Method for u-shaped self-rolling circle amplification of nucleic acid and use thereof

Abstract

The present invention relates to the field of molecular biology, and particularly relates to a method for U-shaped self-rolling circle amplification of a nucleic acid and the use thereof. The method for U-shaped self-rolling circle amplification of the nucleic acid comprises: attaching a specific linker to the 3' end of a single-stranded nucleic acid, wherein the specific linker comprises a hairpin structure and a linker sequence, and the linker sequence is used for complementary binding to the 3' end of the single-stranded nucleic acid; and after the single-stranded nucleic acid is bound to the specific linker, performing extension starting from the 3' end of the single-stranded nucleic acid by using the specific linker as a template, such that the extended single-stranded nucleic acid carries a hairpin structure to form a self-rolling circle, and then performing extension and amplification by using an original single-stranded nucleic acid as a template to form an amplification product. In the method for U-shaped self-rolling circle amplification of the nucleic acid provided by the present invention, the original single-stranded nucleic acid is used as a template to efficiently convert a single-stranded DNA molecule into a double-stranded DNA molecule, with all sequence information of the single-stranded DNA molecule, including the extreme 5' and 3' ends, being completely retained, and thus the library construction efficiency of single-stranded or damaged nucleic acid molecules can be greatly improved, and sequencing costs are greatly reduced.

Description

Method for U-turn amplification of nucleic acid and application thereof TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a method for U-turn amplification of nucleic acid and application thereof. BACKGROUND

[0002] Single-stranded DNA (ssDNA) plays an important role in molecular biology research, but in many experiments, double-stranded DNA (dsDNA) is a more common form. Converting single-stranded DNA into double-stranded DNA is a key step in experiments such as gene cloning, sequencing, mutation analysis, etc. In vitro synthesis is a classic and efficient method that can convert single-stranded DNA into double-stranded DNA through enzymatic reaction, which uses single-stranded DNA as a template and synthesizes a complementary strand through primer guidance to form double-stranded DNA; its core principle is to use single-stranded DNA as a template and deoxynucleotide triphosphates (dNTPs) as raw materials to synthesize a DNA strand complementary to the template through the catalytic action of DNA polymerase.

[0003] Although in vitro synthesis is an efficient and widely used method for converting single-stranded DNA into double-stranded DNA, it also has some limitations and drawbacks. The following are the main drawbacks of in vitro synthesis:

[0004] 1) Dependence on primer design: improper primer design can lead to non-specific amplification or synthesis failure; for complex templates (such as single-stranded DNA rich in secondary structure), primer design can be very difficult; for templates with unknown sequences, it is not possible to provide effective primer design, and if random primers are used, it may cause some single-stranded 3' end sequences to be unable to be converted into double-stranded;

[0005] 2) Limitations of DNA polymerase: certain DNA polymerases (such as Taq polymerase) lack 3'→5' exonuclease activity, which can lead to synthesis errors; high-fidelity polymerases (such as Pfu polymerase) have a low error rate, but the synthesis speed is slow; polymerases are sensitive to the secondary structure of the template, which can cause synthesis to be interrupted;

[0006] 3) Dependence on template quality: impure or degraded templates can significantly reduce synthesis efficiency; long single-stranded DNA fragments have low synthesis efficiency and are prone to produce incomplete products;

[0007] 4) Optimization of reaction conditions: temperature, pH, ion concentration, etc. need to be strictly optimized, otherwise synthesis may fail; for different templates, reaction conditions may need to be repeatedly adjusted;

[0008] 5) Non-specific amplification: non-specific amplification reduces the yield and purity of the target product; gel electrophoresis or purification steps are needed to remove non-specific products, increasing the complexity of the experiment.

[0009] In summary, in vitro synthesis method is a highly efficient method for converting single-stranded DNA to double-stranded DNA, but its dependence on primer design, limitation of DNA polymerase, high requirement for template quality, and need for optimization of reaction conditions limit its application range. In particular, it is unable to convert part of the single-stranded 3' end sequence to double-stranded, resulting in information loss. In addition, the addition of extension primers produces non-specific products, which brings trouble to subsequent experiments.

[0010] The existing synthesis method cannot add a specific linker sequence to the 3' end of the original single-stranded DNA chain while converting it to double-stranded DNA.

[0011] Next-generation sequencing (NGS) is a high-throughput DNA sequencing technology that can sequence a large number of DNA molecules in parallel, thereby quickly and cost-effectively obtaining a large amount of genetic information. NGS technology has applications in multiple fields, including but not limited to whole genome sequencing, targeted region sequencing, RNA sequencing (RNA-Seq), epigenetic research, cancer genomics, microbiome research, etc.

[0012] The current difficulties and challenges in constructing next-generation sequencing (NGS) libraries are as follows: Constructing next-generation sequencing (NGS) libraries involves attaching linker sequences to DNA fragments. These linkers provide critical sequences for sequencing primers, sample identification, and PCR amplification to generate enough library quantity for sequencing runs. Adding linkers is a major challenge, often requiring high-quality double-stranded DNA as input for successful results. However, different sample types pose challenges to adding linkers, such as low-quality / low-quantity DNA, formaldehyde-fixed paraffin-embedded (FFPE) DNA or other damaged DNA, circulating free DNA, etc. These factors can lead to reduced library yield, sequencing failure, or biased results.

[0013] There are two main methods currently used to attach linkers to DNA molecules:

[0014] 1. Ligation: This can be ligation of double-stranded or single-stranded linkers to the template molecule.

[0015] 2. Extension: This involves the use of primers containing linkers that bind to the template DNA strand and extend to replicate the template sequence. Sometimes, a combination of extension and ligation is used to attach linkers to both ends.

[0016] However, each of the above methods has its limitations:

[0017] • Double-stranded ligation: Requires clean, blunt ends or DNA with A-overhanging ends. Preparing these ends involves a complex, multi-step workflow using multiple enzymes. This process can also tamper with the original molecule and introduce mutations, affecting DNA methylation information. Additionally, ligation requires high concentrations of DNA ligase, which can lead to adapter dimer formation and reduce sequencing efficiency.

[0018] • Single-stranded ligation: While this method can be necessary for certain specific applications, such as analyzing archaeological DNA or bisulfite-treated DNA, it is generally less efficient and more labor-intensive compared to double-stranded ligation.

[0019] • Random primer extension: This method is simpler and avoids multiple enzymatic reactions. However, it can introduce bias and lacks specificity. Additionally, it can fail to preserve key information from the original DNA molecule, such as fragment length, start / end positions, and DNA methylation patterns.

[0020] In summary, current methods for adding adapters during NGS library preparation have limitations, especially when dealing with challenging samples. Improved techniques are needed that provide higher efficiency, reduce bias, and better preserve original DNA information.

[0021] Constructing next-generation sequencing (NGS) libraries from double-stranded DNA (dsDNA) is a common method in genomic research. However, there are potential issues that can arise during library preparation that can affect the quality and usability of sequencing data. Here are some common problems encountered when preparing dsDNA NGS libraries:

[0022] 1. Adapter ligation efficiency:

[0023] Inefficient adapter ligation can result in lower yields of usable library fragments. This can occur if sequence-specific effects on end repair prevent proper adapter ligation, or due to issues with the ligation reaction itself (such as non-optimal ligation conditions in different samples).

[0024] 2. End repair issues:

[0025] The end repair step can introduce sequence errors when repairing DNA strands through polymerase extension, gap filling, and other means, and can cause loss of DNA methylation status.

[0026] 3. Low DNA input:

[0027] Libraries prepared from small amounts of starting material can encounter issues such as higher error rates and lower complexity due to the required excessive number of PCR cycles.

[0028] 4. Adapter dimer formation:

[0029] Adapter dimers can form during PCR and can be amplified along with the library. They will occupy sequencing capacity without containing useful sequence information.

[0030] 5. Fragment loss:

[0031] Easily damaged, degrading DNA (e.g. FFPE DNA, which also contains a large amount of single-stranded DNA) can cause significant material loss during library preparation, leading to lower library yield.

[0032] 6. Single-stranded DNA (ssDNA) loss:

[0033] ssDNA in a sample cannot be ligated in a double-stranded system, leading to loss of information and affecting research results.

[0034] Preparation of NGS libraries from single-stranded DNA (ssDNA) can present more challenges compared to double-stranded DNA (dsDNA). Here are some common issues encountered when preparing ssDNA NGS libraries:

[0035] 1. Adapter ligation efficiency:

[0036] Adapters are typically designed to ligate efficiently to the ends of dsDNA. Ligation of adapters to ssDNA is usually less efficient due to differences in structural and dynamic properties between ssDNA and dsDNA.

[0037] 2. Secondary structure formation:

[0038] Single-stranded DNA can form hairpin loops and other secondary structures that can hinder adapter ligation or PCR amplification.

[0039] 3. Low yield:

[0040] ssDNA is more susceptible to degradation than dsDNA, so it can result in lower yield during library preparation.

[0041] 4. Handling and manipulation:

[0042] ssDNA is more susceptible to nuclease degradation and requires careful handling to prevent damage during the preparation process.

[0043] 5. Conversion to double-stranded DNA:

[0044] Some library preparation protocols require conversion of ssDNA to dsDNA, which can introduce errors during the synthesis step.

[0045] 6. Adapter dimer formation:

[0046] ssDNA can increase the formation of adapter dimers during PCR amplification, which wastes sequencing capacity.

[0047] 7. Complexity of the library:

[0048] If ssDNA is derived from a complex mixture, it can be difficult to maintain the complexity of the library during preparation, as there can be a loss of sequence representation.

[0049] Current library construction methods require a separate DNA extraction and quantification step before processing the raw sample (such as cell lysate, blood, or plasma). This adds significant workload and cost, and can become a bottleneck for large-scale studies. SUMMARY

[0050] In view of the above-mentioned disadvantages of the prior art, the purpose of the present application is to provide a method for U-turn amplification of nucleic acids and its use, to solve the problems in the prior art.

[0051] To achieve the above-mentioned purposes and other related purposes, the present application first provides a method for U-turn amplification of nucleic acids, which comprises adding a specific adapter to the 3' end of a single-stranded nucleic acid, the specific adapter comprising a hairpin structure and an adapter sequence for complementary binding to the 3' end of the single-stranded nucleic acid; after the single-stranded nucleic acid binds to the specific adapter, the single-stranded nucleic acid is extended from the 3' end using the specific adapter as a template, and the extended single-stranded nucleic acid has a hairpin structure to form a U-turn, and then the original single-stranded nucleic acid is used as a template for extension and amplification to form an amplification product.

[0052] The present application also provides the use of the above-mentioned method in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing, and / or fourth-generation sequencing.

[0053] The present application also provides a nucleic acid molecule adapter, which comprises a first adapter comprising a hairpin structure and a random sequence, the hairpin structure comprising a stem region and a loop region, the two strands of the stem region being complementary, the two strands of the stem region being an adapter template and an adapter sequence complementary to the adapter template, respectively, the random sequence being connected to the end of the adapter template, the random sequence comprising a sequence complementary to the 3' end of the nucleic acid molecule to be detected.

[0054] The present application also provides the use of the nucleic acid molecule adapter in the addition of adapters to the nucleic acid molecule to be detected or in the preparation of a DNA library construction product.

[0055] The present application also provides a kit for constructing a DNA library, wherein the kit comprises the nucleic acid molecule linker, and further comprises any one or more of the following: a nucleic acid polymerase, a library construction reagent, a nucleic acid purification reagent, and a single-stranded nucleic acid enzyme.

[0056] The present application also provides a method for constructing a NGS library by U-turn amplification of a nucleic acid, comprising the following steps:

[0057] 1) mixing a nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and a first linker, and then reacting to copy the sequence of the first linker to the 3' end of the original strand of the nucleic acid molecule to be tested;

[0058] 2) synthesizing the complementary strand of the original strand of the nucleic acid molecule to be tested to form a double strand of the nucleic acid molecule to be tested;

[0059] 3) mixing the product of step 2), a second linker, and a DNA ligase, and then reacting to add the second linker to the original strand and / or the synthesized strand of the nucleic acid molecule to be tested;

[0060] 4) purifying the product of step 3) with a magnetic bead, and then mixing with a PCR amplification reagent to perform a PCR reaction, thereby obtaining a NGS library comprising a double-end linker structure of the nucleic acid molecule to be tested and / or the complementary strand thereof.

[0061] The present application also provides a method for constructing a NGS library by U-turn amplification of a nucleic acid, comprising the following steps:

[0062] 1) mixing a double-stranded nucleic acid molecule to be tested, a transposase, and a second linker, and then reacting to add the sequence of the second linker to the 5' end of the nucleic acid molecule to be tested; the second linker is a hairpin structure and has an ME sequence;

[0063] 2) denaturing to convert the product of step 1) into a single strand, thereby obtaining a single-stranded nucleic acid molecule to be tested with the second linker;

[0064] 3) mixing the single-stranded nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and a first linker, and then reacting to copy the sequence of the first linker to the 3' end of the nucleic acid molecule to be tested;

[0065] 4) synthesizing the complementary strand of the original strand of the nucleic acid molecule to be tested to form a double strand of the nucleic acid molecule to be tested;

[0066] 5) purifying the product of step 4) with a magnetic bead, and then mixing with a PCR amplification reagent to perform a PCR reaction, thereby obtaining a NGS library comprising a double-end linker structure of the nucleic acid molecule to be tested and / or the complementary strand thereof.

[0067] The present application also provides a NGS library prepared by the method for constructing a NGS library.

[0068] The method for U-turn self-replicating amplification of a nucleic acid and the use thereof according to the present application have the following beneficial effects: unlike the prior art, which only has two methods for adding a linker sequence, i.e. double-strand / single-strand ligation or adding a linker sequence to a replication strand rather than an original strand by extending a random primer or a sequence-specific primer, the present application adds a linker sequence to an original strand rather than a replication strand of a nucleic acid to be tested by extending the nucleic acid to be tested on a linker with a random primer.

[0069] The present application can efficiently convert a single-stranded DNA molecule into a double-stranded DNA molecule, and simultaneously convert a single-copied DNA into a double-copied DNA. When converting a single-stranded DNA molecule into a double-stranded DNA molecule, all sequence information of the single-stranded DNA molecule, including 5' and 3' ends, is completely retained. When converting a single-stranded DNA molecule into a double-stranded DNA molecule, no amplification primer is needed, and the occurrence of primer dimers and multimers is completely avoided. When converting a single-stranded DNA molecule into a double-stranded DNA molecule, the conversion is completely dependent on the extension of the 3' end sequence of the single-stranded DNA molecule, and self-amplification without a primer is achieved. For a double-stranded DNA molecule, the present application can amplify two single strands respectively to obtain two double-stranded DNA molecules, without adding an amplification primer, and all sequence information of the two single-stranded DNA molecules, including 5' and 3' ends, is retained. This application is of great significance for the study of damaged double-stranded DNA. It also includes:

[0070] 1) Compared with the traditional single-stranded library construction method, the present application greatly improves the efficiency of linker addition or library construction of single-stranded or damaged nucleic acid molecules.

[0071] 2) Single-tube library construction is achieved, and no tube transfer is needed during the experiment, greatly facilitating experimental operation and convenient and efficient automation.

[0072] 3) The library produced does not produce primer dimers, greatly saving sequencing costs.

[0073] 4) The present application can be used for DNA methylation research. Bisulfite-treated DNA is easily broken. The present application converts single-stranded DNA treated with bisulfite into double-stranded DNA, making the structure of bisulfite-treated DNA more stable, thereby being protected. The complementary strand obtained by extension completely retains the information of the original strand DNA treated with bisulfite, and the complementary strand obtained by extension has not been treated with bisulfite and has not been subjected to harsh chemical damage, and the structure is more stable than that of bisulfite-treated DNA.

[0074] 5) It can be used for constructing NGS library of FFPE DNA.

[0075] 6) The present application can be used for constructing NGS library of ancient DNA, which has extremely low content, extensive damage and high degradation: ancient DNA is often decomposed into short fragments, usually between 50-200 nucleotides in length. The present application converts single-stranded DNA of ancient DNA into double-stranded DNA, doubling the information of ancient DNA. At the same time, converting into double-stranded DNA structure makes the structure of ancient DNA more stable, thereby being protected. The complementary strand obtained by extension retains the information of ancient DNA completely. The complementary strand obtained by extension is a newly synthesized strand, which is not severely damaged and has a more stable structure than ancient DNA; greatly improving the success rate of research;

[0076] 7) Blood extraction-free can be achieved, and whole genome NGS library can be directly constructed;

[0077] 8) Blood card samples can be used to construct whole genome NGS library without extraction;

[0078] 9) Plasma extraction-free can be achieved, and NGS library can be directly constructed;

[0079] 10) Plasma extraction-free library construction for pregnant women can be achieved, and NIPT NGS sequencing detection can be completed;

[0080] 11) Plasma extraction-free can be achieved, and NGS library of plasma cfDNA bisulfite treatment (BS Treatment) can be constructed for methylation sequencing;

[0081] 12) FFPE slide can be used to directly construct NGS library. BRIEF DESCRIPTION OF DRAWINGS

[0082] Figure 1 shows a schematic diagram of the present application with a linker.

[0083] Figure 2 shows a schematic diagram of the present application with a linker.

[0084] Figure 3 shows a schematic diagram of the results of the NGS library constructed in Example 1; qsep400 map (A); results without dimer formation (B).

[0085] Figure 4 shows a flowchart of direct library construction of FFPE original sample.

[0086] Figure 5 shows qsep400 map of the constructed NGS library; qsep400 map of the NGS library constructed in Example 2 (A); qsep400 map of the NGS library constructed in Example 3 (B).

[0087] Figure 6 shows a flowchart of direct library construction of blood sample.

[0088] Figure 7 shows a schematic diagram of the results of the NGS library constructed in Example 4; qsep400 map (A); agarose gel electrophoresis results (B).

[0089] Figure 8 shows a flow chart for direct library construction for plasma samples.

[0090] Figure 9 shows agarose gel electrophoresis results for NGS library constructed in Example 5.

[0091] Figure 10 shows a schematic diagram of the ligation principle of the present application III.

[0092] Figure 11 shows a schematic diagram of the ligation principle of the present application IV.

[0093] Figure 12 shows agarose gel electrophoresis results for NGS library constructed in Example 6.

[0094] Figure 13 shows a schematic diagram of the results of NGS library constructed in Example 7; agarose gel electrophoresis results (A); qsep400 profile of constructed NGS library (B).

[0095] Figure 14 shows a schematic diagram of the results of NGS library constructed in Example 8; agarose gel electrophoresis results (A); qsep400 profile of NIPT positive DNA library (B); qsep400 profile of NIPT negative DNA library (C).

[0096] Figure 15 shows direct construction of methylation sequencing library from plasma raw sample.

[0097] Figure 16 shows a schematic diagram of the results of NGS library constructed in Example 9; agarose gel electrophoresis results (A); qsep400 profile of NGS library (B).

[0098] Figure 17 shows a method II for library construction of FFPE DNA.

[0099] Figure 18A shows agarose gel electrophoresis results for NGS library constructed in Example 10.

[0100] Figure 18B shows agarose gel electrophoresis results for NGS library constructed in Example 11.

[0101] Figure 19 shows a schematic diagram of the results of NGS library constructed in Example 11; qsep400 profile (A); length distribution of constructed NGS library (B). DETAILED DESCRIPTION

[0102] The present application first provides a method for U-turn amplification of nucleic acid, which comprises adding a specific adapter to the 3' end of a single-stranded nucleic acid, the specific adapter comprising a hairpin structure and an adapter sequence for complementary binding to the 3' end of the single-stranded nucleic acid;

[0103] After the single-stranded nucleic acid is combined with the specific linker, the single-stranded nucleic acid is extended from the 3' end of the single-stranded nucleic acid using the specific linker as a template, and the extended single-stranded nucleic acid has a hairpin structure to form a self-turning, and then the original single-stranded nucleic acid is used as a template to extend and amplify to form an amplification product.

[0104] In some embodiments of the present application, the hairpin structure comprises a stem region and a loop region, and the two strands of the stem region are complementary. Preferably, the sequence length of the stem region is 5-40 bp; and preferably, the sequence of the loop region is TTTTT, AAAAAA, ACTCTTTCCCTA or AATAA.

[0105] In a preferred embodiment of the present application, the two strands of the stem region are a linker template and a linker sequence, respectively, the linker template is complementary to the linker sequence, and the adapter sequence is connected to the end of the linker template.

[0106] In some embodiments of the present application, the single-stranded nucleic acid is selected from DNA or RNA.

[0107] In some embodiments of the present application, the 3' end of the single-stranded nucleic acid comprises a natural 3' end or an extended modified 3' end of the single-stranded nucleic acid. As shown in the embodiment of FIG. 1, the natural 3' end of the single-stranded nucleic acid is complementary combined with the adapter sequence, after the complementary combination, the single-stranded nucleic acid is extended using the hairpin structure as a template, the extended single-stranded nucleic acid has a hairpin structure to form a self-turning, and then the original single-stranded nucleic acid is used as a template to extend and amplify to form an amplification product. As shown in the embodiment of FIG. 10 or FIG. 11, the end of the single-stranded nucleic acid is first extended, the extended modified 3' end is complementary combined with the adapter sequence, after the complementary combination, the single-stranded nucleic acid is extended using the hairpin structure as a template, the extended single-stranded nucleic acid has a hairpin structure to form a self-turning, and then the original single-stranded nucleic acid is used as a template to extend and amplify to form an amplification product.

[0108] In some embodiments of the present application, the linker template is selected from a sequence of a sequencing primer binding site, a protein binding sequence or a promoter. Preferably, the sequence of the sequencing primer binding site is selected from a partial sequence or a full-length sequence of a sequencing primer binding site R1, R2 or a complementary sequence R1', R2' thereof.

[0109] In some embodiments of the present application, the adapter sequence consists of 6-25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G.

[0110] In some embodiments of the present application, the 3' end of the adapter sequence is provided with a blocking group, and the blocking group is a 3' terminal hydroxyl active blocking group. Preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.

[0111] The specific linker comprises a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, an adaptor sequence, and a blocking group; or, the specific linker comprises a sequencing primer binding site R2, a loop structure, a sequence R2' complementary to the sequencing primer binding site R2, an adaptor sequence, and a blocking group.

[0112] The present application also provides the use of the above-mentioned method in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing, and / or fourth-generation sequencing.

[0113] The present application also provides a nucleic acid molecule linker, which comprises a first linker, the first linker comprising a hairpin structure and a random sequence, the hairpin structure comprising a stem region and a loop region, the two strands of the stem region being complementary, the two strands of the stem region being a linker template and a linker sequence respectively, the linker template being complementary to the linker sequence, the random sequence being connected to the end of the linker template, and the random sequence comprising a sequence complementary to a part of the 3' end of the nucleic acid molecule to be detected.

[0114] In the present application, the "random sequence comprising a sequence complementary to a part of the 3' end of the nucleic acid molecule to be detected" means that the random sequence can bind to the 3' end of the nucleic acid molecule to be detected through base complementary pairing, i.e., the random sequence is used for complementary binding to the 3' end of the nucleic acid molecule to be detected. According to specific applications, the design of the random sequence can adopt the following two implementation manners:

[0115] In some embodiments, the random sequence is a completely randomized design, in which embodiment, by designing a sufficient number of random sequence combinations, it is ensured that the nucleic acid molecule to be detected can find a complementary sequence matching it. When the random sequence binds to the 3' end of the nucleic acid molecule to be detected, the two form a local double-stranded structure, so that the nucleic acid molecule to be detected can extend from the 3' end using the hairpin structure as a template.

[0116] In other embodiments, the random sequence is a complementary design based on the 3' end sequence of the nucleic acid molecule to be detected, which has a determined complementary relationship with the 3' end extension sequence of the target nucleic acid molecule. When the random sequence binds to the 3' end extension sequence of the nucleic acid molecule to be detected, the two form a local double-stranded structure, so that the nucleic acid molecule to be detected can extend from the 3' end using the hairpin structure as a template.

[0117] The 3' end of the nucleic acid molecule to be tested comprises a natural 3' end of the nucleic acid molecule to be tested or an extended modified 3' end. The natural 3' end refers to the 3' end of the nucleic acid molecule to be tested without any artificial modification; the extended modified 3' end refers to a structure formed by adding nucleotides on the natural 3' end through a polymerase (such as terminal transferase), a ligase or chemical synthesis.

[0118] In some embodiments of the present application, the extended modified sequence consists of 2-30 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G.

[0119] The nucleic acid molecule to be tested is selected from DNA or RNA.

[0120] The linker template is any sequence, i.e. any sequence desired to be connected to the nucleic acid molecule to be tested according to the experimental purpose.

[0121] The linker template is selected from a sequencing primer binding site, a protein binding sequence or a promoter sequence, etc. The promoter sequence is, for example, a partial or complete sequence of a T7 promoter.

[0122] The sequencing primer binding site is a region where a sequencing primer binds during sequencing, used to indicate the position where sequence reading starts.

[0123] The sequencing primer binding site is selected from a sequencing primer binding site R1, R2 or the respective complementary sequences R1' or R2'. In the embodiments shown in FIG. 1, FIG. 2, FIG. 10 and FIG. 11 of the present application, the sequencing binding site R1 or R2 is a linker sequence, and the respective complementary sequences R1' or R2' is a linker template.

[0124] R1 is Rd1 SP. In the prior art, Rd1 SP (Read1 Sequencing Primer) is a primer binding site for first strand sequencing, usually located at one end of a DNA fragment. During sequencing, a sequencing primer binds to this site to start sequencing the first strand of the DNA fragment.

[0125] R2 is Rd2 SP. In the prior art, Rd2 SP (Read2 Sequencing Primer) is a primer binding site for second strand sequencing, usually located at the other end of a DNA fragment. In paired-end sequencing, this site is used to read the DNA information complementary to the first strand.

[0126] The sequence of the sequencing primer binding site is selected from a partial sequence or a full-length sequence of the sequencing primer binding site R1, R2 or the respective complementary sequences R1', R2', preferably a partial sequence.

[0127] In some embodiments of the present application, the random sequence consists of 6-25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G. In embodiments of the present application as shown in FIG. 1, FIG. 2, FIG. 10, FIG. 11 and other flowcharts, the 3' end of the random sequence is provided with a blocking group, which is a nucleic acid molecule linker 3' end hydroxyl active blocking group.

[0128] In some embodiments of the present application, the blocking group is connected to the last base at the 3' end of the random sequence.

[0129] The blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2, etc. The NH2 modification is, for example, NH2-C6 modification, NH2-C7 modification, NH2-C12 modification, etc. The MGB (Minor Groove Binder) is a small groove binder in DNA helix, which is a dihydrocyclopyrrole tripeptide that can selectively bind to the small groove of the DNA molecule, i.e. the shallow groove in the DNA helix. The Spacer modification is, for example, Spacer C3 modification.

[0130] As shown in Step 1 of FIG. 1 or FIG. 2, in some embodiments of the present application, the first linker comprises a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence and a blocking group.

[0131] In some embodiments of the present application, the first linker comprises, from 5' end to 3' end, a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence and a blocking group.

[0132] As shown in FIG. 1 or FIG. 2, the first linker with a hairpin structure forms partial complementarity and extension with the 3' end of the nucleic acid molecule to be tested, and the sequencing primer binding site R1 (this paragraph takes R1 as an example, and R2 is the same) in the first linker is copied to the original strand end of the nucleic acid molecule to be tested, and the obtained template sequence has a hairpin structure. The hairpin structure allows the nucleic acid molecule to be tested to synthesize the second strand by extending the hairpin structure, so that the nucleic acid molecule to be tested can synthesize the opposite linker by double-stranded ligation and other methods. The nucleic acid molecule with double-sided linker can be amplified and sequenced using universal primers.

[0133] As shown in Step 1 and Step 2 in FIG. 10 or 14, the first adapter with hairpin structure is complementary to and extends the 3' end extension sequence of the nucleic acid molecule to be detected, and the sequencing primer binding site R1 (R2 is the same as R1 in this paragraph) in the first adapter is copied to the original strand end of the nucleic acid molecule to be detected, and the obtained template sequence has a hairpin structure. The hairpin structure allows the nucleic acid molecule to be detected to synthesize the second strand by extending the hairpin structure, so that the nucleic acid molecule to be detected can synthesize the opposite adapter by double-stranded ligation and the like. The nucleic acid molecule with double-sided adapter can be amplified and sequenced using universal primers.

[0134] In some embodiments of the present application, the sequence length of the stem region of the first adapter is 5-40 bp, such as 5-10 bp, 10-15 bp, 15-20 bp, 20-25 bp, 25-30 bp, 30-35 bp, 35-40 bp.

[0135] The loop region sequence of the first adapter usually contains 3-20 nucleotides or more, such as 3-5, 5-7, 7-10, 10-15, 15-20, 20-25 or more nucleotides.

[0136] In some embodiments of the present application, the loop region sequence can be as long as not complementary, such as TTTTT, AAAAAA, ACTCTTTCCCTA, AATAA, etc.

[0137] In some embodiments of the present application, the nucleic acid molecule adapter further comprises a second adapter.

[0138] In the embodiments shown in FIG. 1 or 11, the second adapter is a hairpin structure, and the second adapter comprises a stem region and a loop region, the two strands of the stem region are complementary, and the two strands of the stem region are sequencing primer binding sites. The sequencing primer binding sites are selected from sequencing primer binding sites R1, R2 or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first adapter, that is, when the sequencing primer binding sites in the first adapter are R1 and / or R1', the sequencing primer binding sites in the second adapter are R2 and R2', and when the sequencing primer binding sites in the first adapter are R2 and / or R2', the sequencing primer binding sites in the second adapter are R1 and R1'.

[0139] In some embodiments of the present application, the second adapter has a blunt end or a sticky end.

[0140] In some embodiments of the present application, the end of the second adapter with a sticky end is T and / or C. In a specific embodiment, the 3' end of the second adapter with a sticky end protrudes one T.

[0141] In some embodiments of the present application, the stem region of the second adaptor has a length of 5-40 bp, such as 5-10 bp, 10-15 bp, 15-20 bp, 20-25 bp, 25-30 bp, 30-35 bp, 35-40 bp.

[0142] In some embodiments of the present application, the loop region of the second adaptor generally comprises 3 to 10 nucleotides, such as 3-5, 5-7 or 7-10 nucleotides.

[0143] In some embodiments of the present application, the loop region sequence of the second adaptor can be any sequence as long as it is not complementary, such as TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT or AAAAAA.

[0144] In the embodiments shown in Figure 2 or Figure 10, the second adaptor is a Y-type adaptor, which comprises a head and a tail, and the head and the tail each comprise two strands, the head comprises two strands which are not complementary, and the two strands of the tail are complementary, and the two strands of the tail are sequencing primer binding sites selected from the group consisting of sequencing primer binding sites R1, R2 or their respective complementary sequences R1' or R2', and the sequencing primer binding sites of the second adaptor are different from the sequencing primer binding sites of the first adaptor, that is, when the sequencing primer binding sites of the first adaptor are R1 and / or R1', the sequencing primer binding sites of the second adaptor are R2 and R2', and when the sequencing primer binding sites of the first adaptor are R2 and / or R2', the sequencing primer binding sites of the second adaptor are R1 and R1'.

[0145] The length of the head is 2-15 nucleotides or more, and the length of the tail is 15-30 nucleotides or more.

[0146] In some embodiments, the tail is a blunt end, that is, the two strands have the same length. In other embodiments, the tail is a sticky end, one strand of the tail protrudes by one T nucleotide, preferably, the 3' end of the tail protrudes by one T nucleotide; for example, the 3' end of the sequencing primer binding site R2 or R1 of the tail protrudes by one T nucleotide.

[0147] In some embodiments of the present application, the second adaptor does not contain a phosphorylation modification; in other embodiments of the present application, the second adaptor contains a phosphorylation modification. The adjustment can be made flexibly according to the sample size and the specific situation during the experiment.

[0148] In the present application, the adaptor added to the 3' end of the original strand is the first adaptor, and the adaptor added to the 5' end of the original strand is the second adaptor.

[0149] In the embodiment shown in FIG. 2 and FIG. 17, the second adaptor does not contain phosphorylation modification, and the second adaptor is added to the target nucleic acid molecule but not to the replication strand of the target nucleic acid molecule. The second adaptor works by the following principle, referring to Step 3 in FIG. 2, the 5' end of the target nucleic acid molecule (original strand) and the replication strand of the target nucleic acid molecule (synthetic strand) generated by the random primer form a double-stranded structure. The sequencing primer binding site R2 in the second adaptor which is not phosphorylated is added to the original strand by blunt-end or A / T sticky-end double-stranded ligation; or referring to Step 1 and Step 2 in FIG. 17, the non-phosphorylated second adaptor is added to the 5' end of the DNA sequence (ME sequence) by using the transposition function of Tn5 transposase. Since the second adaptor is not phosphorylated, only the original strand can be connected, and a nick is formed between the synthetic strand and the second adaptor. The second adaptor is designed in a Y-shaped structure, so that the R2 sequence in the correct direction (not the complementary sequence R2') can be added to the original strand, or the method of blocking the 3' end of one strand can also ensure that the R2 sequence in the correct direction (not the complementary sequence R2') is added to the original strand. As shown in Step 4 in FIG. 1, the original strand now has a complete double-end adaptor structure, and universal primer PCR can be used for amplification and library construction.

[0150] In the embodiment shown in FIG. 15, the second adaptor contains phosphorylation modification, and the second adaptor is added to the target nucleic acid molecule and the replication strand of the target nucleic acid molecule. The second adaptor works by the following principle, referring to Step 7 in FIG. 15, the 5' end of the original strand and the synthetic strand generated by the random primer form a double-stranded structure. The sequencing primer binding site R2 in the second adaptor is added to the original strand, and the sequencing primer binding site R2' in the second adaptor is added to the synthetic strand by blunt-end or A / T sticky-end double-stranded ligation, so that the original strand and the synthetic strand both have a complete double-end adaptor structure and can be used as a template for PCR amplification, and universal primer PCR can be used for amplification and library construction.

[0151] The application also provides the use of the nucleic acid molecule adaptor in the addition of the adaptor to the target nucleic acid molecule or in the preparation of a DNA library construction product.

[0152] The target nucleic acid molecule is single-stranded DNA, double-stranded DNA or RNA.

[0153] The target nucleic acid molecule is derived from blood, plasma, FFPE sample, cell lysate, trace and damaged DNA sample.

[0154] The present application also provides a kit for constructing a DNA library, wherein the kit comprises the nucleic acid molecule linker, and further comprises any one or more of the following: a nucleic acid polymerase, a library construction reagent, a nucleic acid purification reagent, and a single-stranded nuclease.

[0155] The nucleic acid polymerase is a nucleic acid polymerase with strand displacement activity and / or a nucleic acid polymerase without strand displacement activity.

[0156] The nucleic acid polymerase with strand displacement activity can be obtained by purchase, such as Vent (exo-) DNA Polymerase (NEB), SD Polymerase (BIORON), DoGene Waq Polymerase (DoGene), Deep (exo-) DNA Polymerase (NEB), Klenow Fragment (3'→5'exo-) (NEB), Bst DNA Polymerase, Large Fragment (NEB), Bst DNA Polymerase (NEB), Bst 3.0 DNA Polymerase (NEB).

[0157] The library construction reagent comprises any one or more of the following: a nucleic acid fragmentation reagent, an end-repair reagent, an A-tailing reagent, a DNA ligase, a Tn5 transposase, a phosphorylation reagent, and a PCR amplification reagent.

[0158] The PCR amplification reagent comprises a primer set and a PCR reaction premix.

[0159] The library construction reagent can be a commercial kit, such as Huarukang HRK-CC220-24.

[0160] The nucleic acid purification reagent is, for example, a magnetic bead, in particular, AMPure XP magnetic bead.

[0161] The single-stranded nuclease is, for example, nuclease S1, mungbean nuclease, etc., which has endo- and exo-hydrolytic activity on single-stranded DNA and RNA phosphodiester bonds, produces 5'-phosphonucleotide and 5'-phospho-oligonucleotide end products, can be used to digest the unannealed polynucleotide tail and hairpin loop in RNA and DNA duplexes, and can be used to convert supercoiled DNA into linear form.

[0162] The Tn5 transposase can efficiently insert the linker sequence (Adapter with ME sequence) into the target DNA fragment randomly, so that the 5' end of each DNA fragment has a linker sequence.

[0163] The application also provides a method for constructing an NGS library by using nucleic acid U-type self-rotation amplification, comprising the following steps:

[0164] 1) mixing and reacting the nucleic acid molecules to be tested, nucleic acid polymerase with strand displacement activity and the first adapter to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecules to be tested;

[0165] 2) synthesizing the complementary strand of the original strand of the nucleic acid molecules to be tested to form double-stranded nucleic acid molecules to be tested;

[0166] 3) mixing and reacting the product of step 2), the second adapter and DNA ligase to add the second adapter to the original strand and / or the synthesized strand of the nucleic acid molecules to be tested;

[0167] 4) purifying the product of step 3) with magnetic beads, and then mixing and reacting with PCR amplification reagents to obtain an NGS library of the nucleic acid molecules to be tested and / or the complementary strand thereof comprising a double-end adapter structure.

[0168] In some embodiments of the application, in step 1), the nucleic acid molecules to be tested, terminal deoxynucleotidyl transferase and dNTPs are mixed separately / combined to extend the 3' end of the nucleic acid molecules to be tested.

[0169] In some embodiments of the application, in step 1), the molar ratio of the nucleic acid molecules to be tested to the terminal deoxynucleotidyl transferase is 1:(0.5-2).

[0170] In some embodiments of the application, in step 1), the molar ratio of the nucleic acid molecules to be tested to dNTPs is 1:(10-100). The molar ratio of the nucleic acid molecules to be tested to dNTPs is selected from any one of the following ranges: 1:(10-30), 1:(30-50), 1:(50-70), 1:(70-90), 1:(90-100).

[0171] In some embodiments of the application, in step 1), the amount of the nucleic acid molecules to be tested is 1 pg-1000 ug.

[0172] In some embodiments of the application, in step 1), the concentration of the nucleic acid polymerase with strand displacement activity is 0.5 U-20 U.

[0173] In some embodiments of the application, in step 1), the concentration of the first adapter is 0.5 μM-5 μM.

[0174] In the embodiment of the present application as shown in Fig. 1, the first adaptor and the original strand of the nucleic acid molecule to be detected are first denatured to open the binding site, and then the complementary strand is synthesized by nucleic acid polymerase to form a double strand. Specifically, in step 2), the first adaptor and the original strand of the nucleic acid molecule to be detected are first denatured to open the binding site, and the U-turn of the hairpin structure sequence carried on the original strand of the nucleic acid molecule to be detected forms a hairpin structure, and the 3' end is extended by nucleic acid polymerase to synthesize a complementary strand to form a double strand.

[0175] In some embodiments of the present application, in step 3), a DNA ligation buffer can also be included to provide a reaction environment for ligation of the second adaptor, and the DNA ligation buffer can be a commercial reagent, such as HuaRuKang HRK-CC220-24.

[0176] In some embodiments of the present application, in step 3), the second adaptor is a blunt-ended second adaptor or a sticky-ended second adaptor.

[0177] In the present application, when the second adaptor is blunt-ended, the molar ratio of the second adaptor to the nucleic acid molecule to be detected is (20-100): 1.

[0178] In the present application, when the second adaptor is sticky-ended, the molar ratio of the second adaptor to the nucleic acid molecule to be detected is (10-50): 1.

[0179] In some embodiments of the present application, in step 3), the reaction condition is 20°C for 25 min in a PCR instrument.

[0180] In some embodiments of the present application, in step 3), the nucleic acid molecule to be detected with the second adaptor is further mixed with a single-strand nuclease to remove the single-stranded portion (i.e. the loop region of the hairpin structure or the head of the Y-shaped structure) in the first adaptor and / or the second adaptor; in this embodiment, the reaction buffer is also mixed with the nucleic acid molecule to be detected with the second adaptor and the single-strand nuclease. The final concentration of the nuclease is 0.3-3 U / ul based on the total volume of the reaction system.

[0181] In some embodiments of the present application, in step 4), after the PCR reaction is completed, the PCR product is further mixed with magnetic beads for purification.

[0182] The present application also provides another method for constructing an NGS library by U-turn amplification of nucleic acid, which comprises the following steps:

[0183] 1) mixing a double-stranded nucleic acid molecule to be detected, a transposase and a second adaptor to react, so as to add the sequence of the second adaptor to the 5' end of the nucleic acid molecule to be detected; the second adaptor is a hairpin structure and has an ME sequence;

[0184] 2) denaturation to convert the product in step 1) into single strand, obtaining single-stranded test nucleic acid molecules with second adapter;

[0185] 3) mixing and reacting the single-stranded test nucleic acid molecules, nucleic acid polymerase with strand displacement activity and the first adapter to replicate the first adapter sequence to the 3' end of the test nucleic acid molecules;

[0186] 4) synthesizing the complementary strand of the original strand of the test nucleic acid molecules to form double-stranded test nucleic acid molecules;

[0187] 5) purifying the product in step 4) with magnetic beads, and then mixing with PCR amplification reagents and performing PCR reaction, to obtain NGS library of test nucleic acid molecules and / or their complementary strands including double-end adapter structure.

[0188] In some embodiments of the present application, in step 3), before mixing and reaction, the single-stranded test nucleic acid molecules, terminal deoxynucleotidyl transferase and dNTPs are mixed to extend and modify the 3' end of the test nucleic acid molecules.

[0189] In some embodiments of the present application, in step 4), the test nucleic acid molecules with the first adapter are mixed with single-stranded nuclease to remove the single-stranded part in the first adapter and / or the second adapter.

[0190] The reaction procedure or condition of each step in the method for constructing NGS library of test nucleic acid molecules with adapter is not particularly limited, only needs to meet the corresponding effect such as denaturation, extension, digestion effect, and can be carried out according to the instruction provided by the reagent manufacturer.

[0191] The present application also provides the NGS library prepared by the method for constructing NGS library.

[0192] The present application also provides the use of the method for constructing NGS library in any one or more of the following:

[0193] I, for constructing NGS library of FFPE DNA;

[0194] II, for constructing NGS library of ancient DNA;

[0195] III, for realizing blood extraction-free, for directly constructing whole genome NGS library;

[0196] IV, for realizing blood card sample extraction-free, for directly constructing whole genome NGS library;

[0197] V, for realizing plasma extraction-free, for directly constructing cfDNA NGS library;

[0198] VI. To achieve plasma extraction-free, construct plasma cfDNA bisulfite treated NGS library for methylation sequencing;

[0199] VII. To achieve plasma extraction-free for pregnant women, for constructing cffDNA NGS library;

[0200] VIII. To achieve FFPE slide direct construction of NGS library.

[0201] The present application is further illustrated by the following specific examples that set forth in detail certain illustrative embodiments of the application. Other advantages and benefits of the application will become apparent to those of ordinary skill in the art upon reading the contents of the specification and appended claims. The present application may be implemented or carried out in other ways than those specifically described herein without departing from the spirit of the application. Numerous modifications or changes can be made with respect to the specific embodiments described herein without departing from the spirit of the application.

[0202] Before further description of the application, it should be understood that the application is not limited to the particular specific embodiments described below; it should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting as to the application. In this specification and in the claims, unless otherwise indicated, the singular forms "a", "an", and "the" include plural referents.

[0203] When a numerical range is given in the embodiments, it should be understood that, unless otherwise specified by the application, both ends of each numerical range and any number between the two ends can be selected. Unless otherwise defined, all technical and scientific terms used in the application have the same meaning as commonly understood by those skilled in the art. In addition to the specific methods, devices, materials used in the embodiments, any method, device and material of the prior art similar or equivalent to those described in the embodiments of the application can also be used to implement the application according to the prior art mastered by those skilled in the art and the description of the application.

[0204] Example 1 Short-chain DNA fragment library construction method

[0205] As shown in Figure 1 or Figure 2, the steps include: Step 1: under the action of nucleic acid polymerase with strand displacement activity, the 3' end of single-stranded DNA (original strand) forms partial complementarity and extension with the hairpin structure of the adapter template R1' with 3' random sequence, and the adapter sequence R1 is copied to the end of the original strand. Since the 3' end of the adapter template R1' is blocked by a blocking group, the adapter template will not produce random extension. The hairpin structure further ensures that the adapter template will not produce random extension to form adapter dimers;

[0206] Step 2: The double-stranded structure of the original strand / adapter template produced in the previous step is separated by nucleic acid denaturation, and the hairpin structure sequence on the original strand will U-turn to form a hairpin structure. The 3' end of the hairpin structure can be further extended by a polymerase to synthesize a complementary synthetic strand;

[0207] The experimental steps of Step 1 and Step 2 are as follows: take 2 μl 10X Reaction Buffer, add 2 μl dNTP Mix (2.5 mM) and 1 μl Vent (exo-) DNA Polymerase (NEB), mix 3.5 μl 20 μM NAP5-N15 NH2 (the sequence is shown in SEQ ID NO. 1), add 9.5 μl water. On the PCR instrument, 94°C for 30 seconds, then reduce the temperature to 55°C for 1 minute, and then reduce the temperature to 4°C for 1 minute;

[0208] SEQ ID NO. 1:

[0209] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0210] Add 2 μL water containing 10 ng 160 bp DNA fragment (a mixture of cell DNA digestion products); a total of 20 μl reaction solution; place in the PCR instrument, and the reaction program is as follows:

[0211] Step 3: The 5' end of the original strand and the synthetic strand produced by U-turn of the 3' end of the original strand form a double-stranded structure, and the second adapter R2 (the second adapter is a hairpin structure (Figure 1); the second adapter is a Y-shaped adapter (Figure 2)) that has not been phosphorylated is added to the original strand by means of blunt-end or A / T or G / C sticky-end double-stranded ligation. Since the second adapter is not phosphorylated, only the original strand can be connected, and a nick is formed between the synthetic strand and the second adapter. The second adapter can be designed by Y-shaped structure or by blocking the 3' end of one strand to add the correct direction R2 sequence (not the complementary sequence R2') to the original strand.

[0212] Step 3: The experimental procedure is as follows: 9 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Huake Kang HRK-CC220-24) are added to 20 μl of reaction solution. At the same time, 1 μl of TP72 adapter (final concentration 1 uM) with the sequence shown in SEQ ID NO. 2 and 1.5 μL of TP7B2 adapter (final concentration 1.5 μM) with the sequence shown in SEQ ID NO. 3 are added. Place in a PCR instrument at 20°C for 25 min, then cool to 4°C until the next step is entered;

[0213] SEQ ID NO. 2:

[0214] SEQ ID NO. 3:

[0215] Step 4: By digestion of single-stranded nuclease, the single-stranded part in the hairpin structure and the single-stranded part in the second adapter are removed, so that the template strand and the synthesized strand can be separated in the next step of denaturation;

[0216] Step 4: The experimental procedure is as follows: 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) are added to 33 μl of reaction solution. Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step is entered;

[0217] Step 5: The template strand and the synthesized strand are separated in PCR denaturation, and the original strand now has a complete double-end adapter structure, which is amplified and library constructed using universal primers PCR.

[0218] 69 μL of Ampure beads are added to bind DNA, and washed with 85% ethanol twice; carefully remove the 85% ethanol wash solution and place at room temperature for 5 minutes;

[0219] Ampure beads are sequentially added with 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 with a concentration of 10 μM each, and the sequences are shown in SEQ ID NO. 4 and 5, respectively) and 19 μl of 2X HiFi PCR Master Mix (Huake Kang HRK-CC220-24);

[0220] SEQ ID NO. 4:

[0221] SEQ ID NO. 5:

[0222] Place on PCR machine, reaction program as follows:

[0223] Add 54 μL Ampure beads to purify the PCR product, and elute with 50 μl water to obtain NGS library with complete double-end adapter structure. The qsep400 map of the constructed NGS library is shown in Figure 3A.

[0224] Take 8 μl NGS library for 1% agarose electrophoresis, electrophoresis conditions are voltage 100 V, electrophoresis time 20 minutes. The results are shown in Figure 3B, which proves that the constructed NGS library does not produce primer dimers.

[0225] Sequencing the library with NovaSeq X Plus, sequencing successfully split data. Sequence analysis shows that the library sequence is consistent with human cell sequence.

[0226] Through sequencing analysis, 46.05% of the data in the starting position of Read2 is sequence TGGTCAT, and 47.62% is sequence TGACTG. According to the experimental design, sequence TGGTCAT is the product of TA ligation, and sequence TGACTG is the product of blunt-end ligation. This result strongly proves that our method can ligate blunt-end and 3' end A-tailed DNA products.

[0227] Example 2 FFPE DNA Direct Library Construction

[0228] As shown in Figure 4, Step 1: pretreat the original sample, treat the sample with chemical reagents, denature the protein to release the nucleic acid; remove the protein and chemical reagents, and retain the DNA;

[0229] Step 2: Randomly bind sample DNA with primer OH-NNNNUNN, and extend the NNNNUNN binding site with polymerase with strand displacement activity. A copy of the sample sequence is obtained, and the 5' end of each molecule is NNNNUNN.

[0230] The experimental steps of Step 2 are as follows: take 1 μl 10X Reaction Buffer, add 1 μl dNTP Mix (2.5 mM) and 0.5 μl Vent (exo-) DNA Polymerase (NEB), mix 0.5 μl 20 μM N8U (sequence: NNNNUNUN), add 4 μl water, add 3 μl FFPE DNA (16 ng / μl). Total reaction volume is 10 μl; on the PCR machine, the reaction program is as follows:

[0231] Step 3: The sample amplification product is treated with UDG and Endonuclease VIII. Each U position is cleaved. The extended copy molecule is cleaved to get an OH-NNNN-P molecule and a 5' phosphate structure extended copy molecule. The OH-NNNN UNN random primer failed to extend and is cleaved to get an OH-NNNN-P molecule and a P-NN. Only the 5' phosphate structure extended copy molecule can enter the subsequent experiment after treatment;

[0232] Step 3: The sample amplification product is treated with UDG and Endonuclease VIII. Each U position is cleaved. The extended copy molecule is cleaved to get an OH-NNNN-P molecule and a 5' phosphate structure extended copy molecule. The OH-NNNN UNN random primer failed to extend and is cleaved to get an OH-NNNN-P molecule and a P-NN. Only the 5' phosphate structure extended copy molecule can enter the subsequent experiment after treatment;

[0233] Step 4: Under the action of a nucleic acid polymerase with strand displacement activity, the 3' end of the 5' phosphate structure extended copy molecule forms partial complementarity with the 3' random sequence hairpin structure linker template R1', and is extended to copy the linker sequence R1 to the original chain end. Since the 3' end of the linker template R1' is blocked by a blocking group, the linker template will not produce random extension. The hairpin structure further ensures that random extension will not occur between the linker templates to cause linker dimers;

[0234] Step 5: The double-stranded structure of the original chain / linker template produced in the previous step is separated by denaturation of the nucleic acid molecule, and the hairpin structure sequence on the original chain will U-turn to form a hairpin structure, and the 3' end thereof can be further extended by a polymerase to synthesize a complementary synthetic chain;

[0235] Step 3: The sample amplification product is treated with UDG and Endonuclease VIII. Each U position is cleaved. The extended copy molecule is cleaved to get an OH-NNNN-P molecule and a 5' phosphate structure extended copy molecule. The OH-NNNN UNN random primer failed to extend and is cleaved to get an OH-NNNN-P molecule and a P-NN. Only the 5' phosphate structure extended copy molecule can enter the subsequent experiment after treatment; Reaction Buffer, 1 μl dNTP Mix (2.5 mM), and 0.5 μl Vent (exo-) DNA Polymerase (NEB) were added, 3.5 μl 20 μM NTP5-N15 NH2 (nucleotide sequence as shown in SEQ ID NO. 6) was added, 4 μl of water was added, and a total of 20 μl of reaction solution was prepared;

[0236] SEQ ID NO. 6 (NTP5-N15 NH2):

[0237] AGATCGGAAGAGCGTCGTTTTTTACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0238] The reaction program is as follows:

[0239] Next, the second linker is connected and PCR amplified to build a library in the same way as in Example 1.

[0240] The experimental steps are as follows:

[0241] 1) Add 9 μl Ligation Buffer and 1.5 μl DNA ligase V3 (HRK-CC220-24) to 20 μl reaction solution. At the same time, add 1 μl TP72 adapter (30 μM) and 1.5 μl TP7B2 adapter (30 μM). Place in a PCR instrument at 20°C for 25 min, and then cool to 4°C until the next step is performed;

[0242] 2) Add 8 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10 U / μl) to 33 μl reaction solution. Place in a PCR instrument at 23°C for 20 min, and then cool to 4°C until the next step is performed;

[0243] 3) Add 69 μL Ampure beads to bind DNA, and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and place at room temperature to dry for 5 min;

[0244] 4) Add 18 μl water, 1.5 μl mixed primers (LP5-UDI0021 and LP7-UDI0021, each at a concentration of 10 μM), and 19 μl 2X HiFi PCR Master Mix (HRK-CC220-24) to the Ampure beads in sequence;

[0245] Place in a PCR instrument, and the reaction program is as follows:

[0246] 5) Add 54 μL Ampure beads to purify the PCR product, and elute with 50 μl water;

[0247] The qsep400 map of the constructed NGS library is shown in FIG. 5A, which shows that the DNA length distribution is in the 100 bp-1000 bp region.

[0248] The library is sequenced using NovaSeq X Plus, and the sequencing is successfully split. Sequence analysis shows that the library sequence conforms to the human genome sequence.

[0249] Example 3: Adding a linker sequence to the 3' end of a DNA fragment

[0250] Take 1.5 μl 10X Reaction Buffer mix 3 μΐ 20 μΜ UT7-N15 NH2, add 1.2 μΐ dNTP Mix (2.5 mM), add 5.8 μΐ water. On PCR machine 94 °C for 30 s, then ramp down to 55 °C for 1 min, then ramp down to 4 °C for 1 min. Add 10 ng of about 160 bp DNA fragment in 2.5 μΐ water, add 1 μΐ Vent (exo-) DNA Polymerase (NEB); total 15 μΐ reaction;

[0251] Place on PCR machine, reaction program as follows:

[0252] The above steps correspond to step 1 and step 2 in FIG. 2;

[0253] Add 4 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μΐ S1 nuclease (10 U / μΐ) to 15 μΐ reaction. Place on PCR machine at 23 °C for 20 min, then ramp down to 4 °C until next step;

[0254] The above steps correspond to step 4 in FIG. 2, i.e., by digestion of single-stranded nuclease, remove the single-stranded part in the hairpin structure and the second adapter, so that the template strand and the synthesized strand can be separated in denaturation;

[0255] Add 32 μΐ Ampure beads to bind DNA, and wash with 85% ethanol twice; carefully remove the 85% ethanol wash solution and place it at room temperature for 5 minutes;

[0256] Add 20 μΐ water to elute the Ampure beads;

[0257] Use Rapid DNA library Kit (Huarui Kang HRK-CC220-24) to construct sequencing library according to the instructions.

[0258] Sequencing with NovaSeq X Plus and sequence analysis.

[0259] The library qsep400 map is shown in FIG. 5B, and the sequencing result analysis shows that the T7 adapter appears at the front end of the sequencing Read1, or at the front end of the sequencing Read2, and there is no case of Read1 and Read2 appearing at the same time.

[0260] The sequencing result conforms to the morphology of adding T7 adapter sequence at the 3' end in FIG. 2.

[0261] T7 adapter: TCCACTTTGCCTTTCT

[0262] read1 adapter proportion: 0.12

[0263] read2 adapter proportion: 0.08

[0264] This data confirms that only a portion of the 3' end has added the T7 adapter sequence.

[0265] Example 4 Direct library construction from blood samples

[0266] As shown in Figure 6,

[0267] Step 1: Pretreatment of raw samples: add lysis solution to the blood sample, lyse the cells; add nuclease to lyse DNA; remove protein, retain DNA;

[0268] Step 2: The 3' end sequence of the single-stranded DNA (original strand) is complementary to the 3' random sequence of the first adapter of the hairpin structure, and under the action of the nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) continues to extend, and the first adapter sequence R1 is copied to the end of the original strand; since the 3' end of the first adapter is blocked by a blocking group, the first adapter will not be extended; the hairpin structure further ensures that random extension will not occur between the adapter templates to cause adapter dimers;

[0269] Step 3: The double-stranded structure of the original strand / adapter template produced in the previous step is separated by nucleic acid denaturation, and the hairpin structure sequence on the original strand will form a U-turn to form a hairpin structure; the 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0270] Next, the connection of the second adapter and the PCR amplification library construction are carried out in the same way as in Example 1.

[0271] The specific experimental steps are as follows:

[0272] 1) Collect 20 μl of peripheral blood from the finger.

[0273] 2) Add 100 μl of 0.1% Tween 20, mix and place in ice bath for 1 minute. Centrifuge at 3000g for 2 minutes, discard the supernatant.

[0274] 3) Add 100 μl of 0.1% Tween 20 again, mix and place in ice bath for 1 minute. Centrifuge at 3000g for 2 minutes, discard the supernatant.

[0275] 4) Wash the cells with 100 μl of Atlantis Digestion Buffer (ZYMO Cat: D5220). Centrifuge at 3000g for 2 minutes, discard the supernatant.

[0276] 5) Resuspend cell lysate with 10 μΐ Atlantis Digestion Buffer, add 0.3 U of Atlantis dsDNase (ZYMO Cat: D5220) and 1 μΐ RNase A (Thermo Scientific EN0531).

[0277] 6) Incubate at 42°C for 30 min.

[0278] 7) Add 10 μΐ magnetic beads (Apostle A17622-250), add 32 μΐ Lysis Binding Buffer (Apostle A17622-250).

[0279] 8) Incubate at room temperature for 30 min, shake every 5 min.

[0280] 9) Place on magnetic stand for 5 min, discard supernatant.

[0281] 10) Add 100 μΐ wash buffer (Apostle A17622-250) and wash, then magnetic adsorption. Discard supernatant.

[0282] 11) Add 100 μΐ 85% ethanol and wash. Magnetic adsorption. Discard supernatant.

[0283] 12) Add 100 μΐ 85% ethanol again and wash. Magnetic adsorption. Discard supernatant. Dry in air for 5 min.

[0284] 13) Take 2 μΐ 10X Reaction Buffer, add 2 μΐ dNTP Mix (2.5 mM) and 1 μΐ Vent (exo-) DNA Polymerase (NEB), mix 3.5 μΐ 20 μΜ NAP5-N15 NH2 (sequence as shown in SEQ ID NO. 1), add 11.5 μΐ water, total 20 μΐ.

[0285] SEQ ID NO. 1:

[0286] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0287] 14) Place in PCR instrument, reaction program as follows:

[0288] 15) To 20 μΐ reaction, add 9 μΐ Ligation Buffer and 1.5 μΐ DNA ligase V3 (HRK-CC220-24). At the same time, add 1 μΐ TP72 adapter (final concentration 1 μΜ) with sequence as SEQ ID NO. 2 and 1.5 μΐ TP7B2 adapter (final concentration 1.5 μΜ) with sequence as SEQ ID NO. 3. Place in PCR machine at 20 °C for 25 min, then cool down to 4 °C until next step.

[0289] SEQ ID NO. 2:

[0290] SEQ ID NO. 3:

[0291] 16) To 33 μΐ reaction, add 8 μΐ 5X Reaction Buffer (EN0321) and 2 μΐ SI nuclease (10 U / μΐ). Place in PCR machine at 23 °C for 20 min, then cool down to 4 °C until next step.

[0292] Step 5: Template strand and synthesized strand are separated in PCR denaturation, now the original strand has complete double-end adapter structure, use universal primer PCR for amplification and library construction.

[0293] Add 69 μΐ Ampure beads to bind DNA, and wash with 85% ethanol for two times. Carefully remove 85% ethanol wash solution, and place at room temperature for air drying for 5 min.

[0294] To Ampure beads, add 18 μΐ water, 1.5 μΐ mixed primers (LP5-UDI0021 and LP7-UDI0021 with concentration of 10 μΜ each, sequence as SEQ ID NO. 4 and 5 respectively) and 19 μΐ 2X HiFi PCR Master Mix (HRK-CC220-24) in sequence.

[0295] SEQ ID NO. 4:

[0296] SEQ ID NO. 5:

[0297] Place in PCR machine, reaction program as follows:

[0298] Add 54 μL Ampure beads to purify the PCR product, and elute with 50 μl water to obtain NGS library with complete double-end adapter structure. The qsep400 profile of the constructed NGS library is shown in FIG. 7A.

[0299] Take 8 μl NGS library for 1% agarose electrophoresis, and the electrophoresis condition is voltage 100 V and electrophoresis time 20 minutes. The result is shown in FIG. 7B, which shows that the DNA length is concentrated between 250 bp and 750 bp.

[0300] Example 5 Direct library construction of plasma samples

[0301] As shown in FIG. 8, Step 1: Pretreatment of raw samples: add lysis solution to plasma samples; remove proteins and retain DNA;

[0302] Step 2: The 3' end sequence of single-stranded DNA (original strand) is complementary to the 3' random sequence of the first adapter of the hairpin structure; under the action of nucleic acid polymerase with strand displacement activity, the 3' end of single-stranded DNA (original strand) continues to extend, and the first adapter sequence R1 is copied to the end of the original strand; since the 3' end of the first adapter is blocked by a blocking group, the first adapter will not produce extension; the hairpin structure further ensures that random extension will not occur between the adapter templates to cause adapter dimers;

[0303] Step 3: The double-stranded structure of the original strand / adapter template produced in the previous step is separated by nucleic acid denaturation, and the hairpin structure sequence on the original strand will form a U-turn to form a hairpin structure; the 3' end thereof can be further extended by polymerase to synthesize a complementary synthetic strand;

[0304] Next, the connection of the second adapter and the PCR amplification library construction are carried out in the same way as in Example 1.

[0305] 1) 190 μl human plasma is added with 8 μl proteinase K and 20 μl sample lysis solution (Apostle A17622-250).

[0306] 2) Add 10 μl magnetic beads (Apostle A17622-250) at 60°C for 20 minutes, and add 125 μl lysis binding solution (Apostle A17622-250).

[0307] 3) Mix well at 2000 rpm for 10 minutes.

[0308] 4) Place on a magnetic stand for 5 minutes, and discard the supernatant.

[0309] 5) Add 500 μl washing solution (Apostle A17622-250) and wash, and then magnetically adsorb. Discard the supernatant.

[0310] 6) Add 500 μΐ of 85% ethanol, wash; magnetic adsorption; discard supernatant.

[0311] 7) Again add 500 μΐ of 85% ethanol, wash. Magnetic adsorption. Discard supernatant. Air dry for 5 minutes.

[0312] 8) Take 2 μΐ of 10X Reaction Buffer, add 2 μΐ of dNTP Mix (2.5 mM) and 1 μΐ of Vent (exo-) DNA Polymerase (NEB), mix 3.5 μΐ of 20 μΜ NAP5-N15 NH2 (sequence as shown in SEQ ID NO. 1), add 11.5 μΐ of water, a total of 20 μΐ.

[0313] SEQ ID NO. 1:

[0314] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0315] 9) Place in PCR instrument, reaction program as follows:

[0316] 10) Add 9 μΐ of Ligation Buffer and 1.5 μΐ of DNA ligase V3 (Huari Kang HRK-CC220-24) to 20 μΐ of reaction solution. At the same time, add 1 μΐ of TP72 adapter (final concentration 1 μΜ) with sequence as shown in SEQ ID NO. 2 and 1.5 μΐ of TP7B2 adapter (final concentration 1.5 μΜ) with sequence as shown in SEQ ID NO. 3. Place in PCR instrument at 20°C for 25 min, then cool to 4°C until entering the next step.

[0317] SEQ ID NO. 2:

[0318] SEQ ID NO. 3:

[0319] 11) Add 8 μΐ of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μΐ of S1 nuclease (10 U / μl) to 33 μΐ of reaction solution. Place in PCR instrument at 23°C for 20 min, then cool to 4°C until entering the next step.

[0320] 12) Add 69 μΐ of Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash and air dry at room temperature for 5 minutes.

[0321] 13) Add 18 μΐ of water, 1.5 μΐ of mixed primers (LP5-UDI0021 and LP7-UDI0021, each at a concentration of 10 μΜ, the sequences of which are shown in SEQ ID NO. 4 and 5, respectively) and 19 μΐ of 2X HiFi PCR Master Mix (Huarui Kang HRK-CC220-24) to the Ampure beads in sequence.

[0322] SEQ ID NO. 4:

[0323] SEQ ID NO. 5:

[0324] 14) Place in a PCR machine, and the reaction program is as follows:

[0325] 15) Add 54 μΐ of Ampure beads to purify the PCR product, and elute with 50 μΐ of water to obtain an NGS library with a complete double-end adapter structure.

[0326] 16) Take 8 μΐ of the NGS library and perform 1% agarose electrophoresis, with a voltage of 100 V and an electrophoresis time of 20 minutes. The results are shown in Figure 9, which shows that the DNA length is concentrated between 100 bp and 750 bp.

[0327] Example 6: Method two for library construction of short-chain DNA fragments

[0328] As shown in Figure 10 or Figure 11, the method comprises the following steps: Step 1: The 3' end of the single-stranded DNA (original strand) is subjected to the action of TdT (terminal deoxynucleotide transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), and the corresponding mononucleotide is added to the 3' end of the single-stranded DNA, thereby forming a 3' extended end of the single-stranded DNA.

[0329] Step 2: The 3' end of the single-stranded DNA (original strand) is extended and the sequence is complementary to the 3' sequence of the first linker of the hairpin structure. Under the action of base complementary matching, the 3' end of the single-stranded DNA (original strand) is specifically combined with the 3' sequence of the first linker of the hairpin structure, and under the action of the nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) is continuously extended, and the first linker sequence R1 is copied to the end of the original strand. Since the 3' end of the first linker is blocked by the blocking group, the first linker will not produce random extension. The hairpin structure further ensures that random extension will not occur between the linker templates to form linker dimers.

[0330] Step 3: The double-stranded structure of the original strand / linker template produced in the previous step is separated by denaturation of the nucleic acid molecule, and the hairpin structure sequence on the original strand will form a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand.

[0331] Step 4: The 5' end of the original strand and the synthetic strand produced by the U-turn of the 3' end of the original strand form a double-stranded structure. The second linker R2 (the second linker is a hairpin structure (Figure 11); the second linker is a Y-shaped linker (Figure 10)) that is not phosphorylated is added to the original strand by means of blunt-end or A / T or G / C sticky-end double-stranded ligation. Since the second linker is not phosphorylated, only the original strand can be connected, and a nick is formed between the synthetic strand and the second linker. The second linker can be designed by Y-shaped structure or by blocking the 3' end of one strand to add the correct direction R2 sequence (not the complementary sequence R2') to the original strand.

[0332] Step 5: By digestion of single-stranded nuclease, the single-stranded part in the hairpin structure (and Y-shaped structure) is removed, so that the template strand and the synthetic strand can be separated in denaturation.

[0333] The specific experimental steps of the above steps are as follows:

[0334] 1) Take about 10 ng of about 160 bp DNA fragments, add 1 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 2 mM dCTP, and add 0.5 μl of TdT (TAKARA 2230A);

[0335] 2) 37°C for 10 min, 90°C for 3 min, and then transfer to an ice box;

[0336] 3) Add 1.6 μΐ SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μΐ dNTP Mix (2.5 mM) and 0.5 μΐ SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μΜ) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μΜ) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), add water, total 16 μΐ;

[0337] SEQ ID NO. 1 :

[0338] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0339] SEQ ID NO. 7:

[0340] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0341] 4) Place in PCR instrument, reaction program as follows:

[0342] 5) Add 8 μΐ Ligation Buffer and 1.5 μΐ DNA ligase V3 (Huari Kang HRK-CC220-24) to 16 μΐ reaction solution. At the same time, add P-STP76 adapter (final concentration 1 μΜ) as shown in SEQ ID NO. 8, P-SCP77 adapter (final concentration 1 μΜ) as shown in SEQ ID NO. 9 and P-STP7B9 adapter (final concentration 1 μΜ) as shown in SEQ ID NO. 10. The total volume is 28 μΐ, placed in the PCR instrument at 20 °C for 25 min, then cooled to 4 °C until the next step is entered.

[0343] SEQ ID NO. 8:

[0344] SEQ ID NO. 9:

[0345] SEQ ID NO. 10:

[0346] 6) Add 7 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μΐ S1 Nuclease (10 U / μΐ) to 28 μΐ reaction solution. Place in PCR machine at 23 °C for 20 min, then cool to 4 °C until next step.

[0347] Step 6: The template strand and the synthetic strand are separated in PCR denaturation, and the original strand now has a complete double-end adapter structure, which can be amplified and library constructed using universal primer PCR.

[0348] 7) Add 42 μΐ Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash and place at room temperature to air dry for 5 min;

[0349] 8) Add 9 μΐ water, 1 μΐ mixed primers (LP5-UDI0021 and LP7-UDI0021, each at a concentration of 10 μΜ, the sequences are shown in SEQ ID NO. 4 and 5, respectively) and 10 μΐ KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0350] SEQ ID NO. 4:

[0351] SEQ ID NO. 5:

[0352] 9) Place in PCR machine, and the reaction program is as follows:

[0353] 10) Add 24 μΐ Ampure beads to purify the PCR product, and elute with 50 μΐ water to obtain an NGS library with a complete double-end adapter structure.

[0354] 11) Take 8 μΐ NGS library for 1% agarose electrophoresis, with a voltage of 100 V and an electrophoresis time of 20 min. The results are shown in Figure 12, which shows that the DNA length is concentrated between 100 bp and 750 bp.

[0355] Example 7: Ancient DNA fragment library construction method

[0356] 1) Take about 0.1 ng of ancient DNA fragments, add 1 μΐ 5X TdT Buffer (TAKARA 2230A), add 1 μΐ 2 mM dCTP, and add 0.5 μΐ TdT (TAKARA 2230A);

[0357] 2) 37 °C for 10 min, 90 °C for 20 s, then transfer to ice box;

[0358] 3) Add 1.6 μl SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl dNTP Mix (2.5 mM) and 0.5 μl SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), add water, total 16 μl;

[0359] SEQ ID NO. 1:

[0360] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0361] SEQ ID NO. 7:

[0362] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0363] 4) Place in PCR instrument, reaction program as follows:

[0364] 5) Add 8 μl Ligation Buffer and 1.5 μl DNA ligase V3 (Huari Kang HRK-CC220-24) to 16 μl reaction solution. At the same time, add P-STP76 adapter (final concentration 1 μM) as shown in SEQ ID NO. 8, P-SCP77 adapter (final concentration 1 μM) as shown in SEQ ID NO. 9 and P-STP7B9 adapter (final concentration 1 μM) as shown in SEQ ID NO. 10. The total volume is 28 μl, placed in the PCR instrument at 20°C for 25 min, then cooled to 4°C until the next step is entered.

[0365] SEQ ID NO. 8:

[0366] SEQ ID NO. 9:

[0367] SEQ ID NO. 10:

[0368] 6) Add 7 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μΐ S1 Nuclease (10 U / μΐ) to 28 μΐ reaction. Place in PCR machine at 23 °C for 20 min, then ramp down to 4 °C until next step.

[0369] At this point, the template strand and the synthesized strand are separated in PCR denaturation, and the original strand now has a complete double-end adapter structure, which is amplified and library constructed using universal primer PCR.

[0370] 7) Add 42 μΐ Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash and air dry at room temperature for 5 min;

[0371] 8) Add 9 μΐ water, 1 μΐ mixed primers (LP5-UDI0021 and LP7-UDI0021, each at a concentration of 10 μΜ, the sequences are shown in SEQ ID NO. 4 and 5, respectively) and 10 μΐ KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;

[0372] SEQ ID NO. 4:

[0373] SEQ ID NO. 5:

[0374] 9) Place in PCR machine, and the reaction program is as follows:

[0375] 10) Add 24 μΐ Ampure beads to purify the PCR product, and elute with 50 μΐ water to obtain an NGS library with a complete double-end adapter structure;

[0376] 11) Take 5 μΐ of the NGS library for 1% agarose electrophoresis, with a voltage of 100 V and an electrophoresis time of 20 min. The results are shown in FIG. 13A, which shows that the DNA length is concentrated between 100 bp and 750 bp.

[0377] The library qsep400 map is shown in FIG. 13B.

[0378] Sequencing with NovaSeq X Plus and sequence analysis show that the library is a human DNA genome library, with a large number of C->T mutations. This is consistent with the characteristics of ancient DNA.

[0379] Example 8 NIPT standard library construction

[0380] 1) Take 3.3 μl of NIPT positive DNA (Huada Genomics) and 3.3 μl of NIPT negative DNA (Huada Genomics), respectively add 1 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 2 mM dCTP, add 0.5 μl of TdT (TAKARA 2230A);

[0381] 2) 37°C for 10 min, 96°C for 2 min, then transfer to ice box;

[0382] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), add water, a total of 16 μl;

[0383] SEQ ID NO. 1:

[0384] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0385] SEQ ID NO. 7:

[0386] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0387] 4) Place on PCR instrument, reaction program as follows:

[0388] 5) Add 8 μl Ligation Buffer and 1.5 μl DNA ligase V3 (HRK-CC220-24) to 16 μl reaction solution. At the same time, add P-STP76 adapter (final concentration 1 μM) with sequence as shown in SEQ ID NO. 8, P-SCP77 adapter (final concentration 1 μM) with sequence as shown in SEQ ID NO. 9 and P-STP7B9 adapter (final concentration 1 μM) with sequence as shown in SEQ ID NO. 10. The total volume is 28 μl, which is placed in a PCR instrument at 20 °C for 25 min, and then cooled to 4 °C until the next step is entered;

[0389] SEQ ID NO. 8:

[0390] SEQ ID NO. 9:

[0391] SEQ ID NO. 10:

[0392] 6) Add 7 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10 U / μl) to 8 μl reaction solution. Place in a PCR instrument at 23 °C for 20 min, and then cool to 4 °C until the next step is entered.

[0393] At this point, the template strand and the synthesized strand are separated in PCR denaturation, and the original strand now has a complete double-end adapter structure, which is amplified and library constructed using universal primer PCR.

[0394] 7) Add 42 μL Ampure beads to bind DNA, and wash with 85% ethanol for two times. Carefully remove the 85% ethanol wash solution and place it at room temperature for 5 minutes;

[0395] 8) Add 9 μl water, 1 μl mixed primer (LP5-UDI0021 and LP7-UDI0021 with a concentration of 10 μM each, sequences as shown in SEQ ID NO. 4 and 5, respectively) and 10 μl KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in turn;

[0396] SEQ ID NO. 4:

[0397] SEQ ID NO. 5:

[0398] 9) Place in a PCR instrument, and the reaction program is as follows:

[0399] 10) Add 24 μL Ampure beads to purify the PCR product, and elute with 50 μl water to obtain NGS library with complete double-end adapter structure;

[0400] 11) Take 5 μl NGS library for 1% agarose electrophoresis, with a voltage of 100 V and an electrophoresis time of 20 minutes. The results are shown in Figure 14A, which shows that the DNA length is concentrated between 100 bp and 750 bp.

[0401] The qsep400 profile of the NIPT positive DNA library is shown in Figure 14B; the qsep400 profile of the NIPT negative DNA library is shown in Figure 14C.

[0402] Sequencing was performed using NovaSeq X Plus and sequence analysis was performed. Sequence analysis showed that the NIPT positive DNA library T21, T18, and T13 were all positive; the NIPT negative DNA library T21, T18, and T13 were all negative.

[0403] Example 9 Direct construction of methylation sequencing library from raw plasma sample

[0404] As shown in Figure 15,

[0405] Step 1: Pretreatment of raw sample: 1a. Add lysis solution to the plasma sample; 1b. Remove protein and retain DNA;

[0406] Step 2: Purify DNA;

[0407] Step 3: Treat DNA with bisulfite. During bisulfite treatment, unmethylated cytosine (C) in the DNA will be converted to uracil (U), and during subsequent DNA replication, uracil (U) will be replaced by thymine (T). In contrast, methylated cytosine (including 5-methylcytosine, 5mC, and 5-hydroxymethylcytosine, 5hmC) will not undergo this conversion;

[0408] Step 4: The 3' end of the single-stranded DNA (original strand) after bisulfite treatment is added with corresponding mononucleotides to the 3' end of the single-stranded DNA under the action of TdT (terminal deoxynucleotide transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), thereby forming the 3' extended end of the single-stranded DNA (original strand);

[0409] Step 5: The 3' end of the single-stranded DNA (original strand) is extended and the sequence is complementary to the 3' sequence of the hairpin structure first adapter. Under the action of base complementary matching, the 3' end of the single-stranded DNA (original strand) is specifically combined with the 3' sequence of the hairpin structure first adapter, and under the action of the nucleic acid polymerase with strand displacement activity, the 3' end of the single-stranded DNA (original strand) is continuously extended, and the first adapter sequence R1 is copied to the end of the original strand. Since the 3' end of the first adapter is blocked by the blocking group, the first adapter will not produce random extension. The hairpin structure further ensures that random extension will not occur between the adapter templates to form adapter dimers;

[0410] Step 6: The double-stranded structure of the original strand / adapter template produced in the previous step is separated by denaturation of the nucleic acid molecule, and the hairpin structure sequence on the original strand will form a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0411] Step 7: The 5' end of the original strand and the synthetic strand produced by U-turn of the 3' end of the original strand form a double-stranded structure. The second adapter R2 treated by phosphorylation is added to the original strand by means of blunt-end or A / T or G / C sticky-end double-stranded ligation.

[0412] Step 8: By digestion of single-stranded nuclease, the single-stranded part in the first adapter and the Y-shaped second adapter is removed, so that the template strand and the synthetic strand can be separated in denaturation.

[0413] Step 9: The original strand and the synthetic strand now have complete double-end adapter structure, which can be amplified and library constructed using universal primers PCR;

[0414] Step 10: By PCR, the U and A pairing of the unmethylated C in the original strand are changed, and the site in the PCR product is T; while the methylated C (including 5mC, 5hmC) is not changed, and the PCR product is still C.

[0415] The specific experimental steps of the above steps are as follows:

[0416] 1) 1ml human plasma is added with 40μl proteinase K and 100μl sample lysis solution (Apostle A17622-250);

[0417] 2) Add 15μl magnetic beads (Apostle A17622-250) and 1.25ml lysis and binding solution (Apostle A17622-250) at 60℃ for 20 minutes;

[0418] 3) Mix well at 2000rpm for 10 minutes;

[0419] 4) Let stand on the magnet stand for 5 minutes, discard the supernatant;

[0420] 5) Add 500 μl of washing solution (Apostle A17622-250) and then magnetically adsorb, discard the supernatant;

[0421] 6) Add 500 μl of 85% ethanol and wash, magnetically adsorb, discard the supernatant;

[0422] 7) Add 500 μl of 85% ethanol again, magnetically adsorb, discard the supernatant, and air dry for 5 minutes;

[0423] 8) Add 20 μl of water to elute;

[0424] 9) Add 130 μl of Lightning Conversion Reagent (Zymo research D5030) and place in a PCR instrument at 98°C for 8 minutes, then at 54°C for 60 minutes, and then cool to 4°C until the next step is performed;

[0425] 10) Add 600 μl of M-Binding Buffer (Zymo research D5030) and mix well; pass through the Zymo-Spin TM IC Column (Zymo research D5030);

[0426] 11) Add 100 μl of M-Wash Buffer to the column, high-speed centrifugation for 30 seconds, and discard the washing solution;

[0427] 12) Add 200 μl of L-Desulphonation Buffer (Zymo research D5030) to the Zymo-Spin TM IC Column; and stand at room temperature for 15 minutes;

[0428] 13) Add 200 μl of M-Wash Buffer to the column, high-speed centrifugation for 30 seconds, and discard the washing solution; repeat once;

[0429] 14) Add 3.5 μl of M-Elution Buffer to elute;

[0430] 15) Take 3.5 μl of M-Elution Buffer eluate, add 1 μl of 5X TdT Buffer (TAKARA 2230A), add 1 μl of 3mM dCTP, and add 0.5 μl of TdT (TAKARA 2230A);

[0431] 16) 37°C for 10 min, then 96°C for 2 min, then transfer to ice box;

[0432] 17) Add 1.6 μl SD Polymerase Reaction Buffer incomplete (BIORON), add 2 μl dNTP Mix (2.5 mM) and 0.5 μl SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), add water, total 16 μl;

[0433] SEQ ID NO. 1:

[0434] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0435] SEQ ID NO. 7:

[0436] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0437] 18) Place in PCR instrument, reaction program as follows:

[0438] 19) Add 8 μl Ligation Buffer and 1.5 μl DNA ligase V3 (HRK-CC220-24) to 16 μl reaction solution. At the same time, add P-STP76 adapter (final concentration 1 μM) as shown in SEQ ID NO. 8, P-SCP77 adapter (final concentration 1 μM) as shown in SEQ ID NO. 9 and P-STP7B9 adapter (final concentration 1 μM) as shown in SEQ ID NO. 10. Total volume is 28 μl, place in PCR instrument at 20°C for 25 min, then cool to 4°C until entering next step;

[0439] SEQ ID NO. 8:

[0440] SEQ ID NO. 9:

[0441] SEQ ID NO. 10:

[0442] 20) To 28 μΐ reaction, add 7 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μΐ S1 Nuclease (10 U / μΐ). Place in PCR machine at 23 °C for 20 min, then ramp down to 4 °C until next step;

[0443] 21) Add 42 μΐ Ampure beads to bind DNA, and wash with 85% ethanol for two times. Carefully remove 85% ethanol wash and let air dry at room temperature for 5 min;

[0444] 22) To Ampure beads, add 9 μΐ water, 1 μΐ mixed primers (LP5-UDI0021 and LP7- UDI0021 at 10 μΜ each, sequences shown in SEQ ID NO. 4 and 5 respectively), and 10 μΐ KAPA HiFi HotStart Ready Mix (Roche) sequentially;

[0445] SEQ ID NO. 4:

[0446] SEQ ID NO. 5:

[0447] 23) Place in PCR machine, and the reaction program is as follows:

[0448] 24) Add 24 μΐ Ampure beads to purify PCR product, and elute with 50 μΐ water to obtain NGS library with complete double-end adapter structure;

[0449] 25) Take 5 μΐ NGS library for 1% agarose electrophoresis, with the following electrophoresis conditions: voltage 100 V, electrophoresis time 20 min. The results are shown in Figure 16A, which shows that the DNA length is concentrated between 100 bp and 750 bp;

[0450] The library qsep400 map is shown in Figure 16B; sequencing was performed using NovaSeq X Plus and sequence analysis was performed. BSMAP sequence analysis showed that the data characteristics were consistent with BS-seq data.

[0451] Example 10 Method two for FFPE DNA library construction

[0452] As shown in Figure 17: Step 1: gDNA or FFPE DNA sample is exposed to a complex composed of Tn5 Transposase and Adapter R2-ME, DNA is randomly broken and Adapter R2-ME sequence is added to the 5' end of the cut DNA fragments. The 5' end of Adapter R2-ME has R2-ME hairpin structure, which can bind to the 5' end of DNA fragments, whether the DNA fragments are single-stranded or double-stranded;

[0453] Step 2: Denature double-stranded DNA into single-stranded DNA by heating or alkali treatment, etc. The 5' end of the DNA molecule treated by Tn5 Transposase is added with R2-ME hairpin structure;

[0454] Step 3: The 3' end of the 5' end R2-ME hairpin structure single-stranded DNA (original strand) is extended by TdT and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxy mononucleotide triphosphates), and the corresponding mononucleotide is added to the 3' end of the single-stranded DNA, forming the 3' extension end of the single-stranded DNA (original strand);

[0455] Step 4: The 3' extension end sequence of the 5' end R2-ME hairpin structure single-stranded DNA (original strand) is complementary to the 3' sequence of the hairpin structure first adapter, and under the action of base complementary matching, the 3' extension end of the single-stranded DNA (original strand) is specifically combined with the 3' sequence of the hairpin structure first adapter, and under the action of the nucleic acid polymerase with strand displacement activity, the 3' extension end of the 5' end R2-ME hairpin structure single-stranded DNA (original strand) is further extended, and the first adapter sequence R1 is copied to the end of the original strand. Since the 3' end of the first adapter is blocked by a blocking group, the first adapter will not produce random extension. The hairpin structure further ensures that random extension will not occur between the adapter templates to cause adapter dimers.

[0456] Step 5: The double-stranded structure of the original strand / adapter template produced in the previous step is separated by denaturation of nucleic acid molecules, and the hairpin structure sequence on the original strand will form a U-turn to form a hairpin structure. The 3' end can be further extended by polymerase to synthesize a complementary synthetic strand;

[0457] Step 6: Through extension, a double-stranded molecule with R1 and R2-ME hairpin structure at both ends is obtained;

[0458] Step 7: Through the digestion of single-stranded nuclease, the single-stranded part in the hairpin structure is removed, so that the DNA can be separated in denaturation;

[0459] Step 8: DNA with complete double-end adapter structure, can be amplified and library construction using universal primer PCR.

[0460] The specific experimental steps are as follows:

[0461] 1) Take 20 μl QuarPro Tn5 Transposase (1 U / μL) (Dynegene NE1001A) and add ME-UTP7 (final concentration 10 μM) with sequence as shown in SEQ ID NO. 11;

[0462] SEQ ID NO. 11:

[0463] 5'-[phos]CTGTCTCTTATACACATCTAGATCGGAAGAGCACACGTCTTTTTTAGACGTGTGCTCTT CCGATCTAGATGTGTATAAGAGACAG

[0464] 2) 30℃ for 60 minutes, labeled as ME-UTP7 transposome;

[0465] 3) Add 2 μl 5x Tagment Buffer (Dynegene), add 1 μl ME-UTP7 transposome, add 100 ng FFPE DNA, and add water to 10 μl;

[0466] 4) 55℃ for 20 minutes;

[0467] 5) Add 1 μL Termination Buffer (Dynegene), and gently pipette 10 times to mix the reaction system thoroughly;

[0468] 6) Add 12 μL Ampure beads to bind DNA, and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash and place it at room temperature for 5 minutes;

[0469] 7) Add 5 μl water to elute the Ampure beads;

[0470] 8) Take 5 μl of eluate, add 1.5 μl 5X TdT Buffer (TAKARA 2230A), add 1 μl 2.5 mM dCTP, and add 0.6 μl) TdT (TAKARA 2230A);

[0471] 9) 37℃ for 10 min, then 96℃ for 2 min, then transfer to ice box;

[0472] 10) Add 2 μΐ SD Polymerase Reaction Buffer incomplete (BIORON), add 2.5 μΐ dNTP Mix (2.5 mM) and 0.5 μΐ SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2 μΜ) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2 μΜ) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 2.5 mM), add water, total 21 μΐ;

[0473] SEQ ID NO. 1 :

[0474] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN- (NH2-C6)

[0475] SEQ ID NO. 7:

[0476] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG- (NH2-C6)

[0477] 11) Place on PCR machine, reaction program as follows:

[0478] 12) Add 5.5 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μΐ S1 Nuclease (10 U / μΐ) to 21 μΐ reaction solution. Place on PCR machine at 23 °C for 25 min, then cool to 4 °C until next step;

[0479] 13) Add 27.5 μΐ Ampure beads to bind DNA, and wash with 85% ethanol twice. Carefully remove 85% ethanol wash and air dry at room temperature for 5 min;

[0480] Add 9 μΐ water, 1 μΐ mixed primers (LP5-UDI0021 and LP7-UDI0021 at a concentration of 10 μΜ each, sequences as shown in SEQ ID NO. 4 and 5 respectively) and 10 μΐ KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in turn;

[0481] SEQ ID NO. 4:

[0482] SEQ ID NO.5:

[0483] 14) Place on PCR machine, reaction program as follows:

[0484] 15) Add 24 μΐ of Ampure beads to purify PCR products, and elute with 50 μΐ of water to obtain NGS library with complete double-end adapter structure.

[0485] 16) Take 5 μΐ of NGS library for 1% agarose electrophoresis, with a voltage of 100 V and an electrophoresis time of 20 minutes. The results are shown in Figure 18A, showing that the DNA length is concentrated between 100 bp and 750 bp.

[0486] Sequencing with NovaSeq X Plus and sequence analysis. Sequence analysis found that Read2 all started with ME sequence AGATGTGTATAAGAGACAG, completely consistent with our experimental design.

[0487] Example 11 Direct library construction of blood collection card samples

[0488] 1) Use a puncher with a diameter of 1.0 mm to punch a blood collection card containing a blood sample on the blood collection card;

[0489] 2) Soak the blood collection card with 14.5 μΐ of Atlantis Digestion Buffer (ZYMO Cat: D5220);

[0490] 3) Place at 37°C for 60 minutes;

[0491] 4) Add 0.05 U of Atlantis dsDNase (ZYMO Cat: D5220);

[0492] 5) Place at 42°C for 30 minutes;

[0493] 6) Add 10 μΐ of magnetic beads (Apostle A17622-250) and 32 μΐ of lysis binding solution (Apostle A17622-250);

[0494] 7) Place at room temperature for 30 minutes, shake and mix every 5 minutes;

[0495] 8) Place on a magnetic stand for 5 minutes, discard the supernatant;

[0496] 9) Add 100 μΐ of washing solution (Apostle A17622-250) and wash, then magnetically attract and discard the supernatant;

[0497] 10) Add 100 μl 85% ethanol, wash, magnetically adsorb, discard supernatant;

[0498] 11) Again add 100 μl 85% ethanol, wash, magnetically adsorb, discard supernatant, air dry for 5 minutes;

[0499] 12) Elute with 5 μl water;

[0500] 13) Take 5 μl water eluate, add 1.5 μl 5X TdT Buffer (TAKARA 2230A), add 1 μl 3 mM dCTP, add 0.3 μl TdT (TAKARA 2230A);

[0501] 14) 37°C for 10 min, then 96°C for 2 min, then transfer to ice box;

[0502] 15) Add 2 μl SD Polymerase Reaction Buffer incomplete (BIORON), add 2.5 μl dNTP Mix (2.5 mM) and 0.5 μl SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 3 μM) (sequence as shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 3.5 μM) (sequence as shown in SEQ ID NO. 7), add MgCl2 (final concentration 4 mM), add water, total 16 μl;

[0503] SEQ ID NO. 1:

[0504] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)

[0505] SEQ ID NO. 7:

[0506] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)

[0507] 16) Place on PCR instrument, reaction program as follows:

[0508] 17) To 16 μΐ reaction, add 8 μΐ Ligation Buffer and 1.5 μΐ DNA ligase V3 (HRK-CC220-24). At the same time, add P-STP76 adapter (final concentration 0.5 μΜ) with sequence as SEQ ID NO. 8, P-SCP77 adapter (final concentration 0.5 μΜ) with sequence as SEQ ID NO. 9 and P-STP7B9 adapter (final concentration 0.5 μΜ) with sequence as SEQ ID NO. 10. The total volume is 28 μΐ, place in PCR machine at 20 °C for 25 min, then cool down to 4 °C until next step;

[0509] SEQ ID NO. 8:

[0510] SEQ ID NO. 9:

[0511] SEQ ID NO. 10:

[0512] 18) To 28 μΐ reaction, add 7 μΐ 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μΐ S1 nuclease (10 U / μΐ). Place in PCR machine at 23 °C for 20 min, then cool down to 4 °C until next step;

[0513] 19) Add 42 μΐ Ampure beads to bind DNA, and wash with 85% ethanol for two times; carefully remove 85% ethanol wash and place at room temperature for 5 min to dry;

[0514] 20) To Ampure beads, add 9 μΐ water, 1 μΐ mixed primers (LP5-UDI0021 and LP7-UDI0021 with concentration of 10 μΜ each, sequence as SEQ ID NO. 4 and 5 respectively) and 10 μΐ KAPA HiFi HotStart Ready Mix (Roche) in sequence;

[0515] SEQ ID NO. 4:

[0516] SEQ ID NO. 5:

[0517] 21) Place in PCR machine, reaction program as follows:

[0518] 22) 24 μL Ampure beads were added to purify the PCR product, and 50 μl water was used to elute to obtain the NGS library with complete double-end adapter structure;

[0519] 23) 5 μl of the NGS library was taken for 1% agarose electrophoresis, and the electrophoresis condition was voltage 100 V, electrophoresis time 20 min. The results are shown in Figure 18B, showing that the DNA length is concentrated between 100 bp and 750 bp. The library qsep400 profile is shown in Figure 19A. Sequencing was performed using NovaSeq X Plus and sequence analysis was performed. The library length distribution is shown in Figure 19B.

[0520] The above examples are intended to illustrate the embodiments disclosed in the present application and should not be understood to limit the present application. In addition, various modifications listed herein and changes in the method of the application are obvious to those skilled in the art without departing from the scope and spirit of the present application. Although the present application has been specifically described in conjunction with various specific preferred embodiments thereof, it should be understood that the present application should not be limited to these specific embodiments. In fact, various modifications as described above to those skilled in the art to obtain the application should be included within the scope of the present application.

Claims

1. A method of nucleic acid U-turn self-priming amplification, characterized by, The method is to add a specific linker to the 3' end of a single-stranded nucleic acid, the specific linker comprising a hairpin structure and an adapter sequence for complementary binding to the 3' end of the single-stranded nucleic acid; After the single-stranded nucleic acid is combined with the specific linker, the single-stranded nucleic acid is extended from the 3' end of the single-stranded nucleic acid using the specific linker as a template, and the extended single-stranded nucleic acid has a hairpin structure to form a self-turning, and then an amplification product is formed by extending and amplifying the original single-stranded nucleic acid as a template.

2. The method of claim 1, wherein, The hairpin structure comprises a stem region and a loop region, and the two strands of the stem region are complementary, preferably, the two strands of the stem region are a linker template and a linker sequence, respectively, the linker template is complementary to the linker sequence, and the adapter sequence is connected to the end of the linker template; And / or, the single-stranded nucleic acid is selected from DNA or RNA; And / or, the 3' end of the single-stranded nucleic acid comprises a natural 3' end or an extended and modified 3' end of the single-stranded nucleic acid; And / or, the adapter sequence consists of 6-25 degenerate bases N; And / or, the 3' end of the adapter sequence is provided with a blocking group, and the blocking group is a 3' terminal hydroxyl active blocking group; preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.

3. The method of claim 2, wherein the linker template is selected from a sequencing primer binding site, a protein binding sequence or a promoter sequence; preferably, the sequence of the sequencing primer binding site is selected from part or full length sequence of the sequencing primer binding site R1, R2 or the respective complementary sequence R1', R2'; And / or, the sequence length of the stem region in the hairpin structure is 5-40 bp; And / or, the sequence of the loop region in the hairpin structure is TTTTT, AAAAAA, ACTCTTTCCCTA or AATAA.

4. The method of claim 1, wherein, The specific linker comprises a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, an adapter sequence and a blocking group; or, the specific linker sequence comprises a sequencing primer binding site R2, a loop structure, a sequence R2' complementary to the sequencing primer binding site R2, an adapter sequence and a blocking group.

5. Use of the method of any one of claims 1-4 in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.

6. A nucleic acid molecule linker, characterized in that, The nucleic acid molecule linker comprises a first linker, the first linker comprising a hairpin structure and a random sequence, the hairpin structure comprising a stem region and a loop region, the two strands of the stem region being complementary, the two strands of the stem region being a linker template and a linker sequence, respectively, the linker template being complementary to the linker sequence, the random sequence being connected to the end of the linker template, and the random sequence comprising a sequence complementary to the 3' end of the nucleic acid molecule to be detected.

7. The nucleic acid molecule linker of claim 6, wherein, The 3' end of the nucleic acid molecule to be detected comprises a natural 3' end or an extended and modified 3' end of the nucleic acid molecule to be detected; preferably, the extended and modified sequence consists of 2-30 degenerate bases N; And / or, the nucleic acid molecule to be detected is selected from DNA or RNA; And / or, the 3' end of the single-stranded nucleic acid comprises a natural 3' end or an extended and modified 3' end of the single-stranded nucleic acid; and / or, the linker template is selected from a sequence of a sequencing primer binding site, a protein binding sequence or a promoter; preferably, the sequence of the sequencing primer binding site is selected from a partial sequence or a full length sequence of a sequencing primer binding site R1, R2 or a complementary sequence R1', R2' respectively; and / or, the random sequence consists of 6-25 degenerate bases N; and / or, the 3' end of the random sequence is provided with a blocking group, and the blocking group is a hydroxyl group activity blocking group at the 3' end of the nucleic acid molecule linker; preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.

8. The nucleic acid molecule linker of claim 6, wherein, The first linker comprises a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence and a blocking group; or, the first linker comprises a sequencing primer binding site R2, a loop structure, a sequence R1' complementary to the sequencing primer binding site R2, a random sequence and a blocking group; and / or, the sequence length of the stem region of the first linker is 5-40 bp; and / or, the sequence of the loop region of the first linker is TTTTT, AAAAAA, ACTCTTTCCCTA or AATAA.

9. The nucleic acid molecule linker of claim 6, wherein, The nucleic acid molecule linker further comprises a second linker, and the second linker is a linker containing phosphorylation modification or a linker not containing phosphorylation modification.

10. The nucleic acid molecule linker of claim 9, wherein the second linker has a blunt end or a sticky end; preferably, the end of the second linker with the sticky end is T and / or C.

11. The nucleic acid molecule linker of claim 9, wherein, The second linker is a hairpin structure, and the second linker comprises a stem region and a loop region, the two strands of the stem region are complementary, and the two strands of the stem region are sequencing primer binding sites, the sequencing primer binding sites are selected from sequencing primer binding sites R1, R2 or complementary sequences R1' or R2' respectively, and the sequencing primer binding sites are different from the sequencing primer binding sites in the first linker.

12. The nucleic acid molecule linker of claim 9, wherein, The second linker is a Y-shaped linker, and the Y-shaped linker comprises a head and a tail, the head and the tail respectively comprise two strands, the two strands of the head are not complementary, the two strands of the tail are complementary, and the two strands of the tail are sequencing primer binding sites, the sequencing primer binding sites are selected from sequencing primer binding sites R1, R2 or complementary sequences R1' or R2' respectively, and the sequencing primer binding sites are different from the sequencing primer binding sites in the first linker.

13. The nucleic acid molecule linker of claim 11, wherein, The length of the stem region of the second linker is generally 5-40 bp; and / or, the sequence of the loop region of the second linker is TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT or AAAAAA.

14. Use of the nucleic acid molecule linker of any one of claims 6-13 in the ligation of a nucleic acid molecule to be tested, or use in the preparation of a DNA library construction product.

15. A kit for constructing a DNA library, characterized by The kit comprises the nucleic acid molecule linker of any one of claims 6-13, and further comprises any one or more of the following: a nucleic acid polymerase, a library construction reagent, a nucleic acid purification reagent, a single-stranded nuclease.

16. A method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, characterized in that, Constructing NGS library using the kit of claim 15.

17. The method of claim 16, wherein, The method comprises the following steps: 1) mixing the nucleic acid molecule to be tested, the nucleic acid polymerase with strand displacement activity and the first adaptor, and then reacting to copy the adaptor sequence to the 3' end of the original strand of the nucleic acid molecule to be tested; 2) synthesizing the complementary strand of the original strand of the nucleic acid molecule to be tested to form a double strand of the nucleic acid molecule to be tested; 3) mixing the product of step 2), the second adaptor and DNA ligase, and then reacting to add the second adaptor to the original strand and / or the synthesized strand of the nucleic acid molecule to be tested; 4) purifying the product of step 3) with magnetic beads, and then mixing with PCR amplification reagents to perform PCR reaction, thereby obtaining the NGS library of the nucleic acid molecule to be tested and / or the complementary strand thereof comprising a double-end adaptor structure.

18. The method of claim 17, wherein, Any one or more of the following features are also included: A) in step 1), mixing the nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, dNTPs to extend and modify the 3' end of the nucleic acid molecule to be tested; B) in step 2), denaturing to open the first adaptor and the original strand of the nucleic acid molecule to be tested, and then extending and synthesizing the complementary strand by the nucleic acid polymerase to form a double strand; C) in step 3), the second adaptor is a blunt-end second adaptor or a sticky-end second adaptor; D) in step 3), mixing the nucleic acid molecule to be tested with the single-strand nuclease after adding the second adaptor to remove the single-strand part of the first adaptor and / or the second adaptor; E) in step 4), after the PCR reaction, further comprising mixing the PCR product with magnetic beads for purification.

19. The method of claim 16, wherein, The method comprises the following steps: 1) mixing the double-stranded nucleic acid molecule to be tested, transposase and the second adaptor, and then reacting to add the second adaptor sequence to the 5' end of the nucleic acid molecule to be tested; the second adaptor is a hairpin structure and has a ME sequence; 2) denaturing to convert the product of step 1) into a single strand, thereby obtaining the single-stranded nucleic acid molecule to be tested with the second adaptor; 3) mixing the single-stranded nucleic acid molecule to be tested, the nucleic acid polymerase with strand displacement activity and the first adaptor, and then reacting to copy the first adaptor sequence to the 3' end of the nucleic acid molecule to be tested; 4) synthesizing the complementary strand of the original strand of the nucleic acid molecule to be tested to form a double strand of the nucleic acid molecule to be tested; 5) purifying the product of step 4) with magnetic beads, and then mixing with PCR amplification reagents to perform PCR reaction, thereby obtaining the NGS library of the nucleic acid molecule to be tested and / or the complementary strand thereof comprising a double-end adaptor structure.

20. The method of claim 19, wherein, Any one or more of the following features are also included: A) in step 3), before the mixing reaction, further comprising mixing the single-stranded nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, dNTPs to extend and modify the 3' end of the nucleic acid molecule to be tested; B) in step 4), mixing the nucleic acid molecule to be tested with the single-strand nuclease after adding the first adaptor to remove the single-strand part of the first adaptor and / or the second adaptor.

21. Use of the method of any one of claims 16-20 in any one or more of the following: 1) for FFPE DNA to construct NGS library; 2) for ancient DNA to construct NGS library; 3) to realize blood free extraction, for direct construction of whole genome NGS library; 4) enable blood card sample extraction-free, for direct construction of whole genome NGS library; 5) enable plasma extraction-free, for direct construction of cfDNA NGS library; 6) enable plasma extraction-free, for construction of plasma cfDNA bisulfite treated NGS library, for methylation sequencing; 7) enable pregnant women plasma extraction-free, for construction of cffDNA NGS library; 8) enable FFPE slide direct construction of NGS library.

Images