGCTGAAAGGACAAACAGAAGCCGGACCGTGCGGTGCG GCGAGATATTCGGATTTGGCTCCATTATCTTTGTGTATCCGGTGCAAGTCGGCTTTTGCGGCTCGGAAATGGCTACTTGTAGCTCTGGGTTTGT GTTTGAGGGGAGAGTTGGATATGGAAAAACGTGGATGGTGAAGCCTTCGGGGAATTGGTGTGGTTCCCAATCAACTACTAGGTCAATTGATGCC GTCTTTTGGAGATTTCTGGACGCCATTGAATTGCTGTCCATGAGACACCCCATATTCGCTTAAGCAGCTTCCTTACCTTAGCGAGGCACAGAAC ATTCCGCCTGTCAGCCCCAACCCAATCTCTGAGGGCCACAACTCTCCCCCAATAGCCAGCTGCCCCAGTTGCTCGATCAGCCACCGAAGCTTCA GACAAGGCAGTTACACACTGAGCCTCAAGGTTGTGCGGGCGGATGGGGTATAAGGGTTGAGGTGGTAACCGTGTGAGCTCAGAAGATATATAAA GGGGTGGCCATGTCCCCCTATCGCTCCTTACCAAACAACAAACAACAAACAACTACAAT >SEQ_ID_NO:_41_pYALI0F13937_promoter ATTTCAAAAATAAAGGACCTAAATACCACTGCACCTGTTTGGAGAAATAACGACTGTGTATCCCGCGTAATAGGTCAGGTGCAGTAAGATAAGT CTAGGGTGTTTTCTGTTGATATGGAAACAGGGAACCATGAGTTAGATAACCGACTCCGCGAAATCTCTCCGAACTCACCAATTAGAGCCAGTTC CGTGCTATTGGTATATCTGGGCTGAGAGGTGCGCTACCCCTCCCCGTGTATGGTGGTAATACGGGAGAGAAAAGTGCAAGTACAGGAAGATACA GAGAGCGTAAATCTTAATCTATTTTTGAGAGACAGGATATGAATAAATTGTACTTTAGAGGAGTTTTGTGGTGACTTCAGCTTGGCTGAGGAAG GATTGTATACGATGTACTATGATTATCGAGAAAAGCAATGGTTTTCTGATTCATTGTTTTATGTTTCCATCATACCGATTCCGCAATATAATTG TAATTGCACAAATACTAACCATTTACTTTTGCGGCCATTTTCTGGAGGTTTCGTGTCTATGTACATCATTAACAGAGACGGTACTGTGGCGGAT GAATCATGTGCGGCTCGAAAATTCAGTCGGTGCGGCTCGAAAATTCAGGCGGTCCGTCTGTGCGGCTCAGAAATTGTCAGACGGGATGCTTGGA ATAATGGCGGGATCCGTTACCAAATTAAAATGTGTGATTAATGTTACATTAGATTGTAATTGTTGCAATCTATCGGAATCACCTGTTTGAAGTC ATATTTTTTCAGCAAAAATGGCAATTTTTCAGACGTGTTTAGTTAAATACAAAATTGCTTCAAGCGGCGACAAGGAATTAATGAGCCGCACGCT TACCCGTTGAAACACCGCGTCTCGACATGATACATGCAAGTTGGTCAGATCAAGGCGGGGGCAAGATGGCGGTATTTGGAATATAAAAGGGCTC AAAACTCCAGTCACTTCATCATCAACACCCACACAATCCCCCACAACAACTACTACAGAT Equivalents and references The foregoing embodiments, instances, and examples are applicable to any of the aspects of the present disclosure and should be construed as such. While the present disclosure has been described in terms of various aspects, embodiments, and examples, it is understood that variations, improvements, and equivalents will occur to the person skilled in the art. Such variations, improvements, and equivalents are contemplated by the present disclosure and fall within the scope of the matter disclosed and claimed herein. All references to other documents made in the present application, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically herein incorporated by reference.

Claims

Claims 1. A method of producing a target product, comprising co-culturing a producer cell and a recycler cell in a culture media comprising a first nutrient source, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source.

2. The method of claim 1, wherein: a) the second nutrient source is a by-product generated by the producer cell in the production of the target product; and / or b) the second nutrient source is not metabolised by the producer cell, or wherein the first nutrient source is metabolised by the producer cell in preference to the second nutrient source.

3. The method of claim 1 or 2, wherein: a) the producer cell and the recycler cell are cultured together in a first vessel; or b) the producer cell and the recycler cell are not in direct contact, but the recycler cell is exposed to the nutrient source produced by the producer cell; optionally wherein: i) the producer cell is cultured in a first vessel and the recycler cell is cultured in a second vessel, arranged so that the recycler cell is exposed to at least a portion of the second nutrient source produced by the producer cell, optionally wherein culture media comprising the second nutrient source is perfused from the first vessel into the second vessel; or ii) the producer cell and the recycler cell are cultured in the same vessel comprising two compartments separated by a semi-permeable membrane, wherein the producer cell and the recycler cell are each in a separate compartment; and / or c) i) the producer cell and the recycler cell are added to the culture at the same time point; or ii) the recycler cell is added to the culture after the producer cell; optionally wherein the recycler cell is added to the culture:at least 6 h after the producer cell, such as at least 12 h, at least 18 h, at least 24 h, at least 30 h, at least 36 h, at least 42 h, at least 48 h, at least 54 h, at least 60 h, at least 66 h, at least 72 h or later after the producer cell; about 6 h after the producer cell, such as about 12 h, about 18 h, about 24 h, about 30 h, about 36 h, about 42 h, about 48 h, about 54 h, about 60 h, about 66 h, or about 72 h after the producer cell; and / or 6 h after the producer cell, such as 12 h, 18 h, 24 h, 30 h, 36 h, 42 h, 48 h, 54 h, 60 h, 66 h, or 72 h after the producer cell; and / or d) the producer cell and the recycler cell are co-cultured for: i) at least 48 h, at least 72 h, at least 96 h, at least 120 h, at least 144 h, at least 168 h, at least 192 h, at least 216 h, at least 240 h, or more h; ii) about 48 h, about 72 h, about 96 h, about 120 h, about 144 h, about 168 h, about 192 h, about 216 h, or about 240 h; and / or iii) 48 h, 72 h, 96 h, 120 h, 144 h, 168 h, 192 h, 216 h, or 240 h; 4. The method of any one of claims 1-3, wherein: a) the first nutrient source is a first carbon source and / or the second nutrient source is a second carbon source, and the culture media further comprises a nitrogen source; optionally wherein the ratio of carbon to nitrogen in the culture media (C / N ratio) is: i) between 5 and 400, such as between 15 and 200, 35 and 100, or 60 and 80; ii) at least 15, at least 35, at least 70, at least 100, at least 200, or at least 400, or more; iii) about 15, about 35, about 70, about 100, about 200, or about 400; and / or iv) 15, 35, 70, 100, 200, or 400; b) wherein the first nutrient source is a first carbon source that is: i) a sugar; optionally wherein the sugar is selected from the group comprising or consisting of: glucose, xylose, sucrose, lactose, and arabinose; optionally wherein the first carbon source is glucose; ii) a lipid, optionally wherein the lipid is canola oil; iii) an organic acid; optionally wherein the organic acid is selected from the group comprising or consisting of: acetic acid, butyric acid, propionic acid, and lactic acid;iv) an alcohol; optionally wherein the alcohol is selected from the group comprising or consisting of: glycerol, ethanol, and erythritol; or v) carbon dioxide; c) culture media has a glucose concentration of: i) at least 10 g / L, at least 20 g / L, at least 30 g / L, at least 40 g / L, at least 50 g / L, at least 60 g / L, at least 70 g / L, at least 80 g / L, at least 90 g / L, at least 100 g / L, or more; ii) about 10 g / L, about 20 g / L, about 30 g / L, about 40 g / L, about 50 g / L, about 60 g / L, about 70 g / L, about 80 g / L, about 90 g / L, or about 100 g / L; and / or iii) 10 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, 80 g / L, 90 g / L, or 100 g / L; d) the second nutrient source is a second carbon source selected from the group comprising or consisting of: an organic acid, acetic acid, butyric acid, propionic acid, lactic acid, caproic acid, valeric acid, glycerol, ethanol, erythritol, carbon dioxide, and citric acid; optionally wherein the second carbon source is citric acid; and / or e) culture media is supplemented with exogenous second nutrient source; optionally wherein the exogenous second nutrient source is added to the culture media at the same time as the recycler cell.

5. The method of claim 1-4 wherein: a) the producer cell and / or the recycler cell is a cell selected from: a eukaryotic cell and a prokaryotic cell; optionally wherein the producer cell and / or the recycler cell is a cell selected from the group comprising or consisting of: a yeast cell, a bacterial cell, an archaeal cell, an algal cell, a plant cell, a mammalian cell, a protist cell, and an amoeba cell; b) the producer cell and / or the recycler cell is a fungal cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: a Yarrowia cell, a Saccharomyces cell, a Komagataella cell (a Pichia cell), a Schizosaccharomyces cell, an Ashbya cell, a Blastobotrys cell, a Cryptococcus cell, a Debaromyces cell, a Dekkera cell, a Hansuela cell, a Kluveromyces cell, a Lipomyces cell, a Rhodosporidium cell, a Rhodotorula cell, and a Candida cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia cell optionally selected from the group comprising or consisting of a Yarrowia bubula cell, aYarrowia deformans cell, a Yarrowia lipolytica cell, a Yarrowia porcina cell, a Yarrowia yakushimensis cell, a Yarrowia parophonii cell, a Yarrowia galli cell, a Yarrowia oslonensis cell, a Yarrowia alimentaria cell, a Yarrowia hollandica cell, and a Yarrowia phangngaensis cell; optionally wherein the producer cell and / or the recycler cell is a Yarrowia lipolytica cell; c) the producer cell and / or the recycler cell is a bacterial cell; optionally wherein the yeast cell is selected from the group comprising or consisting of: an Escherichia cell, a Pseudomonas cell, a Vibrio cell, a Bacillus cell, a Clostridium cell, a Lactobacillus cell, a Komagataeibacter cell, a Gluconacetobacter cell, an Acetobacter cell, a Sarcina cell, an Agrobacterium cell, an Azobacter cell, a Rhizobium cell, a Salmonella cell, an Alcaligenes cell, and a Eubacterium cell; d) the producer cell and the recycler cell are the same species; e) the producer cell and the recycler cell are each a Yarrowia lipolytica cell.

6. The method of any one of claims 1-5, wherein the recycler cell comprises a deletion of: a) a glucose metabolism gene, optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: i) has the sequence of SEQ ID NO: 4; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase.

7. The method of any one of claims 1-6, wherein the recycler cell is an evolved recycler cell has been obtained by directed evolution from an ancestral recycler cell; optionally wherein the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell.

8. The method of claim 7, whereini) the directed evolution comprises: a) culturing an ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutreint for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source, thereby identifying an evolved recycler cell; ii) the method further comprises b) i) sub-culturing the sub-cultured plurality of recycler cells in a culture medium comprising the second nutrient source for a third period to obtain a sub-cultured plurality of recycler cells; iv) wherein c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source comprises: i) culturing the ancestral recycler cell in a culture media comprising the second nutrient source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second nutrient source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second nutrient source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell.

9. The method of any one of claims 1-8, wherein: a) the target product is selected from the group comprising or consisting of: a small molecule, a peptide, a polypeptide, a nucleic acid, and a lipid; b) the target product is a carotene, optionally wherein the target product is β- carotene; and / or c) the target product is indigoidine.

10. The method of claim 9, wherein product is β-carotene and the producer cell and the recycler cell each comprise a nucleic acid required to produce the target, optionally comprising a β-carotene biosynthesis cassette; optionally wherein the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / orc) a CarPR gene.

11. The method of claim 10, wherein: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3; d) wherein at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to an inducible promoter; optionally wherein the inducible promoter is a pTEF promoter; e) at least one, at least two, or all three of the genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence; optionally wherein the terminator is a tLIP2 terminator; and / or f) the nucleic acid comprising the β-carotene biosynthesis cassette is: i) integrated into the genome; ii) comprised by a vector; optionally wherein the vector is a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome; optionallywherein the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; and chloramphenicol.

12. The method of any one of claims 1-11, wherein: i) the method provides a bioconversion yield of: a) at least 0.02 g of target product per g of first nutrient source (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; b) about 0.02 g of target product per g of first nutrient source (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; c) 0.02 g of target product per g of first nutrient source (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g; ii) the first nutrient source is glucose, and the method provides a bioconversion yield of: a) at least 0.02 g of β-carotene per g of glucose (g / g), such as at least 0.03 g / g, at least 0.04 g / g, at least 0.05 g / g, at least 0.06 g / g, at least 0.07 g / g, at least 0.08 g / g, at least 0.09 g / g, at least 0.1 g / g, at least 0.11 g / g, at least 0.12 g / g, at least 0.13 g / g, at least 0.14 g / g, at least at least 0.15 g / g, at least 0.16 g / g, at least 0.17 g / g, at least 0.18 g / g, at least 0.19 g / g, or more; b) about 0.02 g of β-carotene per g of glucose (g / g), such as about 0.03 g / g, about 0.04 g / g, about 0.05 g / g, about 0.06 g / g, about 0.07 g / g, about 0.08 g / g, about 0.09 g / g, about 0.1 g / g, about 0.11 g / g, about 0.12 g / g, about 0.13 g / g, about 0.14 g / g, about 0.15 g / g, about 0.16 g / g, about 0.17 g / g, about 0.18 g / g, or about 0.19 g / g; c) 0.02 g of β-carotene per g of glucose (g / g), such as 0.03 g / g, 0.04 g / g, 0.05 g / g, 0.06 g / g, 0.07 g / g, 0.08 g / g, 0.09 g / g, 0.1 g / g, 0.15 g / g, 0.15 g / g, 0.16 g / g, 0.17 g / g, 0.18 g / g, or 0.19 g / g; optionally wherein the method provides a bioconversion yield of 0.11 g of β-carotene per g of glucose;and / or iii) the first nutrient source is glucose and, and the method provides a β- carotene yield of: a) at least 100 mg / L, at least 200 mg / L, at least 300 mg / L, at least 400 mg / L, at least 500 mg / L, at least 600 mg / L, at least 700 mg / L, at least 800 mg / L at least 900 mg / L, at least 1000 mg / L, at least 1200 mg / L, at least 1400 mg / L, at least 1600 mg / L, at least 1800 mg / L, at least 2000 mg / L, at least 2500 mg / L, at least 3000 mg / L, at least 3500 mg / L, at least 4000 mg / L, or more; b) about 100 mg / L, about 200 mg / L, about 300 mg / L, about 400 mg / L, about 500 mg / L, about 600 mg / L, about 700 mg / L, about 800 mg / L about 900 mg / L, about 1000 mg / L, about 1200 mg / L, about 1400 mg / L, about 1600 mg / L, about 1800 mg / L, about 2000 mg / L, about 2500 mg / L, about 3000 mg / L, about 3500 mg / L, about 4000 mg / L, or about 4100 mg / L; c) 100 mg / L, 200 mg / L, 300 mg / L, 400 mg / L, 500 mg / L, 600 mg / L, 700 mg / L, 800 mg / L 900 mg / L, 1000 mg / L, 1200 mg / L, 1400 mg / L, 1600 mg / L, 1800 mg / L, 2000 mg / L, 2500 mg / L, 3000 mg / L, 3500 mg / L, 4000 mg / L, 4100 mg / L, or 4101 mg / L.

13. A method of producing a target product, comprising co-culturing a producer cell and a first plurality of recycler cells in a culture media comprising a first nutrient source, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the cells of the first plurality of recycler cells is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first nutrient source.

14. The method of claim 13, wherein: a) the method is the method according to any one of claims 1-12; and / or b) the producer cell is a producer cell according to any one of claims 1-12; and / or the method further comprises co-culturing the producer cell and first plurality of recycler cells with a second, a third, a fourth, a fifth, a sixth, a seventh, an eighth, a ninth, and / or a tenth plurality of recycler cells; and / or the producer cell is capable of producing a third, a fourth, a fifth, a sixth, a seventh, an eight, a ninth, or a tenth nutrient source; optionally wherein:a) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of producing the target product; b) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is: i) capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; and / or ii) not capable of metabolising at least one nutrient source selected from the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth nutrient sources; c) each of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source; and / or d) at least one of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells is capable of metabolising a different nutrient source to at least one other of the first, second, third, fourth, fifth, sixth, seventh, an eighth, ninth, and / or tenth plurality of recycler cells; and / or e) each cell of each plurality of recycler cells is a recycler cell as defined in any one of claims 1-12.

15. A method of improving the improve the ability of an ancestral recycler cell to metabolise a second nutrient source, the method comprising: a) culturing the ancestral recycler cell in a culture medium comprising the second nutrient source for a first period to obtain a plurality of recycler cells; b) sub-culturing the plurality of recycler cells in a culture medium comprising the second nutrient for a second period to obtain a sub-cultured plurality of recycler cells; and c) identifying an evolved recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second nutrient source; optionally wherein: the second carbon source is a second nutrient source as defined in any one of claims 1-12; and / or the recycler cell is a recycler cell as defined in any one of claims 1-12.

16. A producer cell, wherein the producer cell is as defined in any one of claims 1-12.

17. A recycler cell, wherein the recycler cell is as defined in any one of claims 1-12.

18. A Yarrowia lipolytica cell that is capable of utilising citric acid as a sole carbon source.

19. The Yarrowia lipolytica cell of claim 18, wherein: the Yarrowia lipolytica cell comprises a deletion of: a) a glucose metabolism gene; optionally wherein the glucose metabolism gene is hexokinase; optionally wherein the hexokinase is HXT; optionally wherein the HXT gene: i) has the sequence of SEQ ID NO: 4; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 4; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 4; b) a xylose metabolism gene, optionally wherein the xylose metabolism gene is xylose reductase; and / or c) an arabinose metabolism gene, optionally wherein the arabinose metabolism gene is arabinose reductase; and / or the Yarrowia lipolytica cell is an evolved Yarrowia lipolytica cell has been obtained by directed evolution from an ancestral Yarrowia lipolytica cell; optionally wherein the directed evolution comprises: d) culturing an ancestral Yarrowia lipolytica cell in a culture medium comprising the second carbon source for a first period to obtain a plurality of Yarrowia lipolytica cells; e) sub-culturing the plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a second period to obtain a sub-cultured plurality of Yarrowia lipolytica cells; and f) identifying a Yarrowia lipolytica cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source, thereby identifying an evolved Yarrowia lipolytica cell; optionally wherein the directed evolution further comprises b) i) sub-culturing the sub- cultured plurality of Yarrowia lipolytica cells in a culture medium comprising the second source for a third period to obtain a sub-cultured plurality of Yarrowia lipolytica cells; and / or wherein c) identifying a recycler cell of the sub-cultured plurality that has an improved ability to metabolise the second carbon source comprises:i) culturing the ancestral recycler cell in a culture media comprising the second carbon source; ii) culturing a recycler cell of the sub-cultured plurality of recycler cells in a culture media comprising the second carbon source; and iii) determining the doubling time of the ancestral recycler cell and of the recycler cell of the sub-cultured plurality of recycler cells; wherein a recycler cell of the sub-cultured plurality has an improved ability to metabolise the second carbon source when the doubling time of the recycler cell of the sub-cultured plurality is shorter than the doubling time of the ancestral recycler cell; and / or g) wherein the evolved recycler cell comprises one or more insertions, deletions, and / or single nucleotide polymorphisms (SNPs) in at least one or more gene, compared to the ancestral recycler cell.

20. A culture medium comprising lignocellulosic hydrolysate, wherein the medium comprises glycose, citric acid, acetic acid, and xylose; optionally wherein the lignocellulosic hydrolysate further comprises furfural, hydroxymethylfurfural, benzoic acid, fructose, and / or arabinose.

21. A nucleic acid comprising a β-carotene biosynthesis cassette; optionally wherein the β-carotene biosynthesis cassette comprises: a) a GSS1 gene; b) a CarB gene; and / or c) a CarPR gene.

22. The nucleic acid of claim 21, wherein: a) the GSS1 gene has a sequence that: i) is the sequence of SEQ ID NO: 1; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 1; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 1; b) the CarB gene has a sequence that: i) is the sequence of SEQ ID NO: 2; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 2; oriii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 2; and / or c) the CarPR gene has a sequence that: i) is the sequence of SEQ ID NO: 3; ii) has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the sequence of SEQ ID NO: 3; or iii) has a sequence that is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 3; d) at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to an inducible promoter; optionally wherein the inducible promoter is a pTEF promoter; e) at least one, at least two, or all three of the GSS1, CarB, and / or CarPR genes in the β-carotene biosynthesis cassette are operably linked to a terminator sequence; optionally wherein the terminator is a tLIP2 terminator.

23. A vector comprising the nucleic acid of any one of claim 22, wherein the vector is a plasmid, a cosmid, a phagemid, a bacterial artificial chromosome, or a yeast artificial chromosome; optionally wherein the vector comprises an antibiotic resistance marker, optionally wherein the antibiotic resistance marker is selected from the group comprising or consisting of: hygromycin; nourseothricin; ampicillin; kanamycin; spectinomycin; streptomycin; chloramphenicol.

24. A cell comprising the nucleic acid of claim 21 or 22, or the vector of claim 23.

25. A composition comprising a producer cell and a recycler cell, wherein: the producer cell is capable of producing the target product and is capable of producing a second nutrient source; and the recycler cell is capable of producing the target product, is capable of metabolising the second nutrient source, and is not capable of metabolising the first carbon source.

Images