Composition and method for promoting plant regeneration from protoplasts

A gene combination enhances protoplast regeneration efficiency by promoting microcallus formation and plant reprogramming, addressing low regeneration rates and complex mechanisms, thereby improving genome editing tools for agricultural productivity.

WO2026059191A1PCT designated stage Publication Date: 2026-03-19SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/013311
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-12
Filing Date
2025-08-29
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

The low regeneration rates and complex molecular mechanisms of protoplast regeneration in plants, particularly in Arabidopsis mesophyll protoplasts, limit the widespread application of genome editing tools in plant biotechnology, posing a bottleneck for agricultural productivity improvements.

Method used

A gene combination comprising SCR, ESR1, WOX5, BBM, ERF115, PSK5, LBD16, LBD29, PAT1, and PLT7 is introduced into protoplasts to enhance microcallus formation and plant regeneration, ensuring the transient expression of the gene does not persist in the regenerated plant tissue.

Benefits of technology

The gene combination significantly increases plant regeneration efficiency and shortens the regeneration time, maintaining desired effects without the transformed gene being present in the final plant, facilitating advancements in plant and agricultural biotechnology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025013311_19032026_PF_FP_ABST
    Figure KR2025013311_19032026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a gene combination capable of promoting plant regeneration or reprogramming. By transiently expressing the gene combination in plant cells through transformation, the efficiency of plant regeneration can be improved and the time required for regeneration can be reduced while the transformed genes are not present in the finally regenerated plants.
Need to check novelty before this filing date? Find Prior Art

Description

Composition and method for promoting plant regeneration from protoplasts

[0001] The present invention relates to a composition capable of promoting the development of microcalli from a protoplast and also promoting regeneration into a whole plant therefrom, and a method for regenerating a whole plant from a protoplast using said composition.

[0002] [Research and development projects that supported this invention]

[0003] [Project No.] SSTF-BA2001-10

[0004] [Specialized Research Management Agency] Samsung Future Technology Foundation

[0005] [Research Project Name] Private Sector Support Project (Samsung Future Technology Development Project)

[0006] [Project Title] [SSTF-BA2001-10] Regulation of Plant Cell Orthogonality by Cell Division Activity

[0007] [Principal Research Institution] Seoul National University

[0008] [Research Period] 2020.08.01-2025.07.31

[0009] [Research and development projects that supported this invention]

[0010] [Project ID] 2710080837

[0011] [Project No.] NR060084

[0012] [Ministry Name] Ministry of Science and ICT

[0013] [Name of Project Management (Specialized) Agency] National Research Foundation of Korea

[0014] [Research Project Name] Leading Research Center (SRC)

[0015] [Research Project Title] Plant Plasticity Research Center

[0016] [Name of Project Performing Organization] Seoul National University

[0017] [Research Period] 2025.03.01 ~ 2026.02.28

[0018] One of the most fundamental questions in biology is elucidating the complex mechanisms that reprogram differentiated somatic cells into a pluripotent or pluripotent state. Plants possess remarkable reprogramming potential, allowing them to regenerate organs or entire plants from various sources, such as tissues or individual cells. Over the past century, research has expanded Haverland’s concept of pluripotency to support the hypothesis that specialized plant cells retain the ability to differentiate into various cell types. This principle remains central to plant research, holding broad significance in the fields of agriculture and biotechnology. Protoplasts are crucial tools for studying genetic engineering and intracellular processes because they can reconstruct cell walls and divide. While mature mesophyll cells generally have limited division and regeneration capabilities, mesophyll protoplasts can reconstruct cell walls, restart the cell cycle, generate calluses, and initiate the regeneration process. Although Arabidopsis mesophyll protoplasts can divide and form microcalluses in gel-based media, they present a problem with significantly low regeneration rates. Although regeneration (redifferentiation) protocols from various protoplasts have been developed for several plant species, including Arabidopsis, challenges such as low stem regeneration rates still remain. This is considered a technical obstacle specific to protoplast regeneration compared to explant-based regeneration. Furthermore, the complex molecular mechanisms coordinating cell fate transitions during protoplast regeneration have not yet been clearly elucidated.

[0019] Despite these limitations, protoplast regeneration technology is widely used in various genetic modification studies in plants, such as genetic modification and genome editing, although the success rate remains limited. Therefore, the protoplast regeneration process remains a key bottleneck limiting the widespread application of genome editing tools in plant biotechnology, and resolving this bottleneck could enable improvements in agricultural productivity.

[0020] As a result of diligent efforts, the inventors have arrived at the present invention by developing a technology that significantly increases the efficiency of plant regeneration from plant protoplasts, shortens the regeneration time, and further ensures that the gene used for the transient transfection of the protoplast no longer remains in the regenerated plant tissue or the entire plant. It is expected that this invention, combined with various application strategies including genome editing, will bring innovation across plant and agricultural biotechnology.

[0021] One objective of the present invention is to provide a composition that can promote the development of microcallus from protoplasts, promote plant regeneration, and also induce reprogramming into pluripotent cells.

[0022] Another objective of the present invention is to provide a method for forming microcallus from a protoplast or regenerating plant tissue or an entire plant using the above composition.

[0023] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below.

[0024] As a result of diligent efforts, the inventors of the present invention have arrived at the present invention by discovering a gene combination that, when transformed to be expressed in a protoplast, specifically enhances the developmental efficiency of microcalluses from the protoplast and significantly improves the plant regeneration efficiency from the microcalluses thus developed. Additionally, the inventors confirmed that by causing the said gene combination to be temporarily expressed in the protoplast, the aforementioned effects are maintained, while the transformed gene is not present or expressed in the final regenerated plant.

[0025] According to one embodiment of the present invention, the invention relates to a gene construct for promoting the development of microcalli, plant regeneration, or plant reprogramming from a protoplast, comprising the following gene combination.

[0026] The gene combination of the present invention may be a combination of at least two of the genes listed below:

[0027] SCR (SCARECROW), ESR1 (ENHANCER OF SHOOT REGENERATION 1), WOX5 (WUSCHEL RELATED HOMEOBOX 5), BBM (BABY BOOM), ERF115 (ETHYLENE RESPONSE FACTOR 115), PSK5 (PHYTOSULFOKINE 5 PRECURSOR), LBD16 (LATERAL ORGAN BOUNDARIES) DOMAIN 16), LBD29 (LATERAL ORGAN BOUNDARIES DOMAIN 29), WIND1 (WOUND INDUCED DEDIFFERENTIATION 1), PAT1 (PHYTOCHROME A SIGNAL TRANSDUCTION 1), PLT3 (PLETHORA 3) and PLT7 (PLETHORA 7)

[0028] In the present invention, the gene combination may be selected from the following:

[0029] 1) A gene combination comprising two or more genes selected from the group consisting of SCR, ESR1, WOX5, PSK5, BBM, and PLT3; or

[0030] 2) A gene combination comprising one or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, and PLT3, and additionally comprising one or more genes selected from the group consisting of ERF115, PSK5, LBD16, LBD29, WIND1, PAT1, and PLT7.

[0031] In the present invention, the gene combination may include two or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, ERF115, PSK5, LBD16, LBD29, PAT1, and PLT7.

[0032] In the present invention, the gene combination may include two or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, PSK5, LBD16, LBD29, PAT1, and PLT7.

[0033] In the present invention, the gene combination may include two or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, PSK5, LBD16, and LBD29, and may include two genes as an example.

[0034] In the present invention, the gene combination may include three or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, PSK5, LBD16, and LBD29, and may include three genes as an example.

[0035] In the present invention, the gene combination may include four or more genes selected from the group consisting of SCR, ESR1, WOX5, BBM, PSK5, LBD16, and LBD29, and as an example, may include four genes.

[0036] In the present invention, the gene combination may be selected from the following:

[0037] 1) A gene combination comprising two or more genes selected from the group consisting of SCR, WOX5, and PSK5; or

[0038] 2) A gene combination comprising one or more genes selected from the group consisting of SCR, WOX5, and PSK5, and additionally comprising one or more genes selected from the group consisting of ESR1, BBM, LBD16, and LBD29.

[0039] In the present invention, preferably, the gene combination comprises at least one gene among ESR1 and PSK5, and may include one or more genes selected from the group consisting of SCR, BBM, PAT1, WOX5 and LBD16.

[0040] In the present invention, preferably, the gene combination comprises at least one gene among ESR1 and PSK5, and may include one or more genes selected from the group consisting of SCR, WOX5 and LBD16.

[0041] In the present invention, the gene combination may be a gene combination selected from the group below, but is not limited thereto:

[0042] SCR and BBM;

[0043] SCR and ESR1;

[0044] SCR and ERF115;

[0045] SCR and PSK5;

[0046] WOX5 and LBD29;

[0047] BBM and ERF115;

[0048] ESR1 and WIND1;

[0049] BBM and LBD29;

[0050] BBM and PSK5;

[0051] SCR and LBD16;

[0052] SCR and PAT1;

[0053] WOX5 and LBD16;

[0054] WOX5 and PSK5;

[0055] WOX5 and ERF115;

[0056] ESR1 and PSK1;

[0057] ESR1 and PLT7;

[0058] PLT3 and PSK5;

[0059] WOX5 and PAT1;

[0060] SCR, ESR1 and PSK5;

[0061] SCR, ESR1 and PAT1;

[0062] ESR1, PSK5, and WOX5;

[0063] PSK5, WOX5, and LBD16;

[0064] SCR, ESR1, PSK5 and WOX5.

[0065] In the present invention, the gene combination may be a gene combination selected from the group below, but is not limited thereto:

[0066] SCR and BBM;

[0067] SCR and ERF115;

[0068] SCR and PSK5;

[0069] WOX5 and LBD29;

[0070] BBM and ERF115;

[0071] SCR and LBD16;

[0072] WOX5 and LBD16;

[0073] WOX5 and PSK5;

[0074] ESR1 and PSK1;

[0075] ESR1 and PLT7;

[0076] SCR, ESR1 and PSK5;

[0077] SCR, ESR1 and PAT1;

[0078] ESR1, PSK5, and WOX5;

[0079] PSK5, WOX5, and LBD16;

[0080] SCR, ESR1, PSK5 and WOX5.

[0081] Preferably, in the present invention, the gene combination may be a gene combination selected from the group below, but is not limited thereto:

[0082] SCR and BBM;

[0083] SCR and PSK5;

[0084] WOX5 and LBD29;

[0085] SCR and LBD16;

[0086] WOX5 and LBD16;

[0087] WOX5 and PSK5;

[0088] ESR1 and PSK1;

[0089] SCR, ESR1 and PSK5;

[0090] ESR1, PSK5, and WOX5;

[0091] PSK5, WOX5, and LBD16;

[0092] SCR, ESR1, PSK5 and WOX5.

[0093] Preferably, in the present invention, the gene combination may be a gene combination selected from the group below, but is not limited thereto:

[0094] SCR, ESR1 and PSK5;

[0095] ESR1, PSK5, and WOX5;

[0096] PSK5, WOX5, and LBD16;

[0097] SCR, ESR1, PSK5 and WOX5.

[0098] Preferably, the gene combination of the present invention may include SCR, ESR1, and PSK5.

[0099] Preferably, the gene combination of the present invention may include SCR, ESR1, PSK5 and WOX5.

[0100] The gene(s) of the present invention may be of the same species as the host cell, or they may be of a different species. Regardless of origin, when the gene combination of the present invention is introduced into a host cell, desired effects such as the promotion of microcallus formation and plant regeneration can be obtained. Preferably, at least one of the genes in the gene combination may be of the same species as the host cell, or of the same genus, or of a closely related plant species to the host cell.

[0101] The above SCR (SCARECROW) gene may be an SCR (SCARECROW) gene derived from Arabidopsis thaliana. Additionally, the above SCR gene may have a Gene ID of AT3G54220. Additionally, the above SCR gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 1. Additionally, the protein encoded by the above SCR may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 2.

[0102] The above SCR (SCARECROW) gene may be an SCR (SCARECROW) gene derived from rice (Oryza sativa). Additionally, the above SCR gene may have a Gene ID of LOC_Os12g02870.1. Furthermore, the above SCR gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 3. Additionally, the protein encoded by the above SCR may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 4.

[0103] The above SCR (SCARECROW) gene may be an SCR (SCARECROW) gene derived from soybeans (Glycine max). Additionally, the above SCR gene may have a Gene ID of XP_003537749.1. Additionally, the above SCR gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 5. Additionally, the protein encoded by the above SCR may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 6.

[0104] The above SCR (SCARECROW) gene may be an SCR (SCARECROW) gene derived from soybeans (Glycine max). Additionally, the above SCR gene may have a Gene ID of XP_014621421.1. Additionally, the above SCR gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 7. Additionally, the protein encoded by the above SCR may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 8.

[0105] The above ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene may be an ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene derived from Arabidopsis thaliana. Additionally, the above ESR1 gene may have a Gene ID of AT1G12980. Furthermore, the above ESR1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 9. In addition, the protein encoded by the above ESR1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 10.

[0106] The above ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene may be an ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene derived from rice (Oryza sativa). Additionally, the above ESR1 gene may have a Gene ID of LOC_Os06g44750.1. Furthermore, the above ESR1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 11. In addition, the protein encoded by the above ESR1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 12.

[0107] The above ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene may be an ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene derived from soybeans (Glycine max). Additionally, the above ESR1 gene may have a Gene ID of XP_003519832.1. Furthermore, the above ESR1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 13. In addition, the protein encoded by the above ESR1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 14.

[0108] The above ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene may be an ESR1 (ENHANCER OF SHOOT REGENERATION 1) gene derived from soybeans (Glycine max). Additionally, the above ESR1 gene may have a Gene ID of XP_006573022.1. Furthermore, the above ESR1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 15. In addition, the protein encoding the above ESR1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 16.

[0109] The above PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene may be a PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene derived from Arabidopsis thaliana. Additionally, the above PSK5 gene may have Gene ID AT5G65870. Furthermore, the above PSK5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 17. In addition, the protein encoded by the above PSK5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 18.

[0110] The above PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene may be a PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene derived from rice (Oryza sativa). Additionally, the above PSK5 gene may have a Gene ID of LOC_Os11g35310.1. Furthermore, the above PSK5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 19. In addition, the protein encoded by the above PSK5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 20.

[0111] The above PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene may be a PSK5 (PHYTOSULFOKINE 5 PRECURSOR) gene derived from soybeans (Glycine max). Additionally, the above PSK5 gene may have a Gene ID of XP_003549999.1. Furthermore, the above PSK5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 21. In addition, the protein encoded by the above PSK5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 22.

[0112] The above WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene may be a WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene derived from Arabidopsis thaliana. Additionally, the above WOX5 gene may have a Gene ID of AT3G11260. Furthermore, the above WOX5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID NO. 23. In addition, the protein encoded by WOX5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 24.

[0113] The above WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene may be a WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene derived from rice (Oryza sativa). Additionally, the above WOX5 gene may have a Gene ID of LOC_Os01g63510.1. Furthermore, the above WOX5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 25. In addition, the protein encoded by WOX5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 26.

[0114] The above WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene may be a WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene derived from soybeans (Glycine max). Additionally, the above WOX5 gene may have a Gene ID of XP_003518406.1. Furthermore, the above WOX5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 27. In addition, the protein encoded by WOX5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 28.

[0115] The above WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene may be a WOX5 (WUSCHEL RELATED HOMEOBOX 5) gene derived from soybeans (Glycine max). Additionally, the above WOX5 gene may have a Gene ID of XP_003537483.1. Furthermore, the above WOX5 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 29. In addition, the protein encoded by WOX5 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 30.

[0116] The above LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene may be an LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene derived from Arabidopsis thaliana. Additionally, the above LBD16 gene may have a Gene ID of AT2G42430. Furthermore, the above LBD16 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 31. In addition, the protein encoded by LBD16 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 32.

[0117] The above LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene may be an LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene derived from rice (Oryza sativa). Additionally, the above LBD16 gene may have a Gene ID of LOC_Os08g44940.1. Furthermore, the above LBD16 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 33. In addition, the protein encoded by the above LBD16 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 34.

[0118] The above LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene may be an LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene derived from soybeans (Glycine max). Additionally, the above LBD16 gene may have a Gene ID of XP_003536930.1. Furthermore, the above LBD16 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 35. In addition, the protein encoded by LBD16 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 36.

[0119] The above LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene may be an LBD16 (LATERAL ORGAN BOUNDARIES DOMAIN 16) gene derived from soybeans (Glycine max). Additionally, the above LBD16 gene may have a Gene ID of XP_040870025.1. Furthermore, the above LBD16 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 37. In addition, the protein encoded by LBD16 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 38.

[0120] The above ERF115 (ETHYLENE RESPONSE FACTOR 115) gene may be an ERF115 (ETHYLENE RESPONSE FACTOR 115) gene derived from Arabidopsis thaliana. Additionally, the above ERF115 gene may have a Gene ID of AT5G07310. Furthermore, the above ERF115 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 39. In addition, the protein encoded by the above ERF115 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 40.

[0121] The above BBM (BABY BOOM) gene may be a BBM (BABY BOOM) gene derived from Arabidopsis thaliana. Additionally, the above BBM gene may have Gene ID AT5G17430. Additionally, the above BBM gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 41. Additionally, the protein encoding the above BBM may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 42.

[0122] The above LBD29 (LATERAL ORGAN BOUNDARIES DOMAIN 29) gene may be an LBD29 (LATERAL ORGAN BOUNDARIES DOMAIN 29) gene derived from Arabidopsis thaliana. Additionally, the above LBD29 gene may have a Gene ID of AT3G58190. Furthermore, the above LBD29 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 43. In addition, the protein encoded by LBD29 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 44.

[0123] The above WIND1 (WOUND INDUCED DEDIFFERENTIATION 1) gene may be a WIND1 (WOUND INDUCED DEDIFFERENTIATION 1) gene derived from Arabidopsis thaliana. Additionally, the above WIND1 gene may have a Gene ID of AT1G78080. Furthermore, the above WIND1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 45. In addition, the protein encoded by WIND1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 46.

[0124] The above PAT1 (PHYTOCHROME A SIGNAL TRANSDUCTION 1) gene may be a PAT1 (PHYTOCHROME A SIGNAL TRANSDUCTION 1) gene derived from Arabidopsis thaliana. Additionally, the above PAT1 gene may have a Gene ID of AT5G48150. Furthermore, the above PAT1 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence indicated by SEQ ID No. 47. In addition, the protein encoded by the above PAT1 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 48.

[0125] The above PLT3 (PLETHORA 3) gene may be a PLT3 (PLETHORA 3) gene derived from Arabidopsis thaliana. Additionally, the above PLT3 gene may have a Gene ID of AT5G10510. Additionally, the above PLT3 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 49. Additionally, the protein encoded by the above PLT3 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 50.

[0126] The above PLT7 (PLETHORA 7) gene may be a PLT7 (PLETHORA 7) gene derived from Arabidopsis thaliana. Additionally, the above PLT7 gene may have a Gene ID of AT5G65510. Additionally, the above PLT7 gene may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the nucleotide sequence represented by SEQ ID NO. 51. Additionally, the protein encoded by the above PLT7 may include a sequence having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the amino acid sequence represented by SEQ ID NO. 52.

[0127] As used herein, the term “percent (%) identity” may refer to the percentage of amino acid (or nucleic acid) residues of a candidate sequence equivalent to an amino acid (or nucleic acid) residue of a reference sequence after aligning the sequences and introducing a gap to achieve maximum percentage identity, if necessary (i.e., a gap may be introduced in one or both of the candidate and reference sequences for optimal alignment, and non-homologous sequences may be ignored for comparison purposes). Alignment to determine percentage identity may be achieved in various ways within the scope of the art using publicly available computer software, such as, for example, BLAST, ALIGN, or Megalign (DNASTAR) software. The percentage identity of two sequences may be calculated by using BLAST to align a test sequence with a comparison sequence, determining the number of amino acids or nucleotides in the aligned test sequence that are equivalent to an amino acid or nucleotide at the same position in the comparison sequence, and dividing the number of equivalent amino acids or nucleotides by the number of amino acids or nucleotides in the comparison sequence.

[0128] The above "protoplast" is a plant cell from which the cell wall has been removed, and can be obtained from various plant cells, such as parts of plants, tissues, or calluses, by removing the cell wall constituent material surrounding the protoplast using physical, mechanical, or enzymatic methods. The present invention includes all protoplasts derived from various plant species without limitation on the method of acquisition.

[0129] In the present invention, the species of the plant from which the protoplast is derived is not specifically limited and may include all plants in general. Here, the plant may be any of seed plants, ferns, and bryophytes. The seed plant may be angiosperm or gymnosperm. The angiosperm may be a monocotyledon or a dicotyledon. Additionally, the plant may be a herbaceous plant or a woody plant. Examples of monocotyledonous plants include the Orchidaceae family (e.g., Phalaenopsis, vanilla, etc.), the Poaceae family (e.g., rice, wheat, barley, rye, corn, millet, sorghum, sugarcane, etc.), the Papyrus family (e.g., papyrus), the Araceae family (e.g., taro), the Water Lily family (e.g., mulberry), the Liliaceae family (e.g., tulip), the Lycoris family (e.g., onion, leek, garlic, chives, etc.), the Asparagus family (e.g., asparagus), the Dioscoreaceae family (e.g., Chinese yam), and the Zingiberaceae family (e.g., ginger, ginger). Dicotyledonous plants include the Asteraceae (sunflower, lettuce, burdock, crown daisy, butterbur, etc.), Fabaceae (soybean, pea, adzuki bean, broad bean, peanut, etc.), Rubiaceae (coffee, etc.), Perillaceae (perilla, sesame, mint, etc.), Malvaceae (poinsettia, cassava, etc.), Malvaceae (cotton, okra, etc.), Apiaceae (carrot, parsley, celery, etc.), Brassicaceae (Arabidopsis thaliana, radish, rapeseed, komatsuna, Chinese cabbage, Chinese mustard greens, mustard greens, cauliflower, cabbage, broccoli, wasabi, radish, etc.), Rosaceae (strawberry, apple, pear, cherry blossom, plum, peach, etc.), Solanaceae (eggplant, tomato, chili pepper, tobacco, bell pepper, potato, etc.), Amaranthaceae (spinach, etc.), Suileneceae (suilene, water spinach, etc.), Hassaceae (has, etc.), Citrus family (tangerine, lemon, etc.), and Araliaceae (ground asparagus, Examples include Aralia elata, etc.), Convolvulaceae (sweet potato, etc.), Cucurbitaceae (watermelon, melon, cucumber, bitter melon, pumpkin, loofah, etc.), Vitaceae (grape, etc.), Sesameaceae (sesame, etc.), Dianthus (baby's breath, carnation, etc.), Violaceae (pansy, etc.), Primulaceae (cyclamen, etc.), Ranunculaceae (Ranunculus genus, etc.).

[0130] The aforementioned "plant regeneration," also known as plant redifferentiation, is the process of growing an entire plant from a small piece of a plant cell, tissue, or organ, and is generally achieved through organogenesis or somatic embryogenesis.

[0131] The above "plant reprogramming" includes converting mature cells back into undifferentiated cells or redifferentiating already differentiated cells into other types of cells. The present invention includes transforming a protoplast with the aforementioned gene combination to redifferentiate the protoplast into pluripotent cells. Here, the pluripotent cells may have increased expression of the SCR or WOX5 gene compared to wild-type control cells.

[0132] The term "gene construct" above refers to a DNA fragment designed to be introduced into a plant cell, particularly a protoplast, into which the gene combination of the present invention is intended. The gene construct of the present invention may be a single polynucleotide fragment containing multiple genes, or it encompasses multiple polynucleotide fragments containing one or more genes. Furthermore, the present invention is not intended to limit the gene construct to a nucleotide structure containing DNA, and those skilled in the art will understand that nucleotide structures, particularly polynucleotides and oligonucleotides composed of combinations of ribonucleotides and deoxyribonucleotides, may also be used in the methods disclosed herein. The nucleotide structures, nucleic acids, and nucleotide sequences of the Examples also include all complementary forms of such structures, molecules, and sequences. Moreover, the nucleotide structures, nucleotide molecules, and nucleotide sequences of the Examples include, but are not limited to, deoxyribonucleotides, ribonucleotides, and combinations thereof, all nucleotide structures, molecules, and sequences that can be used in the methods of the Examples for transforming plants. These deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogs. The nucleotide structures, nucleic acids, and nucleotide sequences of the present example also encompass all forms of nucleotide structures, including but not limited to single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, etc.

[0133] The gene construct may further include a gene encoding a reporter molecule. The reporter molecule may be a detectable protein, such as a fluorescent protein, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), such as super-fold GFP (sfGFP), red fluorescent protein (RFP), such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed or DsRed2, cyan fluorescent protein (CFP), blue green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), and a variant thereof including species variants, monomer variants, and codon-optimized and stabilized and / or enhanced variants of the fluorescent protein. In addition, in the present invention, the reporter molecule may include an enzyme, such as luciferase, an E. coli-derived lacZ gene, alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), chloramphenicol acetyl transferase (CAT), β-galactosidase, or β-glucuronidase (GUS). The expression of the enzyme may be detected by the addition of a substrate that can be detected upon the expression and functional activity of the enzyme. Furthermore, it may further include a gene encoding a selectable marker for detecting transformed cells.The above-mentioned selection markers may include (e.g., neomycin, cabbageillin, kanamycin, spectinomycin, hygromycin, bleomycin, ampicillin, chloramphenicol, etc.) or herbicide resistance genes, but are not limited thereto.

[0134] When a gene combination according to the present invention is transformed to be expressed in a protoplast, the development of microcallus from the protoplast is promoted, the regeneration efficiency of the entire plant from the microcallus is improved, and the regeneration time is shortened. In addition, the protoplast transformed to express such a gene combination can be reprogrammed into a pluripotent cell.

[0135]

[0136] According to another embodiment of the present invention, the invention relates to a composition for promoting microcallus development, plant regeneration, or plant reprogramming from a protoplast, comprising the gene combination or a protein encoded by the same.

[0137] The above composition may include a gene construct comprising the gene combination described above.

[0138] In addition, the above composition may include proteins encoded by the genes described above.

[0139]

[0140] According to another embodiment of the present invention, the invention relates to a recombinant expression vector for promoting microcallus development, plant regeneration, or plant reprogramming of a protoplast comprising the gene construct described above.

[0141] In this specification, the terms "vector" or "expression vector" refer to a recombinant vector capable of expressing a target protein when transfected into a suitable host cell, and a genetic construct comprising essential regulatory elements operably linked to enable the expression of a gene insert. Here, "operably linked" means that a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding the target protein are functionally linked to perform a general function. Operatory linkage with the recombinant vector can be prepared using gene recombination technology well known in the art, and site-specific DNA cleavage and linkage can be easily performed using enzymes, etc., generally known in the art.

[0142] In this specification, the terms “recombinant” or “genetically modified” mean that a host cell replicates a foreign gene or expresses a peptide or protein encoded by a foreign gene. Such a cell is described as being transformed by one or more foreign genes or as being transformed by the introduction of one or more foreign genes. A recombinant or transformed cell may contain a gene that is not found in the original (non-recombinant) form of the cell. A recombinant cell may also contain a gene found in the original form of said cell, said gene modified by artificial means and reintroduced into said cell. The term also includes a cell containing a nucleic acid that is endogenous to said cell, which is modified or whose expression is modified without removing nucleic acid from said cell; such modification includes gene replacement, promoter substitution; site-specific mutation; and modification obtained by related techniques.

[0143] In the present invention, various types of vectors may be used as recombinant expression vectors for inserting the gene construct described above, such as plasmids, viral vectors, RNA vectors, artificial chromosome vectors such as BACs or YACs. As for the plasmids, basic plasmids such as pUC, pBI121, pGreen, pCAMBIA, and pSAT; binary vectors such as Ti-plasmid derived from Agrobacterium tumefaciens, Ri plasmid derived from Agrobacterium rhizogenes, and pTOK233 may be used. However, the types of such recombinant vectors are not particularly limited as long as they function to express a desired gene and produce a desired protein in plant cells, particularly protoplasts.

[0144] The expression vector of the present invention may include expression regulatory elements such as a promoter, a start codon, a termination signal, a polyadenylation signal, or an enhancer.

[0145] As the above promoter, any promoter commonly used in the industry for gene introduction into plants may be used, for example, the SP6 promoter, T7 promoter, T3 promoter, PM promoter, maize ubiquitin promoter, cauliflower mosaic virus (CaMV) 35S promoter, hybrid CaMV 35S-TEV (HBT) promoter, nophalin synthase (NOS) promoter, pigwort mosaic virus 35S promoter, sucrain basilyform virus promoter, Commelina yellow motl virus promoter, photo-induced promoter of ribulose-1,5-bis-phosphate carboxylase small subunit (ssRUBISCO), rice cytosol triosephosphate isomerase (TPI) promoter, and Arabidopsis adenine phosphoribosyltransferase (APRT) promoter. One or more promoters, such as the octopine synthase promoter and the BCB (blue copper binding protein) promoter, may be used, but are not limited thereto.

[0146] Additionally, polyadenylation signal sequences that cause polyadenylation of the 3'-terminus of the vector may include, for example, those derived from the nophalin synthase gene of Agrobacterium tumefaciens (NOS 3' end), a terminator derived from the octopine synthase gene of Agrobacterium tumefaciens (octopine synthase terminator), the 3' end portion of the protease repressor I or ± gene of tomato or potato, CaMV 35S terminator, rice α-amylase RAmy1 A terminator, and phaseolin terminator, but are not limited thereto.

[0147] Additionally, the vector may include an enhancer sequence for transcriptional enhancement. The "enhancer" refers to a DNA sequence capable of stimulating the activity of a promoter, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of the promoter. For example, various enhancers are already known in the art, such as introns that enhance gene expression in plants, including ubiquitin introns, omega enhancers, omega prime enhancers, CaMV 35S enhancers, and TEV enhancers.

[0148] The vector of the present invention may optionally further include a gene encoding a reporter molecule for confirming whether a gene to be introduced into a host cell has been introduced, the location of a protein, etc. The reporter molecule may include or may include a detectable protein, such as a fluorescent protein, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), such as super-fold GFP (sfGFP), red fluorescent protein (RFP), such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed or DsRed2, cyan fluorescent protein (CFP), blue green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), and species variants, monomer variants, and codon-optimized and stabilized and / or enhanced variants of the fluorescent protein. In addition, in the present invention, the reporter molecule may include enzymes, such as luciferase, E. coli-derived lacZ gene, alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), chloramphenicol acetyl transferase (CAT), β-galactosidase, or β-glucuronidase (GUS). The expression of the enzyme may be detected by the addition of a substrate that can be detected upon the expression and functional activity of the enzyme.In addition, it may further include a gene encoding a selection marker for detecting transformed cells. The selection marker may include, but is not limited to, (e.g., neomycin, cabbageillin, kanamycin, spectinomycin, hygromycin, bleomycin, ampicillin, chloramphenicol, etc.) or herbicide resistance genes.

[0149] The above vector may additionally include foreign genes in addition to the gene combinations described above, if necessary. The foreign genes include all cases where they originate from or are derived from a source other than the host species, where they are modified forms of polynucleotides, genes, or nucleic acids originating or derived from the host species, or where polynucleotides, genes, or nucleic acids originating or derived from the host species are inserted into other locations within the genome. For the purposes of the present invention, the foreign genes may be genes for pest or disease resistance, herbicide resistance, genes for nutritional or taste / aroma improvement, genes for tolerance to drought, salinity, or cold, genes for growth regulation, genes related to flowering or fruit development, or genes encoding proteins or enzymes for medicinal purposes intended for mass production in plants, but are not limited thereto.

[0150] In the present invention, the vector may be a stable expression vector or a transient expression vector, but preferably, it may be a transient expression vector that is expressed only transiently in a host cell. For example, the vector may be maintained in the host cell for 5 to 20 days, 5 to 15 days, or 5 to 10 days from the day of introduction into the host cell, but is not limited thereto.

[0151] In the present invention, by using a transient expression vector as the vector, the expression of the gene combination of the present invention is temporarily increased during the development of microcallus from the protoplast, thereby promoting the development of microcallus from the protoplast, and promoting the regeneration of roots, stems, or the entire plant from the developed callus, but the finally regenerated plant may not contain the transformed gene combination or the vector containing it.

[0152] In the present invention, a commercially available transient expression vector may be used, but a transient expression vector constructed in the present invention may also be used. A vector map of the transient expression vector according to the present invention is shown in FIGS. 66 to 68. The transient expression vector of the present invention may include the nucleotide sequence of SEQ ID NO. 53, 54, or 55, and may be composed of such nucleotide sequences. Additionally, a gene according to the present invention or other desired foreign genes may be cloned therein.

[0153]

[0154] According to another embodiment of the present invention, the invention relates to a plant cell transformed to express a gene combination according to the present invention.

[0155] The transformed plant cells of the present invention may be transformed with a recombinant expression vector comprising the gene combination of the present invention.

[0156] The above plant cells may be protoplasts, callus cells, embryonic cells, leaf cells, seed cells, stem cells, or root cells, but preferably may be protoplasts.

[0157] Techniques for introducing the above-mentioned recombinant expression vector into plant cells may include, but are not limited to, electroporation of plant protoplasts, liposome-mediated transformation, polyethylene glycol (PEG)-mediated transformation, virus-induced transformation, micro-injection into plant cells, micro-projectile impaction into plant cells, vacuum penetration, and Agrobacterium tumepiciens-mediated transformation. Any method known in the art for introducing a vector into plant cells may be included without limitation.

[0158] In the present invention, the plant cell, preferably the protoplast, transformed to express the gene, can be promoted to develop into a callus. Additionally, the transformed plant cell can be promoted to reprogram into pluripotent cells as the expression of pluripotency markers such as WOX5 and / or SCR is increased. Furthermore, the transformed plant cell, in particular the transformed protoplast or the callus developed therefrom, can be promoted to regenerate into plant tissues (roots, stems, leaves) or the whole plant.

[0159] The plant cells of the present invention may be transformed to express foreign genes in addition to the gene combinations described above, if necessary. The foreign genes include all cases where they originate from or are derived from a source other than the host species, where they are modified forms of polynucleotides, genes, or nucleic acids originating or derived from the host species, or where polynucleotides, genes, or nucleic acids originating or derived from the host species are inserted into other locations within the genome. For the purposes of the present invention, the foreign genes may be genes for pest or disease resistance, herbicide resistance, genes for nutritional or taste / aroma improvement, genes for tolerance to drought, salinity, or cold, genes for growth regulation, genes related to flowering or fruit development, or genes encoding proteins or enzymes for medicinal purposes intended for mass production in plants, but are not limited thereto.

[0160]

[0161] According to another embodiment of the present invention, the invention relates to a whole plant regenerated from the transformed plant cell described above.

[0162] Expression of the transformed gene may not be observed in the entire regenerated plant. Here, whether the transformed gene is expressed can be confirmed through the expression of a reporter molecule, but is not limited thereto.

[0163] The whole plant regenerated according to the present invention may, if necessary, express a desired foreign gene or a protein encoded by it. The foreign gene includes all cases where it originates from or is derived from a source other than the host species, where it is a modified form of a polynucleotide, gene, or nucleic acid originating or derived from the host species, or where a polynucleotide, gene, or nucleic acid originating or derived from the host species is inserted into a different location within the genome. For the purposes of the present invention, the foreign gene may be a gene for pest or disease resistance, a gene for herbicide resistance, a gene for nutritional or taste / aroma improvement, a gene for tolerance to drought, salinity, or cold, a gene for growth regulation, a gene related to flowering or fruit development, or a gene encoding a protein or enzyme for medicinal use intended for mass production in the plant, but is not limited thereto.

[0164]

[0165] According to another embodiment of the present invention, the invention relates to a method for regenerating a plant from a plant cell, particularly a protoplast, or a method for reprogramming it into a pluripotent cell.

[0166] The method of the present invention may include the step of transforming a plant cell so that the gene combination according to the present invention is expressed.

[0167] The above transformation step may include the step of introducing a recombinant expression vector containing the gene combination of the present invention into a plant cell.

[0168] The above-mentioned transformation step may further include a step of transforming a plant cell to express a desired foreign gene in addition to the gene combination according to the present invention. Here, the foreign gene encompasses all cases where the foreign gene is of origin or derived from a source other than the host species, is a modified form of a polynucleotide, gene, or nucleic acid originating or derived from the host species, or is inserted into a different location within the genome. For the purposes of the present invention, the foreign gene may be a gene for pest or disease resistance, a gene for herbicide resistance, a gene for nutritional or taste / aroma improvement, a gene for tolerance to drought, salinity, or cold, a growth regulatory gene, a gene related to flowering or fruit development, or a gene encoding a protein or enzyme for medicinal purposes intended for mass production in plants, but is not limited thereto.

[0169] The above plant cells may be protoplasts, callus cells, embryonic cells, leaf cells, seed cells, stem cells, or root cells, but preferably may be protoplasts.

[0170] Techniques for introducing the above-mentioned recombinant expression vector into plant cells may include, but are not limited to, electroporation of plant protoplasts, liposome-mediated transformation, polyethylene glycol (PEG)-mediated transformation, virus-induced transformation, micro-injection into plant cells, micro-projectile impaction into plant cells, vacuum penetration, and Agrobacterium tumepiciens-mediated transformation. Any method known in the art for introducing a vector into plant cells may be included without limitation.

[0171] In the present invention, by allowing the gene combination according to the present invention to be temporarily expressed in the plant cells, the expression of the transformed gene may not be observed in the finally regenerated plant. Here, whether the transformed gene is expressed can be confirmed through the expression of a reporter molecule expressed by a reporter molecule gene included together with the gene in the recombinant expression vector or the construct, but is not limited thereto.

[0172] The method of the present invention may include the step of culturing transformed plant cells.

[0173] The above culture method can be appropriately selected or adjusted from among the media or culture conditions commonly used in the industry, depending on the plant species to be cultured and the type of cell or tissue.

[0174] As the culture medium for the above-mentioned culture, a basic medium for culturing plant cells may be used, such as MS (Murashige and Skoog) medium, LS (Linsmaier and Skoog) medium, B5 medium, White medium, N6 medium, SH medium, or a mixture thereof, and preferably MS medium may be used, but is not limited thereto. Here, the MS medium may be commercially available, or may be prepared by adding 3 to 5 g of MS basic salt, 5 to 20 g of sucrose, 0.1 to 1 g of MES (2-Morpholinoethanesulphonic acid), and 0.1 to 1 w / v% of phytoagar to 1 L of water (distilled water), but the specific composition is not limited thereto.

[0175] In addition, depending on the purpose of the above culture, a protoplast induction medium (PIM), a callus induction medium (CIM), a shoot induction medium (SIM), or a root induction medium (RIM) may be used.

[0176] As an example of the above protoplast induction medium (PIM), a medium prepared with a concentration of 1 L total volume containing ammonium nitrate (NH4NO3), 1-5 g of vitamin-free MS basic salt, 1-10% by weight of glucose, 1-10% by weight of D-mannitol, 100-1000 mg of MES (2-Morpholinoethanesulphonic acid), 0.1-0.5 mg of folic acid, 0.1-2 mg of 2-4 D, 0.01-0.1 g of thidiazuron (TDZ), and 100-500 mg of cefotaxime in 1 L of water (distilled water) may be used, but is not limited thereto. Any medium commercially available for the same purpose or any composition widely known in the art as a protoplast induction medium may be used, without limitation as to whether it is a liquid or solid medium.

[0177] As an example of the above callus induction medium (CIM), it can be prepared with a concentration of 1 L total volume by including ammonium nitrate (NH4NO3), 1-5 g of vitamin-free MS basic salt, 1-10% by weight of sucrose, 1-10% of D-mannitol, 100-1000 mg of MES, 0.05-0.2 g of thidiazuron (TDZ), and 100-500 mg of cefotaxim in 1 L of water (distilled water), but is not limited thereto. Any medium commercially available for the same purpose or any composition widely known in the art as a callus induction medium can be used without limitation as a liquid medium or a solid medium.

[0178] As an example of the above shoot induction medium (SIM), a mixture of 1 to 5 g of Gamborg's B-5 basic salt mixture, 1 to 10 wt% of sucrose, and 0.1 to 1 g of MES is prepared in water (distilled water) to a concentration of 1 L, then phytoa is added in an amount of 0.1 to 1 w / v%, and 2 IP (6-(γ,γ-dimethylallylamino) purine) (500 to 1000 μL from a 1 mg / mL stock), IAA (50 to 200 μL from a 1 mg / mL stock), and 100 to 500 mg of cefotaxim is added. However, it is not limited to this, and any commercially available medium for the same purpose or any composition widely known in the art as a shoot induction medium can be used, regardless of whether it is a liquid or solid medium.

[0179] As an example of the above root induction medium (RIM), a mixture of 1 to 5 g of Gamborg's B-5 basic salts, 1 to 10 wt% of sucrose, and 0.1 to 1 g of MES can be prepared in water (distilled water) to a concentration of 1 L, then phytoa can be added in an amount of 0.1 to 1 w / v%, and IAA (50 to 200 μL from a 1 mg / mL stock) and 100 to 500 mg of cefotaxim can be added, but is not limited thereto. Any commercially available medium for the same purpose or any composition widely known in the art as a root induction medium can be used, without limitation as to whether it is a liquid medium or a solid medium.

[0180] Preferably, when culturing, particularly when culturing to induce a callus from a protoplast, culturing under a three-dimensional solid medium containing sodium alginate can promote callus development. As an example, a protoplast may be resuspended in a protoplast induction medium, sodium alginate may be added in an amount of 1 to 5 weight percent, poured into a calcium agar solid bed, polymerized, and then culture may be performed.

[0181] The above culture period can be appropriately adjusted according to the type of plant cell or tissue to be cultured or the type of plant cell or tissue to be regenerated through culture, but, for example, it may be performed for 1 to 180 days, 7 to 150 days, 11 to 120 days, 7 to 90 days, 7 to 84 days, or 7 to 77 days, but is not limited thereto.

[0182] During the above culture, protoplasts among the plant cells may be cultured for 50 days or more, 60 days or more, 70 days or more, 77 days or more, 80 days or more, 84 days or more, 100 days or more, 110 days or more, or 120 days or more, and 150 days or less, 140 days or less, 130 days or less, 120 days or less, 110 days or less, 100 days or less, 90 days or less, 84 days or less, 80 days or less, or 77 days or less to regenerate into a whole plant, but are not limited thereto.

[0183] During the above culture, a callus may be induced by culturing the protoplasts among the plant cells for 5 days or more, 7 days or more, 11 days or more, 14 days or more, 30 days or more, 35 days or more, 40 days or more, 41 days or more, 42 days or more, or 60 days or more, and 80 days or less, 75 days or less, 71 days or less, 60 days or less, 50 days or less, 42 days or less, 41 days or less, 40 days or less, 35 days or less, 30 days or less, 15 days or less, 11 days or less, or 7 days or less, and preferably, the callus may be induced by culturing for 30 to 75 days or 35 to 71 days, but is not limited thereto.

[0184] Microcalli can be induced by culturing protoplasts among plant cells during the above culture for 5 days or more, 7 days or more, 11 days or more, 14 days or more, 30 days or more, or 41 days or more, and 45 days or less, 41 days or less, 30 days or less, 15 days or less, 14 days or less, 11 days or less, or 7 days or less, and preferably by culturing for 11 to 41 days, 7 to 14 days, or 7 to 11 days, but is not limited thereto.

[0185] In the above culture, microcallus among plant cells can be cultured for 5 to 70 days, 20 to 70 days, 20 to 60 days, 30 to 60 days, 5 to 40 days, 25 to 40 days, or 25 to 30 days to induce maturation into callus, but is not limited thereto.

[0186] In the above culture, the callus among the plant cells can be cultured for 15 to 30 days, 20 to 30 days, or 21 to 28 days to induce the regeneration of the sprout, but is not limited thereto.

[0187] In the above culture, the callus in which the sprout (stem) has regenerated among the plant cells can be cultured for 15 to 30 days, 20 to 30 days, or 21 to 28 days to induce root regeneration, but is not limited thereto.

[0188] In the above culture, the callus among the plant cells can be cultured for 30 to 60 days, 40 to 60 days, 40 to 50 days, or 42 to 49 days to induce regeneration into a whole plant, but is not limited thereto.

[0189] As an example, the method of the present invention may include, but is not limited to, a method of regenerating into a whole plant by culturing the transformed protoplast in a protoplast induction medium for 5 to 15 days to induce microcallus, further culturing in a callus induction medium for 20 to 70 days to induce maturation into callus, culturing in a sprout (stem) induction medium for 20 to 30 days to induce regeneration of a sprout (stem), and culturing in a root induction medium for 20 to 30 days to induce regeneration of a root.

[0190] As an example, the method of the present invention may include, but is not limited to, a method of regenerating into a whole plant by culturing the transformed protoplast in a protoplast induction medium for 5 to 10 days to induce microcallus, further culturing in a callus induction medium for 20 to 40 days to induce maturation into callus, culturing in a sprout (stem) induction medium for 20 to 30 days to induce regeneration of a sprout (stem), and culturing in a root induction medium for 20 to 30 days to induce regeneration of a root.

[0191] Figure 3a illustrates a flowchart of a standard culture process for regenerating a whole plant from a transformed protoplast. By culturing the transformed protoplast in a protoplast induction medium for 11 days to induce microcallus, culturing it first in a callus induction medium for 30 days, culturing it secondarily for 30 days in a callus induction medium with the same or different composition as the callus induction medium to induce callus maturation, culturing it in a sprout (stem) induction medium for 28 days to induce sprout (stem) regeneration from the callus, and culturing it in a root induction medium for 21 days to induce root regeneration, the protoplast can be regenerated into a whole plant.

[0192] FIG. 3b illustrates a flowchart of a shortened culture process for regenerating a whole plant from a transformed protoplast. By culturing the transformed protoplast in a protoplast induction medium for 7 days to induce microcallus, culturing it first in a callus induction medium for 7 days, culturing it secondarily for 28 to 30 days in a callus induction medium with the same or different composition as the callus induction medium to induce callus maturation, culturing it in a sprout (stem) induction medium for 21 days to induce sprout (stem) regeneration from the callus, and culturing it in a root induction medium for 21 days to induce root regeneration, the protoplast can be regenerated into a whole plant.

[0193] FIG. 3c illustrates a flowchart of a shortened culture process for regenerating a whole plant from a transformed protoplast. By culturing the transformed protoplast in a protoplast induction medium for 7 days to induce microcallus, culturing it first in a callus induction medium for 7 days, culturing it secondarily for 20 to 21 days in a callus induction medium having the same or different composition as the callus induction medium to induce callus maturation, culturing it in a sprout (stem) induction medium for 21 days to induce sprout (stem) regeneration from the callus, and culturing it in a root induction medium for 21 days to induce root regeneration, the protoplast can be regenerated into a whole plant.

[0194] FIGS. 3a to 3c merely illustrate an example of a culture method for regenerating an entire plant from a protoplast transformed with a gene combination according to the present invention, and the culture method of the present invention is not limited to that shown in the drawings.

[0195] The protoplasts transformed according to the present invention have a high efficiency of developing microcalli, and the regeneration efficiency from the developed microcalli to plant tissues such as roots, stems, and leaves, or to whole plants, is also excellent. Here, high regeneration efficiency means that the regeneration rate from the callus to plant tissues or whole plants is high and the regeneration time is shortened. In addition, the protoplasts transformed according to the present invention induce reprogramming into pluripotent cells, such as an increase in the expression level of pluripotency markers.

[0196] Figure 1 shows photographs of cells observed by a fluorescence microscope on each day (d) after transforming Arabidopsis mesophyll protoplasts with an HBT-PGSG-NOS vector (containing the fluorescence marker sGFP, mRFP, or mBFP) containing the gene combination according to the present invention. UT represents a photograph of an untransformed protoplast control. A brightfield image is displayed over each fluorescence image, and the scale bar is 50 μm.

[0197] Figure 2a is a graph showing the transformation efficiency of individual vectors expressing markers, where positive fluorescent cells were calculated using Image-J software and the graph is plotted with the mean values ​​obtained from three technical triple experiments. The mean ± SD of fluorescently positive cells is expressed as (****P < 0.0001 and **P = 0.0014 in the multiple t-test using the Sidak method). Figure 2b is a graph showing the relative fluorescence units (RFU) of protoplasts transformed with individual vectors, where the black baseline represents the mean RFU of UT (i.e., autofluorescence). It is expressed as the mean ± SD of RFU obtained from Image-J analysis of two biological replicate experiments with three independent images each (*P < 0.05 compared to UT in 2-way ANOVA, Turkey's multiple comparison test).

[0198] Figure 3a shows an overview of the standard protoplast regeneration protocol, schematically illustrating the entire timeline of protoplast culture, callus formation, and shoot (stem) regeneration. Figures 3b and 3c show an overview of the shortened culture protocol for protoplast regeneration performed in this experiment.

[0199] Figure 4 shows the percentage of microcallus formation in liquid cultures of PIM 7 days and CIM1 7 days after co-transforming protoplasts with the gene combination according to the present invention. Here, the percentage of microcallus was calculated after Image-J analysis of samples stained with chalcofluor white. Each was expressed as the mean ± SD of 5 biological replicates with n = 5 (p-value comparing CIM1 7 days and UT in one-way ANOVA, Dunnett's test of multiple comparisons).

[0200] Figure 5 shows the percentage of microcallus area in black and white heat maps after co-transforming protoplasts with the gene combination according to the present invention. The total percentage of microcallus area was calculated after Image-J analysis of samples stained with chalcofluor white at CIM1 7 days.

[0201] Figure 6 shows the formation of microcalluses in liquid PIM and CIM1 cultures after co-transforming protoplasts with the gene combination according to the present invention, and is a bright-field (BF) and chalcofluor white (CW) stained fluorescence microscope image of a sample showing microcalluse formation on day 7 of CIM1 after 7 days of PIM and 11 days of PIM culture. Scale bar = 200 μm, and white arrows indicate dividing protoplasts.

[0202] Figure 7a shows the development of microcallus (indicated by red arrows) in alginate culture on day 20 of CIM. It is a photograph of the callus development observed using a bright-field microscope on day 20 of CIM2 after transferring microcallus developed in liquid culture on day 7d of CIM1 to alginate culture. Scale bar = 250 μm. Figure 7b shows a selectively magnified image of a portion of the microcallus developed on day 25 of CIM2. Scale bar = 100 μm.

[0203] Figures 8a and 8b confirm the developmental efficiency of microcalluses in shortened alginate cultures after co-transformation of the gene combination according to the present invention, and show bright-field images illustrating the development of microcalluses at different time points of CIM1 7 days and CIM2 cultures. In Figure 8a, the red arrow indicates a microcalluse. Scale bar = 250 μm.

[0204] Figures 9a and 9b show magnified images of a sprout regenerated from a microcallus on day 28 of SIM. Scale bar = 2 mm.

[0205] Figures 10a and 10b show the emergence of buds from microcalluses observed on day 28 of SIM, each image representing a single biological replicate of n = 16. Scale bar = 5 mm.

[0206] Figure 11 shows the percentage of microcalluses that formed buds on day 28 of SIM from microcalluses developed after 7 days of PIM, 7 days of CIM1, and 28–30 days of CIM2 culture, representing the mean ± SD of 4 biological replicates with n = 16, respectively (****P < 0.0001 and **P = 0.0014, compared with EV in one-way ANOVA, Dunnett’s test of multiple comparison). EV: Results of protoplasts transformed with empty vectors (HBT-PGSG-sGFP(S65T)-NOS, HBT-PGSG-mRFP-NOS, and HBT-PGSG-mBFP-NOS).

[0207] Figures 12a and 12b show the sprout regeneration efficiency of microcallus obtained after co-transformation of the gene combination of the present invention, and show magnified images of sprouts regenerated from microcallus on day 28 of SIM. Scale bar = 2 mm.

[0208] Figures 13a and 13b are images showing the emergence of shoots from microcallus on SIM day 28, each image representing a single biological repeat with n = 16. Scale bar = 5 mm.

[0209] Figure 14 shows the percentage of microcalluses that formed shoots at SIM 28 days from microcalluses developed after 7 days of PIM, 7 days of CIM1, and 21 days of CIM2 culture, expressed as the mean ± SD of 4 biological replicates with n = 16 (****P < 0.0001 compared to EV in one-way ANOVA, Dunnett's multiple comparison test).

[0210] Figure 15 shows an Arabidopsis plant fully regenerated in a mesophyll protoplast after co-transformation with the gene combination of the present invention, and Figures 15a and 15b show images of the regenerated roots on day 21 of RIM. Scale bar = 2 mm. Figure 15c shows an image of an Arabidopsis plant fully regenerated on day 14 after transfer to soil. Scale bar = 1 cm. The gene combinations used for protoplast transformation are SEP (SCR-sGFP + ESR1-mBFP + PSK5-mRFP), WL29 (WOX5-sGFP + LBD29-mRFP), EP (ESR1-mBFP + PSK5-mRFP), and WP (WOX5-sGFP + PSK5-mRFP).

[0211] Figure 16 is an image showing low shoot regeneration efficiency in mesophyll protoplasts and microcalluses co-transformed with an untransformed control (UT) and three empty vectors (EV) in standard alginate culture. Figure 16a shows bright-field images of developing microcalluses on day 11 of PIM (scale bar = 100 μm), day 30 of CIM1 (scale bar = 500 μm), and day 30 of CIM2 (scale bar = 1 mm). Figure 16b shows magnified images of shoots regenerated from microcalluses on day 21 or day 28 of SIM after 11 days of PIM, 30 days of CIM1, and 30 days of CIM2 culture. Scale bar = 2 mm. Figure 16c is an image observing shoot emergence from microcalluses on day 28 of SIM, where each image represents a single biological replicate with n = 16. Scale bar = 5 mm. Figure 16d shows the percentage of sprout regeneration from microcallus in SIM 28d, with the mean ± SD of four biological replicates with n=16 shown.

[0212] FIG. 17 is an image showing the development of microcallus and bud regeneration from protoplasts co-transformed with the gene combination according to the present invention under standard alginate culture conditions, where FIG. 17a shows a bright-field image of a microcallus developing at 30 days of CIM1. FIG. 17b shows an image of a microcallus developing at 30 days of CIM1 stained with chalcofluor white. Scale bar = 300 μm.

[0213] Figure 18 shows the percentage of microcallus development on day 30 of CIM1 after 11 days of PIM culture, calculated through Image-J analysis of chalcofluor white stained samples. It represents the mean ± SD of 5 biological replicates with n = 5 (****P < 0.0001, compared to EV in one-way ANOVA, Dunnett's multiple comparison test).

[0214] Figure 19 shows a bright-field image of a well-developed microcallus (1–2 nm) on day 30 of CIM2.

[0215] Figure 20 shows a microcallus grown after co-transformation of the gene combination according to the present invention in a standard alginate culture, and is a bright-field image of a microcallus developing on day 30 of CIM2 after 11 days of PIM and 30 days of CIM1 culture. Scale bar = 1 mm.

[0216] Figure 21 shows the percentage of microcallus development at 30 days of CIM1 calculated through Image-J analysis of chalcofluor white stained samples, representing the mean ± SD (****P < 0.0001, compared to EV in one-way ANOVA, Dunnett's multiple comparison test) of 5 biological replicates with n = 5, respectively.

[0217] Figures 22a and 22b show images of sprouts regenerated from microcallus on day 28 of SIM. Scale bar = 2 mm.

[0218] Figure 23 shows the percentage of shoots formed from microcallus on day 28 of SIM after 11 days of PIM, 30 days of CIM1, and 30 days of CIM2 culture. Each is expressed as the mean ± SD of four biological replicates with n = 16 (****P < 0.0001 compared to EV in one-way ANOVA, Dunnett's test of multiple comparisons).

[0219] Figures 24a and 24b show images of sprouts regenerated from microcallus in SIM 28d. Each image represents a single biological replicate with n = 16. Scale bar = 5 mm.

[0220] Figures 25a and 25b show magnified images of roots regenerated in RIM 21d. Scale bar = 2 mm.

[0221] Figures 26a and 26b show a bright-field image (a) and a chalcofluorescent white stained micrograph (b) of a microcallus developing on day 7 of PIM under shortened alginate culture conditions. Figures 26c and 26d show a bright-field image (c) and a chalcofluorescent white stained micrograph (d) of a microcallus developing on day 7 of CIM under shortened alginate culture conditions. Here, the scale bar = 100 μm.

[0222] Figure 27a shows the percentage of microcallus in PIM day 7 and CIM1 day 7 cultures calculated through Image-J analysis of chalcofluor white stained samples, with the mean ± SD (significant P-value obtained in CIM1 day 7 compared to EV in one-way ANOVA, Dunnett's multiple comparison test) represented by 5 biological replicates with n = 5, respectively. Figure 27b shows the percentage of microcallus area after the same analysis, with the mean ± SD (****P < 0.0001 compared to EV in one-way ANOVA, Dunnett's multiple comparison test) represented by 5 biological replicates with n = 5, respectively.

[0223] Figure 28 is a bright-field image showing microcallus developing on day 7 of CIM1 under shortened alginate culture conditions. Scale bar = 100 μm.

[0224] Figure 29 shows the percentage of microcallus in PIM day 7 and CIM1 day 7 cultures calculated through Image-J analysis of chalcofluor white stained samples, with mean ± SD (significant P value obtained in CIM1 day 7 compared to EV in one-way ANOVA, Dunnett's test of multiple comparison) represented by 5 biological replicates with n = 5, respectively.

[0225] Figure 30a is a brightfield image of a microcallus on day 28 of CIM2, with a scale bar = 300 μm. Figures 30b and 30c are images of a regenerated sprout on day 21 of SIM, with a scale bar = 2 mm.

[0226] Figure 31 shows the percentage of shoots formed on day 21 of SIM from microcalluses developed after 7 days of PIM, 7 days of CIM1, and 28 days of CIM2 culture, expressed as the mean ± SD of 4 biological replicates with n = 16 (****P < 0.0001, compared to EV in one-way ANOVA, Dunnett's multiple comparison test).

[0227] Figure 32a is a bright-field image of a microcallus on day 21 of CIM2. Scale bar = 300 μm. Figures 32b and 32c show images of a regenerated sprout on day 21d of SIM, scale bar = 2 mm.

[0228] Figure 33 shows the percentage of shoots formed on day 21 of SIM from microcalluses developed after 7 days of PIM, 7 days of CIM1, and 21 days of CIM2 culture, expressed as the mean ± SD of 4 biological replicates with n = 16 (****P < 0.0001, compared with EV in one-way ANOVA, Dunnett's multiple comparison test).

[0229] Figure 34a is a bright-field image of a developing microcallus on day 21 of CIM2, with a scale bar = 300 μm. Figures 34b and 34c are images of a regenerated shoot on day 21 of SIM, each image representing a single biological replicate with n = 16. The scale bar = 5 mm.

[0230] Figure 35a is a bright-field image of microcallus developing on day 28 of CIM2 after 7 days of PIM and 7 days of CIM1 culture, with a scale bar = 300 μm. Figures 35b and 35c are images of regenerated shoots on day 21 of SIM, with a scale bar = 5 mm.

[0231] Figures 36a and 36b show magnified images of regenerated roots on day 21 of RIM after various CIM2 culture periods (21 days in (a), 28 days in (b)). Scale bar = 2 mm.

[0232] Figures 37a to 37f show images of fully regenerated Arabidopsis plants on the 14th day after soil transplanting. Scale bar = 1 cm.

[0233] Figure 38a shows gel images of DNA obtained by PCR using genomic DNA (gDNA) or plasmid DNA extracted from Arabidopsis plants regenerated after soil transplantation as templates, where gDNA from pSCR::SCR-mGFP and pWOX5::nYFP plants and plasmid DNA including SCR-sGFP, ESR1-mBFP, PSK5-mRFP, WOX5-sGFP, LBD16-sGFP, and LBD29-mRFP from the HBT-PGSG-NOS vector were used as positive controls for PCR, and gDNA from wild-type (WT) Col was used as a negative control. Genes amplified by PCR using specific primers (Table 3) are indicated in parentheses. Figures 38b to 38e are gel images of DNA obtained by PCR using specified gDNA as templates, where the gDNA was isolated from regenerated plants. The culture conditions used prior to sprout regeneration are as follows: (b): PIM 11 days → CIM1 30 days → CIM2 30 days; (c): PIM 7 days → CIM1 7 days → CIM2 20 / 21 days or 28 / 30 days; (d): PIM 7 days → CIM1 7 days → CIM2 28 days; (e): PIM 7 days → CIM1 7 days → CIM2 21 days.

[0234] Figure 39 shows fluorescence micrographs of Arabidopsis mesophyll protoplasts transfected with specified HBT-PGSG-NOS plasmids expressing fusion proteins (SCR-sGFP, PSK5-mRFP, ESR1-mBFP and WOX5-sGFP), taken on each day after transfection. Scale bar = 50 μm.

[0235] Figure 40a is a graph showing the transfection efficiency of individual plasmids expressing fusion proteins, where fluorescence-positive cells were calculated using Image-J and the graph was plotted as the mean values ​​obtained from three technical triple experiments. The mean ± SD of fluorescence-positive cells is shown (****P < 0.0001 and **P = 0.0014 in the multiple t-test using Sidak's method). Figure 40b is a graph showing the relative fluorescence units (RFU) of protoplasts transfected with individual plasmids. The black baseline represents the mean RFU (i.e., autofluorescence) of untransfected protoplasts. It shows the mean ± SD of RFU obtained from Image-J analysis for two biological replicate experiments, each with three independent images (*P < 0.05 compared to UT in 2-way ANOVA, Turkey's multiple comparison test).

[0236] Figure 41a shows confocal micrographs taken in bright-field (BF) and nYFP panels from 6 to 11 hours after co-transforming SEPW without fluorescent tags (sGFP, mBFP, or mRFP) into mesophyll protoplasts isolated from transgenic plants homozygous to pWOX5::nYFP, observing the nucleus expression of nYFP in non-dividing mesophyll protoplasts. Scale bar = 10 μm. Figure 41b shows the percentage of non-dividing protoplasts expressing nYFP calculated at specified time points after confocal imaging. Each is expressed as the mean ± SD of 8 biological replicates with n = 4 (****P < 0.0001 compared to UT in 2-way ANOVA, Sidak's multiple comparison test).

[0237] Figure 42a shows confocal micrographs taken in brightfield (BF) and on the mGFP panel at 6 to 11 hours after co-transforming SEPWs without fluorescent tags (sGFP, mBFP, or mRFP) into mesophyll protoplasts isolated from transgenic plants homozygous to pSCR::SCR-mGFP, observing nucleal expression of mGFP in non-dividing mesophyll protoplasts. Scale bar = 10 μm. Figure 42b shows the percentage of non-dividing protoplasts expressing SCR-mGFP calculated at specified time points after confocal imaging. Each is expressed as the mean ± SD of 8 biological replicates with n = 4 (****P < 0.0001 compared to UT in 2-way ANOVA, Sidak's multiple comparison test).

[0238] Figure 43a shows confocal imaging of microcalluses developed on each day after embedding mesophyll protoplasts isolated from pWOX5::nYFP in alginate medium, culturing for 11 days in PIM, 30 days in CIM1, 30 days in CIM2, and 3 days in SIM, stained with calcofluorine white (CW). Scale bar = 300 μm. Figures 43b and 43c show the percentage of nYFP-expressing microcalluses counted on each day after confocal imaging, representing the mean ± SD of six biological replicates with n = 5 (****P < 0.0001 compared to UT in two-way ANOVA, Sidak's multiple comparison test).

[0239] Figure 44a shows confocal imaging of microcalluses developed on each day after embedding mesophyll protoplasts isolated from pSCR::SCR-mGFP in alginate medium, culturing for 11 days in PIM, 30 days in CIM1, 30 days in CIM2, and 3 days in SIM, stained with calcofluorescent white (CW). Scale bar = 300 μm. Figures 44b and 44c show the percentage of microcalluses expressing SCR-mGFP counted on each day after confocal imaging, representing the mean ± SD of 8 biological replicates with n = 4 (****P < 0.0001 compared to UT in 2-way ANOVA, Sidak's multiple comparison test).

[0240] Figures 45a and 45b show calcofluorine white stained images of microcalluses developed on day 7 of PIM (a) and day 7 of CIM1 after 11 days of PIM culture (b) after co-transformation of protoplasts of B. oleracea and S. lycopersicum with the gene combination of the present invention and standard culture in alginate medium, with a scale bar = 100 μm. Figure 45c shows a bright-field image of microcalluses developed on day 30 of CIM1 after 11 days of PIM culture, with a scale bar = 300 μm. Figure 45d is a graph showing the number of regenerated shoots per microcallus of the three species on day 28 of SIM. The values ​​were expressed as mean ± SD (***P < 0.001, **P < 0.01, Dunnett's multiple comparison test compared to EV in one-way ANOVA) obtained from one biological replicate experiment with n=16.

[0241] Figure 46 shows the percentage of microcallus developed at 7 days of PIM and 7 days of CIM1 culture, calculated by Image-J analysis of calcofluorine white stained samples after co-transfection of the gene combination of the present invention into protoplasts of B. oleracea and S. lycopersicum. Each is expressed as the mean ± SD of 5 biological replicates with n = 5 (significant P-value obtained at 7 days of CIM1 compared to EV in one-way ANOVA, Dunnett's test of multiple comparison).

[0242] Figure 47 shows chalcofluorescent white staining images of the mesophyll and hypocotyl protoplast of C. annuum observed on day 7 of PIM, with a scale bar = 50 μm.

[0243] Figure 48 shows the percentage of microcallus developed on day 7 of CIM1 after 11 days of PIM culture of C. annuum mesophyll and hypocotyl protoplasts. The graph is presented as the mean ± SD of 5 biological replicates with n = 5 (P < 0.001 compared to EV in one-way ANOVA, Dunnett's test of multiple comparisons).

[0244] Figure 49 is a bright-field (BF) and chalcofluorescent white (CW) stained image of microcallus developing in the mesophyll and hypocotyl protoplasts of C. annuum on day 7 of CIM1 after 11 days of PIM culture. Scale bar = 100 μm.

[0245] Figure 50 is a bright-field image showing microcallus developed in the mesophyll and hypocotyl protoplasts of C. annuum on day 30 of CIM1 after 11 days of PIM culture. Scale bar = 300 μm.

[0246] Figure 51 shows images of sprouts regenerated from microcalluses of three crop species observed at SIM 28, with a scale bar = 2 mm.

[0247] Figure 52 shows the percentage of sprouts regenerated from microcallus on day 28 of SIM after standard alginate culture of three crop species protoplasts, expressed as the mean ± SD of four biological replicates with n = 16 (****P < 0.0001, compared to EV in one-way analysis of variance, Dunnett's multiple comparison test).

[0248] Figure 53 is a graph showing the number of regenerated shoots per microcallus of three crop species on day 28 of SIM, expressed as the mean ± SD obtained from one biological replicate experiment with n=16 (***P < 0.001, **P < 0.01, Dunnett's multiple comparison test compared to EV of one-way ANOVA).

[0249] Figure 54a is an image showing regenerated roots in three crop species on day 21 of RIM. Scale bar = 2 mm. Figure 54b is an image of three crops fully regenerated on day 14 after soil transplanting. Scale bar = 1 cm.

[0250] Fig. 55a shows a bright-field image of microcalluses developed on day 28 of CIM2 after 7 days of PIM and 7 days of CIM1 culture following co-transfection of B. oleracea, S. lycopersicum, and C. annuum protoplasts with the gene of the present invention under shortened alginate culture conditions in which sprouts do not regenerate in the case of untransformed protoplasts. Scale bar = 300 μm. Fig. 55b shows an enlarged image of sprouts regenerated from microcalluses of the three species on day 21 of SIM. Scale bar = 2 mm.

[0251] Figure 56a shows the percentage of sprouts from microcalluses on SIM 21 days after 7 days of PIM, 7 days of CIM1, and 28 days of CIM2 culture. Each is presented as the mean ± SD of four biological replicates with n = 16 (***P < 0.001 and **P < 0.05 compared to EV in one-way ANOVA, Dunnett's multiple comparison test). Figure 56b is a graph showing the number of regenerated sprouts per microcallus on SIM 21 days after 7 days of PIM, 7 days of CIM1, and 28 days of CIM2 culture. Each is presented as the mean ± SD of one biological replicate with n = 16 (***P < 0.001 and **P < 0.01 compared to EV in one-way ANOVA, Dunnett's multiple comparison test).

[0252] In Fig. 57, the top panel shows an image of a regenerated root on day 21 of RIM, and the bottom panel shows an image of a fully regenerated plant on day 14 after soil transplanting. Scale bar = 2 mm.

[0253] Figure 58a shows bright-field images of B. oleracea, S. lycopersicum, and C. annuum microcallus developed on day 21 of CIM2 after 7 days of culture in PIM and CIM1, which are shortened alginate culture conditions, with a scale bar = 300 μm. Figure 58b shows magnified images of sprouts regenerated from the microcallus of the three species on day 21 of SIM, with a scale bar = 2 mm.

[0254] Figure 59a shows the percentage of microcalluses that formed shoots on day 21 of SIM after culturing three types of protoplasts for 7 days in PIM, 7 days in CIM1, and 21 days in CIM2, expressed as the mean ± SD of 5 biological replicates (n = 16 each) (***P < 0.001 and **P < 0.01 compared to EV in unidirectional ANOVA, Dunnett's multiple comparison test). Figure 59b is a graph showing the number of regenerated shoots per microcallus on day 21 of SIM after culturing for 7 days in PIM, 7 days in CIM1, and 21 days in CIM2, expressed as the mean ± SD of 1 biological replicate (n = 16 each) (***P < 0.001 and **P < 0.01 compared to EV in unidirectional ANOVA, Dunnett's multiple comparison test).

[0255] The upper panel of Fig. 60 shows an image of a regenerated root on day 21 of RIM, and the lower panel shows an image of a fully regenerated plant on day 14 after soil transplanting. Scale bar = 2 mm.

[0256] Figure 61a is a gel image of DNA obtained by PCR using gDNA from pWOX5::nYFP and pSCR::SCR-mGFP Arabidopsis plants as positive controls, and Figures 61b to 61j are gel images of DNA obtained by PCR using each gDNA as a template. The gDNA was isolated from regenerated B. oleracea (bd), S. lycopersicum (eg), and C. annuum (hj) plants. The gene combinations used for transfection of protoplasts prior to regeneration are listed above. Culture conditions were carried out as standard culture (b, e, h) or shortened culture (PIM 7d → CIM1 7d → CIM2 28d: c, f, i, PIM 7d → CIM1 7d → CIM2 21d: d, g, j).

[0257] Figure 62a shows fluorescence microscopy images of microcalluses formed at specific time points during the PIM and CIM stages, stained with Calcofluor White, with scale bars: PIM 7, PIM 11, CIM 14 - 100 μm; CIM 21 - 250 μm; CIM 42 - 500 μm; CIM 60 - 1 mm. Figure 62b shows the results of quantifying the quantity of microcalluses formed at specific time points from rice leaf sheath protoplasts under PIM and CIM culture conditions by analyzing the Calcofluor White-stained samples using ImageJ; the data are expressed as mean ± standard deviation (SD) for four biological replicates (n = 5 each). Statistical significance was evaluated using Dunnett's test of multiple comparisons following two-way ANOVA (****P < 0.0001). Figure 62c is a representative image showing shoot regeneration from microcalluses at specific time points; initial shoot emergence was observed at SIM 10 days, and clear shoot regeneration was confirmed at SIM 28 days. The last row is a representative image showing shoot regeneration from microcalluses at SIM 28 days, with each image representing a single biological replicate (n = 20). Here, the scale bar is 2 mm. Figure 62d shows the proportion of rice microcalluses that formed shoots at SIM 28 days under standard alginate culture conditions. Data are presented as mean ± SD for four biological replicates (n = 20 each). Statistical significance was evaluated using Dunnett's test of multiple comparisons following one-way ANOVA (****P < 0.0001, *P < 0.05). In the diagram, 'At' is derived from Arabidopsis thaliana, and 'OS' is derived from Oryza sativa.

[0258] Figure 63a shows fluorescence microscopy images of microcalluses formed at specific time points during the CIM stage, stained with Calcofluor White, with scale bars: CIM 14 days - 200 μm; CIM 21 days - 250 μm; CIM 42 days - 1 mm. Figure 63b shows the results of quantifying the number of microcalluses formed from rice sheath protoplasts at specific time points under CIM culture conditions by analyzing the Calcofluor White-stained samples using ImageJ. Data are presented as mean ± standard deviation (SD) for four biological replicates (n = 5 each). Statistical significance was evaluated using Dunnett's test of multiple comparisons following two-way ANOVA (****P < 0.0001). Figure 63c illustrates the shoot regeneration phenomenon observed at specific time points during the SIM stage, with the first and second rows showing shoot initiation at SIM 10 days and subsequent shoot regeneration at SIM 21 days, respectively. The last row is a representative image of shoot regeneration from microcallus at SIM 21 days. Each image represents a single biological replicate (n = 20), with a scale bar of 2 mm. Figure 63d shows the proportion of rice microcallus that formed shoots at SIM 21 days under shortened alginate culture conditions; data are expressed as mean ± SD for four biological replicates (n = 20 each). Statistical significance was evaluated using Dunnett's test of multiple comparisons following one-way ANOVA (****P < 0.0001).

[0259] Figure 64a shows a fluorescence microscopy image of microcalluses derived from soybean mesophyll protoplasts co-introduced with a specific gene combination, stained with chalcofluor white at 30 days of PIM, scale bar: 250 μm. The soybean gene combinations used are as follows, where 'GM' is derived from soybean (Glycine max):

[0260] GmSEPW1: GmSCR1, GmESR1-1, GmPSK5, GmWOX5-1

[0261] GmSEPW2: GmSCR1, GmESR1-1, GmPSK5, GmWOX5-2

[0262] GmSEPW3: GmSCR1, GmESR1-2, GmPSK5, GmWOX5-1

[0263] GmSEPW4: GmSCR1, GmESR1-2, GmPSK5, GmWOX5-2

[0264] GmSEPW5: GmSCR2, GmESR1-1, GmPSK5, GmWOX5-1

[0265] GmSEPW6: GmSCR2, GmESR1-1, GmPSK5, GmWOX5-2

[0266] GmSEPW7: GmSCR2, GmESR1-2, GmPSK5, GmWOX5-1

[0267] GmSEPW8: GmSCR2, GmESR1-2, GmPSK5, GmWOX5-2

[0268] GmPWL1: GmPSK5, GmWOX5-1, GmLBD16-1

[0269] GmPWL2: GmPSK5, GmWOX5-2, GmLBD16-1

[0270] GmPWL3: GmPSK5, GmWOX5-1, GmLBD16-2

[0271] GmPWL4: GmPSK5, GmWOX5-2, GmLBD16-2

[0272] Figure 64b shows the proportion of microcalluses formed from soybean protoplasts quantified based on samples stained with chalcofluor white at 30 days of PIM, with data presented as mean ± standard deviation (SD) for five biological replicates (n = 5 each). Statistical comparisons were performed using one-way ANOVA and Dunnett's test of multiple comparisons compared to EV (control) (****P < 0.0001, ns: not significant). Figure 64c is a representative image of regenerated soybean sprouts at 28 days of SIM under standard alginate culture conditions. The scale bar is 2 mm. Figure 64d shows the proportion of soybean microcalluses that formed sprouts at 28 days of SIM under standard alginate culture conditions. Data were expressed as mean ± SD for five biological replicates (n = 16 each), and statistical significance was evaluated using Dunnett's test of multiple comparisons following one-way ANOVA (****P < 0.0001, ***P = 0.0004, ns: not significant).

[0273] Figure 65a is a fluorescence microscopy image stained with Calcofluor White of microcalluses derived from soybean mesophyll protoplasts co-introduced with a specific gene combination at 15 days of PIM, scale bar: 100 μm. Figure 65b shows the proportion of microcalluses formed from soybean protoplasts, quantified based on samples stained with Calcofluor White at 15 days of PIM; data are expressed as mean ± standard deviation (SD) for five biological replicates (n = 5 each). Statistical comparisons were performed using one-way ANOVA and Dunnett's test of multiple comparisons against the EV control group (****P < 0.0001, ns: not significant). Figure 65c is a representative image of regenerated soybean sprouts at 21 days of SIM under shortened alginate culture conditions, scale bar: 2 mm. Figure 65d shows the proportion of sprouted soybean microcalluses at SIM 21 days under shortened alginate culture conditions, and data are expressed as mean ± SD for five biological replicates (n = 16 each). Statistical significance was evaluated by Dunnett's test of multiple comparisons following one-way ANOVA (****P < 0.0001).

[0274] FIG. 66 illustrates a vector map of a transient transformation vector (HBT-PGSG-sGFP-NOS) according to one embodiment of the present invention.

[0275] FIG. 67 illustrates a vector map of a transient transformation vector (HBT-PGSG-mRFP-NOS) according to one embodiment of the present invention.

[0276] FIG. 68 illustrates a vector map of a transient transformation vector (HBT-PGSG-mBFP-NOS) according to one embodiment of the present invention.

[0277] The present invention will be described in more detail below through examples. These examples are intended solely to explain the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the invention.

[0278]

[0279] Examples

[0280]

[0281] Preparation of Primer

[0282] The sequence information of each primer used in the following experiments is shown in Tables 1 to 4 below.

[0283] Serial Number Primers for HiFi DNA Assembly Forward Primer (5'->3') Reverse Primer (5'->3') 1HBT-PGSG-NOS vector GAT GTT CAAA CAT TT GGCAA (Sequence No. 56) GGATCC GATGGGTT GCAC GAT (Sequence No. 57) 2s GFP TG CAACC CAT CG GAT CC GGG TCAG GTG TG AG CAAGGG C GAGG AG (Sequence No. 58) AA TG TT TG AA CG AT CT GC AG CC GG GC GG CC GC TT TA (Sequence No. 59) 3m RF PT GCA ACC CAT CG GAT CC GG GTC AG GTA TG GTG TC TA AGGG CG AA GAG (Sequence No. 60) AA TG TT TG AA CG AT CAT TA AG TT TG TG CC CC AG TT T (Sequence No. 61) 4m B FP TG CA ACC CAT CG GAT CC GGG TC AG GTA TG TC TG AA TT GA TT AA AG AG (Sequence No. 62)AATGTTTGAACGATCTTAGTTCAATTTGTGTCCTAA(Sequence No. 63)5SCR (AT3G54220)-sGFPAACCCATCGGATCCCATGGCGGAATCCGGCGATTT(Sequence No. 64)GCTCACACCTGACCCAGAACGAGGCGTCCAAGCTGA(Sequence No. 65)6SCR (AT3G54220)-mRFPAACCCATCGGATCCCATGGCGGAATCCGGCGATTT(Sequence No. 66)CACCATACCTGACCCAGAACGAGGCGTCCAAGCTGA(Sequence No. 67)7PSK5 (AT5G65870)-mRFPAACCCATCGGATCCCATGGTTAAGTTCACAACTTT(Sequence No. 68)CACCATACCTGACCCGGGATTGTGGTTTTGAGTGT(Sequence No. 69)8ERF115 (AT5G07310)-mBFPAACCCATCGGATCCCATGGCGAATTCAGGAAATTATGG(Sequence No. 70)AGACATACCTGACCCAAAACCAGAATTAGGAGGTG(Sequence No. 71)9PAT1 (AT5G48150)-sGFPAACCCATCGGATCCCATGTACAAGCAGCCTAGACAAGAGC(Sequence No.72)GCTCACACCTGACCCTTTCCAAGCACACGAGGCAACC(Sequence No. 73)10WOX5 (AT3G11260)-sGFPAACCCATCGGATCCCATGTCTTTCTCCGTGAAAGGTC(Sequence No. 74)GCTCACACCTGACCCAAGAAAGCTTAATCGAAGATCT(Sequence No. 75)11WOX5 (AT3G11260)-mRFPAACCCATCGGATCCCATGTCTTTCTCCGTGAAAGGTC(Sequence No. 76)CACCATACCTGACCCAAGAAAGCTTAATCGAAGATCT(Sequence No. 77)12ESR1(AT1G12980)-mBFPAACCCATCGGATCCCATGGAAAAAGCCTTGAGAAACTTC(Sequence No. 78)AGACATACCTGACCCTCCCCACGATCTTCGGCAAGTA(Sequence No 79)13PLT3 (AT5G10510)-mBFPAACCCATCGGATCCCATGGAGATGTTGAGGTCATC(Sequence No. 80)AGACATACCTGACCCGTAAGACTGATTAGGCCAGA(Sequence No. 81)14PLT7 (AT5G65510)-mRFPAACCCATCGGATCCCATGGCGGATTCAACAACCTT(Sequence No. 82)CACCATACCTGACCCGTAAGACTGGTTAGGCCACA(Sequence No. 83)15LBD16 (AT2G42430)-sGFPAACCCATCGGATCCCATGGCATCTTCCGGTAACGG(Sequence No. 84)GCTCACACCTGACCCGTTCTTCATCATTCTAAGAG(Sequence No. 85)16LBD29 (AT3G58190)-mRFPAACCCATCGGATCCCATGACTAGTTCCAGCTCTAG(Sequence No. 86)CACCATACCTGACCCCGAGAAGGAGATGTAGCCAA(Sequence No. 87)17BBM (AT5G17430)-sGFPAACCCATCGGATCCCATGAACTCGATGAATAACTG(Sequence No. 88)GCTCACACCTGACCCAGTGTCGTTCCAAACTGAAA(Sequence No. 89)18WIND1(AT1G78080)-mRFPAACCCATCGGATCCCATGGCAGCTGCTATGAATTT(Sequence No. 90)CACCATACCTGACCCAGCTAGAATCGAATCCCAAT(Sequence No. 91)19SCR (AT3G54220)-HBTAACCCATCGGATCCCATGGCGGAATCCGGCGATTT(Sequence No. 92)AATGTTTGAACGATCAGAACGAGGCGTCCAAGCTGA(Sequence No. 93)20ESR1(AT1G12980)-HBTAACCCATCGGATCCCATGGAAAAAGCCTTGAGAAACTTC(Sequence No. 94)AATGTTTGAACGATCTCCCCACGATCTTCGGCAAGTA(Sequence No. 95)21PSK5 (AT5G65870)-HBTAACCCATCGGATCCCATGGTTAAGTTCACAACTTT(Sequence No 96)AATGTTTGAACGATCGGGATTGTGGTTTTGAGTGT(Sequence No. 97)22WOX5 (AT3G11260)-HBTAACCCATCGGATCCCATGTCTTTCTCCGTGAAAGGTC(Sequence No. 98)AATGTTTGAACGATCAAGAAAGCTTAATCGAAGATCT(Sequence No. 99)

[0284] Primers for identification or sequencing of positive clones Forward primer (5'->3') Reverse primer (5'->3') 1 HBT-PGSG-NOS vector CTCCCCTTGCTCCGTGGATCCC (Sequence No. 100) 2 35 SPPDK-promoter CGCACAATCCCACTATCCTT (Sequence No. 101) 3 sGFPAGCGGCTGAAGCACTGCACGC (Sequence No. 102) 4 m BFPTCGTTACGACCTTCCAATCC (Sequence No. 103) 5 m RFPGCTTCTTGGCCATGTAGGTGG (Sequence No. 104)

[0285] Primers for genotyping Forward primer (5'->3') Reverse primer (5'->3') 1 SCR (AT3G54220)-1 GAG TG AA GA GA GA GA CAT GTC G TG GA (Sequence No. 105) 2 SCR (AT3G54220)-2 CT CT GC ACT CT T G ACT C ACT GG (Sequence No. 106) 3 ESR1 (AT1G12980) T T G TT CA AG AG ACT AA GG AG AC (Sequence No. 107) 4 PSK5 (AT5G65870) CT C ACT C A C C AA TC CC TA A (Sequence No. 108) 5 WOX5 (AT3G11260) G GA GC TA GA GG CA ATA ACC AG TA (Sequence No. 109) 6 LBD16 (AT2G42430) T T T T C GG TC C GA TG GA ATA GG G T (Sequence No 110)7LBD29 (AT3G58190)GAGTAGTTACCACAACGAAACCTC(Sequence No. 111)8WOX5 (AT3G11260) genomic regionACGGCAAGATAGAGAGCAAGAA TG(Sequence No. 112)GTACTGGTTATTGCCTCTAGCT C(Sequence No. 113)9sGFPAGCGGCTGAAGCACTGCACGC(Sequence No. 114)10mGFPAAATCGATTCCCTTAAGCTCGAT(Sequence No. 115)11mBFPTCGTTACGACCTTCCAATCC(Sequence No. 116)12mRFPGCTTCTTGGCCATGTAGGTGG(Sequence No. 117)

[0286] Primers used for Gateway cloning Forward primer (5'-> 3') Reverse primer (5'-> 3') 1pSCR::SCR_EntryCACCGCTGGTGTTGAATGGATAAGGGATAG(Sequence No. 118)AGAACGAGGCGTCCAAGCTGAAGC(Sequence No. 119)

[0287]

[0288] Preparation of badges

[0289] Information on each medium used in the following experiments is shown in Table 5 below.

[0290] Preparation of Solution and Composition Enzyme Solution for Cell Wall Lithosis 1. A 20 mM MES (Bio Basic, MB0341) solution (pH 5.7) was prepared containing 1.5% (wt / vol) cellulase R10 (Ducefa Biochemie, C8001.0010), 0.4% (wt / vol) macerozyme R10 (Ducefa Biochemie, M8002.0005), 0.4 M D-mannitol (Ducefa Biochemie, M0803.1000), and 20 mM KCl (Daejung, P0168TE3). 2. To inactivate the enzymes in the solution, the temperature was raised to 55 ℃ for 10 minutes. 3. Cooled to room temperature, and 10 mM CaCl2 (Sigma, C3306-500G) and 0.1% BSA (Sigma, A9418) were added. 4. The solution was sterilized by filtering it through a syringe filter (0.22 μm) (Millipore, SLGP R33RS) before use. W5 Solution 1. Containing 154 mM NaCl (Junsei, 2022L1235), 125 mM CaCl2, and 5 mM KCl 2 mM MES (pH 5.7) was prepared. 2. It was sterilized using a syringe filter (0.22 μm) and stored at room temperature. MMG solution 1. Containing 0.4 M D-mannitol and 15 mM MgCl2 (Junsei, 0A1350) 4 mM MES (pH 5.7) was prepared. 2. It was stored at room temperature. PEG-calcium transfection solution: 20–30% (wt / vol) PEG4000 (Fluka, 81240) containing 0.2 M D-mannitol and 100 mM CaCl2 was prepared using ddH2O. Na-Alginate Solution: 1. 2.8 g sodium alginate (Sigma, A2158) and 7.28 g D-mannitol were added to 100 mL of ddH2O. 2. It was autoclaved and stored at room temperature. CaCl2 Agar: 1. 72.8 g D-mannitol and 2.2 g CaCl2 were added to 1 L of ddH2O. 2. 10 g Phyto agar (Ducefa Biochemie, P1003, 1000) was added to the above solution. 3. It was autoclaved and stored at 4°C. Murashige and Skoog (MS) medium 1. 4.2 g MS base salt (Ducefa Biochemie, M0221.0050), 10 g sucrose (Junsei, 2022L1229), and 0.5 g MES were added to 1 L of ddH2O. 2. 0.8% Phytoaga was added. 3. The pH was adjusted to 5.8 and autoclaved. Protoplast induction medium (PIM) 1. NH 4 NO No 3 MS 기본 염 (Ducefa Biochemie, M0238.0050) and Vitamin (Sigma, M3900-50mL) 4.3 g1 L of medium was prepared containing 4% D-glucose (Sigma, G7021-1KG), 6% D-mannitol, MES (700 mg / L), 0.2 mg folic acid (Sigma, F7876), 1 mg 2-4 D (Sigma, D70724), 0.02 mg TDZ (Sigma, P6186-25MG), and 200 mg cefotaxim (MB cell, MB-C4392). 2. The pH was adjusted to 5.6 with KOH, filtered through a syringe filter (0.22 μm), and sterilized. Callus induction medium (CIM1)1. 1 L of medium was prepared containing 4.3 g of MS base salt free of NH4NO3, vitamins, 3% sucrose, 7% D-mannitol, 700 mg MES, 0.11 mg TDZ, and 200 mg cefotaxim. 2. The pH was adjusted to 5.6 with KOH, filtered through a syringe filter (0.22 μm), and sterilized. Callus induction medium (CIM2) 1. 1 L of medium was prepared containing 4.3 g of MS base salt free of NH4NO3 and vitamins, 3% sucrose, 6% D-mannitol, 700 mg MES, 0.11 mg TDZ, and 200 mg cefotaxim. 2. The pH was adjusted to 5.6 with KOH, filtered through a syringe filter (0.22 μm), and sterilized. Shoot induction medium (SIM) 1. 1 L of medium was prepared containing 4.3 g Gamborg's B-5 basic salt mixture, a mixture of minimal organic matter (Sigma, G5893-10 L), 3% sucrose, and 0.5 g MES. 2. The pH was adjusted to 5.6 with KOH, and 0.8% Phytoaga was added and the mixture was autoclaved. 3. Filter-sterilized 2 IP (6-(γ,γ-dimethylallylamino) purine) (894 μL from 1 mg / mL stock), IAA (158 μL from 1 mg / mL stock), and 200 mg cefotaxim were added.Root induction medium (RIM) 1. 1 L of medium was prepared containing 4.3 g Gamborg's B-5 basic salt mixture, a mixture of minimal organic matter (Sigma, G5893-10 L), 3% sucrose, and 0.5 g MES. 2. The pH was adjusted to 5.6 with KOH, and 0.8% Phytoaga was added and the mixture was autoclaved. 3. Filter-sterilized IAA (158 μL from a 1 mg / mL stock) and 200 mg cefotaxim were added.

[0291]

[0292] Genetic combination

[0293] The gene combinations transformed to be temporarily expressed in protoplasts in this experiment are shown in Table 6 below.

[0294] Serial NumberFactor 1Factor 2Factor 3Factor 4CF1SCR-sGFPERF115-mBFPCF2SCR-mRFPBBM-sGFPCF3SCR-sGFPESR1-mBFPCF4SCR-sGFPPSK5-mRFPCF5SCR-sGFPLBD29-mRFPCF6BBM-sGFPPSK5-mRFPCF7BBM-sGFPERF115-mB FPCF8ESR1-mBFPWIND1-mRFPCF9BBM-sGFPLBD29-mRFPCF10WOX5-sGFPLBD29-mRFPCF11SCR-mRFPLBD16-sGFPCF12SCR-mRFPPAT1-sGFPCF13WOX5-mRFPLBD16-sGFPCF14WOX5- sGFPPSK5-mRFPCF15WOX5-sGFPERF115-mBFPCF16ESR1-mBFPPSK5-mRFPCF17ESR1-mBFPPLT7-mRFPCF18PLT3-mBFPPSK5-mRFPCF19WOX5-mRFPPAT1-sGFPCF20SCR-sGFPESR1-m BFPPSK5-mRFPCF21SCR-mRFPESR1-mBFPPAT1-sGFPCF22ESR1-mBFPPSK5-mRFPWOX5-sGFPCF23PSK5-mRFPWOX5-sGFPLBD16-mRFPCF24SCR-sGFPESR1-mBFPPSK5-mRFPWOX5-sGFP

[0295]

[0296] Construction of vectors and plasmids

[0297] To implement transient gene expression in protoplasts, the NEBuilder HiFi DNA assembly reaction protocol (New England Biolabs, E2621S) was used. By adding a DNA sequence containing multiple cloning sites (MCS) including BamHI and XmaI / SmaI sites to the basic vector backbone, HBT-sGFP(S65T)-NOS, a vector was constructed named HBT-PGSG-sGFP(S65T)-NOS (Fig. 66; SEQ ID 53) that encodes four amino acids (pro-gly-ser-gly) downstream of the 35SPPDK promoter. Additionally, the HBT-PGSG-mRFP-NOS vector (Fig. 67; SEQ ID NO. 54) and the HBT-PGSG-mBFP-NOS vector (Fig. 68; SEQ ID NO. 55) were constructed by replacing the sGFP(S65T) coding sequence within the HBT-PGSG-sGFP(S65T)-NOS vector with an mRFP or mBFP coding sequence. The HBT-PGSG-sGFP(S65T)-NOS vector was linearized by cleavage with StuI and purified using a DNA purification kit (Intron Biotechnology, 17290). The vector and the sGFP / mRFP / mBFP insert were amplified using high-performance pfu-X DNA polymerase (SolGent, SPX16-R250) and duplicate primers (Table 1). To remove the plasmid template, the PCR product was cleaved with DpnI and purified using a PCR purification column (Intron Biotechnology, 17290). After removing the plasmid template, the PCR amplification vector backbone was ligated with the sGFP / mRFP / mBFP insert. The resulting ligation mixture was transformed into E. coli DH5α, and ampicillin-resistant colonies were further screened via colony PCR using the primers in Table 2 above, designed for the 35SPPDK promoter and the sGFP / mRFP / mBFP region. Positive clones were finally confirmed by sequencing.To clone the target gene into the HBT-PGSG-sGFP / mRFP / mBFP-NOS vector, first-strand cDNA was synthesized from total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, K1621). Subsequently, the coding sequence (CDS) was amplified by PCR using the primers listed in Table 1. HiFi DNA was assembled using the PCR-amplified CDS and the vector cleaved by SmaI. Genes such as SCR, ESR1, PSK5, and WOX5 were cloned into the sGFP / mRFP / mBFP untagged vector for tag-free experiments. The target gene and the vector backbone (untagged) were amplified (Table 1) and assembled using the NEBuilder HiFi DNA assembly reaction protocol. The final clones were verified by sequencing (Table 2).

[0298]

[0299] Plasmid preparation by CsCl density gradient ultracentrifugation for transfection

[0300] Escherichia coli cells (DH5α) cultured in 250 mL of LB medium supplemented with ampicillin were lysed, and the plasmid was isolated using the alkaline lysis method. The extracted plasmid was suspended in 2 mL of TE buffer (10 mM Tris-HCl containing 1 mM EDTA (pH 8.0)), and then 2.2 g of CsCl (Thermo Fisher Scientific, BP1595-500) and 160 μL of ethidium bromide (10 mg / mL stock; Sigma, E8751) were added. The solution containing dissolved CsCl was transferred to an open-type polycarbonate thick-wall centrifuge tube (Beckman Coulter, TLA110) and ultracentrifuged at 45,000 rpm at 22 °C for 16 hours using an Optima MAX-XP (Beckman Coulter). The superhelical form of the plasmid was carefully extracted using a syringe, and then washed 4 to 5 times with 1-butanol (Sigma, B7906-500 mL) until the solution became clear. The purified plasmid was concentrated by ethanol precipitation and quantified using Nanodrop (GE Healthcare).

[0301]

[0302] Plant material and protoplasm separation

[0303] Arabidopsis thaliana Accession Columbia-0 (Col) seeds were sterilized 5–6 times using a seed sterilization solution [a solution of 0.1% Triton X-100 (Thermo Fisher Scientific, A16046.AP) dissolved in 70% ethanol (Merk, 1.00983.1011)], followed by two washes with 90% ethanol. Seeds were sown on solid MS medium and stored for 3–4 days under dark conditions at 4°C for stratification; afterward, they were transferred to a plant growth chamber with a long-day photoperiod (16-hour light / 8-hour dark cycle) at 22°C for seed germination. Brassica oleracea L. cv. Okina, Solanum lycopersicum L. cv. MicroTom, and Capsicum annuum L. cv. C15 seeds were sterilized 5 to 6 times with a seed sterilization solution and treated with a 3% sodium hypochlorite (Sigma, MSDS-105614) solution for 2 minutes. The seeds were washed 4 to 5 times with sterile water and 2 times with 90% ethanol, then sown on solid MS medium (B. oleracea) or 1 / 2 MS medium supplemented with 1.5% sucrose (S. lycopersicum and C. annuum). For stratification, the seeds were stored for 4 days under dark conditions at 4°C; B. oleracea seeds were germinated and cultivated at 22°C, while S. lycopersicum and C. annuum seeds were cultivated at 25°C under a long-day photoperiod. Protoplasts were isolated by the following process: Approximately 100 to 150 leaves from 15-day-old Col grown in MS were cut and placed in 10 mL of enzyme solution, and digested for 12 hours under dark conditions at 22 °C to release mesophyll protoplasts. The enzyme / protoplast solution was diluted with an equal volume of W5 solution and filtered using a 40 µm cell filter (SPL Life Sciences, 93040) to remove undigested leaf tissue.The generated protoplasts were centrifuged at 600 rpm for 5 minutes and washed twice with W5 solution, after which the green pellet containing the mesophyll protoplasts was resuspended in a reduced amount of MMG solution. The protoplasts were counted using a hemocytometer under an optical microscope (Carl Zeiss, Axioskop 40), and the density was finally determined to ~2 x 10⁶ using MMG solution prior to transfection or culture. 5 It was adjusted to / mL. Protoplasts of B. oleracea, S. lycopersicum, and C. annuum were also isolated from the leaves, cotyledons, or hypocotyls of 2- to 3-week-old seedlings grown in MS medium using the same protocol.

[0304]

[0305] Staining of cells or microcalli

[0306] To evaluate the viability of protoplasts, fluorescein diacetate (FDA; Invitrogen, F1303) staining was performed. An FDA staining solution was prepared by adding 20 μL of FDA stock (5 mg / mL FDA in acetone) to 1 mL of 0.8 M D-mannitol (Ducefa Biochemie, M0803.1000). 5 μL of the FDA staining solution was added to 10 μL of protoplasts and incubated for 2 minutes, after which the protoplasts were washed with W5 solution prior to imaging. Calcofluor-white (Sigma, 18909-100ML-F) staining was used to confirm protoplast cleavage and microcallus development in PIM or CIM1 / 2. Protoplast cultures obtained from liquid PIM or CIM1 / 2 were mixed with an equal volume of calcofluoride white (diluted 1:10) for 2 minutes, and then washed with W5 solution prior to imaging. For alginate-embedded protoplasts or developing microcalluses, small alginate block fragments were cut out, stained with calcofluoride white for 2 minutes on separate Petri plates (60 x 15 mm, SPL Life Sciences, 11060), washed with W5 solution, and observed under a fluorescence (Carl Zeiss, Axiozoom V16) or confocal (Carl Zeiss, LSM700) microscope. Propidium iodide (PI; Sigma, P4170) staining was performed with a 1 mg / mL stock to visualize intact cell walls. Plant tissues were immersed in the PI stock for 1 minute, and then washed with sterile double-distilled water prior to confocal imaging (Carl Zeiss, LSM700).

[0307]

[0308] DNA-PEG-calcium-mediated protoplast transfection

[0309] Protoplasts were cultured pre-transfection for 1 hour under dark conditions at 22°C. Approximately 10–20 μg of plasmid DNA prepared by CsCl density gradient ultracentrifugation was used at approximately 2 x 10⁶ per mL. 4100 μL of protoplasts with a cell density was combined. Subsequently, 150 μL of 20–30% PEG-4000 (Fluka, 81240) was added to the protoplast suspension, and the mixture was incubated in the dark at room temperature for 15 minutes. The transfection reaction was terminated by adding an equal amount of W5 solution. The protoplasts were centrifuged at 500 rpm for 5 minutes, washed once with PIM, and finally resuspended in 500 μL of PIM for imaging and subsequent cell culture.

[0310]

[0311] Protoplast culture

[0312] For liquid culture, protoplasts were placed in Petri dishes containing liquid PIM. To prevent hemolysis of the protoplasts, Tween 80 (Thermo Fisher Scientific, 28329) was added, and the cultures were maintained in the dark at 22°C. The medium was replaced with fresh medium every 5 to 7 days to prevent the accumulation of toxins. For the standard culture protocol, after culturing in PIM for 11 days, the culture was switched to CIM1 for 30 days, followed by an additional switch to CIM2 for 30 days. To induce sprouting in the callus developed in CIM2, the culture was transferred to solid SIM and incubated for 28 days. Support matrices such as low-melting point agarose (Sigma, A9414), VitroGel (TheWell Bioscience, VHM01), Phytoagar (Ducefa Biochemie, P1003.1000), and sodium alginate (Sigma, A2158) were used for protoplast culture. For the sodium alginate culture method, protoplasts were suspended in PIM and mixed with 3% sodium alginate; the mixture was then poured onto a solid calcium agar bed and polymerized. After one hour, the plates were covered with PIM and incubated at 22°C under dark conditions. Similar to liquid culture, the medium was replaced with fresh medium every 5–7 days. After 11 days of PIM incubation, the samples were cultured in CIM1 for 30 days and then in CIM2 for 30 days. Visible micro-calluses of approximately 1–2 mm in size were isolated from the alginate layer and cultured on a solid SIM for 28 days to induce sprouting. To induce root growth, the regenerated sprouts were transferred to a solid RIM and cultured for 21 days. After root regeneration, the fully regenerated plants were transferred to soil for adaptation and cultured. The seeds of the regenerated plants were collected and stored at 4°C for future use.

[0313]

[0314] Microscopic observation

[0315] Protoplast viability, transformation efficiency, and microcallus formation in PIM, CIM1, and CIM2 were investigated using a fluorescence microscope (Carl Zeiss, AxioZoom V16). A GFP filter (excitation-emission at 488 nm) was used to detect the green fluorescence signal from FDA-stained protoplasts. Transformed protoplasts were observed using a fluorescence microscope with three channels (3CH: green, red, and blue filters). Imaging was performed using appropriate excitation lines and excitation and emission filters. Cracked protoplasts or microcalluses stained with chalcofluorine white were visualized using a fluorescence microscope with a DAPI filter (excitation-emission at 447 nm). Confocal imaging (Carl Zeiss, LSM700) was performed to confirm nuclear expression of nYFP and SCR-mGFP in protoplasts and microcalluses transfected with untagged SEPW. Protoplasts or microcalluses embedded in alginate were sectioned, placed on glass slides, and imaged using a confocal microscope. Root tips of transgenic Arabidopsis seedlings homozygous for pWOX5::nYFP or pSCR::SCR-mGFP were stained with PI, rinsed with sterile water, placed on glass slides, and imaged using a confocal microscope. Confocal imaging involved 3 channels with brightfield illumination. The solid-state laser ranged from 405 to 639 nm. Images were captured at 5 frames per second at 20x or 40x magnification and superimposed to create merged images. Consistency in magnification, exposure time, and gamma settings was maintained across all microscopic images. Brightness and contrast level adjustments were performed uniformly for each channel using Zen Microscopy software.

[0316]

[0317] Cell counting

[0318] Protoplast counting was performed using a hemocytometer under an optical microscope (Carl Zeiss, Axioskop 40). The total number of protoplasts or microcalluses, transfection efficiency, and the percentage of the total area covered by microcalluses after calcofluorine white staining were calculated using Image-J software.

[0319]

[0320] Genotype analysis

[0321] In the genotyping experiment, genomic DNA (gDNA) was isolated from Arabidopsis and crop plants, and an extraction buffer was prepared by diluting Edwards solution 10-fold with TB buffer. Approximately 5–10 mg of leaf tissue was placed in Eppendorf tubes (e-tubes) and pulverized with 200 μL of extraction buffer. The resulting green supernatant was centrifuged at 13,000 rpm for 5 minutes and carefully transferred to a new e-tube. Subsequently, an equal amount of isopropanol was added to precipitate the gDNA, and the sample was washed with 70% ethanol. The precipitated gDNA was ultimately suspended in sterile water for quantification and quality evaluation on an agarose gel, followed by use in PCR. The PCR products were loaded and examined on an agarose gel to confirm the presence of the gene of interest in the genome of the regenerated plants. Finally, gel images were captured using a Gel Logic 100 imaging system.

[0322]

[0323] pSCR::SCR-mGFP and pWOX5::nYFP plants

[0324] The genomic fragment containing the 2.131kb SCR promoter region and the entire SCR coding region was first amplified from Col genomic DNA using pSCR::SCR_Entry_F and pSCR::SCR_Entry_R primers (Table 4), and pENTR TM Cloned into the / SD / D-TOPO entry vector. Gateway TMpSCR::SCR-mGFP was generated using the LR reaction (Invitrogen, 11791020) and the pEarleyGate vector, and then transformed into Col via Agrobacterium-mediated transformation using the floral dip method. Transformed plants were selected in MS medium containing 50 mg / L of BASTA (glufosinate ammonium, GoldBio, P-165-1), and homologous lines were established in subsequent generations. pWOX5::nYFP was obtained from Ben Scheres (Wageningen U.).

[0325]

[0326] Statistics and Reproducibility

[0327] Data were presented as mean ± standard deviation (SD) of results from at least two independent biological replicate experiments. Each experiment consisted of three descriptive replicates. Statistical analysis was performed using one-way ANOVA, two-way ANOVA, Student's t-test, and two-sided distributions to evaluate the significance of the experiments. The analysis was conducted using GraphPad Prism 8.0 software, and results with a p-value ≤ 0.05 between groups were considered statistically significant.

[0328]

[0329] Stable gene expression for 7 days is possible due to transient transfection of mesophyll protoplasts.

[0330] As a representative plant, protoplasts of Arabidopsis mesophyll cells (hereinafter referred to as mesophyll protoplasts) were used to induce transient expression of the gene combinations according to the present invention. Specifically, Arabidopsis mesophyll protoplasts were transformed with an HBT-PGSG-NOS vector (containing fluorescent markers sGFP, mRFP, or mBFP) in which the gene combination according to the present invention was cloned, and the number of fluorescent cells and fluorescence intensity for all markers were detected (Fig. 1). After 1 day had passed since transformation, expression of the fluorescent markers was detected in 90% of the cells, indicating a very high transformation rate. Furthermore, the fluorescence intensity of all markers remained stable for the first 7 days (Fig. 2). From this, it was confirmed that the gene combination according to the present invention was transformed into protoplasts with high efficiency via the HBT-PGSG-NOS vector and was stably expressed after transformation. Generally, it takes approximately 4 days to 2 weeks to reprogram cells from callus to a pluripotent state during tissue culture. Therefore, it was expected that the continuous expression of the fluorescent marker for 7 days could be effective in reprogramming the protoplasts into a pluripotent state. The standard protocol for protoplast regeneration (Fig. 3a) involves culturing microcalluses (diameter ~50–100 μm) formed on day 11 of culture in PIM on callus induction medium 1 (CIM1) and callus induction medium 2 (CIM2) until day 71, during which their size gradually increases, and then regenerating into whole plants over a total of 120 days through culture on sprout induction medium (SIM) and root induction medium (RIM). In this experiment, to reduce the time required for sprout and whole plant regeneration, protoplast culture was also attempted using two shortened regeneration protocols shown in Figs. 3b and 3c.

[0331]

[0332] Evaluation of the effect of transient expression of gene combinations on promoting microcallus development

[0333] To confirm the effects of the gene combination according to the present invention on the sprouting and overall plant regeneration of plant protoplasts, Arabidopsis mesophyll protoplasts were co-transformed with the genes shown in Table 6 above, and the mesophyll protoplasts were applied to liquid PIM to induce cell division and microcallus formation. In the case of the untransformed control group (UT), the microcallus formation rate from the protoplasts was approximately 5% on day 7 of PIM, showing a very low microcallus formation rate. However, it was confirmed that the microcallus formation rate was very high in the protoplasts transformed with the gene combination according to the present invention. In particular, when the combination of SCR, ESR1, and PSK5 and the combination of WOX5 and PSK5 were transformed, the microcallus formation rate was very high on day 7 of PIM and day 7 of CIM1 (Figs. 4 and 5). As a result of performing additional analysis using chalcofluorescent white staining, it was clearly confirmed that the microcallus growth efficiency was significantly improved in protoplasts transformed with the gene combination according to the present invention compared to the untransformed control (UT) (Fig. 6). In particular, in protoplasts transformed with the combination of SCR, ESR1, PSK5 and the combination of WOX5, PSK5, microcallus development was promoted to a high level of over 30% of the total area percentage of microcallus at 7 days of CIM1 (Fig. 5).

[0334] Additionally, microcalluses derived from untransformed protoplasts (UT) and protoplasts transformed with the gene combination according to the present invention were obtained from CIM1 liquid culture for 7 days, embedded in CIM2 sodium alginate culture medium, and their growth was monitored. As a result, compared to the control group, it was observed that the level of microcallus growth in protoplasts transformed with the gene combination according to the present invention increased significantly at CIM2 day 20 (Fig. 7a). Furthermore, the microcalluses developing in protoplasts transformed with the gene combination according to the present invention exhibited various shapes, ranging from round to irregular, whereas in the case of the control protoplasts, well-developed microcalluses were hardly observed at CIM2 day 25 (Fig. 7b).

[0335] From these results, it was found that the gene combination according to the present invention promotes the development and growth of microcallus from protoplasts.

[0336]

[0337] Evaluation of Sprouting Regeneration Efficiency of Protoplast-Derived Microcallus

[0338] In the case of protoplasts transformed with the gene combination according to the present invention, it was confirmed that microcalluses formed earlier (i.e., on day 7 of CIM1) compared to the control group (EV) transformed with a covector (Figs. 8a, 8b). These microcalluses exhibited a rapid growth pattern throughout the entire CIM2 culture period compared to the EV control group. After culturing microcalluses derived from protoplasts transformed with the gene combination according to the present invention in CIM2 for 28–30 days, and then transferring them to a solid SIM for culture, it was confirmed that sprouts regenerated on day 28 (Figs. 9a, 9b). In particular, microcalluses derived from protoplasts co-transformed with SEP (SCR + ESR1 + PSK5), EP (ESR1 + PSK5), WP (WOX5 + PSK5), and WL29 (WOX5 + LBD29) showed an excellent percentage of sprout regeneration on day 28 of SIM. More specifically, sprouts were regenerated in 65% of the microcalluses derived from SEP co-transformed protoplasts, but no sprout regeneration was observed in the control group (EV) transformed with the co-vector under the same conditions (Figs. 10a, 10b and 11).

[0339] To more accurately evaluate the sprout regeneration-promoting effect of the gene combination according to the present invention, the CIM2 culture period was reduced to 20–21 days before transferring the microcalluses to SIM. As a result, microcalluses transformed with some gene combinations according to the present invention showed excellent sprout regeneration efficiency (Figs. 12a, 12b). In particular, microcalluses co-transformed with SEP showed the highest sprout regeneration efficiency reaching ~45% (Figs. 13a, 13b and 14). Additionally, sprouts regenerated from SEP, WL29, EP, and WP co-transformers took root on day 21 of RIM and eventually regenerated into whole plants (Fig. 15).

[0340]

[0341] Confirmation of vector persistence in developed shoots and regenerated whole plants

[0342] Sprouting regeneration of the untransformed control (UT), the control (EV) transformed with a blank vector, and the protoplast transformed with the gene combination according to the present invention was re-evaluated under standard alginate culture conditions (PIM 11 days, CIM1 30 days, CIM2 30 days).

[0343] In both the untransformed control group (UT) and the control group transformed with a covector (EV), green-colored microcalluses (~2 mm) were observed at 30 days of CIM2 (Fig. 16a), but only about 17% of these microcalluses regenerated sprouts on day 28 of SIM (Figs. 16b, 16c, 16d). However, in the case of protoplasts transformed with the gene combination (SEP or SEPW) according to the present invention, the microcallus development rate was significantly higher compared to the control group, and in particular, in the case of SEPW co-transformed protoplasts, the microcallus formation rate was very high at approximately 55% (Figs. 17a, 17b, Figs. 18-21). This result is about four times higher than that of the untransformed control group (UT) or the control group transformed with a covector (EV).

[0344] The sprout regeneration efficiency from microcalluses derived from SEPW, SEP, EPW, and PWL co-transfected protoplasts was also very high. In particular, in the case of microcalluses developed after transformation with SEPW, sprouts regenerated from up to ~90%, which is at least 5 times higher than the untransformed control group (UT) or the control group transformed with a covector (EV) (Figs. 22, 23, 24a, 24b). Thus, the sprouts regenerated according to the present invention successfully rooted in RIM (Figs. 25a, 25b).

[0345] Next, as a result of performing the above plant regeneration experiment under two shortened alginate culture conditions, protoplasts transfected with the gene combination according to the present invention exhibited higher microcallus development efficiency compared to the untransformed control (UT) or the control transformed with a covector (EV) (Figs. 26a-26d, Fig. 27, Figs. 28a, 28b, Fig. 29). In addition, shoots regenerated with high efficiency from microcalluses derived from protoplasts transfected with the gene combination, whereas no shoot regeneration was observed in the control microcalluses (Figs. 30a-30c, Fig. 31, Figs. 32a-32c, Fig. 33, Figs. 34a-34c, Figs. 35a-35c). SEPW co-transformed protoplasts showed the best results in both microcallus development and shoot regeneration efficiency, and the regenerated shoots rooted well in RIM (Figs. 36a, 36b). In addition, the entire plant was regenerated from the sprout regenerated from the protoplast according to the present invention and showed successful adaptation to the soil (Fig. 37).

[0346] Finally, upon confirming the genotype of the regenerated plant, it was confirmed that the transforming gene used for the transient transformation of the protoplast was absent in the regenerated plant (Fig. 38). From these results, it was found that the transient transformation of the gene combination according to the present invention not only increases the efficiency of plant regeneration from the protoplast and shortens the regeneration time, but also enables the regeneration of a plant in which the transforming gene is no longer present (each gene—sGFP / mBFP / mRFP—was not observed).

[0347]

[0348] long-term reprogramming of protoplasts into pluripotent cells through transient expression

[0349] As a result of studying the expression kinetics after co-transfection of SEPW gene combinations in Arabidopsis mesophyll protoplasts, SCR-sGFP, WOX5-sGFP, PSK5-mRFP, and ESR1-mBFP were all stably expressed for up to 7 days after transfection, but then expression rapidly decreased on day 9 and was no longer expressed on day 11 (Fig. 39, Fig. 40a-40b).

[0350] To determine whether regenerative potential is increased by the transient expression of SEPW at the molecular level, mesophyll protoplasts were extracted from homozygous pWOX5::nYFP and pSCR::SCR-mGFP stable transgenic plants. The expression activity of WOX5 and SCR, well-known pluripotency marker genes, was confirmed using fluorescent markers (nYFP or mGFP). Subsequently, the extracted protoplasts were co-transgenic using SEPW without fluorescent tags, and the expression patterns of nYFP or SCR-mGFP were investigated. Both nYFP and SCR-mGFP were strongly expressed in the nuclei of mesophyll protoplasts for 9 days after transgenicity, but not in UT protoplasts (Figs. 41a-41b, 42a-42b). In UT protoplasts, nYFP and SCR-mGFP expression was observed at a frequency of less than 3% up to 6 hours after transgenicity, which is expected to be attributed to mechanical stress associated with protoplast separation. The expression of nYFP and SCR-mGFP in the nuclei of protoplasts that did not form microcalluses (non-dividing protoplasts) decreased on day 11 of PIM culture (Figs. 41a, 42a). However, in microcalluses derived from SEPW (untagged) co-transformed protoplasts, nYFP and SCR-mGFP were continuously expressed during PIM, CIM1, CIM2, and early SIM (SIM 3d) cultures (Figs. 43a-43c, Figs. 44a-44c). The proportion of microcalluses expressing nYFP and SCR-mGFP reached nearly 80% throughout the culture period. From these experimental results, it was found that the transient expression of SEPW stably activates the expression of major pluripotency marker genes such as WOX5 and SCR, thereby inducing long-term reprogramming of mesophyll protoplasts.

[0351]

[0352] Promotion of crop regeneration free of foreign genes

[0353] To determine whether the gene combination according to the present invention can promote regeneration in plant species other than Arabidopsis, the protoplasts of Brassica oleracea L. cv. Okina (cabbage), Solanum lycopersicum L. cv. MicroTom (tomato), and Capsicum annuum L. cv. C15 (pepper pepper) were co-transformed with the SEPW and PWL gene combination, cultured under standard protoplast culture conditions, and the microcallus development efficiency was evaluated compared to the control group. The mesophyll protoplasts of B. oleracea, S. lycopersicum, and C. annuum co-transformed with the SEPW and PWL gene combination showed an increased microcallus development rate compared to the control groups UT and EV during PIM and CIM1 cultures (Figs. 45a-45c, 46-50), and the microcallus sprout regeneration efficiency was also significantly increased in SIM (Figs. 45d, 51, 52, 53). In addition, when the gene combination according to the present invention was transgenic in all three crop species, both regeneration into whole plants and adaptation to soil were successfully achieved (Figs. 54a, 54b).

[0354] Subsequently, the same experiment was performed under two shortened culture conditions. As a result, shoots did not regenerate in the UT and EV control groups of the three plant species, but when the SEPW or PWL gene combination was transiently transformed according to the present invention, the developmental efficiency of microcallus increased, and the regeneration efficiency of shoots, roots, and whole plants was also excellent (Figs. 55-60). As a result of the genotyping experiment, the gene used for transient transfection was not detected in any of the three regenerated plant species (Fig. 61).

[0355] From the experiments described above, it was found that temporarily transforming a plant protoplast with the gene combination according to the present invention enables regeneration of various crop species without permanent transformation, even under conditions where regeneration is impossible.

[0356]

[0357] Interspecies protoplast reprogramming and bud regeneration

[0358] To determine whether the protoplast reprogramming and regeneration processes mediated by SEPW and PWL are conserved processes across various plant species, the regenerative capacity of genes from Arabidopsis (AtSEPW / AtPWL) and rice (OsSEPW / OsPWL) in rice was investigated. Under standard alginate culture conditions (PIM 11 days, CIM 60 days, SIM 28 days), co-introduction of Arabidopsis and rice homologous genes, respectively, into rice protoplasts enhanced microcallus formation compared to UT and EV controls (Figs. 62a, 62b). In particular, the combination of OsSEPW and OsPWL induced much larger and more proliferative microcalluses (Fig. 62b). At SIM 10 days, shoot-like structures began to appear from microcalluses derived from protoplasts co-introduced with OsSEPW and OsPWL, indicating the onset of visible shoot organ formation. However, no shoot formation was observed in the UT and EV control groups at SIM 10 days (Fig. 62c). At SIM 28 days, the highest shoot regeneration efficiency of approximately 45% was observed under the condition where OsSEPW was co-introduced, followed by OsPWL, AtSEPW, and AtPWL, while there was almost no regeneration in the UT and EV control groups (approx. 5%) (Fig. 62d). These results demonstrate that while Arabidopsis gene combinations can induce reprogramming in rice, rice homologous genes exhibit superior performance and lead to optimal shoot regeneration.

[0359] Under alginate culture conditions with shortened culture periods (PIM 7 days, CIM 42 days, SIM 21 days), the ability to regenerate sprouts was maintained in protoplasts co-introduced with OsSEPW and OsPWL, and AtSEPW / PWL showed a response in microcallus growth and proliferation; however, when comparing the results with UT and EV controls, it was found that optimizing homologous genes is very important to induce regeneration within a limited period (Figs. 63a-63d).

[0360] When the same approach was applied to the soybean variety (Williams 82), GmSEPW5 was found to be the most superior homologous gene combination that strongly induces microcallus formation and sprout regeneration (PIM 30 days, CIM 60 days, SIM 28 days conditions). Soybean protoplasts co-introduced with AtSEPW showed effects on microcallus formation and sprout regeneration efficiency (Figs. 64a-64d). In particular, under conditions with shortened culture periods (PIM 15 days, CIM 45 days, SIM 21 days), regeneration occurred in protoplasts co-introduced with GmSEPW5 and GmSEPW6, whereas such effects were not observed in the UT and EV controls (Figs. 65a-65d).

[0361] In both standard and shortened alginate culture systems, rice and soybean homologous genes demonstrate better effects than Arabidopsis factors in their respective plants, showing that they can be a powerful strategy for inducing regeneration in various cultivated crops. In summary, this experiment demonstrates that reprogramming and regeneration by SEPW / PWL are evolutionarily conserved and therefore universally applicable. However, it was found that using homologous genes specific to a particular species or those of closely related species further enhances the efficiency and speed of regeneration, particularly in species distantly related to Arabidopsis.

[0362]

[0363] In numerous crop species, the production of transgenic or genome-edited plants depends on successfully regenerating plants from transgenic tissues or edited protoplasts. Despite the extensive benefits of genetic modification or genome editing, plant regeneration acts as a major bottleneck in enabling these processes. The transient transgenic combination of genes according to the present invention is expected to resolve these issues and significantly contribute to improving the efficiency and target species range of plant genome or epigenome engineering. Furthermore, since the present invention has the potential to increase the regeneration efficiency of haploid and hybrid protoplasts, it is expected to accelerate the development of plant breeding technology by enabling the production of genetically modified, haploid, or hybrid plants with desired characteristics. In addition, the present invention will contribute to the conservation of endangered plant species by promoting regeneration without transgenic means and can serve as a powerful platform technology for future innovation in plant biotechnology, agriculture, and conservation biology.

[0364] The present invention relates to a composition capable of promoting the development of microcalli from a protoplast and also promoting regeneration into a whole plant therefrom, and a method for regenerating a whole plant from a protoplast using said composition.

Claims

A composition for promoting plant regeneration or reprogramming, comprising a gene combination comprising at least one gene among ESR1 and PSK5 and one or more genes selected from the group consisting of SCR, BBM, PAT1, WOX5 and LBD16, or a protein encoded by the same. In paragraph 1, The above composition is a composition that promotes the development of callus from a protoplast. In paragraph 1, A composition in which the above gene combination is selected from the group below: SCR, ESR1 and PSK5; ESR1, PSK5, and WOX5; PSK5, WOX5, and LBD16; SCR, ESR1, PSK5 and WOX5. In paragraph 1, The above composition comprises a gene construct including the above gene combination. In paragraph 4, A composition wherein the above gene construct further comprises a gene encoding a reporter molecule. A recombinant expression vector for promoting regeneration or reprogramming of plants comprising a gene combination comprising at least one gene among ESR1 and PSK5 and one or more genes selected from the group consisting of SCR, BBM, PAT1, WOX5 and LBD16. In paragraph 6, The above gene combination is a recombinant expression vector selected from the following group: SCR, ESR1 and PSK5; ESR1, PSK5, and WOX5; PSK5, WOX5, and LBD16; SCR, ESR1, PSK5 and WOX5. In paragraph 6, The above vector is a recombinant expression vector that is a stable expression vector or a transient expression vector. In paragraph 6, The above vector is a recombinant expression vector comprising any one of the nucleotide sequences of SEQ ID NOs 53 to 55. A step of transforming a plant cell to express a gene combination comprising at least one gene among ESR1 and PSK5 and one or more genes selected from the group consisting of SCR, BBM, PAT1, WOX5 and LBD16; and A method for regenerating or reprogramming a plant, comprising the step of culturing a transformed plant cell. In Paragraph 10, A method for regenerating or reprogramming plants, wherein the above-mentioned transforming step involves transforming a plant cell so that a gene combination selected from the group below is expressed: SCR, ESR1 and PSK5; ESR1, PSK5, and WOX5; PSK5, WOX5, and LBD16; SCR, ESR1, PSK5 and WOX5. In Paragraph 10, A method for regenerating or reprogramming a plant, wherein the above-mentioned transformation step is performed by introducing a recombinant expression vector containing the above-mentioned gene combination into a plant cell. In Paragraph 12, The above vector is a transient expression vector, a method for regenerating or reprogramming plants. In Paragraph 12, A method for regenerating or reprogramming a plant, wherein the recombinant expression vector is maintained for 5 to 20 days from the date of introduction of the vector into the plant cell. In Paragraph 10, A method for the regeneration or reprogramming of a plant, wherein the above plant cell is a protoplast, callus cell, embryonic cell, leaf cell, seed cell, stem cell, or root cell. In Paragraph 10, A method for regenerating or reprogramming a plant, wherein the step of culturing the transformed plant cells is performed for 1 to 180 days. In Paragraph 10, The above plant cell is a protoplasm, and A method for regenerating or reprogramming a plant, wherein the above-mentioned culturing step comprises the step of inducing a callus by culturing a transformed protoplast in a three-dimensional solid medium containing sodium alginate. In Paragraph 10, The above plant cell is a protoplasm, and A method for regenerating or reprogramming a plant, comprising the step of culturing a protoplast for 5 to 15 days to induce microcalli; culturing the microcalli for 20 to 70 days to induce callus maturation; culturing the callus for 20 to 30 days to induce sprout regeneration; and culturing the callus with regenerated sprouts for 20 to 30 days to induce root regeneration and regenerate into a whole plant. In Paragraph 10, The above plant cell is a protoplasm, and A method for regenerating or reprogramming a plant, comprising the step of culturing a protoplast for 5 to 10 days to induce microcalli; the step of culturing the microcalli for 20 to 40 days to induce callus maturation; the step of culturing the callus for 20 to 30 days to induce sprout regeneration; and the step of culturing the callus with regenerated sprouts for 20 to 30 days to induce root regeneration and regenerate into a whole plant. In Paragraph 10, A method for regenerating or reprogramming plants in which the transformed gene is not expressed in the regenerated plant.

Citation Information

Patent Citations

  • Genes for hormone-free plant regeneration

    US20210054393A1

  • Means and Methods for Improved Regeneration

    US20240294931A1

  • Plant regeneration from protoplasts derived from elaeis SP suspension cultures

    WO2014027880A1

  • Improved genetic transformation by improving de-novo shoot regeneration in adult plants and during in-vitro tissue culture

    WO2023081731A1