Use of dspcka gene in regulation of pathogenicity of d. segeticola and as bactericide target

Abstract

Disclosed in the present invention is the use of DspckA in the regulation of the pathogenicity of Didymella segeticola and as a bactericide target. The DspckA gene of the present invention is derived from D. segeticola, and a knockout mutant is obtained by means of constructing a knockout gene fragment targeting the DspckA gene and then introducing same into a D. segeticola protoplast. Experiments found that the DspckA gene plays a role in the pathogenicity of D. segeticola and the sensitivity thereof to ningnanmycin. By means of molecular docking analysis and microscale thermophoresis experiments, it is verified that the DspckA protein can be used as a bactericide target and has an interaction with ningnanmycin, and amino acids at positions T264, T265 and E306 are key binding sites. The DspckA of the present invention can be used as a bactericide target and a key protein in the pathogenic mechanism of a disease, and has broad application prospects in the control of plant pathogenic fungal diseases.

Description

Application of DspckA gene in regulating pathogenicity of D. segeticola and as a fungicide target TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to application of DspckA gene in regulating pathogenicity of D. segeticola and as a fungicide target. BACKGROUND

[0002] Didymella is a genus of fungi in the Ascomycota class Dothideomycetes order Pleosporales family Didymellaceae, and fungi in this genus have certain pathogenicity to some plants. Didymella segeticola is a plant pathogenic fungus in the genus, which can cause various plant diseases, especially can cause harm to various economic crops and other important plant species, causing great economic losses, for example, it can cause Zanthoxylum bungeanum leaf spot disease (Yang, J. Z., Chen, C. X., et al. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., et al. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), tea leaf spot disease (Deng, X. Y., Yang, J., et al. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113: 516-527). D. segeticola strain GZSQ-4 (China General Microbiological Culture Collection Center strain preservation number: CGMCC3.20152, preservation address: No. 1 Yard, Beichen West Road, Chaoyang District, Beijing, preservation time: August 2020) was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province by the research group of the present inventors, and the pathogen can infect tea tree shoots, tender leaves and leaves, and cause serious influence on the quality and yield of tea.

[0003] However, the pathogenic biology of D. segiticola is still weak, especially the lack of pathogenic mechanism and host defense response mechanism.Although there are some studies on the pathogen D. segeticola and the screening of fungicides that can prevent and control D. segeticola in production, such as zhongshengmycin, shenqinmycin, griseofulvin, and carvacrol biological pesticides (Ren, Y. F., Li, D. X., et al. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobial zhongshengmycin against Didymella segeticola, the causal agent of tea leaf spot. Phytopathology, 2021, 111: 2238-2249; Zhao, X. Z., Chen, Z., et al. Investigating the antifungal activity and mechanism of a microbial pesticide shenqinmycin against Phoma sp. Pesticide Biochemistry and Physiology, 2018, 147: 46-50; Huang, H. K., Li, D. X., et al. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leaf spot. Phytopathology, 2023, 113: 194-205; Yin, J. Y., Wu, S., et al. In addition to damaging the plasma membrane, phenolic monoterpenoid carvacrol can bind to minor groove of DNA of Phytopathogenic fungi to potentially control tea leaf spot caused by Lasiodiplodia theobromae. Phytopathology, 2023, 114: 700-716).However, the pathogenic mechanism and infection mechanism of D. segicola are unclear, which limits the development and application of fungicides, so it is very important to construct a D. segicola insecticide target screening model and study the mechanism of fungicides.

[0004] Phosphoenolpyruvate carboxykinase gene family is widely present in various organisms, including bacteria, protozoa and yeast. Some play a role in gluconeogenesis, especially in organisms in which fatty acids are the main carbon source (Liu, K., Yu, J., Russell, D.G. pckA-deficient Mycobacterium bovis BCG shows attenuated virulence in mice and in macrophages. Microbiology, 2003, 149, 1829-1835). Some catalyze the conversion of oxaloacetate to phosphoenolpyruvate, which is the first step in the gluconeogenesis pathway and is a key link between the tricarboxylic acid cycle and the glycolysis pathway. SUMMARY

[0005] Therefore, the present application provides a phosphoenolpyruvate carboxykinase family gene, which is derived from Didymella segeticola and is named DspckA in the present application. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the encoded amino acid sequence is as shown in SEQ ID NO. 3. The gene can solve the problem of preventing and controlling the pathogenic bacteria D. segicola. Therefore, the purposes of the present application are specifically:

[0006] In a first aspect, the present application provides the application of DspckA gene in regulating the pathogenicity of D. segicola, or the sensitivity to ningnanmycin, or the design and screening of antifungal drugs.

[0007] Further, the regulation of the pathogenicity of D. segicola and the sensitivity to ningnanmycin is both reduced. For example, after knocking out the DspckA gene in D. segicola, the pathogenicity of D. segicola is reduced, and the sensitivity to ningnanmycin is also reduced.

[0008] In a second aspect, the present application provides the application of DspckA gene in cultivating transgenic D. segicola with reduced pathogenicity and / or sensitivity to ningnanmycin. For example, a transgenic D. segicola with reduced pathogenicity and sensitivity to ningnanmycin can be obtained by constructing a knock-out mutant of DspckA gene.

[0009] In a third aspect, a method for breeding a transgenic D. segetum with reduced pathogenicity and / or sensitivity to ningnanmycin is provided, which comprises the step of reducing the expression amount or / and activity of mRNA or protein of DspckA gene in a recipient D. segetum to obtain a transgenic D. segetum.

[0010] Further, the reduction of the expression amount or / and activity of mRNA or protein of DspckA gene is achieved by knocking out or inhibiting or silencing the expression of DspckA gene in the recipient D. segetum. For example, the DspckA gene in the recipient D. segetum is knocked out by introducing a homologous recombination fragment for homologous recombination into the protoplast of the recipient.

[0011] In a fourth aspect, the above method is used for preventing and treating diseases caused by D. segetum. After the expression amount or / and activity of mRNA or protein of DspckA gene in the recipient D. segetum is reduced, the pathogenicity of D. segetum is reduced, thereby preventing and treating the diseases caused by D. segetum.

[0012] In a fifth aspect, DspckA protein is used as a drug target for screening fungicides. The DspckA protein is encoded by DspckA gene.

[0013] Further, T264, T265 and E306 in the DspckA protein are used as drug targets for screening fungicides.

[0014] In a sixth aspect, ningnanmycin is used as a fungicide component for preventing and treating diseases caused by D. segetum. Ningnanmycin interacts with DspckA protein, and the two have strong binding affinity. The binding of ningnanmycin and DspckA protein changes the structure of DspckA protein, reduces the activity of DspckA protein or inhibits the activity of DspckA protein, thereby inhibiting the damage of pathogenic bacteria to plants.

[0015] In a seventh aspect, ningnanmycin is used for regulating the structure or activity of DspckA protein.

[0016] This invention provides the application of the phosphoenolpyruvate carboxykinase family gene DspckA from *D. segeticola* in regulating the pathogenicity and susceptibility to ningnanmycin in *D. segeticola*. Knockout of the DspckA gene in wild-type *D. segeticola* significantly reduced both pathogenicity and susceptibility to ningnanmycin. The DspckA protein encoded by the DspckA gene can be used as a drug target for screening fungicides. It interacts strongly with the fungicide ningnanmycin, and the binding affinity between the two is strong. The binding of ningnanmycin to the DspckA protein can alter its structure, reduce its activity, or inhibit its activity, thereby suppressing the pathogen's damage to plants. Therefore, DspckA can serve as a fungicide target and a key protein in the pathogenic mechanism of diseases, with amino acids T264, T265, and E306 being key binding sites, showing broad application prospects in the control of plant pathogenic fungal diseases. Attached Figure Description

[0017] Figure 1 is a schematic diagram of the DspckA gene knockout and mutant screening strategy of D. segeticola in this invention.

[0018] Figure 2 shows the spectrum of the plasmid pCT74 of this invention;

[0019] Figure 3 is a PCR electrophoresis diagram of the knockout detection in this invention;

[0020] Figure 4 shows the results of the pathogenicity test of the mycelium of wild-type D. segeticola and ΔDspckA mutant on tea.

[0021] Figure 5 shows the colony susceptibility of wild-type and ΔDspckA mutant of D. segeticola to ningnanmycin in this invention.

[0022] Figure 6 shows the inhibition rate analysis of the ningnanmycin agent of the present invention against wild-type and ΔDspckA mutant of D. segeticola.

[0023] Figure 7 shows the results of the analysis of the interaction between DspckA and Ningnanmycin using molecular docking technology in this invention;

[0024] Figure 8 is a schematic diagram of the CDS sequence point mutation strategy of D. segeticola;

[0025] Figure 9 shows the SDS-PAGE analysis of the purified DspckA and three site-mutated proteins of this invention.

[0026] Figure 10 shows the results of the in vitro interaction between DspckA and three site mutant proteins and ningnanmycin, as studied using MST in this invention. DETAILED DESCRIPTION

[0027] The application will be described in greater detail by way of specific examples which are illustrative only and not restrictive of the application. The application is not limited to the following examples or embodiments, and any modifications and variations that do not depart from the spirit of the application should be considered within the scope of the application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0028] In the following examples, the wild strain GZSQ-4 of D. segiticola was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province, and was deposited with the China General Microbiological Culture Collection Center, with the strain preservation number CGMCC3.20152 and the preservation address No. 1, Beichen West Road, Chaoyang District, Beijing. The genomic DNA sequence of the DspckA gene in the strain is shown in SEQ ID NO. 1, the CDS sequence is shown in SEQ ID NO. 2, and the amino acid sequence of the DspckA protein encoded by the gene is shown in SEQ ID NO. 3. Sequence alignment shows that the gene belongs to the phosphoenolpyruvate carboxykinase (PCK) family gene.

[0029] Example 1, construction of D. segiticola gene knockout mutant ΔDspckA

[0030] The schematic diagram of the knockout and mutant screening strategy of the DspckA gene of D. segiticola is shown in FIG. 1, and the specific construction and screening method is as follows:

[0031] 1. Construction of knockout gene fragment

[0032] 1) Amplification of the upstream and downstream homologous sequences of the target gene: the genomic DNA of the wild type strain CGMCC3.20152 of D. segiticola was used as the template, and primer 1F and 2R were used to amplify the upstream A fragment, and primer 3F and 4R were used to amplify the downstream B fragment. The 5' end of primer 2R has a reverse complementary sequence of primer HYGF, and the 5' end of primer 3F has a reverse complementary sequence of primer HYGR. The sequences (5' end to 3' end) of primers 1F, 2R, 3F, 4R, HYGF and HYGR are as follows:

[0033] 1F: ACGATTGCGAGGTACTTTCTG

[0034] 2R: ACCTCCACTAGCTCCAGCCAAGATGGAAATGTGATCGCTGC

[0035] 3F: GAATAGAGTAGATGCCGACCGGGTCCTGACGTCAGCATAATCG

[0036] 4R: TTCAACGTCGGATTGTTCAAC

[0037] HYGF: CTTGGCTGGAGCTAGTGGAGGT

[0038] HYGR: CCCGGTCGGCATCTACTCTATTC

[0039] 2) Amplification of the hygromycin resistance gene hph: the first half of the hygromycin resistance gene H1 (1094 bp) was amplified using the plasmid pct74 (the map is shown in Figure 2) as a template and primers HYGF and HYG-1R; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYGR. The sequences of primers HYG-1F and HYG-1R (from 5' end to 3' end) are:

[0040] HYG-1F: CGTTGCAAGACCTGCCTGAA

[0041] HYG-1R: GGATGCCTCCGCTCGAAGTA

[0042] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with the H1 fragment and the H2 fragment, respectively, to obtain the A-H1 ligation fragment and the H2-B ligation fragment. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify the A-H1 and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0043] 2, Preparation of D. segiticola protoplasts

[0044] 1) D. segiticola was inoculated into potato dextrose broth (PDB) and cultured at 25°C for 36 h, and the mycelium was collected into a 2 mL centrifuge tube. The mycelium was broken by a grinder, and the bacterial suspension was transferred to CM liquid medium and shaken for 36 h. Fresh mycelium of D. segiticola was collected by filtration;

[0045] 2) 10 mL of 0.8 mol / L potassium chloride solution was used as an osmotic pressure stabilizer to prepare a mixed enzyme solution of Drislase, lysozyme and snailase. The enzyme solution was used to lyse 5 g of suspended mycelium at 30°C and 100 rpm for 4 h;

[0046] 3) The 2-3 layers of sterilized mirror paper (fiber mesh aperture 45±12 μm) were filtered, washed with 0.8 mol / L potassium chloride, and the filtrate was collected. The obtained filtrate was centrifuged at 4°C and 4000 rpm for 6 min. Resuspend with 15 mL of 1.2 mol / L sorbitol buffer (STC) solution;

[0047] 4) Discard the supernatant, resuspend the protoplasts with 1 mL of STC buffer to prepare a protoplast suspension with a concentration of 1×10 7

[0048] 3. Protoplast transformation of D. segiticola

[0049] 1) Take 200 μL of protoplast suspension and add to a 50 mL centrifuge tube. Add 10-20 μg of A-H1 and H2-B knock-out transformation fragments, mix gently, and place on ice for 20 min.

[0050] 2) Add 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) in two portions, mix gently, and place at room temperature for 20 min. Add 5 mL of TB3 liquid medium, mix, and incubate at 25°C and 120 rpm for 12-16 h.

[0051] 3) Centrifuge at room temperature and 4000 rpm / min for 6 min, discard the supernatant, and resuspend the remaining 1 mL with regenerated protoplasts.

[0052] 4) Add 50 mL of warm TB3 regeneration solid medium, mix, and prepare a plate. After 24 h of inverted culture at 25°C, overlay with PDA medium containing 30 μg / mL of hygromycin B, and incubate at 25°C for 2-4 days until the transformants grow, and then subculture and select for 3 generations.

[0053] 4. PCR verification of transformants

[0054] After subculturing for 3 generations on PDA medium containing hygromycin, the transformants of ΔDspckA can be obtained. DNA was extracted from the transformant colonies using the CTAB method, and PCR amplification was performed using primers to amplify the hph gene using primer pair HYGF / HYGR, and to detect whether the target gene was knocked out using primer pair 5F / 6R. The sequences of primers 5F and 6R (5' end to 3' end) are:

[0055] 5F: CGTCGCTATCAACTTTGCCG

[0056] 6R: TGCTGGAATGGCTTCTCGTT

[0057] ​The gene knockout fragment was introduced into the protoplast of D. segiticola by homologous recombination method, and hygromycin positive transformants were obtained. The positive transformants were analyzed by PCR using hph gene specific primers, and the results are shown in Figure 3. The hph gene, the occurrence of homologous recombination upstream and the occurrence of homologous recombination downstream were detected in the transformants, and the DspckA gene was not amplified in the transformants. Therefore, the corresponding positive transformants were screened, and the ΔDspckA knockout mutant was obtained.

[0058] Experimental Example Two, Analysis of Properties of D. segiticola Wild Type WT and Mutant ΔDspckA

[0059] 1. Analysis of pathogenicity of WT and ΔDspckA

[0060] The wild type and knockout mutant ΔDspckA of D. segiticola were inoculated on PDA medium and cultured in an incubator at 25°C for 7 days. A sterile puncher with a diameter of 4 mm was used to take several pieces of the colony edge, which were then inoculated on the surface of tea leaves. The tea leaves were investigated for disease incidence after 3 days.

[0061] The results of the pathogenicity test of the ΔDspckA knockout mutant of D. segiticola on tea leaves are shown in Figure 4. Figure 4A shows the lesion patterns of D. segiticola wild type and mutant strain ΔDspckA inoculated on tea leaves after 3 days (the left lesion is WT, and the right lesion is ΔDspckA). Figure 4B shows the lesion area measurement results of D. segiticola wild type and mutant strain ΔDspckA inoculated on tea leaves after 3 days. The vertical axis represents the lesion area measurement, and the values are the mean values based on 20 independent experiments, and the data were analyzed by Duncan's new multiple range method (p<0.05). As shown in Figure 4, compared with the wild type, the lesion area of the knockout mutant ΔDspckA on tea leaves decreased significantly, indicating that the pathogenicity of D. segiticola was inhibited after knocking out the DspckA gene.

[0062] 2. Analysis of the difference in sensitivity of WT and ΔDspckA to ningnanmycin

[0063] D. segiicola wild type WT and knockout mutant ADspckA were inoculated on PDA medium with different concentrations (0, 50, 100, 200 U / mL) of ningnanmycin respectively, and cultured at 25°C in the dark. The colony diameter was measured using the cross method at 7d, and the colony morphology was observed. Each treatment was set up with 5 replicates. The results are shown in the colony morphology of Figure 5 and the inhibition rate statistics of Figure 6 (dark color is WT, light color is mutant). As the concentration of ningnanmycin increased, the inhibition rate of ningnanmycin on D. segiicola wild type increased significantly, while the knockout mutant ADspckA was almost not affected, indicating that the knockout of DspckA gene reduced the sensitivity of the strain to ningnanmycin.

[0064] Example Three, Molecular docking experiment of ningnanmycin and candidate target protein involved in energy metabolism

[0065] The DNA sequence of the candidate target protein was converted into a protein sequence using BLAST and screened in the UniProt database (http: / / www.uniprot.org). The target sequence search was performed using BLAST with the primary amino acid sequences contained in the SWISS-MODEL template library (Bienert, S., Waterhouse, A., De, Beer. T. A., Tauriello, G., Studer, G., Bordoli, L., Schwede, T. The SWISS-MODEL Repository—new features and functionality. Nucleic Acids Research, 2017, 45 (D1): D313-D319; Camacho, C, Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., Madden, T. L. BLAST +:architecture and applications. BMC Bioinformatics, 2009, 10: 1-9), the crystal structure of phosphoenolpyruvate carboxykinase (PEPCK) of Trypanosoma cruzi (1ii2.1) was chosen as a homology model to build the three-dimensional structure of DspckA. The active binding pockets of these models were predicted using fpocket (https: / / bio.tools / fpocket) (Schmidtke, C., Findeis, S., Sharma, C. M., Kuhfuβ, J., Hoffmann, S., Vogel, J., Stadler, P. F., Bonas, U. Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies sRNAs with putative virulence functions. Nucleic Acids Research, 2012, 40(5): 2020-2031). The molecular docking program AutoDock Tools and AutoDock vina were used to perform automatic molecular docking simulations between ningnanmycin and each candidate target protein (Morris, G. M., Huey, R., Lindstrom, W., Sanner, M. F., Belew, R. K., Goodsell, D. S., Olson, A. J. AutoDock4 and AutoDock Tools4: Automated docking with selective receptor flexibility. Journal of Computational Chemistry, 2009, 30(16): 2785-2791; Trott, O., Olson, A. J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. Journal of Computational Chemistry, 2010, 31(2): 455-461). PyMOL was used for visual analysis. Water molecules and ligands were removed from the protein structures and hydrogens and Gasteiger were added before the molecular docking calculations. Ten docking poses were obtained for the molecular docking calculations.The docking conformation with the lowest binding energy was selected, as shown in the results of Figure 7 (Figure 7A: molecular docking results of ningnanmycin and DspckA; Figure 7B: docking binding site of ningnanmycin and DspckA), with a binding energy of -7.4 Kcal / mol, revealing that ningnanmycin has interaction with DspckA, forming stable hydrogen bonds with amino acids T264, T265 and E306 of DspckA, thus indicating that DspckA can serve as a target for screening fungicides, and then ningnanmycin is screened as a candidate fungicide.

[0066] Experimental Example Four, Prokaryotic Expression and Protein Purification

[0067] 1. Prokaryotic expression vector construction

[0068] 1) Point mutation fragment and DspckA CDS sequence amplification: total RNA of D. segiticola was extracted (kit: Quanshijin ER501), and reverse transcription PCR (kit: Quanshijin AE311) was used to obtain cDNA of D. segiticola. The amplification primers of amino acid 264 (T264A), 265 (T265A), 306 (E306A) mutation and DspckA gene CDS sequence SEQ ID NO. 2 were designed. Using the cDNA of D. segiticola as a template, the first half of the point mutation fragment P1 was amplified with primers 13-F / 8R, 13F / 10R and 13F / 12R, respectively, and the second half of the point mutation P2 was amplified with primers 7F / 14R, 9F / 14R and 11F / 14R, respectively (as shown in Figure 8); DspckA CDS sequence was amplified with primers 13F and 14R. The sequences of primers 7F, 8R, 9F, 10R, 11F, 12R, 13F and 14R (5' end to 3' end) are:

[0069] 7F: CTCTCCGGTACTGGCAAGGCCACTCTCTCCGCCGACCC

[0070] 8R: GGGTCGGCGGAGAGAGTGGCCTTGCCAGTACCGGAGAG

[0071] 9F: TCCGGTACTGGCAAGACCGCTCTCTCCGCCGACCC

[0072] 10R: GGGTCGGCGGAGAGAGCGGTCTTGCCAGTACCGGA

[0073] 11F: GGTCTCTCCGCCGAGAAGGCGCCCGATATCTTCAACG

[0074] 12R: CGTTGAAGATATCGGGCGCCTTCTCGGCGGAGAGACC

[0075] 13F: cagcaaatgggtcgcggatccATGGTTCCCCAAGTCAACAAGA

[0076] 14R: ttgtcgacggagctcgaattcTTATGCCTTGGTCTGTGGCC

[0077] 2) Fusion of point mutation fragment gene: Overlapping PCR was used to overlap the recovered P1 fragment and P2 fragment to obtain a DNA fragment of T264A, T265A, and E306A point mutation.

[0078] 3) Construction of vectors by homologous recombination: the amplified CDS sequence of DspckA gene and the DNA fragments of three point mutations were respectively introduced into the pET-28a(+) vector by homologous recombination to obtain recombinant plasmids.

[0079] 2, Prokaryotic expression of protein

[0080] Transformation: the four recombinant plasmids were transformed into competent E. coli Rosetta DE3 cells, and then plated on plates containing 50 μg / mL kanamycin after heat shock at 42°C, and cultured at 37°C;

[0081] Activation: single colonies were picked into liquid culture medium containing antibiotics and cultured at 37°C;

[0082] Induction: when the OD value reached 0.6, 0.8 mM inducer IPTG was added, and the culture was continued, and the culture was incubated at 16°C overnight, and the culture without adding inducer was negative control;

[0083] Collection of bacterial cells: centrifugation at 6000 rpm for 20 min, discard the supernatant, and collect the bacterial cells;

[0084] Expression detection: add buffer A (0.2M PBS, 19mL NaH2PO4, 81mL Na2HPO4, sterilized water to 1L) to the collected bacterial cells and suspend, and use an ultrasonic disrupter to fully dissolve them. Centrifuge to collect the supernatant crude protein, sample the supernatant crude protein, and prepare for gel detection.

[0085] 3, Protein purification

[0086] The supernatant crude protein was subjected to affinity purification;

[0087] Equilibration: equilibrate the column with Ni-NTA packing, and wash the column with buffer B (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 1.36 g imidazole, and sterilized water to 1 L) to balance the column;

[0088] Column loading: incubate the crude protein with the column packing after equilibration, and collect the effluent;

[0089] Equilibration: wash the column with buffer B to balance the column;

[0090] Washing: wash the column with buffer B;

[0091] Elution: elute with buffer C (50 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 27.2 g imidazole, and sterilized water to 1 L), and collect the effluent;

[0092] Purification detection: prepare samples from the crude protein, effluent component, and purified protein, respectively, and prepare SDS-PAGE (10% separation gel, 5% concentration gel) for detection.

[0093] Collection and treatment: desalt the purified component into protein storage buffer D (150 mL PBS, 300 mM NaCl, pH 7.4), concentrate, filter sterilize, divide into 1 mL per tube, and store at -80°C.

[0094] The results of the gel detection are shown in FIG. 9 (FIG. 9A is the protein expressed and purified by DspckA, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-11 lanes: multiple tubes of protein after purification; FIG. 9B is the T264A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2, 3 lanes: effluent after protein column, 4-11 lanes: multiple tubes of protein after purification; FIG. 9C is the T265A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-9 lanes: multiple tubes of protein after purification; FIG. 9D is the E306A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-8 lanes: multiple tubes of protein after purification), and it can be seen that the DspckA and T264A, T265A, and E306A mutant proteins have been successfully purified.

[0095] Experimental Example Five, Microscale Thermophoresis Experiment

[0096] The microscale thermophoresis technology (MST) was used to study the interaction between DspckA, T264A, T265A, and E306A proteins and candidate bactericides

[0097] Preparation of protein sample: 5 μL of RED-NHS dye and NHS labeling buffer were mixed by gently blowing, 10 μL of purified desalted protein (obtained in Example Four) and 90 μL of the above RED-NHS solution were added to a 1.5 mL centrifuge tube with inactivated enzyme, mixed on ice, and incubated at room temperature for 30 min in a dark light-proof environment; 10 μL of protein fluorescent labeling solution was taken by capillary blood vessel and placed on a micro-thermal mobility instrument for determination, and the protein labeling solution with a fluorescence value of 400-1200 was reserved for subsequent experiments;

[0098] Parameter setting of micro-thermal mobility instrument: the interaction of DspckA, T264A, T265A and E306A protein with ningnanmycin was studied by using Monolith NT.115 micro-thermal mobility instrument, and the instrument parameters were LED power 40%, laser power 30%, and Red excitation;

[0099] Analysis of the interaction of protein with ningnanmycin: the results are shown in Figure 10, DspckA has interaction with ningnanmycin, and the dissociation constant K d = 4.51 ± 1.76, which reveals that DspckA can be used as a target for screening bactericides; and it is found that T264A, T265A and E306A do not have interaction with ningnanmycin, and the dissociation constant increases, K d = 80.61 ± 30.59, K d = 22.87 ± 8.50 and K d = 14.03 ± 2.73. It is shown that amino acid substitution weakens the binding affinity, which reveals that amino acids at positions 264, 265 and 306 of DspckA protein are important binding sites.

[0100] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Use of DspckA gene in regulating pathogenicity or sensitivity to ningnanmycin of Didymella segeticola or designing and screening antifungal drugs; the nucleotide sequence of the DspckA gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is as shown in SEQ ID NO.

3.

2. Use according to claim 1, wherein The regulation of the pathogenicity and the sensitivity to ningnanmycin of Didymella segeticola is both reduction.

3. Use of the DspckA gene for breeding transgenic D. segetalis with reduced pathogenicity and / or reduced sensitivity to validamycin, characterized in that, The nucleotide sequence of the DspckA gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is as shown in SEQ ID NO.

3.

4. A method for breeding a transgenic D. segetalis having reduced pathogenicity and / or reduced sensitivity to nanaozymic acid, characterized in that, The method for reducing the expression amount or / and activity of the mRNA or protein of the DspckA gene in the recipient D. segeticola is achieved by knocking out or inhibiting or silencing the expression of the DspckA gene in the recipient.

5. The method of claim 4, wherein, 6. Use of the method of claim 4 or 5 in preventing and treating diseases caused by D. segeticola. The amino acid sequence of the DspckA protein is as shown in SEQ ID NO.

3.

7. Use of DspckA protein as a drug target for screening of fungicides, characterized in that, The amino acids at positions T264, T265 and E306 in the DspckA protein serve as drug targets.

8. Use according to claim 7, wherein the compound is ###0002### 9. Use of ningnanmycin as a fungicide ingredient in preventing and treating diseases caused by D. segeticola. The amino acid sequence of the DspckA protein is as shown in SEQ ID NO.

3.

10. Use of ningnanmycin in modulating the structure or activity of DspckA protein, characterized in that, ​

Images