Method for synthesizing single-stranded DNA containing DNA barcode sequences
The method synthesizes primerless single-stranded DNA using adapter sequences and T4 DNA ligase to address DNA barcode lengthening issues in DELs, enhancing sequencing accuracy and diversity by reducing DNA damage and mistranslation.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2026-03-19
AI Technical Summary
Existing DNA-Encoded Libraries (DELs) face issues with DNA barcode lengthening due to primer sequences for PCR amplification, leading to increased DNA damage and mistranslation, which affects sequencing accuracy and diversity.
A method for synthesizing single-stranded DNA that omits primer sequences by using adapter sequences and T4 DNA ligase to create a double-stranded DNA template, which is then converted into single-stranded DNA suitable for PCR amplification, allowing for shorter DNA barcodes and reduced damage.
This approach suppresses DNA damage and mistranslation, enabling accurate and diverse sequencing analysis with shorter DNA barcodes, applicable to next-generation sequencing and Sanger sequencing.
Smart Images

Figure JP2025030197_19032026_PF_FP_ABST
Abstract
Description
Method for Synthesizing Single-Stranded DNA Containing DNA Barcode Sequences
[0001] This disclosure relates to the amplification of short single-stranded DNA in a DNA-Encoded Library.
[0002] DNA-Encoded Libraries (DELs) are widely used in academia and industry as a drug discovery technology for the next generation. By associating various compounds, ligands 104, with DNA barcodes 101 based on the sequence specificity and amplifiability of DNA, compounds can be identified regardless of their chemical structure (Figure 1) (Non-Patent Documents 1, 2). However, in the construction of DELs, molecular biology techniques such as annealing and ligation are generally used. In addition, since primer sequences 102, 103 for PCR amplification are included on both sides of the DNA barcode 101 that encodes the building blocks of the ligand 104, the longer the cycle in library construction, the longer the DNA barcode becomes. In many cases, the length of the DNA barcode is unnecessarily longer than the actual size of the library. This consequently increases the probability of DNA damage and mistranslation.
[0003] Nat. Rev. Methods Primers, 2022, 2, 1-17 Chem. Rev., 2021, 121, 7155-7177
[0004] Amplification and sequencing are possible even when the DNA barcode in the DEL is short and does not contain primers for PCR amplification on both sides. This suppresses the probability of DNA damage during library construction and mistranslation during sequencing, and provides maximum diversity with a minimum length.
[0005] To achieve the above object, the present invention includes, for example, the following aspects.
[0006] Item 1. A method for synthesizing single-stranded DNA that enables base sequence analysis of a single-stranded DNA sequence that does not contain a primer sequence for amplification by PCR, comprising: a double-stranding step of obtaining double-stranded DNA using DNA polymerase, with a template single-stranded DNA having a base sequence in which a first adapter sequence is attached to the 3′ end of a DNA barcode sequence as a template; and a read-only DNA synthesis step of synthesizing single-stranded DNA that can be amplified by PCR, by using double-stranded DNA composed of a single-stranded DNA having a complementary sequence to a second adapter sequence and a single-stranded DNA containing a second adapter sequence and having a dideoxy-modified 3′ end, and linking the single-stranded DNA having a complementary sequence to the first adapter sequence and the single-stranded DNA having a complementary sequence to the second adapter sequence, which constitute the double-stranded DNA obtained in the double-stranding step, using T4 DNA ligase. A method for synthesizing single-stranded DNA, wherein the single-stranded DNA that can be amplified by PCR is a single-stranded DNA having, in order from the 5′ end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, and a complementary sequence of the second adapter sequence. Item 2. A method for synthesizing single-stranded DNA according to Item 1, wherein a linker sequence is added to the 5′ end of the DNA barcode sequence, and in the reading DNA synthesis step, the linker sequence is ligated to the 3′ side of the second adapter sequence, and the single-stranded DNA that can be amplified by PCR is a single-stranded DNA having, in order from the 5′ end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, a complementary sequence of the linker sequence, and a complementary sequence of the second adapter sequence.Item 3. A method for synthesizing single-stranded DNA that enables base sequence analysis of a single-stranded DNA sequence that does not contain a primer sequence for amplification by PCR, comprising: a nucleic acid preparation step of preparing single-stranded DNA containing a DNA barcode sequence; a first ligation step of ligating the single-stranded DNA with a single-stranded DNA having a first adapter sequence at its 3' end after the nucleic acid preparation step to obtain a template single-stranded DNA having a base sequence in which the first adapter sequence is attached to the 3' end of the DNA barcode sequence; an aggregate formation step of hybridizing the template single-stranded DNA obtained in the first ligation step with an extension primer which is a single-stranded DNA having a complementary sequence to the first adapter sequence to form an aggregate; and a double-stranding step of converting the aggregate into double-stranded DNA using DNA polymerase from the extension primer in the aggregate obtained in the aggregate formation step, using the template single-stranded DNA as a template. A method for synthesizing single-stranded DNA, comprising: a read-only DNA synthesis step, using a double-stranded DNA obtained in the double-stranding step, a double-stranded DNA composed of a double-stranded DNA having a complementary sequence of the second adapter sequence, and a single-stranded DNA containing the second adapter sequence and having a dideoxy-modified 3′ end, to synthesize single-stranded DNA that can be amplified by PCR by using T4 DNA ligase; and a purification step, to purify the single-stranded DNA that can be amplified by PCR synthesized in the read-only DNA synthesis step, wherein the single-stranded DNA that can be amplified by PCR is a single-stranded DNA having, in order from the 5′ end, a sequence having a part of the complementary sequence of the first adapter sequence, the complementary sequence of the DNA barcode, and the complementary sequence of the second adapter sequence.Item 4. In the nucleic acid preparation step, the single-stranded DNA containing the DNA barcode sequence is a single-stranded DNA consisting of a base sequence in which a linker sequence is attached to the 5′ end of the DNA barcode sequence, in the read DNA synthesis step, the linker sequence is ligated to the 3′ side of the second adapter sequence, and the PCR-amplified single-stranded DNA is a single-stranded DNA having, in order from the 5′ end, a complementary sequence of the DNA barcode having a part of the complementary sequence of the first adapter sequence, a complementary sequence of the linker sequence, and a complementary sequence of the second adapter sequence, as described in Item 3. Item 5. The method for synthesizing single-stranded DNA according to any one of Items 1 to 4, wherein the number of bases of the DNA barcode sequence is 10 bases or more and 55 bases or less. Item 6. The method for synthesizing single-stranded DNA according to Item 2 or 4, wherein the linker sequence attached to the 5′ end of the DNA barcode sequence is 1 to 10 bases long. Item 7. A method for synthesizing single-stranded DNA according to item 2 or 4, wherein the linker sequence added to the 5′ end of the DNA barcode sequence consists of 1 to 10 bases including the 3′ end of the base sequence consisting of 5′CTTCCGATCT 3′ (SEQ ID NO: 22). Item 8. A method for synthesizing single-stranded DNA according to item 7, wherein the linker sequence added to the 5′ end of the DNA barcode sequence is a sequence consisting of 5′GATCT 3′. Item 9. A method for synthesizing single-stranded DNA according to any one of items 1 to 4, wherein the first adapter sequence is a sequence consisting of AGATCGGAAG (SEQ ID NO: 23), the single-stranded DNA sequence having a complementary sequence to the second adapter sequence is a sequence consisting of 5′GGAAGAGCGTCGTGTAGGGAAAGAGTGTA 3′ (SEQ ID NO: 5), and a phosphate group is labeled at the 5′ end of the single-stranded DNA having a complementary sequence to the second adapter sequence. Item 10. The method for synthesizing single-stranded DNA according to either item 3 or 4, wherein the extension primer is a sequence consisting of 5′GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3′ (SEQ ID NO: 24), and the phosphate-binding site of 5′CGATCT 3′ in the sequence is a phosphorothioate bond.Item 11. A method for synthesizing single-stranded DNA according to item 3 or 4, wherein in the first linking step, a single-stranded DNA having a base sequence in which a random region consisting of eight or more random bases is added to the 3′ end of a base sequence complementary to the region including the 5′ end of the single-stranded DNA having the first adapter sequence is used as a template to link the single-stranded DNA with the single-stranded DNA having the first adapter sequence. Item 12. A method for synthesizing single-stranded DNA according to any one of items 1 to 4, wherein the base sequence analysis is next-generation sequencing (NGS), nanopore sequencing, or Sanger sequencing. Item 13. A method for synthesizing single-stranded DNA according to item 2 or 4, wherein the base sequence analysis is next-generation sequencing (NGS), and the base sequence in which the linker sequence is linked to the 3′ side of the second adapter sequence constitutes the NGS read sequence. Item 14. Use of single-stranded DNA in sequencing analysis for analyzing a DNA barcode of template DNA containing a DNA barcode, without primer sequences for amplification by PCR, wherein the single-stranded DNA has, in order from the 5' end, a sequence having a complementary sequence to a first adapter sequence, a complementary sequence to the DNA barcode, and a complementary sequence to a second adapter sequence. Item 15. Use according to Item 14, wherein the template DNA has, in order from the 5' end, a linker sequence and the DNA barcode sequence, and the single-stranded DNA has, in order from the 5' end, a sequence having a complementary sequence to the first adapter sequence, a complementary sequence to the DNA barcode, a complementary sequence to the linker sequence, and a complementary sequence to the second adapter sequence.Item 16. A method for reading a DNA barcode sequence using a sequencer, comprising: a single-stranded DNA synthesis step of obtaining single-stranded DNA having, in order from the 5′ end, a sequence having the complementary sequence of the first adapter sequence, the complementary sequence of the DNA barcode, and the complementary sequence of the second adapter sequence, by the single-stranded DNA synthesis method described in any one of Items 1 to 12; an index sequence addition step of obtaining double-stranded DNA by adding the index sequence to both ends of the single-stranded DNA by PCR amplification of the single-stranded DNA obtained in the single-stranded DNA synthesis step using a primer having an index sequence; and a sequence analysis step of analyzing the double-stranded DNA obtained in the index sequence addition step with a sequencer and reading the DNA barcode sequence.
[0007] A schematic diagram illustrating the structure of a conventional DNA encoding library. A schematic diagram illustrating a method for synthesizing single-stranded DNA containing an NGS readable sequence and a DNA barcode sequence that enables base sequence analysis by next-generation sequencing (NGS), and a method for reading the DNA barcode sequence using such single-stranded DNA via NGS. Index PCR amplicons analyzed by the Agilent 2100 Bioanalyzer electrophoresis system. M: molecular marker, 1: amplified single-stranded short DNA, -: negative control without template
[0008] In this specification, the singular form includes both singular and plural forms unless otherwise explicitly stated herein or the context clearly contradicts it.
[0009] In this specification, "comprise" is a concept that also includes "consist of".
[0010] In this specification, next-generation sequencing refers to preparing a library by attaching adapters to both ends of multiple DNA fragments, each containing a different DNA sequence to be sequenced, and then performing sequencing using such a library. The library may be pre-prepared by being immobilized on a support such as beads or an emulsion, and sequencing may be performed on the library immobilized on the support.
[0011] In this specification, next-generation sequencers (NGS) refer to equipment for performing next-generation sequencing. Examples include, but are not limited to, Illumina's next-generation sequencers and Nanopore's next-generation sequencers.
[0012] In this specification, nanopore sequencing refers to a base sequence determination method that sequentially reads a DNA strand by applying a voltage to a membrane having nano-sized pores (nanopores), thereby passing an ionic current through the nanopores, and reading the characteristic changes in the current for each nucleotide (type of DNA base) passing through the nanopores.
[0013] In this specification, Sanger sequencing, also known as the dideoxy method, refers to a base sequence determination method that utilizes a mechanism to stop the DNA synthesis reaction by incorporating dideoxynucleotides (ddNTPs) when DNA is replicated using DNA polymerase.
[0014] This invention relates to a technique for analyzing DNA barcodes in DEL. Specifically, a double-stranded DNA with sticky ends is ligated to the 3′ end of a single-stranded DNA barcode, and then captured as appropriate using magnetic beads or the like. Subsequently, it is hybridized with a primer containing the adapter sequence necessary for sequencing, and the captured DNA barcode is used as a template to extend using a DNA polymerase such as a Klenow fragment, thereby generating a complementary strand containing one of the adapter sequences. Then, the other adapter sequence is added by ligation. The complementary strand of the original barcode constructed through this series of steps has adapter sequences at both ends, so the DNA barcode sequence is analyzed by performing amplification by PCR (polymerase chain reaction) and adding primers for sequencing as appropriate.
[0015] This disclosure provides one embodiment of a method for synthesizing single-stranded DNA that enables sequencing analysis of single-stranded DNA sequences that do not contain primer sequences for amplification by PCR.
[0016] In primerless DNA amplification, particularly in the field of genome sequencing, technological advancements have been remarkable, and numerous methods have been reported (Gansauge, MT et al., Nat. Protoc., 2020, 15, 2279-2300.; Wu, J. et al., BMC Genomics, 2018, 19, 1-12; Troll, CJ et al., BMC Genomics, 2019, 20, 1-14; Ding, J. et al., Nat. Protoc., 2015, 10, 1433-1444; Tin, MMY et all, PLoS One, 2014, 9, e96793; Turchinovich, A. et al., RNA Biol., 2014, 11, 817-828) However, existing methods often require double-stranded DNA or phosphorylation of the ends. In contrast, according to this disclosure, DNA containing DNA barcodes can be relatively short and unprotected single-stranded DNA, for example, unprotected single-stranded DNA with a total length of less than 30 nt and with the hydroxyl groups at the 5′ and 3′ ends exposed. Taking this into account, single-stranded DNA can be synthesized by applying the method of Meyer et al. (Nat. Protoc., 2020, 15, 2279-2300) as shown in Figures 2(A)-(H).
[0017] First, the above single-stranded DNA synthesis method includes a nucleic acid preparation step (Figure 2(A)) in which single-stranded DNA 3 is made up of a base sequence in which linker sequence 2 is added to the 5′ end of DNA barcode sequence 1. This single-stranded DNA 3 is primerless single-stranded DNA (ssDNA). While existing DEL DNA barcodes have primer sequences of approximately 10 to 20 bases in length pre-integrated at both ends, which are necessary for amplification by PCR, DNA barcode sequence 1 does not contain primer sequences for amplification by PCR on either side. By shortening single-stranded DNA 3 to the minimum strand length necessary for encoding, the physical probability of DNA damage can be suppressed compared to conventional DNA barcodes.
[0018] DNA barcode sequence 1 can be used to identify nucleic acid molecules; for example, sequencing can identify a specific barcode linked to a target nucleic acid molecule. In some cases, sequence-specific events can be used to identify nucleic acid molecules, and at least a portion of DNA barcode sequence 1 may be recognized in a sequence-specific event, for example, and at least a portion of DNA barcode sequence 1 may be involved in ligation or extension reactions.
[0019] DNA barcode sequence 1 can be fabricated based on the selection of a specific nucleic acid sequence and can be appropriately designed by those skilled in the art. In some embodiments, the number of bases in DNA barcode sequence 1 is between 10 and 55 bases.
[0020] Linker sequence 2, which is added to the 5′ end of DNA barcode sequence 1, is a sequence for reading by a next-generation sequencer. The composition of linker sequence 2 can be appropriately selected by those skilled in the art. In some embodiments, linker sequence 2 consists of 0 to 10 bases in length, in terms of reading accuracy or ease of the nucleic acid preparation process. In some embodiments, the linker sequence is 0 bases long, i.e., absent. In some embodiments, linker sequence 2 consists of 1 to 10 bases in length. In some embodiments, linker sequence 2 consists of 1 to 10 bases including the 3′ end of the base sequence consisting of 5′CTTCCGATCT 3′ (Sequence ID 22). In some embodiments, linker sequence 2 is a sequence consisting of 5′GATCT 3′.
[0021] Next, the method for synthesizing single-stranded DNA described above includes a first linking step (Figure 2(B)) in which, after the nucleic acid preparation step, the single-stranded DNA 3 and the single-stranded DNA 5 having a first adapter sequence 4 at its 3′ end are linked to obtain a template single-stranded DNA 6 having a base sequence in which the linker sequence 2 is attached to the 5′ end of the DNA barcode sequence 1 and the first adapter sequence 4 is attached to the 3′ end of the DNA barcode sequence 1.
[0022] Each of the first adapter sequence 4 and the second adapter sequence 16 may include elements for immobilizing a template DNA polynucleotide on a support, elements for binding oligonucleotides used for sequencing (binding sites for extended primers in sequencing by synthetic methods), or elements for both immobilization and sequencing. The adapter may also include the following additional features: a reaction endonuclease recognition site, an extended primer hybridization site (for use in analysis), a barcode sequence, a unique molecular identifier sequence, and a polymerase recognition sequence.
[0023] Each of the first adapter sequence 4 and the second adapter sequence 16 may have a length, structure, and other properties suitable for use in specific sequencing. For example, each adapter may be single-stranded, double-stranded, or partially double-stranded. For example, each adapter may have a length of 10 to 200 nucleotides, 10 to 100 nucleotides, or 10 to 50 nucleotides.
[0024] In some embodiments, the length of the first adapter sequence 4 is 8 to 25 nucleotides. In some embodiments, the length of the second adapter sequence 16 is 20 to 40 nucleotides, and the length of the complementary sequence 13 of the second adapter sequence 16 is 20 to 40 nucleotides.
[0025] In some embodiments, the first adapter sequence 4 is a sequence consisting of AGATCGGAAG (SEQ ID NO: 23), the complementary sequence 13 of the second adapter sequence is a sequence consisting of 5′GGAAGAGCGTCGTGTAGGGAAAGAGTGTA 3′ (SEQ ID NO: 5), and a phosphate group is labeled at the 5′ end of the single-stranded DNA 14 having the complementary sequence 13 of the second adapter sequence. Ligation becomes possible by modifying the 5′ end with a phosphate group.
[0026] In some embodiments, single-stranded DNA 3 (Figure 2(A)) temporarily becomes double-stranded by hybridization with double-stranded DNA consisting of a single-stranded DNA 8 having a sequence with biotin modification 5 and a first adapter sequence 4 at its 5′ end, and a random sequence of 8 or more bases at the 3′ end of a base sequence complementary to the region containing the 5′ end of the first adapter sequence 4 (Figure 2(B)). From this double-stranded state, single-stranded DNA 3 and the biotin-modified first adapter sequence 4 are ligated together with DNA ligase (Figure 2(C)).
[0027] Next, the aggregate is returned to a single-stranded state by thermal denaturation and captured using streptavidin beads (Figure 2(D)). Then, the template single-stranded DNA 6 is hybridized with extension primer 11 containing the adapter sequence necessary for next-generation sequencing (NGS) (Figure 2(E)).
[0028] In some embodiments, the extension primer 11 has a sequence consisting of 5′GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3′ (SEQ ID NO: 24). The extension primer 11 contains a complementary sequence of the first adapter sequence 4 at its 3′ end. In the sequence of the extension primer 11, the phosphate binding site of 5′CGATCT 3′ is a phosphorothioate bond. This configuration suppresses degradation.
[0029] Next, optionally, the 3′ end of the template single-stranded DNA 6 may be captured with a solid support such as a magnetic bead 10. The magnetic bead 10 is, for example, a magnetic bead covalently bonded to a streptavidin molecule, but is not limited to this.
[0030] Next, the single-stranded DNA synthesis method described above includes a double-stranding step (Figure 2(F)) in which the extension primer 11 in the aggregate (Figure 2(E)) obtained in the aggregate formation step is extended using a DNA polymerase such as a Klenow fragment, with the template single-stranded DNA 6 as a template, to form double-stranded DNA 12.
[0031] Next, the single-stranded DNA synthesis method described above uses a double-stranded DNA composed of a double-stranded DNA 12 obtained in the double-stranding step, a single-stranded DNA 14 having a complementary sequence 13 of the second adapter sequence 16, and a single-stranded DNA 17 containing the second adapter sequence 16 with the 3′ end of the second adapter sequence modified by dideoxy. Using T4 DNA ligase, the single-stranded DNA containing the extension primer 11 from the single-stranded DNA 12 obtained in the double-stranding step and the single-stranded DNA 14 having the complementary sequence 13 of the second adapter sequence 16 are ligated (Figure 2(G)), and the complementary strand of the original DNA barcode is eluted by thermal denaturation. This synthesizes a readable single-stranded DNA 20 that can be amplified by PCR, and a library of single-stranded DNA barcodes is constructed (Figure 2(H)).
[0032] Next, the method for synthesizing single-stranded DNA includes a purification step for purifying the single-stranded DNA 20 synthesized in the read DNA synthesis step.
[0033] The single-stranded DNA 20 has, in order from the 5′ end, an extension primer 11, a complementary sequence 18 of DNA barcode 1, a complementary sequence 19 of linker sequence 2, and a complementary sequence 13 of a second adapter sequence. Within the single-stranded DNA 20 are primer sequences for PCR. Linker sequence 2 is ligated to the 3′ side of the second adapter sequence 16, and this sequence constitutes a sequence that enables amplification of DNA barcode 1 by PCR, as well as identification and reading of DNA barcode 1. Sequence analysis becomes possible by amplifying the single-stranded DNA 20 by PCR.
[0034] This disclosure provides the use of single-stranded DNA in sequencing analysis for analyzing a DNA barcode of template DNA containing a DNA barcode, without primer sequences for amplification by PCR, wherein the single-stranded DNA has, in order from the 5′ end, a first adapter sequence, a complementary sequence of the DNA barcode, and a second adapter sequence. The sequencing analysis is preferably sequencing by a sequencer, more preferably next-generation sequencing (NGS) or Sanger sequencing.
[0035] In a particular embodiment, the template DNA has, in order from the 5′ end, a second adapter sequence, a linker sequence, a DNA barcode sequence, and a first adapter sequence, and the single-stranded DNA has, in order from the 5′ end, a complementary sequence to the first adapter sequence, a complementary sequence to the DNA barcode, a complementary sequence to the linker sequence, and a complementary sequence to the second adapter sequence.
[0036] The disclosure further provides a DNA complex comprising a template DNA having, in order from the 5′ end, a second adapter sequence, a DNA barcode sequence, and a first adapter sequence, and a single-stranded DNA having, in order from the 5′ end, a complementary sequence to the first adapter sequence, a complementary sequence to the DNA barcode, and a complementary sequence to the second adapter sequence.
[0037] In a particular embodiment, the DNA complex has, in order from the 5′ end, a template DNA, a second adapter sequence, a linker sequence, a DNA barcode sequence, and a first adapter sequence, and the single-stranded DNA has, in order from the 5′ end, a complementary sequence to the first adapter sequence, a complementary sequence to the DNA barcode, a complementary sequence to the linker sequence, and a complementary sequence to the second adapter sequence.
[0038] This disclosure also provides a method for reading DNA barcode sequences with a sequencer.
[0039] The method for reading the DNA barcode sequence includes a single-stranded DNA synthesis step of obtaining a single-stranded DNA 20 having, in order from the 5′-end side, an extension primer 11 (including the complementary sequence 7 of the first adapter sequence 4), the complementary sequence 18 of the DNA barcode 1, the complementary sequence 19 of the linker sequence 2 for sequencer reading, and the complementary sequence 13 of the second adapter sequence 16 by the method for synthesizing single-stranded DNA according to any one of the above (Figs. 2(G), 2(H)).
[0040] Next, the method for reading the DNA barcode sequence includes an index sequence addition step of obtaining a double-stranded DNA 25 for sequencer reading by adding index sequences 23, 24 to both ends of the single-stranded DNA 20 by PCR amplification of the single-stranded DNA 20 obtained in the single-stranded DNA synthesis step using primers 21, 22 having index sequences (Fig. 2(I)).
[0041] Next, the method for reading the DNA barcode sequence includes a sequence analysis step of analyzing the double-stranded DNA 25 for reading obtained in the index sequence addition step with a sequencer to read the DNA barcode sequence 1.
[0042] In the embodiments shown in Figs. 2(A) to (I), a linker sequence 2, which is a sequence for reading by a next-generation sequencer, is added to the 5′-end of the DNA barcode sequence 1, but the linker sequence 2 may be omitted. For example, in the case of Sanger sequencing, the linker sequence 2 is unnecessary.
[0043] By using the single-stranded DNA synthesis method disclosed herein, it is possible to omit the primer sequences required for PCR amplification when constructing DNA barcodes in DEL. This makes it possible to shorten the length of the DNA barcode compared to conventional methods. Generally, the longer the length of the DNA barcode, the higher the risk of DNA damage and mistranslation, so the technology of the present invention helps to solve such major problems in DEL. It is also possible to use the sequences that would have been used for the primers to correspond to new building blocks. In addition, the present invention is not limited to DEL constructed using conventional methods such as DNA annealing and ligation, but is particularly applicable to cases where DNA barcodes are constructed by chemical synthesis. Chemical synthesis of DNA is generally considered to have lower synthesis efficiency and accuracy as the sequence length increases. On the other hand, since chemical synthesis of DNA generally synthesizes DNA one base at a time, it is possible to shorten the length of the DNA barcode significantly compared to conventional methods using annealing and ligation. Based on the above, the present invention will be extremely powerful in the analysis of DNA barcodes where such "shortness" is a key point.
[0044] The single-stranded DNA synthesized by the single-stranded DNA synthesis method disclosed herein, which is amplified by PCR, can be applied to the analysis of DNA barcodes. For such analysis, a sequencer, preferably a next-generation sequencer (NGS), a nanopore sequencer, or a Sanger sequencer can be used to read the DNA barcode sequence. In DNA barcode analysis, the accuracy of the barcode is crucial. Generally, the longer the sequence, the more susceptible DNA damage and mistranslation become, affecting the analysis results. In particular, in DNA-derived elucidates (DELs), DNA barcodes tend to be unnecessarily long, and since chemical reactions are carried out in the presence of DNA, the damage is significant. Therefore, by applying the present invention, it is possible to shorten the DNA barcode as much as possible, making it possible to achieve greater diversity at the same length as conventional methods, and further suppressing DNA damage and mistranslation.
[0045] Example 1 1. Preparation of Primerless Short Single-Stranded DNA (ssDNA) Template In this example, the amplification of the actually designed primerless short single-stranded DNA barcode was carried out. The designed single-stranded DNA is a nucleotide containing 5 bases of 5´-GATCT-, which is an NGS linker, and a repeat sequence of CAGT. This single-stranded DNA was chemically synthesized or purchased from a supplier.
[0046] 2. Amplification of ssDNA The ssDNA amplification was carried out with the following modifications based on the report by Meyer et al. (Nat. Protoc., 2020, 15, 2279-2300., hereinafter referred to as the reference paper).
[0047] 2-1. Preparation of Oligonucleotides for ssDNA Amplification The sequences described in Table 1 below and Table 1 on page 2284 of the reference paper were used.
[0048]
[0049] For DNA 17 (Figure 2(G)), Control Seq., qPCR probe, and primers, those with HPLC-purified purity were used. The P5 index primer and the P7 index primer are not limited to this sequence, and sequences containing indexes specified by general sequence analysis providers may also be used. The same applies to Sanger sequencing and nanopore sequencing, and the sequences can be changed according to the experimental purpose.
[0050] For other reagents, those described in Table 2 below were used.
[0051] Other reagents were also purchased from general suppliers and used. Also, various buffers were prepared using nuclease-free water (NFW).
[0052] According to the reference paper, the reagents described in Table 1 and Table 2 were used, and the reagents were adjusted as follows.
[0053] Hybridization of DNA 4 (Figure 2(B)) and DNA 8 (Figure 2(B)) (double-stranded DNA-a): 30 μL of a mixed solution of 3 μL of reagent No. 1, 6 μL of 100 μM DNA 4 (Figure 2(B)), 1.5 μL of reagent No. 3 (10 U / μL), 1.5 μL of reagent No. 4 (10 U / μL), and 18 μL of NFW was mixed with 30 μL of a mixed solution of 3 μL of reagent No. 1, 12 μL of 100 μM DNA 8 (Figure 2(B)), 1.5 μL of reagent No. 3 (10 U / μL), 1.5 μL of reagent No. 4 (10 U / μL), and 12 μL of NFW. 60 μL of this mixed solution was incubated at 37 °C for 20 minutes, and then incubated at 95 °C for 1 minute. Next, this mixed solution was incubated at 95°C for 10 seconds, and then gradually cooled to 10°C at a rate of 0.5°C / s.
[0054] Hybridization of DNA 14 (Figure 2(G)) and DNA 17 (Figure 2(G)) (double-stranded DNA-b): 9.5 μL of TE buffer, 0.5 μL of 5M NaCl, 20 μL of DNA 14 (Figure 2(G)), and 20 μL of DNA 17 (Figure 2(G)) were mixed. This mixture was then incubated at 95 °C for 10 seconds, followed by gradual cooling to 14 °C at a rate of 0.1 °C / s. 50 μL of TE buffer was then added. Wash buffer-1: 0.1 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), 0.5% SDS (w / v), 0.05% Tween20 (v / v) Preparation of Wash buffer-2: 0.1 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0),0.05% Tween20 (v / v) Wash buffer-3 preparation: 0.1% SDS (w / v), 0.1x SSC buffer
[0055] 2-2. The experiment followed Step 1-42 of the procedure section described on pages 2290-2294 of the reference paper. The following modifications were made:
[0056] A. The experiment was conducted using the DNA sequence prepared in "1. Preparation of primerless short single-stranded DNA (ssDNA) templates". As described, single-stranded DNA chemically synthesized in-house was also used without any special purification procedures.
[0057] B. Fast AP (1 U μl) in the master mix as described in Step 2 on page 2290 of the reference paper. -1 ) was not used; NFW was used instead.
[0058] C. Assay B is not essential for the quantification of the ssDNA library in Steps 32-37 described on page 2293 of the reference. Therefore, a single concentration (10) is used for the qPCR standard in Assay B without preparing a dilution series. 8 The experiment was conducted using only copies, and then qualitatively evaluated.
[0059] D. The qPCR standard has 10 8 A dilution series was created using a maximum dilution of 10 times, with the copy being the most common.
[0060] E. The qPCR machine used is different from the one described in the reference paper (Applied Biosystems, StepOne). TM Since ) was used, the procedure was carried out by adding Rox solution according to the Maxima probe qPCR master mix protocol.
[0061] F. In the indexing PCR described in Steps 38-42 on pages 2293-2294 of the reference, care was taken to ensure that the number of PCR cycles did not exceed 30, and the conditions were adjusted as appropriate according to the condition of the sample.
[0062] Single-stranded DNA was amplified according to the instructions on pages 2293-2294, taking into account the above modifications. The experimental procedure is briefly described below. Using 30 μL of amplification single-stranded DNA3 (Figure 2(A)) solution dissolved in TET buffer and various reagents, 45.6 μL of a mixed solution containing DNA3, final concentration 1.75xT4 RNA ligation buffer, 0.09% Tween20, 0.22 pM Control seq. was prepared. Next, this mixed solution was incubated at 37 °C for 10 minutes and at 95 °C for 2 minutes, and then cooled to 4 °C.
[0063] To this mixed solution, 32 μL of PEG8,000, 0.4 μL of reagent No. 2, 1 μL of double-stranded DNA-a, and 1 μL of reagent No. 5 were added to prepare an 80 μL mixed solution. This solution was then gently shaken at room temperature for 15 minutes, incubated at 37 °C for 1 hour and 95 °C for 2 minutes, and cooled to 10 °C. Approximately 20 μL of Dynabeads (hereinafter referred to as magnetic beads) were washed twice with 500 μL of Wash buffer-1, then mixed with 200 μL of Wash buffer-1 and the aforementioned 80 μL mixed solution, and incubated at room temperature for 20 minutes. The magnetic beads were washed as follows: The solution was removed from the suspension and washed again with 200 μL of Wash buffer-1. Next, 100 μL of Wash buffer-2 was added and the beads were suspended, then incubated at 45 °C for 3 minutes. The solution was then removed and resuspended in 200 μL of Wash buffer-3. A magnetic rack was used as appropriate for washing the magnetic beads.
[0064] The solution was removed from 200 μL of the bead suspension and resuspended in 50 μL of 1x Klenow reaction buffer, 200 μM reagent 8, 0.05% Tween20 (v / v), 2 μM DNA11 (Figure 2(E)), and 0.4 U / μL of Klenow fragment solution. This suspension was shaken at 35 °C for 20 minutes. Subsequently, the magnetic beads were washed as described above. The solution was removed from 200 μL of the bead suspension and the beads were resuspended in 100 μL of 1x T4 DNA ligase, 5% PEG4,000 (w / v), 0.05% Tween20 (v / v), 2 μM double-stranded DNA-b, and 0.1 U / μL of T4 DNA ligase solution. This suspension was incubated at approximately 22-25 °C for 1 hour with vigorous shaking. Subsequently, the magnetic beads were washed as described above. The solution was removed from 200 μL of bead suspension and resuspended in 50 μM TET buffer. The mixture was then incubated at 95 °C for 1 minute and cooled to 25 °C. Subsequently, qPCR and indexing PCR were performed using this single-stranded DNA solution.
[0065] qPCR was performed using the single-stranded DNA solution diluted 50-fold with TET buffer. Assay A was performed using 0.2 μM Fw qPCR primer, 0.2 μM Rv qPCR primer 1, and 0.2 μM qPCR probe 1. Assay B was performed using 0.2 μM Fw qPCR primer, 0.2 μM Rv qPCR primer 2, and 0.2 μM qPCR probe 2. The PCR conditions were: incubation at 95 °C for 10 minutes, followed by 45 cycles of incubation at 95 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 30 seconds, with fluorescence measured at the end of each annealing cycle.
[0066] For indexing PCR, the samples were incubated at 95°C for 2 minutes, followed by incubation at 95°C for 20 seconds, 60°C for 30 seconds, and 68°C for 1 minute, repeating this cycle for a number of cycles determined by the qPCR results. Finally, the samples were incubated at 68°C for 5 minutes. After that, spin column purification was performed, and the PCR products were confirmed by electrophoresis. The above series of procedures was carried out by increasing the amount of reagents as appropriate according to the number of samples.
[0067] 3. PCR amplification pattern of single-stranded DNA 1 ssDNA amplification was performed using the following sequence purchased from a standard oligonucleotide manufacturer, and the PCR product was confirmed by capillary electrophoresis.
[0068] DNA sequence 1: 5′-GATCTCAGTCAGTCAGTCAGTCAGT-3′ (Sequence ID 18) DNA sequence 2: 5′-GATCTCAGTCAGTCAGTCAGTCAGTT-3′ (Sequence ID 19)
[0069] Pattern 2: The following sequence, purchased from a standard oligonucleotide manufacturer, was cleaved in liquid phase with endonuclease V, followed by ssDNA amplification. The PCR product was then confirmed by capillary electrophoresis. The second term from the 3′ end of the following DNA sequence is inosine.
[0070] DNA sequence 3: 5′-N6-FAM 3′ (FAM modification at the end of 3) N6 is GATCTCAGTCAGTCAGTCAGTIT (Sequence ID 20)
[0071] The following sequence was used for the qPCR standard: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTN 20 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3′ (Sequence ID 21) N, any of G, A, C or T. PCR primers for Index PCR were purchased from an external sequencing service. PCR amplification products were analyzed using Bioanalyzer 2100. NGS analysis using MiSeq was performed by an external sequencing service (Bioengineering Lab. Co., Ltd.).
[0072] As a result, we successfully amplified 25 nt single-stranded DNA, and electrophoresis results using Bioanalyzer 2100 revealed that the target sequence could be amplified with very high accuracy (Figure 3).
[0073] 1...DNA barcode sequence, 2...linker sequence, 3...single-stranded DNA consisting of a base sequence with a linker sequence attached to the 5′ end of the DNA barcode sequence, 4...first adapter sequence, 8...complementary sequence of the first adapter sequence, 11...extension primer, 12...double-stranded DNA, 13...complementary sequence of the second adapter sequence, 14...single-stranded DNA having the complementary sequence of the second adapter sequence, 16...second adapter sequence, 18...complementary sequence of the DNA barcode, 19...complementary sequence of the linker sequence, 20...single-stranded DNA that can be amplified by PCR.
Claims
1. A method for synthesizing single-stranded DNA that enables base sequence analysis of a single-stranded DNA sequence that does not contain a primer sequence for amplification by PCR, comprising: a double-stranding step of obtaining double-stranded DNA using DNA polymerase, with a template single-stranded DNA having a base sequence in which a first adapter sequence is attached to the 3′ end of a DNA barcode sequence as a template; and a read-only DNA synthesis step of synthesizing single-stranded DNA that can be amplified by PCR, by using double-stranded DNA composed of a single-stranded DNA having a complementary sequence to a second adapter sequence and a single-stranded DNA containing a second adapter sequence and having a dideoxy-modified 3′ end, and linking the single-stranded DNA having a complementary sequence to the first adapter sequence and the single-stranded DNA having a complementary sequence to the second adapter sequence from the single-stranded DNA constituting the double-stranded DNA obtained in the double-stranding step using T4 DNA ligase. A method for synthesizing single-stranded DNA, wherein the single-stranded DNA that can be amplified by PCR is a single-stranded DNA having, in order from the 5′ end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, and a complementary sequence of the second adapter sequence.
2. A method for synthesizing single-stranded DNA according to claim 1, wherein a linker sequence is added to the 5′ end of a DNA barcode sequence, and in the reading DNA synthesis step, the linker sequence is ligated to the 3′ side of the second adapter sequence, and the PCR-amplified single-stranded DNA is a single-stranded DNA having, in order from the 5′ end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, a complementary sequence of the linker sequence, and a complementary sequence of the second adapter sequence.
3. A method for synthesizing single-stranded DNA that enables base sequence analysis of a single-stranded DNA sequence that does not contain a primer sequence for amplification by PCR, comprising: a nucleic acid preparation step of preparing single-stranded DNA containing a DNA barcode sequence; a first ligation step of ligating the single-stranded DNA with a single-stranded DNA having a first adapter sequence at its 3' end after the nucleic acid preparation step to obtain a template single-stranded DNA having a base sequence in which the first adapter sequence is attached to the 3' end of the DNA barcode sequence; an aggregate formation step of hybridizing the template single-stranded DNA obtained in the first ligation step with an extension primer which is a single-stranded DNA having a complementary sequence of the first adapter sequence at its 3' end to form an aggregate; and a double-stranding step of converting the aggregate into double-stranded DNA using DNA polymerase from the extension primer in the aggregate obtained in the aggregate formation step, using the template single-stranded DNA as a template. A method for synthesizing single-stranded DNA, comprising: a read-only DNA synthesis step, in which a single-stranded DNA composed of double-stranded DNA obtained in the double-stranding step, a single-stranded DNA having a complementary sequence of the second adapter sequence, and a single-stranded DNA containing the second adapter sequence and having a dideoxy-modified 3′ end is used to synthesize single-stranded DNA that can be amplified by PCR by using T4 DNA ligase; and a purification step, in which the single-stranded DNA synthesized in the read-only DNA synthesis step that can be amplified by PCR is purified, wherein the single-stranded DNA that can be amplified by PCR is a single-stranded DNA having, in order from the 5′ end, the complementary sequence of the first adapter sequence, the complementary sequence of the DNA barcode, and the complementary sequence of the second adapter sequence.
4. In the nucleic acid preparation step, the single-stranded DNA containing the DNA barcode sequence is a single-stranded DNA consisting of a base sequence in which a linker sequence is attached to the 5′ end of the DNA barcode sequence; in the read DNA synthesis step, the linker sequence is ligated to the 3′ side of the second adapter sequence; and the PCR-amplified single-stranded DNA is a single-stranded DNA having, in order from the 5′ end, the complementary sequence of the first adapter sequence, the complementary sequence of the DNA barcode, the complementary sequence of the linker sequence, and the complementary sequence of the second adapter sequence; the method for synthesizing single-stranded DNA according to claim 3.
5. A method for synthesizing single-stranded DNA according to any one of claims 1 to 4, wherein the number of bases in the DNA barcode sequence is 10 bases or more and 55 bases or less.
6. The method for synthesizing single-stranded DNA according to claim 2 or 4, wherein the linker sequence added to the 5′ end of the DNA barcode sequence is 1 to 10 nucleotides long.
7. The method for synthesizing single-stranded DNA according to claim 2 or 4, wherein the linker sequence added to the 5′ end of the DNA barcode sequence consists of 1 to 10 bases including the 3′ end of the base sequence consisting of 5′CTTCCGATCT 3′ (SEQ ID NO: 22).
8. The method for synthesizing single-stranded DNA according to claim 7, wherein the linker sequence added to the 5′ end of the DNA barcode sequence is a sequence consisting of 5′GATCT3′.
9. A method for synthesizing single-stranded DNA according to any one of claims 1 to 4, wherein the first adapter sequence is a sequence consisting of AGATCGGAAG (SEQ ID NO: 23), the single-stranded DNA having the complementary sequence of the second adapter sequence is a sequence consisting of 5′GGAAGAGCGTCGTGTAGGGAAAGAGTGTA 3′ (SEQ ID NO: 5), and a phosphate group is labeled at the 5′ end of the single-stranded DNA having the complementary sequence of the second adapter sequence.
10. The method for synthesizing single-stranded DNA according to any one of claims 3 or 4, wherein the extension primer is a sequence consisting of 5′GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3′ (SEQ ID NO: 24), and the phosphate-binding site of 5′CGATCT 3′ in the sequence is a phosphorothioate bond.
11. The method for synthesizing single-stranded DNA according to claim 3 or 4, wherein in the first ligation step, a single-stranded DNA having a base sequence in which a random region consisting of eight or more random bases is added to the 3′ end of a base sequence complementary to the region including the 5′ end of the single-stranded DNA having the first adapter sequence is used as a template to ligate the single-stranded DNA with the single-stranded DNA having the first adapter sequence.
12. A method for synthesizing single-stranded DNA according to any one of claims 1 to 4, wherein the base sequence analysis is next-generation sequencing (NGS), nanopore sequencing, or Sanger sequencing.
13. The method for synthesizing single-stranded DNA according to claim 2 or 4, wherein the base sequence analysis is next-generation sequencing (NGS), and the base sequence in which the linker sequence is ligated to the 3' side of the second adapter sequence constitutes the NGS read sequence.
14. Use of single-stranded DNA in sequencing analysis for analyzing DNA barcodes of template DNA containing DNA barcodes but not containing primer sequences for amplification by PCR, wherein the single-stranded DNA has, in order from the 5′ end, a complementary sequence of a first adapter sequence, a complementary sequence of the DNA barcode, and a complementary sequence of a second adapter sequence.
15. The use according to claim 14, wherein the template DNA has, in order from the 5' end, a linker sequence and the DNA barcode sequence, and the single-stranded DNA has, in order from the 5' end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, a complementary sequence of the linker sequence, and a complementary sequence of the second adapter sequence.
16. A method for reading a DNA barcode sequence with a sequencer, comprising: a single-stranded DNA synthesis step of obtaining single-stranded DNA having, in order from the 5' end, a complementary sequence of the first adapter sequence, a complementary sequence of the DNA barcode, and a complementary sequence of the second adapter sequence, by the single-stranded DNA synthesis method described in any one of claims 1 to 12; an index sequence addition step of obtaining double-stranded DNA by adding the index sequence to both ends of the single-stranded DNA by PCR amplification of the single-stranded DNA obtained in the single-stranded DNA synthesis step using a primer having an index sequence; and a sequence analysis step of analyzing the double-stranded DNA obtained in the index sequence addition step with a sequencer and reading the DNA barcode sequence.
Citation Information
Patent Citations
Improved methods for processing dna substrates
JP2017504360A
High-throughput polynucleotide library sequencing and transcriptome analysis methods
JP2020523034A
Methods and compositions for analyzing nucleic acids
JP2022528139A
Oligonucleotide-linked triphosphate nucleotides useful for labeling nucleic acids for preparing next-generation sequencing libraries
JP2022537069A
Methods of Preparing Dual-Indexed DNA Libraries for Bisulfite Conversion Sequencing
US20180044731A1