Engineered bacterium, construction method therefor and use thereof

Abstract

Provided in the present invention is an engineered bacterium, the engineered bacterium comprising an exogenous cyuP gene and / or cyuA gene, the exogenous cyuP gene encoding a cysteine transporter protein, the exogenous cyuA gene encoding a cysteine desulfurase, and the engineered bacterium being an intestinal bacterium or a probiotic.

Description

An engineered bacterium and a construction method and application thereof TECHNICAL FIELD

[0001] The present disclosure relates to the field of biotechnology, in particular to an engineered bacterium for cancer treatment or inflammatory disease treatment and a construction method and application thereof. BACKGROUND

[0002] Cysteine has multiple functions, it is involved in protein synthesis, post-translational modification and maintaining the balance of reducing power. It and glutamate, glycine together form glutathione, which is the most abundant antioxidant in cells. Mammalian cells can synthesize cysteine through the transsulfuration pathway using methionine. However, rapidly growing cancer cells face tremendous oxidative stress, and the cysteine synthesized by themselves is not enough to meet the antioxidant demand, and cancer cells must absorb cysteine from the environment to meet the demand for reducing power. The abundance of cysteine in the environment has important influence on the maintenance of the homeostasis of cancer cells, escape from ferroptosis, escape from immunity and resistance to tumor therapy. In multiple tumor models such as colorectal cancer, pancreatic cancer and breast cancer, it has been observed that limiting cysteine absorption can inhibit cancer cell growth and tumor development, and on the contrary, increased cysteine absorption will lead to further development of tumors. However, depriving cysteine from diet will cause continuous weight loss in mice, and serious side effects such as mental and hair. In cells, cysteine and its oxidized form cystine are converted to each other.

[0003] Phocaeicola vulgatus (formerly known as Bacteroides vulgatus) is a bacterium of the genus Bacteroides, which is a dominant intestinal bacterium with extremely high abundance in the intestine, and naturally uses cysteine as a sulfur source. After modification, it can greatly reduce the abundance of cysteine in the intestine, thereby being used for the treatment of colorectal cancer. Nissle bacteria (Escherichia coli Nissle 1917, abbreviated as EcN) is a special E. coli bacterium with probiotic characteristics, which can automatically enrich in tumors after intravenous injection into the body, and can specifically reduce the abundance of cysteine in the tumor microenvironment after being engineered, thereby treating various cancers. EcN has good biocompatibility and ideal targeting ability, can express exogenous proteins, and at the same time as a natural capsule, can slowly release drugs through its own colonization effect. Due to these characteristics, the application of EcN strain as a drug delivery system in treatment and diagnosis strategies is being intensively studied. SUMMARY

[0004] To solve the problems existing in the prior art, the purpose of the present disclosure is to provide an engineered bacterium for cancer treatment and a construction method and application thereof. The engineered bacterium of the present disclosure can express exogenous cyuP and / or cyuA genes, and thus can reduce the abundance of cysteine in the environment, for example, in the environment where tumor cells and / or tumor tissues are located, affecting the tumor to absorb and utilize cysteine / cystine, thereby treating tumors or intervening tumor development as a more targeted and less side-effect cysteine disturbance method.

[0005] In a first aspect, the present disclosure provides an engineered bacterium comprising an exogenous gene encoding one or more proteins that reduce the abundance of cysteine in the environment, the exogenous gene being an exogenous cyuP gene and / or an exogenous cyuA gene; the exogenous cyuP gene encoding a cysteine transporter protein; the exogenous cyuA gene encoding a cysteine desulfurase.

[0006] According to a specific embodiment of the present disclosure, the engineered bacterium is modified to express an exogenous cyuP gene and / or an exogenous cyuA gene.

[0007] According to a specific embodiment of the present disclosure, the engineered bacterium is selected from enteric bacteria or probiotics.

[0008] According to a specific embodiment of the present disclosure, the engineered bacterium is selected from Bacteroides bacteria, Enterobacteriaceae bacteria (e.g., Escherichia), Lactococcus bacteria, Lactobacillus bacteria, and Bifidobacterium bacteria.

[0009] Preferably, the engineered bacterium is selected from Bacteroides caccae (e.g., ATCC 8482), Bacteroides fragilis, Escherichia coli (e.g., Escherichia coli Nissle 1917), Lactobacillus reuteri, and Bifidobacterium adolescentis.

[0010] According to a specific embodiment of the present disclosure, the exogenous cyuP gene and the exogenous cyuA gene are from Enterobacteriaceae bacteria.

[0011] Preferably, the exogenous cyuP gene and the exogenous cyuA gene are from Escherichia coli, Enterobacter hormaechei, Citrobacter freundii, Shigella flexneri, Salmonella enterica, or Yersinia enterocolitica; more preferably, from Escherichia coli.

[0012] According to a specific embodiment of the present disclosure, the cysteine transporter protein comprises an amino acid sequence as set forth in any one of SEQ ID NO: 32, SEQ ID NO: 35-38.

[0013] Preferably, the cysteine transporter comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 32, SEQ ID NO: 35-38.

[0014] Preferably, the cyuP gene comprises a nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 39-42.

[0015] Preferably, the cyuP gene comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 2, SEQ ID NO: 39-42.

[0016] According to specific embodiments of the present disclosure, the cysteine desulfurase comprises an amino acid sequence set forth in any one of SEQ ID NO: 33, SEQ ID NO: 43-46.

[0017] Preferably, the cysteine desulfurase comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 33, SEQ ID NO: 43-46.

[0018] Preferably, the cyuA gene comprises a nucleotide sequence set forth in any one of SEQ ID NO: 34, SEQ ID NO: 47-50.

[0019] Preferably, the cyuA gene comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 34, SEQ ID NO: 47-50.

[0020] According to specific embodiments of the present disclosure, wherein the environment is an environment in which tumor cells and / or tumor tissues reside; preferably, the environment is an intestinal microenvironment.

[0021] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacteria.

[0022] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacterium by genetic recombination or CRISPR-Cas9 technology.

[0023] According to specific embodiments of the present disclosure, the engineered bacterium is B. vulgaris or E. coli.

[0024] According to specific embodiments of the present disclosure, the exogenous cyuP gene and cyuA gene is expressed in the engineered bacterium by a promoter; preferably, the promoter is an IScepA promoter or a J23100 promoter.

[0025] According to specific embodiments of the present disclosure, the engineered bacterium is B. vulgaris, and the promoter is an IScepA promoter.

[0026] According to specific embodiments of the present disclosure, the engineered bacterium is E. coli, and the promoter is a J23100 promoter.

[0027] The third aspect of the present disclosure provides a composition comprising the engineered bacterium of any one of the aspects of the present disclosure and optionally a pharmaceutically acceptable carrier.

[0028] According to specific embodiments of the present disclosure, the composition is formulated in a form for oral administration, enteral administration, intravenous injection administration or in situ injection administration to a tumor.

[0029] The fourth aspect of the present disclosure provides use of the engineered bacterium of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure in the preparation of a medicament for treating cancer or a medicament for treating an inflammatory disease.

[0030] The fifth aspect of the present disclosure provides a method for treating cancer or an inflammatory disease, the method comprising administering to a subject in need thereof an effective amount of the engineered bacterium of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure; preferably, the administration mode comprises oral administration, enteric administration or parenteral administration; preferably, the parenteral administration comprises intravenous injection and / or in situ injection to a tumor.

[0031] According to specific embodiments of the present disclosure, the cancer is selected from a solid tumor.

[0032] Preferably, the solid tumor is selected from gastrointestinal cancer, melanoma, pancreatic cancer or breast cancer.

[0033] Preferably, the gastrointestinal cancer is colorectal cancer, more preferably, the colorectal cancer is chronic intestinal inflammation-induced colorectal cancer.

[0034] According to specific embodiments of the present disclosure, the inflammatory disease is selected from an intestinal inflammatory disease;

[0035] Preferably, the intestinal inflammatory disease is selected from intestinal inflammation, gastric inflammation, gastroenteritis; preferably, the intestinal inflammation is acute intestinal inflammation or chronic intestinal inflammation.

[0036] Preferably, the chronic intestinal inflammation is inflammatory bowel disease (IBD); more preferably, the inflammatory bowel disease is Crohn's disease or ulcerative colitis.

[0037] The sixth aspect of the present disclosure provides use of the engineered bacteria of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure in the preparation of a reagent for reducing the abundance of cysteine in an environment.

[0038] According to a specific embodiment of the present disclosure, the environment is an environment in which tumor cells and / or tumor tissues are located.

[0039] Preferably, the environment is an intestinal microenvironment. BRIEF DESCRIPTION OF DRAWINGS

[0040] FIG. 1 is a schematic diagram of the construction of a cecal orthotopic model.

[0041] FIG. 2 is the colon cancer development of mice treated with the engineered bacteria BV1608 obtained in Example 1 by gavage. Among them, Control represents PBS, BV-WT represents ordinary B. vulgatus without genetic editing, and BV1608 represents the engineered bacteria BV1608 obtained in Example 1.

[0042] FIG. 3 is the detection and analysis of cysteine in the intestinal contents of mice treated with the engineered bacteria BV1608 obtained in Example 1 by gavage. Among them, Control represents PBS, BV-WT represents ordinary B. vulgatus without genetic editing, and BV1608 represents the engineered bacteria BV1608 obtained in Example 1.

[0043] FIG. 4 is the tumor development inhibition of the engineered bacteria EcN-cyuP and EcN-cyuA obtained in Example 2. Among them, control represents PBS, EcN-WT represents EcN without genetic editing, EcN-cyuP represents the EcN strain with high expression of cyuP, and EcN-cyuA represents the EcN strain with high expression of cyuA gene.

[0044] FIG. 5 is a schematic diagram of the construction of an AOM / DSS colorectal cancer model.

[0045] Figures 6A-6D are the colon cancer development of mice treated with engineered bacteria BV1608 obtained in Example 1 and engineered bacteria EcN-cyuP obtained in Example 2 by gavage; Figures 6A and 6C are the body weight change line graphs of mice in the AOM / DSS model intervened by engineered bacteria EcN-cyuP and engineered bacteria BV1608, respectively; Figures 6B and 6D are the survival time change of mice in the AOM / DSS model intervened by engineered bacteria EcN-cyuP and engineered bacteria BV1608, respectively, with the mean value of SEM (n=10). Among them, Health Control and Disease Control represent healthy mice and AOM / DSS colorectal cancer model mice, respectively, EcN-WT and BV-WT represent wild-type EcN and ordinary B. fragilis gavage treatment groups, respectively, EcN-cyuP and BV1608 represent engineered bacteria EcN with high expression of cyuP and engineered bacteria BV1608 gavage treatment groups, respectively.

[0046] Figure 7 is the treatment of AOM / DSS model mice with colorectum by engineered bacteria BV1608 obtained in Example 1 and engineered bacteria EcN-cyuP obtained in Example 2; Figures 7A and 7C are the colorectal samples of AOM / DSS model mice intervened by engineered bacteria EcN-cyuP and engineered bacteria BV, respectively; Figures 7B and 7D are the data statistical column charts of the length and weight of the colorectum of mice intervened by engineered bacteria EcN-cyuP and engineered bacteria BV1608, respectively, with the mean value of SEM (n=10), (***P<0.001). Among them, Health Control and Disease Control represent healthy mice and AOM / DSS colorectal cancer model mice, respectively, EcN-WT and BV-WT represent wild-type EcN and ordinary B. fragilis gavage treatment groups, respectively, EcN-cyuP and BV1608 represent engineered bacteria EcN with high expression of cyuP and engineered bacteria BV1608 gavage treatment groups, respectively.

[0047] Figure 8 is the treatment of acute enteritis model mice with engineered bacteria BV1608 obtained in Example 1. Figure 8A is a schematic diagram of the construction of an acute enteritis model, Figure 8B is a line graph of the body weight change of mice, Figure 8C is a DAI inflammation score, Figures 8D-8E are the statistical column charts of the colon samples and length change, Figures 8F-8G are the HE and MPO staining results and their data statistical column charts. Among them, Control represents the PBS-treated control group, DSS represents the acute enteritis model group, BV-WT represents the ordinary B. fragilis treatment group, and BV1608 represents the engineered bacteria BV1608 treatment group obtained in Example 1.

[0048] FIG. 9 is the treatment of engineered bacteria BV1608 obtained in Example 1 in a chronic intestinal inflammation model mouse. FIG. 9A is a schematic diagram of the construction of an acute intestinal inflammation model, FIG. 9B is a line graph of the change in body weight of the mouse, FIG. 9C-9D are statistical column charts of the length change of the colon sample, and FIG. 9E-9G are HE and MPO staining results and their data statistical column charts. Among them, Control represents the control group treated with PBS, DSS represents the acute intestinal inflammation model group, BV-WT represents the ordinary Bacteroides treatment group, and BV1608 represents the engineered bacteria BV1608 treatment group obtained in Example 1.

[0049] FIG. 10 is the change in cysteine content and barrier function detection; FIG. 10A is a column chart of the change in cysteine content in feces, FIG. 10B is a column chart of the change in cysteine content in the colon epithelium, FIG. 10C-10D are column charts of the change in serum FD-40 content in the two groups of models, and FIG. 10E-10G are column charts of the change in content of three inflammatory factors IL-6, IL-1β, and TNF-α, respectively.

[0050] DETAILED DESCRIPTION

[0051] The present disclosure provides an engineered bacteria for cancer treatment, which comprises an exogenous cyuP gene and / or cyuA gene. The engineered bacteria provided by the present disclosure can express the exogenous cyuP and / or cyuA gene, thereby reducing the abundance of cysteine in the environment, for example, affecting the absorption / metabolism / utilization of cysteine by tumor cells, and playing a positive role in cancer treatment.

[0052] Some embodiments according to the present disclosure will be described more fully below. However, the aspects of the present disclosure can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the aspects of the present disclosure to those skilled in the art. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to limit the disclosure.

[0053] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present application and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0054] Unless explicitly indicated, the various features of the disclosure described herein can be used in any combination. Furthermore, the present disclosure also contemplates that in embodiments, any feature or combination of features set forth herein can be excluded or omitted.

[0055] Unless explicitly stated, all recited embodiments, features and terms are intended to encompass the recited embodiment, feature or term and their biological equivalents.

[0056] All references, articles, publications, patent publications, and patent applications cited herein are incorporated by reference in their entirety for all purposes. The mention of any reference, article, publication, patent publication, or patent application cited herein is not, and should not be taken as an acknowledgment or admission that the reference, article, publication, patent publication, or patent application is prior art to this disclosure or that its

[0057] Each of the embodiments described and illustrated herein has individual components and features that can be readily separated from or combined with features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be performed in the order of events recited or in any other order that is logically possible.

[0058] The experimental methods of the specific conditions not noted in the following examples of the present disclosure are generally performed according to conventional conditions, or according to the conditions recommended by the manufacturer. The various common chemical biological reagents used in the examples are commercially available products. Unless otherwise specified, the present disclosure is not limited to a particular material, reagent, tool, etc.

[0059] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art.

[0060] Definitions

[0061] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0062] As used herein, the term "about" or "approximately" means within ±20%, ±10%, ±5%, ±1%, or ±0.1% variation in some cases.

[0063] The terminology used in the description of the present disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the present disclosure. It is further possible that steps can be performed in different order than as described in the present disclosure, as long as they are logically possible.

[0064] Where a numerical range is provided, it is understood that every intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges can independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included within the disclosure.

[0065] The terms "comprise", "comprising", "include", "including", "have", "has", "have", "having", and "contain", "containing", and any variations thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, article, or apparatus that comprises a list of steps or modules is not necessarily limited to those listed steps or modules, but can optionally include additional steps or modules not expressly listed or optional steps or modules inherent to such process, method, article, or apparatus.

[0066] As used herein, the term "or" means any one of, or a combination of, the alternatives so conjoined. It will be understood by those within the art that the disclosure is not limited in scope to the exemplified embodiments, which are intended as illustrations only examples. Any equivalents for the exemplified embodiments within the scope of the disclosure along with their individual features are included with the disclosure.

[0067] "Multiple" mentioned in the disclosure refers to two or more. "And / or", which describes the association relationship of the associated objects, means that there can be three relationships, for example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally represents that the associated objects before and after are in an "or" relationship.

[0068] With regard to recitations herein of a range of values, every intervening value having the same degree of precision as the lower limit of the range is expressly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.

[0069] As used herein, the term “engineered bacteria” refers to microorganisms that are modified by genetic engineering means to possess desired properties, such as to possess specific biological functions or to produce specific compounds. These modifications can include the introduction of new genes, deletion or modification of existing genes, or adjustment of the expression level of genes. For example, through genetic engineering methods, an exogenous gene is highly expressed to possess specific biological functions or produce specific biological products. In the context of synthetic biology, the design and construction of engineered bacteria is a complex process involving techniques such as gene expression, mutation, introduction, and metabolic control. The successful construction of engineered bacteria also needs to consider their functionality and stability in the target environment, as well as their interaction with indigenous microorganisms.

[0070] Currently, the modification of engineered bacteria has gradually expanded from common model microorganisms (such as Bacteroides, Enterobacteriaceae, for example, Escherichia) to special functional indigenous flora. Lactococcus, Lactobacillus, and Bifidobacterium are becoming a hot direction for the development of a new generation of engineered bacteria due to their unique physiological characteristics and safety. These genera, although different in phylogeny compared to Bacteroides bacteria and Enterobacteriaceae bacteria, can all achieve exogenous gene expression through plasmid vectors and genome editing. Therefore, they can easily achieve a large uptake of cysteine by introducing exogenous genes.

[0071] In addition, the natural defects (such as transporter deletion, low-efficiency decomposition enzyme) of the endogenous cysteine metabolic pathway in Lactococcus, Lactobacillus, and Bifidobacterium allow them to rely on the exogenous CyuP / CyuA system to achieve efficient cysteine uptake and decomposition. The pyruvate generated by exogenous CyuA can be integrated by the host lactic acid fermentation (Lactococcus / Lactobacillus) or F6PPK pathway (Bifidobacterium) to form a functional synergistic positive feedback loop. Therefore, the cyuP / cyuA gene can be stably expressed in the above-mentioned genera driven by codon optimization and constitutive promoters, and its function is not interfered by endogenous metabolism.

[0072] In embodiments of the present disclosure, the engineered bacteria are selected from, but not limited to, Bacteroides bacteria, Enterobacteriaceae bacteria (such as Escherichia and the like), Lactococcus bacteria, Lactobacillus bacteria, and Bifidobacterium bacteria.

[0073] In some preferred embodiments, the engineered bacteria are selected from B. vulgaris, B. fragilis, E. coli, L. reuteri, and B. adolescentis. In some specific embodiments, the engineered bacteria are B. vulgaris or E. coli.

[0074] As used herein, the term “gut bacteria” refers to microorganisms that live in the gut of a host, which are the major component of the gut microbiota. The gut microbiota is a complex ecosystem composed of a variety of bacteria, fungi, viruses, and protozoa, among which bacteria are the most predominant members. Gut bacteria have a wide range of functions, including participating in the host’s digestive process, energy metabolism, synthesizing essential nutrients, modulating the host’s immune response, and protecting the host from pathogenic invaders. The composition and function of the gut bacterial community are closely related to the host’s health and disease status. Imbalance of the gut microbiota (dysbiosis) is associated with a variety of diseases, including metabolic diseases, immune-related diseases, and neurodevelopmental diseases, among others.

[0075] As used herein, the term “probiotic” refers to live microorganisms that are beneficial to the health of the host, capable of exerting positive health effects on the host. Probiotics exert health benefits on the host through a variety of mechanisms, including improving gut microbial balance, enhancing gut barrier function, modulating the immune system, promoting the absorption and synthesis of nutrients, inhibiting the growth of harmful microorganisms, among others.

[0076] As used herein, the term “effective amount” refers to the amount of a compound, agent, material, or composition that will achieve a particular biological result. In some embodiments, an effective amount is a therapeutically effective amount. In some embodiments, an effective amount of an agent is an amount sufficient to achieve a beneficial or desired result (e.g., a clinical result). For example, in the context of administering an agent to treat a disorder, an effective amount of the agent can be an amount sufficient to achieve treatment of the disorder compared to the response obtained if the agent is not administered.

[0077] As used herein, the term “operably linked” refers to functional linkage between two or more molecules, constructs, transcripts, entities, moieties, etc. In some embodiments, “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence, resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. DNA sequences that are operably linked can be contiguous and, for example, when two protein coding regions are desired to be joined, they are in the same reading frame.

[0078] As used herein, the term “pharmaceutically acceptable” means not producing an allergic or similar untoward reaction when administered to a subject (e.g., a human).

[0079] As used herein, the term "pharmaceutically acceptable carrier" generally refers to those substances that are used in pharmaceutical formulations to stabilize the drug, improve the drug release characteristics, increase the bioavailability, or achieve a specific therapeutic purpose, while these carrier materials should meet the requirements of safety and biocompatibility. Specifically, the pharmaceutically acceptable carrier can include, but is not limited to, starch, powdered sugar, dextrin, lactose, microcrystalline cellulose, mannitol, etc., which can be used alone or in the form of a mixture. In addition, the pharmaceutically acceptable carrier can also include buffers, pH adjusters and stability-increasing excipients, which help to maintain the stability of the pharmaceutical preparation, especially in the absence of preservatives. The selection and application of these carriers should follow the principles of pharmacy and relevant regulatory standards to ensure the safety and effectiveness of the drug.

[0080] As used herein, the term "subject" is intended to include both human and non-human animals. In some embodiments, the subject is a human subject, e.g., a human patient having or at risk of having a disorder described herein. The term "non-human animal" includes mammals and non-mammals, e.g., non-human primates. The vectors, cells, and compositions described herein are suitable for treating a human patient having a disorder described herein. A patient having a disorder described herein includes, e.g., a patient who has developed a disorder described herein but is (at least temporarily) asymptomatic, a patient who has exhibited symptoms of a disorder described herein, and a patient who has a condition associated with the disorder.

[0081] As used herein, the term "treatment" refers to a subject (e.g., a human) having a disorder and / or experiencing symptoms of a disorder will, in some embodiments, suffer less severe symptoms and / or recover more quickly when treated than if left untreated. Treatment can partially or completely alleviate, ameliorate, relieve, inhibit effects or symptoms, manifestations, and / or causes of one or more of the effects or symptoms, or reduce the severity thereof, and / or reduce the incidence, and optionally delay onset, of a disease. In some embodiments, treatment is of a subject who does not exhibit some signs of a certain disorder and / or who exhibits only early signs of a certain disorder. In some embodiments, the subject of treatment is one who exhibits one or more established signs of a disorder. In some embodiments, treatment is of a subject diagnosed with a disorder.

[0082] The terms "nucleic acid" or "nucleic acid sequence" as used in the present disclosure refer to a polymeric form of nucleotides of any sort (deoxyribonucleotides or ribonucleotides), or modifications of either type of nucleotide. These terms should also be understood to include equivalents of RNA or DNA made from nucleotide analogs, as well as single-stranded (such as sense or antisense) and double-stranded polynucleotides. The terms "nucleic acid" or "nucleic acid sequence" can also encompass a strand comprising non-natural nucleotides, modified nucleotides, and / or non-nucleotide moieties that can exhibit the same functional properties as natural nucleotides (e.g., "nucleotide analogs"); furthermore, the term "nucleic acid sequence" as used herein refers to an oligonucleotide, a nucleotide, or a polynucleotide, and fragments or portions thereof, as well as genomic DNA or RNA, or DNA or RNA of synthetic origin, which can be single-stranded or double-stranded, and represent the sense or antisense strand. The terms "nucleic acid," "polynucleotide," "nucleotide sequence," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any sort (deoxyribonucleotides or ribonucleotides), or modifications of either type of nucleotide.

[0083] The term "gene" as used in the present disclosure refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA (e.g., ribosomal RNA, or transfer RNA), a polypeptide, or a precursor of any of the foregoing. The RNA or polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Thus, a "gene" refers to a DNA or RNA or portion thereof that encodes a polypeptide or RNA chain that functions in an organism. For purposes of the present disclosure, a gene can be considered to include regions that regulate gene product production whether or not such control sequences are adjacent to coding and / or transcribed sequences. A gene therefore includes, but is not necessarily limited to, promoter sequences, terminators, translational control sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.

[0084] The terms "protein," if single chain, "polypeptide," and "peptide" are used interchangeably herein when referring to a gene product, e.g., encoded by a coding sequence. A "protein" can also refer to an association of one or more polypeptides. A "gene product" refers to a molecule produced as a result of transcription of a gene. Gene products include RNA molecules transcribed from a gene, as well as proteins translated from such transcripts. A "product of interest" herein is the product of a gene of interest.

[0085] The term "gene construct" as used in the present disclosure refers to a nucleic acid, such as a vector, plasmid, viral genome, etc., either single- or double-stranded. It is isolated from a naturally occurring gene, or modified to comprise a segment of nucleic acid in a manner that does not exist in nature, or is synthetic, which includes a "coding sequence" of a polypeptide or is otherwise transcribable into a biologically active RNA (e.g., antisense, decoy, ribozyme, etc.), can be transfected into a cell, e.g., in certain embodiments, into a yeast engineering bacteria cell, and can cause the coding sequence to be expressed in the cell transfected with the construct. A gene construct can include one or more regulatory elements operably linked to the coding sequence.

[0086] The terms "non-naturally occurring," "engineered," and "synthetic" are used interchangeably in the present disclosure and indicate the involvement of human artifice. When referring to a nucleic acid molecule or polypeptide, these terms mean that the nucleic acid molecule or polypeptide is at least substantially free of at least one other component with which it is naturally associated and found in nature.

[0087] Gene editing techniques used in the present disclosure can include meganuclease (MegN) technology, zinc finger protein nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology, and CRISPR-associated technology, among others.

[0088] The term "CRISPR-Cas9" as used in the present disclosure is a molecular biology technique that employs the use of the CRISPR-Cas9 gene editing system to edit genes within cells and organisms. That is, by some biological means and technique, the genetic material within an organism is modified.

[0089] Delivery vectors can be used in the gene editing process, such as nanoparticle and lipid-based mRNA or protein delivery systems. Other examples of delivery vectors include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery systems, gene guns, hydrodynamics, electroporation or nucleofection microinjection, and biolistics. Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res. 2012; 1 :27) and Ibraheem et al. (Int J Pharm. 2014 Jan 1; 459(1-2): 70-83), incorporated herein by reference.

[0090] The term "vector" as used in the present disclosure is a means that allows or facilitates the transfer of an entity from one environment to another. Some vectors used in the present disclosure for recombinant nucleic acid technology allow the transfer of an entity, such as a nucleic acid fragment (e.g., a heterologous DNA fragment, such as a heterologous cDNA fragment) to a cell. Vectors can be used for the purpose of maintaining a heterologous nucleic acid (DNA or RNA) within a cell, facilitating replication of the vector containing the nucleic acid fragment, or facilitating expression of a protein encoded by the nucleic acid fragment. Vectors can be non-viral or viral.

[0091] Vectors can be introduced into cells using various techniques known in the art, such as transfection, transformation, and transduction. When exogenous DNA, e.g., a recombinant expression vector, is introduced into a cell, the cell is "genetically modified," "transformed," or "transfected" with that exogenous DNA. The presence of the exogenous DNA results in a permanent or temporary genetic change. The transforming DNA can or can not integrate (covalently link) with the genome of the cell. For example, the transforming DNA can be maintained on an episomal element, such as a plasmid, as an autonomously replicating sequence, or as an extrachromosomal element.

[0092] Non-viral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection includes the process of delivering genes to cells using non-viral vectors. Typical transfection methods include electroporation, DNA gene gun, lipids-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated transfection, cationic facial amphiphiles (CFAs) (Nat. Biotechnol. (1996) 14:556), and combinations thereof.

[0093] The term "integration site" as used in the present disclosure can be used interchangeably with "insertion site" and refers to the location in a nucleic acid into which a gene is inserted.

[0094] The term "neutral locus" as used in the present disclosure refers to a location in a genome where it is generally believed that genetic modification at that locus will not affect cell viability or will not cause a noticeable change in phenotype.

[0095] The term "homologous recombination (HR)" as used in the present disclosure refers to a form of recombination that occurs directly between homologous sequences of two DNA molecules. Homologous recombination does not depend on the specificity of the sequence, but only on the homology of the sequence. The homologous sequences that undergo exchange can be identical or can be very similar.

[0096] The terms "gene of interest", "gene of interest", "target sequence" and "target sequence" used in the present disclosure can be used interchangeably, referring to a specific gene intended to be studied or manipulated. The "gene of interest" can be endogenous or exogenous. The terms "target product" and "target product" used in the present disclosure can be used interchangeably, referring to the expression product of the gene of interest.

[0097] The terms "exogenous" and "heterologous" used in the present disclosure can be used interchangeably to refer to substances other than those intended to be studied or manipulated, which can be naturally occurring or non-naturally occurring substances. For example, the terms "exogenous gene" and "heterologous gene" used in the present disclosure can be used interchangeably to refer to genes other than those intended to be studied or manipulated, which can be genes from the same species as the species to which the genes intended to be studied or manipulated belong, or genes from different species. For example, the terms "exogenous cyuP gene" and "heterologous cyuP gene" used in the present disclosure can be used interchangeably to refer to cyuP genes from outside the genome, which can be cyuP genes from the same species or different species, and can be naturally occurring or non-naturally occurring cyuP genes; similarly, the terms "exogenous cyuA gene" and "heterologous cyuA gene" used in the present disclosure can be used interchangeably to refer to cyuA genes from outside the genome, which can be cyuA genes from the same species or different species, and can be naturally occurring or non-naturally occurring cyuA genes.

[0098] The term "promoter" used in the present disclosure refers to a site on the DNA template consisting of a specific sequence of nucleotides, which is specifically recognized, bound and initiated by RNA polymerase for transcription, and has directionality. The structure of the promoter affects its binding to RNA polymerase, thereby controlling the starting time of gene expression (transcription) and the degree of expression, in addition, the last segment of the DNA template has a specific structure as a termination site, so that transcription is carried out between the initiation and termination sites. The promoter is mainly composed of three parts: core promoter, proximal promoter and distal promoter.

[0099] The term "Constitutive Promoter" used in the present disclosure is a type of promoter commonly used in biotechnology, especially in genetic engineering. Constitutive promoters are capable of expressing target genes continuously throughout the life cycle of cells, regardless of cell type or environmental conditions. They usually have high transcriptional activity, capable of driving high-level gene expression in cells. Constitutive promoters can function in a variety of cell types, with good versatility. Due to their continuous expression characteristics, constitutive promoters do not require complex regulatory mechanisms to control gene expression. In genetic engineering, constitutive promoters are often used to ensure stable and efficient expression of target genes in host cells. The use of constitutive promoters also has some limitations and challenges, such as the potential to adversely affect the physiological state of host cells, or in some cases, leading to non-specific regulation of gene expression.

[0100] The term "expression" used in the present disclosure includes any step related to the production of a polypeptide, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0101] The term "Nested PCR" used in the present disclosure is a molecular biology technique that improves the specificity and sensitivity of target DNA sequence amplification by using two pairs of specific primers. This method is particularly suitable for detecting low-abundance DNA sequences, or distinguishing highly similar sequences in complex samples.

[0102] The term "Cysteine" used in the present disclosure is a sulfur-containing non-essential amino acid with important physiological functions. It is the rate-limiting precursor of glutathione (GSH), which is the most abundant antioxidant in cells and is essential for maintaining the redox balance of cells. Cysteine has multiple roles in protein synthesis, post-translational modification, and redox maintenance. In addition, cysteine is also a precursor for the synthesis of coenzyme A (COA), taurine, and inorganic sulfur (sulfide, sulfate).

[0103] The metabolism of cysteine also involves glutathione synthetase, which catalyzes the synthesis of glutathione, with the rate-limiting step of glutathione synthesis being highly feedback-inhibited by glutathione. The metabolism of cysteine is closely related to immune function, and its role in immune cells includes regulating immune responses, affecting T cell function and antibody production, etc.

[0104] The term "cyuP" gene used in the present disclosure encodes a cysteine transporter protein in Escherichia coli, which is located in an operon with cyuA. The cyuP gene is also known as dlsT gene or yhaO gene. The Escherichia coli cyuP gene encodes a cysteine transporter protein cyuP, which functions as a specific cysteine transporter. cyuP has the ability to specifically transport cysteine into the cell, which is crucial for the cell to utilize cysteine as the sole nitrogen source or carbon / energy source under anaerobic conditions. cyuP is a high-flux cysteine-specific transporter, whose expression is regulated by cyuR (a cysteine-activated transcriptional activator) and CrP. The activity of cyuP is crucial for cysteine metabolism in Escherichia coli under anaerobic conditions. Studies have shown that cyuP is a high-efficiency, specific cysteine transporter that can directly transport cysteine into the cell, where cyuA degrades it into pyruvate, ammonia and hydrogen sulfide. The synergistic effect of this transport and degradation allows Escherichia coli to utilize cysteine as a carbon source and nitrogen source under anaerobic conditions. In addition, the expression and activity of cyuP are regulated by the intracellular concentration of cysteine, indicating that cyuP plays an important role in the control of intracellular cysteine levels. It is worth noting that cyuP is the first dedicated cysteine transporter to be functionally verified in bacteria. The iron-sulfur cofactor of cyuA is inactivated by oxygen, which makes cysteine the only available carbon source for Escherichia coli in anoxic environments. This feature avoids the release of hydrogen sulfide in aerobic environments, which can interfere with aerobic respiration. Therefore, cyuP plays a key role in cysteine metabolism and energy acquisition in Escherichia coli.

[0105] The term "cyuA" used in the present disclosure is an enzyme in Escherichia coli, whose main function is to degrade cysteine to produce pyruvate, ammonia and hydrogen sulfide, with the functional activity of cysteine desulfurase. The cyuA gene is also known as the b3109 gene, yhaN gene, b3108 gene or yhaM gene. The activity of cyuA is crucial for cysteine metabolism in Escherichia coli under anaerobic conditions, which produces hydrogen sulfide by degrading cysteine, which is believed to improve the resistance of bacteria to oxidative stress, thereby helping bacteria to obtain antibacterial properties. The activity of cyuA is crucial for the growth of Escherichia coli in sulfur-containing media, which not only is the main catalyst for cysteine consumption, but also is the main source of hydrogen sulfide production.

[0106] The term “cyuP-cyuA cysteine assimilation system” as used in the present disclosure is a transport system found in bacteria that is involved in the transport of cysteine. Cysteine is an important sulfur-containing amino acid that is essential for various physiological functions of cells, including protein synthesis, generation of glutathione (GSH), and maintenance of the redox state within cells. In tumor cells, the acquisition of cysteine is particularly critical, as they require this amino acid to support rapid proliferation and survival. In the tumor microenvironment, both cysteine and glutamine are often scarce, making it difficult for tumor cells to meet their cysteine demand through traditional Xc-amino acid transport systems. Therefore, tumor cells can synthesize cysteine through the transsulfuration pathway, a metabolic pathway that utilizes methionine as a precursor. Studies have shown that the content of methionine in tumor tissues significantly increases, which may be related to the activation of the transsulfuration pathway. The activity of the transsulfuration pathway is crucial for tumor cells to maintain their growth under cysteine-limited conditions.

[0107] Further descriptions of cyuP gene, cyuA gene, and “cyuP-cyuA cysteine assimilation system” can be found in Pieper LM, Spanogiannopoulos P, Volk RF, Miller CJ, Wright AT, Turnbaugh PJ. The global anaerobic metabolism regulator fnr is necessary for the degradation of food dyes and drugs by Escherichia coli. mBio. 2023; 14(5): e0157323. doi: 10.1128 / mbio.01573-23 and Zhou Y, Imlay JA. Escherichia coli Uses a Dedicated Importer and Desulfidase To Ferment Cysteine. mBio. 2022; 13(2): e0296521. doi: 10.1128 / mbio.02965-21, which are hereby incorporated by reference in their entirety. The term “IScepA promoter” as used in the present disclosure is a promoter often used for gene expression regulation in Bacteroides. In synthetic biology research, promoter engineering is one of the key factors to achieve efficient and precise regulation of gene expression. The IScepA promoter is recognized and regulated by the sigma factor of RNA polymerase, which activates the transcription of downstream genes. In certain embodiments, the strength of the promoter can be adjusted by changing the upstream activation sequence (UAS) of the promoter, thereby achieving fine regulation of gene expression.

[0108] The term "TA cloning technology" used in the present disclosure is a commonly used molecular biology technique for cloning a PCR-amplified target gene fragment into a plasmid vector. During PCR amplification, certain DNA polymerases (such as Taq polymerase) have the ability to add an adenine (A) at the 3' end of the PCR product. TA cloning takes advantage of this feature by directly ligating the PCR product (with a 3'-A end) to a linearized vector with a 3'-thymine (T) overhanging end, achieving cloning of the DNA fragment.

[0109] The term "pEASY-T1 cloning vector" used in the present disclosure is a plasmid vector provided by TransGene Co. for TA cloning. Typically, the pEASY-T1 cloning vector is provided in a linear form, with a 3' end overhanging thymine (T) for TA cloning. Topoisomerase is coupled to the vector (activating the vector), and a base, usually adenine, is added to the 3' end of the newly synthesized double-stranded product using Taq DNA polymerase. The pEASY-T1 vector is 3928 bp in length and contains elements such as CAP binding site, lac promoter, lac operator, M13 forward and reverse primer binding sites, multiple cloning site, T7 promoter, f1 origin, NeoR / KanR resistance gene, and AmpR resistance gene. The specific sequence information of the pEASY-T1 vector can be queried in the GenBank database, including the corresponding sequences of the above-mentioned elements. The pEASY-T1 vector can be used for gene cloning operations, especially when multiple single enzyme digestion sites are needed, the method of TA cloning can overcome the limitations of commonly used cloning vectors, and improve the flexibility and effectiveness of gene manipulation.

[0110] The term "Bacteroides vulgatus ATCC 8482" used in the present disclosure is a strict anaerobic, Gram-negative bacterium that is commonly found in the human gut. This strain is widely used for laboratory quality control, testing, including media testing, quality control, sterility testing, and testing of pharmaceutical and personal care products. Since Bacteroides vulgatus is associated with human health and disease, this strain can also be used to study the composition and function of the gut microbiota. ATCC 8482 can grow in specific media, such as reinforced clostridial agar or broth medium (pre-reduced), as well as tryptic soy agar or broth with defibrillated sheep blood medium, with growth conditions at 37°C, anaerobic mixed gas (80% N2-10% CO2-10% H2). Some specific gene sequences of Bacteroides vulgatus ATCC 8482 are recorded in the GenBank database, such as 16S ribosomal RNA (M58762), partial gyrA gene for DNA gyrase subunit A (AJ279041), and complete genome sequence (CP000139).

[0111] The term "PCR (Polymerase Chain Reaction)" used in the present disclosure is a molecular biology technique for rapidly replicating a fragment of a specific DNA sequence. PCR uses DNA polymerase to synthesize DNA strands by repeating three steps of denaturation (heating the reaction system to 94-98°C to denature double-stranded DNA template into single-stranded), annealing (lowering the temperature to 50-65°C to allow primers to pair with complementary sequences of the target DNA single strand), and extension (increasing the temperature to 72°C (the optimal activity temperature of Taq polymerase), and DNA polymerase starts to synthesize new DNA strands from the primer along the template strand). PCR reaction requires one or more short RNA or DNA fragments specific to the target DNA sequence, called primers; a stable DNA polymerase, such as Taq polymerase, which remains active at high temperatures; a target DNA template; four deoxynucleotide triphosphates (dNTPs): dATP, dCTP, dGTP, and dTTP. PCR is usually performed for 25-35 cycles, each cycle doubling the number of target DNA fragments. There are many variants of PCR techniques, such as real-time quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), nested PCR, etc., for different research and application purposes.

[0112] The term "ligation" used in the present disclosure is a basic technique in molecular biology, which generally refers to the process of joining two or more DNA or RNA fragments together to form a continuous nucleic acid molecule. Ligation of nucleic acid fragments is usually performed by end ligation, including cohesive end ligation (when the ends of two DNA fragments have complementary cohesive ends, they can be directly ligated by DNA ligase) or blunt end ligation (when the DNA fragments have blunt ends, ligation usually needs to be performed using DNA ligase, but the efficiency is lower); overlap extension PCR (using long primers designed so that the end portions of the two fragments have overlapping sequences, the overlapping region is generated by PCR amplification, and then the two fragments are ligated by a second PCR reaction); homologous recombination (in yeast, bacteria or cells, homologous sequences between fragments are used to promote recombination, thereby achieving ligation of fragments); Gibson assembly (a multi-fragment assembly technique that can assemble multiple DNA fragments in the same reaction); Golden Gate cloning (a cloning technique based on restriction enzymes and DNA ligase, which can quickly assemble multiple DNA fragments); and the like.

[0113] The term "Gibson assembly" used in the present disclosure is a highly efficient DNA assembly technique proposed by Dr. Daniel Gibson and his colleague J. Craig Venter in 2009. It is very suitable for splicing multiple linear DNA fragments, and can seamlessly insert the target DNA into a vector. The process of Gibson assembly is relatively simple, and up to 6 DNA fragments can be spliced in one reaction without the need for specific restriction enzyme sites. The key steps of Gibson assembly include: 1. Design of terminal homologous sequences: homologous sequences are added to both ends of the DNA fragments by PCR, and the length of these homologous sequences is recommended to be 15-40 bp. 2. Mixing reaction system: mix the linearized vector fragment and the DNA fragment containing the homologous sequence, and add the Gibson assembly master mix. The master mix contains three enzymes: an exonuclease, a polymerase and a DNA ligase, which work together to achieve seamless splicing of DNA fragments. 3. Incubate the reaction: the whole reaction can be completed at 50°C for about an hour. 4. Transformation: the incubated sample can be directly used for transformation to form a complete DNA molecule. Gibson assembly requires proper primer design to ensure sufficient homologous sequences and to avoid the formation of stable secondary structures by cohesive ends as much as possible, which can affect the success rate of splicing. Gibson assembly can also be combined with CRISPR technology to achieve more complex genetic manipulation.

[0114] The term "mating hybridization method" used in the present disclosure is a technique used in microbiology and molecular genetics, particularly in genetic studies involving single-cell organisms such as bacteria and yeast. In bacteria, mating hybridization often involves a process called conjugation, in which one bacterium (usually a male cell with a plasmid) transfers genetic material to another bacterium (a female cell) through an intercellular channel. It is usually necessary to induce or select cells capable of conjugation, and then to co-culture them to facilitate the exchange of genetic material. This method can be used to transfer plasmids, including those with antibiotic resistance genes, to achieve gene transfer and expression in genetic engineering. This method can be used to produce recombinant proteins or develop new biological products.

[0115] The term "double crossover recombination" method used in the present disclosure, referred to as double crossover, is used to precisely modify or replace specific genes or DNA sequences in the genome. Double crossover recombination utilizes two adjacent homologous arms flanking the target DNA sequence, which can guide homologous recombination between the exogenous DNA and the corresponding sequence in the host genome. Through this mechanism, the target sequence between the two homologous arms can be precisely replaced by the exogenous DNA. When designing double crossover recombination, a recombination vector containing homologous arms flanking the target gene is designed, the homologous arms are usually several hundred to several thousand base pairs in length, and the vector carries a selection marker gene (such as an antibiotic resistance gene) and a mutated version or replacement sequence of the target gene in the middle. After transforming the recombination vector into the host cell, the host cell containing the recombination vector is screened using the selection marker. In the host cell, the recombination vector undergoes a double crossover event with the homologous sequence in the genome through the homologous recombination mechanism, resulting in the replacement of the target gene by the sequence on the vector. The occurrence of the recombination event and the replacement of the target gene are verified by methods such as PCR, Southern blot or sequencing. Double crossover recombination technology can precisely modify or replace specific genes in the genome without introducing other non-target mutations. It is suitable for gene knockout, gene knock-in and introduction of point mutations. When designing experiments, the homologous arms need to be long enough to ensure sufficient homology, improve recombination efficiency, and need to be carefully verified for recombination events to ensure correct modification of the target gene.

[0116] The term "constitutive strong promoter J23100" used in the present disclosure is a promoter used in gene expression that can maintain relatively stable transcription levels with little influence from intracellular or extracellular stimuli. This promoter is relatively strong in strength and can be used for high-level gene expression in microorganisms such as Escherichia coli.

[0117] The term "strong ribosome binding site" used in the present disclosure is a part of the DNA sequence located upstream of the coding sequence, which is an important region on the mRNA. The main function of the ribosome binding site (RBS) is to provide a binding site for the ribosome, so that the ribosome can recognize and correctly bind to the mRNA, thereby initiating the protein synthesis process, i.e. the translation process. The strength of the ribosome binding site can affect the efficiency of translation. A strong RBS can recruit ribosomes more efficiently, thereby increasing the expression level of a particular gene. By changing the sequence of the RBS or using different RBSs, the expression level of the gene can be regulated to some extent. By optimizing the RBS, the yield of the target protein can be improved, especially in heterologous expression systems. The RBS is usually located upstream of the start codon (such as AUG) of the coding sequence, and the position of the start codon also affects the translation efficiency.

[0118] The term "strong terminator" used in the present disclosure is one of the important elements used to control gene expression in genetic engineering, especially in prokaryotes such as E. coli. Their main function is to provide a clear end signal during transcription, preventing RNA polymerase from continuing to transcribe non-target DNA sequences, thereby improving the specificity and efficiency of gene expression. The rrnB T1 terminator used in the embodiments of the present disclosure is a particularly strong terminator derived from the T1 promoter region of the ribosomal RNA operon (rrnB operon) in E. coli. The rrnB T1 terminator can efficiently terminate transcription in a variety of different gene expression systems, reducing the generation of non-specific transcription products. The use of strong terminators can improve the stability of plasmids, as they reduce plasmid loss or instability due to non-specific transcription. And since the rrnB T1 terminator is isolated from the ribosomal RNA gene of E. coli, it is particularly effective in E. coli. In gene cloning, protein production and synthetic biology, the rrnB T1 terminator is often used to ensure that the sequence behind the target gene will not be transcribed, thereby avoiding possible gene interference or unintended protein expression.

[0119] The term "Golden Gate cloning" used in the present disclosure is a highly efficient DNA assembly technique developed by Feng Zhang and George Church in 2009. It is based on the cleavage properties of Type II restriction enzymes and the ligation activity of T4 DNA ligase, allowing multiple DNA fragments to be precisely assembled together in a one-step reaction. Golden Gate cloning technology is widely used in synthetic biology and molecular biology research due to its high efficiency, high fidelity, and scalability. Unlike traditional multi-step cloning methods, Golden Gate cloning can assemble multiple DNA fragments in a single reaction, greatly simplifying the cloning process.

[0120] In a first aspect, the present disclosure provides an engineered bacterium, said engineered bacterium comprising an exogenous cyuP gene, said exogenous cyuP gene encoding a cysteine transporter protein.

[0121] According to specific embodiments of the present disclosure, said engineered bacterium is modified to express an exogenous cyuP gene.

[0122] According to specific embodiments of the present disclosure, said engineered bacterium is selected from enteric bacteria and / or probiotic bacteria.

[0123] According to specific embodiments of the present disclosure, said engineered bacterium is selected from Bacteroides bacteria, Enterobacteriaceae bacteria (e.g. Escherichia), Lactococcus bacteria, Lactobacillus bacteria, and Bifidobacterium bacteria.

[0124] Preferably, said engineered bacterium is selected from Bacteroides caccae, Bacteroides fragilis, Escherichia coli (e.g. Escherichia coli Nissle 1917), Lactobacillus reuteri, and Bifidobacterium adolescentis.

[0125] According to specific embodiments of the present disclosure, the cyuP gene expresses a cysteine transporter protein cyuP, said cysteine transporter protein cyuP having cysteine transporter activity.

[0126] According to specific embodiments of the present disclosure, said cyuP gene is from an Enterobacteriaceae bacterium;

[0127] Preferably, said cyuP gene is from Escherichia coli, Enterobacter hormaechei, Citrobacter freundii, Shigella flexneri, Salmonella enterica, or Yersinia enterocolitica; more preferably, from Escherichia coli.

[0128] Preferably, the cysteine transporter comprises the amino acid sequence set forth in any one of SEQ ID NO: 32, SEQ ID NO: 35-39, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 32, SEQ ID NO: 35-39.

[0129] Preferably, the cyuP gene comprises the nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 40-44, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 2, SEQ ID NO: 40-44.

[0130] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuP from Escherichia coli, SEQ ID NO: 32, is as follows:

[0131] Accordingly, the nucleotide sequence of the above-mentioned amino acid sequence of cyuP from Escherichia coli, SEQ ID NO: 32, SEQ ID NO: 2, is as follows:

[0132] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuP from Enterobacter cloacae NCTC 9394, SEQ ID NO: 35, is as follows:

[0133] Accordingly, the nucleotide sequence of the above-mentioned amino acid sequence of cyuP from Enterobacter cloacae NCTC 9394, SEQ ID NO: 35, SEQ ID NO: 40, is as follows:

[0134] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuP from Citrobacter freundii CFNIH1, SEQ ID NO: 36, is as follows:

[0135] Accordingly, the nucleotide sequence of the above-mentioned amino acid sequence of cyuP from Citrobacter freundii CFNIH1, SEQ ID NO: 36, SEQ ID NO: 41, is as follows:

[0136] According to a specific embodiment of the present disclosure, the amino acid sequence SEQ ID NO: 37 of cyuP from Shigella flexneri 301 is as follows:

[0137] Accordingly, the nucleotide sequence SEQ ID NO: 42 of the amino acid sequence SEQ ID NO: 37 of cyuP from Shigella flexneri 301 is as follows:

[0138] According to a specific embodiment of the present disclosure, the amino acid sequence SEQ ID NO: 38 of cyuP from Salmonella enterica subsp. enterica serovar Typhi LT2 is as follows:

[0139] Accordingly, the nucleotide sequence SEQ ID NO: 43 of the amino acid sequence SEQ ID NO: 38 of cyuP from Salmonella enterica subsp. enterica serovar Typhi LT2 is as follows:

[0140] According to a specific embodiment of the present disclosure, the amino acid sequence SEQ ID NO: 39 of cyuP from Yersinia enterocolitica subsp. enterocolitica 8081 is as follows:

[0141] Accordingly, the nucleotide sequence SEQ ID NO: 44 of the amino acid sequence SEQ ID NO: 39 of cyuP from Yersinia enterocolitica subsp. enterocolitica 8081 is as follows:

[0142] SEQ ID NO: 35-39 have high homology with SEQ ID NO: 32, and the sequence identity is 73.7%, 83.3%, 98.9%, 83.5%, 64.3%, respectively.

[0143] According to a specific embodiment of the present disclosure, the engineered bacteria further comprise an exogenous cyuA gene encoding a cysteine desulfurase.

[0144] According to a specific embodiment of the present disclosure, the engineered bacteria are modified to express an exogenous cyuA gene.

[0145] According to a specific embodiment of the present disclosure, the exogenous cyuP gene and the exogenous cyuA gene are expressed in series.

[0146] According to a specific embodiment of the present disclosure, the exogenous cyuP gene and the exogenous cyuA gene are expressed in fusion.

[0147] According to specific embodiments of the present disclosure, the exogenous cyuP gene is expressed under the control of the same or a different promoter as the exogenous cyuA gene.

[0148] The present disclosure provides in a second aspect an engineered bacterium comprising an exogenous cyuA gene encoding a cysteine desulfurase.

[0149] According to specific embodiments of the present disclosure, the engineered bacterium is modified to express an exogenous cyuA gene.

[0150] According to specific embodiments of the present disclosure, the engineered bacterium is selected from an enteric bacterium and / or a probiotic bacterium.

[0151] According to specific embodiments of the present disclosure, the cyuA gene expresses a cysteine desulfurase cyuA having activity to decompose cysteine.

[0152] According to specific embodiments of the present disclosure, the engineered bacterium is selected from a Bacteroides bacterium, an Enterobacteriaceae bacterium (e.g. an Escherichia bacterium), a Lactococcus bacterium, a Lactobacillus bacterium, and a Bifidobacterium bacterium;

[0153] Preferably, the engineered bacterium is selected from Bacteroides vulgatus (e.g. ATCC 8482), Bacteroides fragilis, Escherichia coli (e.g. Escherichia coli Nissle 1917), Lactobacillus reuteri, and Bifidobacterium adolescentis.

[0154] According to specific embodiments of the present disclosure, wherein the cyuA gene is from an Enterobacteriaceae bacterium.

[0155] Preferably, the cyuA gene is from Escherichia coli, Enterobacter hormaechei, Citrobacter freundii, Shigella flexneri, Salmonella enterica, or Yersinia enterocolitica; more preferably, from Escherichia coli.

[0156] Preferably, the cysteine desulfurase comprises an amino acid sequence as set forth in any one of SEQ ID NO: 33, SEQ ID NO: 45-49, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 33, SEQ ID NO: 45-49.

[0157] Preferably, the cyuA gene comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 34, SEQ ID NO: 50-54 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 34, SEQ ID NO: 50-54.

[0158] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuA from Escherichia coli, SEQ ID NO: 33, is as follows:

[0159] The nucleotide sequence of cyuA from Escherichia coli, SEQ ID NO: 33, mentioned above, SEQ ID NO: 34, is as follows:

[0160] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuA from Enterobacter cloacae NCTC 9394, SEQ ID NO: 45, is as follows:

[0161] Accordingly, the nucleotide sequence of cyuA from Enterobacter cloacae NCTC 9394, SEQ ID NO: 45, mentioned above, SEQ ID NO: 50, is as follows:

[0162] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuA from Citrobacter freundii CFNIH1, SEQ ID NO: 46, is as follows:

[0163] Accordingly, the nucleotide sequence of cyuA from Citrobacter freundii CFNIH1, SEQ ID NO: 46, mentioned above, SEQ ID NO: 51, is as follows:

[0164] According to a specific embodiment of the present disclosure, the amino acid sequence of cyuA from Shigella flexneri 301, SEQ ID NO: 47, is as follows:

[0165] Accordingly, the nucleotide sequence of cyuA from Shigella flexneri 301, SEQ ID NO: 47, mentioned above, SEQ ID NO: 52, is as follows:

[0166] According to specific embodiments of the present disclosure, the amino acid sequence of cyuA from Salmonella enterica subsp. enterica serovar Typhi LT2, SEQ ID NO: 48, is as follows:

[0167] Accordingly, the nucleotide sequence of cyuA from Salmonella enterica subsp. enterica serovar Typhi LT2, SEQ ID NO: 48, mentioned above, SEQ ID NO: 53, is as follows:

[0168] According to specific embodiments of the present disclosure, the amino acid sequence of cyuA from Yersinia enterocolitica subsp. enterocolitica 8081, SEQ ID NO: 49, is as follows:

[0169] Accordingly, the nucleotide sequence of cyuA from Yersinia enterocolitica subsp. enterocolitica 8081, SEQ ID NO: 49, mentioned above, SEQ ID NO: 54, is as follows:

[0170] SEQ ID NOs: 45-49 have high homology with SEQ ID NO: 33, and the sequence identities thereof are 88.7%, 95.5%, 99.1%, 95.9%, and 85.8%, respectively.

[0171] According to specific embodiments of the present disclosure, the engineered bacteria comprise an exogenous cyuP gene encoding a cysteine transporter protein.

[0172] According to specific embodiments of the present disclosure, the engineered bacteria are modified to express an exogenous cyuP gene.

[0173] According to specific embodiments of the present disclosure, the exogenous cyuP gene is expressed in tandem with the exogenous cyuA gene.

[0174] According to specific embodiments of the present disclosure, the exogenous cyuP gene is expressed in fusion with the exogenous cyuA gene.

[0175] According to specific embodiments of the present disclosure, the exogenous cyuP gene and the exogenous cyuA gene are expressed under the control of the same or different promoters.

[0176] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacteria.

[0177] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacterium by genetic recombination or CRISPR-Cas9 technology.

[0178] According to specific embodiments of the present disclosure, the engineered bacterium is selected from Bacteroides bacteria, preferably Bacteroides vulgatus.

[0179] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or cyuA gene is each expressed in the engineered bacterium under the control of a Bacteroides promoter; preferably, the exogenous cyuP gene and cyuA gene are expressed under the control of an IScepA promoter.

[0180] According to specific embodiments of the present disclosure, the engineered bacterium is selected from Enterobacteriaceae bacteria; preferably Escherichia coli Nissle 1917.

[0181] According to specific embodiments of the present disclosure, the exogenous cyuP gene and / or cyuA gene is expressed in the engineered bacterium under the control of an Escherichia coli constitutive promoter.

[0182] Preferably, the constitutive promoter is a constitutive strong promoter; preferably a J23100 promoter.

[0183] The present disclosure provides in a third aspect a composition comprising the engineered bacterium of the first or second aspect of the present disclosure and optionally a pharmaceutically acceptable carrier.

[0184] According to specific embodiments of the present disclosure, the composition is formulated in a form for oral administration, enteral administration, intravenous injection administration or in situ injection administration to a tumor.

[0185] The present disclosure provides in a fourth aspect use of the engineered bacterium of the first or second aspect of the present disclosure and the composition of the third aspect of the present disclosure in the preparation of a medicament for treating cancer or an inflammatory disease.

[0186] The present disclosure provides in a fifth aspect a method for treating cancer or an inflammatory disease, the method comprising administering to a subject in need thereof the engineered bacterium of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure.

[0187] According to specific embodiments of the present disclosure, the method comprises administering to a subject in need thereof a therapeutically effective amount of the engineered bacterium of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure.

[0188] According to specific embodiments of the present disclosure, the cancer is selected from solid tumors;

[0189] Preferably, the solid tumor is selected from gastrointestinal cancer, melanoma, pancreatic cancer or breast cancer; preferably, the gastrointestinal cancer is colorectal cancer, more preferably, the colorectal cancer is chronic intestinal inflammation-induced colorectal cancer.

[0190] According to specific embodiments of the present disclosure, the inflammatory disease is selected from intestinal inflammatory disease;

[0191] Preferably, the intestinal inflammatory disease is selected from intestinal inflammation, gastric inflammation, gastroenteritis; preferably, the intestinal inflammation is acute intestinal inflammation or chronic intestinal inflammation; preferably, the chronic intestinal inflammation is Inflammatory Bowel Disease (IBD); more preferably, the Inflammatory Bowel Disease is Crohn's disease or ulcerative colitis.

[0192] According to specific embodiments of the present disclosure, the administration mode comprises oral administration, intestinal administration or parenteral administration; preferably, the parenteral administration comprises intravenous injection and / or in situ injection of tumor.

[0193] The sixth aspect of the present disclosure provides use of the engineered bacterium of the first or second aspect of the present disclosure or the composition of the third aspect of the present disclosure in the preparation of a reagent for reducing the abundance of cysteine in an environment.

[0194] According to specific embodiments of the present disclosure, the environment is an environment where tumor cells and / or tumor tissues are located;

[0195] Preferably, the environment is intestinal microenvironment.

[0196] According to specific embodiments of the present disclosure, the use is for non-therapeutic purposes.

[0197] According to specific embodiments of the present disclosure, the use is for in vitro use. DETAILED DESCRIPTION

[0198] The technical solutions of the present disclosure are further illustrated below by means of specific examples. Those skilled in the art should understand that the examples are only to help understand the present disclosure and should not be regarded as specific limitations of the present disclosure.

[0199] Example 1 Construction of recombinant B. vulgaris expressing E. coli cyuP

[0200] This example starts from B. vulgaris ATCC 8482, and constructs a recombinant B. vulgaris expressing E. coli cyuP gene. E. coli cyuP gene encodes specific cysteine transporter cyuP in E. coli.

[0201] This example uses Bacteroides IScepA promoter to express E. coli cyuP gene in B. vulgaris.

[0202] (1) Obtain IScepAp-cyuP expression module by connecting promoter: use nested PCR technology to splice 98 bp length of Bacteroides IScepA promoter (SEQ ID NO: 1) and 1332 bp length of E. coli cyuP gene coding region (SEQ ID NO: 2), and then clone to pEASY-T1 cloning vector (Transgene) through TA cloning, and perform sequencing confirmation. Obtain IScepAp-cyuP expression module. In this process, single enzyme digestion sites XbaI and KpnI are introduced on both sides of the IScepAp-cyuP expression module.

[0203] The IScepA promoter sequence used in this process is shown in SEQ ID NO: 1: GGATATACTAAATTACCTAAAAAAGTGGCGCACAAATTTGCGCGCCACAATTATTATTCATACCTTTGTGGACCGTATTACAAAGAACCCAATCATAT (SEQ ID NO: 1), which is obtained by PCR amplification using primer 1: 5'-tctagaggatatactaaattacctaaaaaagtggcgcacaaatttgcgcgccacaattattattcatacc-3' (SEQ ID NO: 3) and primer 2: 5'-cctttattcgatgcaatttccatatatgattgggttctttgtaatacggtccacaaaggtatgaataataattgtg-3' (SEQ ID NO: 4) as primer templates.

[0204] The cyuP gene used in this process is shown in SEQ ID NO: 2:

[0205]

[0206] (2) Inserting the IScepAp-cyuP expression module into a vector: The insertion site of the IScepAp-cyuP expression module in B. vulgaris is preferably a downstream intergenic spacer of the amino acid transport-related genes that are conserved in B. vulgaris, and the downstream genes are arranged tail-to-tail with the IScepAp-cyuP expression module. For example, taking B. vulgaris ATCC 8482 as an example, between the amino acid transport-related genes BVU_2794 and BVU_2793, a 1379 bp length fragment containing the BVU_2794 gene (obtained by PCR amplification of B. vulgaris ATCC 8482 using primer 5: 5'-taagattagcattatgagtggatcctttccaggaacggtacggttc-3' (SEQ ID NO: 7) and primer 6: 5'-ctggcaacttttcatgaatgggggtacccggtctagattattgtatggaccggagatttttc-3' (SEQ ID NO: 8)) and a 1425 bp length fragment containing the BVU_2793 gene (obtained by PCR amplification of B. vulgaris ATCC 8482 using primer 7: 5'-cccattcatgaaaagttgccag-3' (SEQ ID NO: 9) and primer 8: 5'-actggaagataggcaattagtcgaccgtatactagtccatccggcac-3' (SEQ ID NO: 10)) were spliced, cloned into the BamHI-SalI site of the pLGB30 vector (Addgene, #126620) using the Gibson assembly method (Garcia-Bayona & Comstock, 2019), and sequencing was performed for confirmation. In this process, single enzyme digestion sites XbaI and Kpnl were introduced between the BVU_2794 and BVU_2793 genes. This recombinant plasmid was named pKUT1606.

[0207] (3) Inserting the IScepAp-cyuP expression module into the B. vulgatus chromosome: the IScepAp-cyuP expression module obtained in step (1) was inserted into the XbaI-KpnI site of the recombinant plasmid pKUT1606 obtained in step (2), and the obtained recombinant plasmid was named pKUT1608. The plasmid pKUT1608 was conjugated from the E. coli donor strain ST18 into B. vulgatus by the method of double parental hybridization, and the IScepAp-cyuP expression module was inserted into the B. vulgatus ATCC 8482 chromosome between the BVU_2794 and BVU_2793 genes by the double crossover recombination method according to the method described by García-Bayona L et al. (García-Bayona L Comstock LE. Streamlined Genetic Manipulation of Diverse Bacteroides and Parabacteroides Isolates from the Human Gut Microbiota. mBio. 2019 Aug 13;10(4):e01762-19. doi: 10.1128 / mBio.01762-19), and PCR sequencing confirmation was performed. The recombinant B. vulgatus was named BV1608. The recombinant B. vulgatus containing the cyuP gene was obtained.

[0208] The PCR sequencing results are shown in the following sequence SEQ ID NO: 11, the IScepAp-cyuP sequence inserted between the BVU_2794 and BVU_2793 genes on the chromosome of the engineered bacteria BV1608 (the uppercase part represents the original sequence of B. vulgatus, the lowercase part represents the exogenous inserted sequence, and the underlined part represents the IScepAp sequence), and it can be seen that the B. vulgatus with the cyuP gene inserted in the genome is successfully obtained.

[0209] SEQ ID NO: 11

[0210] Example 2 Construction of probiotic Escherichia coli Nissle 1917 (EcN) with additional constitutively high expression of cyuP gene or cyuA gene

[0211] In wild-type E. coli, cyuP-cyuA cysteine assimilation system plays a role in resisting harmful concentrations of cysteine, and the expression of E. coli endogenous cyuP-cyuA can respond to specific physiological signals of E. coli. This embodiment inserts constitutively high expression cyuP and cyuA in the genome of E. coli EcN by CRISPR-Cas9 system, respectively, to bypass the regulation of EcN on the expression of these genes.

[0212] (1) Obtain sgRNA: using the CHOPCHOP website, based on the whole genome sequence of EcN strain (NCBI Reference Sequence: NZ_CP007799.1), an sgRNA (sequence: 5'-ttaaaagcgcagtataatagcgg-3' (SEQ ID NO: 12)) was designed in the non-coding region between the mokC and ompK genes of the EcN strain (position 15806), and using pTarget F plasmid (see Jiang Y, Chen B, Duan C, et al. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system [J]. Applied and environmental microbiology, 2015, 81(7): 2506-2514) as a template, the target sgRNA was obtained by PCR (primer sgRNA F: 5'-aatactagtttaaaagcgcagtataataggttttagagctagaaatagc-3' (SEQ ID NO: 13); sgRNA R: 5'-gtcaaggagaagagagcaaaaaaaagcaccgactcggt-3' (SEQ ID NO: 14)).

[0213] (2) Construction of pTarget F plasmid containing sgRNA and homology arms: To achieve homologous recombination repair of target site, 154 bp upstream homology arm (upstream homology arm sequence as shown in SEQ ID NO: 15, SEQ ID NO: 15: TGCTCTCTTCTCCTTGACCTTTCGGTCAGTAAGAGGCACTCTACATGTGTTCTGCATATAGGGGGCCTCGGGTTGATGGTAAAATATCACTCGGGGCTTTTCTCTATCTGCCGTTCAGCCAATGCCTGAGACAGACAGCCTCAAGCACCCGCCG) and 180 bp downstream homology arm (downstream homology arm sequence as shown in SEQ ID NO: 16, SEQ ID NO: 16: TTCACTTCTGTTTTATCAATTCTTTTTCTGAAGACGCCTCGCATTTTTGCGGAATAATATTTCAATACATCAATTTATTTAACTTAAATATATCCAGGGATTCACAAAAAAAGGTGTTTTCCTCTATCAAAAGTGAATGGCTAAAGGAAATTAATTATTAAAGGTTACTGTAATACTATA) were designed and repaired by λRed homologous recombination system. The primers for upstream homology arm were homology arm forward F: 5'-accgagtcggtgcttttttttgctctcttctccttgac-3' (SEQ ID NO: 17) and homology arm forward R: 5'-tcaagaattccggcgggtgcttgaggct-3' (SEQ ID NO: 18), and PCR reaction was performed with E. coli mg1655 strain genome as template to obtain the upstream homology arm. The primer design contained the overlapping region with sgRNA sequence, and sgRNA and upstream homology arm sequence were combined by overlap PCR, and then cleaved with spe I and EcoRI to be cloned into pTarget F plasmid.The primers for the downstream homology arm were homology arm reverse F: 5'- gcagaagcttttcacttctgttttatcaattctttttctg-3' (SEQ ID NO: 19) and homology arm reverse R: 5'- tgaactcgagtatagtattacagtaacctttaataattaatttcctttagc-3' (SEQ ID NO: 20), which were obtained in the same way and cloned into the pTarget F plasmid after HindIII and Xhol digestion. All plasmid constructions were completed and verified by sequencing.

[0214] (3) Obtain the pTarget F plasmid containing the target gene: The constitutive strong promoter J23100 of Escherichia coli (the sequence of the constitutive strong promoter J23100 is shown as SEQ ID NO: 21, SEQ ID NO: 21: ttgacggctagctcagtcctaggtacagtgctagc), the strong ribosome binding site aaagaggagaaa (SEQ ID NO: 22) (see Elowitz M B, Leibler S. A synthetic oscillatory network of transcriptional regulators [J]. Nature, 2000, 403(6767): 335-338.) and the strong terminator rrnB T1 terminator (the sequence of the strong terminator rrnB T1 terminator is shown as SEQ ID NO: 23, SEQ ID NO: 23: TCAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC) were used to regulate the expression of the target gene in the Escherichia coli EcN strain. First, the following 3 pairs of primers were designed:

[0215] cyuA F: 5'- ggctacggtctcgagctactagagaaagaggagaaatactagatggtaataatgtttgattcgactttaaat-3' (SEQ ID NO: 24)

[0216] cyuA R: 5'- ggctacggtctcacagtctttcgactgagcctttcgttttattgatgctggcttatcAttatctggccttgctcgccat-3' (SEQ ID NO: 25)

[0217] cyuP F: 5'-ggctacggtctcgagctactagagaaagaggagaaatactagatggtaataatggaaattgcatcgaataaa-3' (SEQ ID NO: 26)

[0218] cyuP R: 5'-ggctacggtctcacagtctttcgactgagcctttcgttttattgatgctggcttatcatcaagaaaatgccaggaacgg-3' (SEQ ID NO: 27)

[0219] pTarget Goldengate F: 5'-ggctacGGTCTCgactgggcctttcgttttatctgttgtttgtcggtgaacgctctcaagcttttcacttctgttttatca-3' (SEQ ID NO: 28)

[0220] pTarget Goldengate R: 5'-ggctacGGTCTCaagctagcactgtacctaggactgagctagccgtcaagaattccggcgggtgcttgaggct-3' (SEQ ID NO: 29).

[0221] PCR was performed using pTarget Goldengate F and R primers and pTarget F containing homologous arms and sgRNA as a template to obtain linearized pTarget F plasmid with Bsal enzyme cutting site. Then, two pairs of primers, cyuA F and cyuA R and cyuP F and cyuP R, were used to amplify cyuA and cyuP gene fragments with Bsal enzyme cutting site using E. coli mg1655 strain genomic DNA as a template. Then, Goldengate reaction was performed to obtain plasmids: pTarget F-cyuA and pTarget F-cyuP, both of which were verified by sequencing.

[0222] (4) Inserting the target gene into the EcN genome: the cyuP gene and cyuA gene were respectively knocked into the genome of EcN by using the successfully constructed pTarget F-cyuA and pTarget F-cyuP in step (3). First, the electrotransformation competent cells of the E. coli EcN strain were prepared, and the temperature-sensitive pCas plasmid was transformed into the cells. The culture was maintained at 30°C, and L-arabinose was added to induce the expression of the lambda Red homologous recombination system. Then, the pTarget F-cyuA and pTarget F-cyuP plasmids were respectively transformed into the EcN strain containing pCas, and after recovery at 30°C, the cells were cultured on Kana+Spec double-antibiotic plates (agar plates containing kanamycin (Kana) and spectinomycin (Spec)) overnight. The obtained single colonies were subjected to sequencing verification.

[0223] The sequencing results of the E. coli EcN chromosome inserted with the additional constitutively high-expression cyuP gene are shown in SEQ ID NO: 30 (the uppercase letter part represents the original sequence of the E. coli EcN genome, the lowercase letter part represents the additional constitutively high-expression cyuP gene inserted, and the underlined part represents the cyuP gene sequence), and it can be seen that the E. coli EcN with the additional constitutively high-expression cyuP gene inserted into the genome has been successfully obtained.

[0224] SEQ ID NO: 30:

[0225] The sequencing results of the E. coli EcN chromosome inserted with the additional constitutively high-expression cyuA gene are shown in SEQ ID NO: 31 (the uppercase letter part represents the original sequence of the E. coli EcN genome, the lowercase letter part represents the additional constitutively high-expression cyuA gene inserted, and the underlined part represents the cyuA gene sequence), and it can be seen that the E. coli EcN with the additional constitutively high-expression cyuA gene inserted into the genome has been successfully obtained.

[0226] SEQ ID NO: 31:

[0227] (5) Elimination of pCas plasmid and pTarget F plasmid: For the positive clones confirmed by sequencing, the elimination of pCas plasmid and pTarget F plasmid was subsequently performed. First, the positive clones were cultured in LB medium containing kanamycin with 0.5 mM IPTG for 8-20 hours, and then streaked on the medium containing kanamycin and the medium containing kanamycin and streptomycin, respectively, and the clones growing only on the medium containing kanamycin were selected. The clones successfully eliminating pTarget F were further subjected to pCas plasmid elimination, and after 37°C liquid overnight culture, they were streaked on the medium without antibiotics and the medium containing kanamycin, and the clones growing only on the medium without antibiotics were selected to complete the elimination of pCas plasmid.

[0228] Example 3 Evaluation of the ability of genetically engineered bacteria BV1608 to inhibit cancer development using a mouse model

[0229] This example evaluates the ability of the common Bacteroides obtained in Example 1 to inhibit cancer development using a mouse cancer model.

[0230] (1) Experimental cell lines and animals

[0231] The cell line is CT-26-luc (mouse colon cancer cells) from the cell bank of Peking University First Hospital. The cancer cell lines are maintained in DMEM medium (Gibco, catalog number: 10566016; containing 4.5 g / L glucose, GlutaMAX and phenol red, without glutamine sodium pyruvate) supplemented with 10% fetal bovine serum (Thermo Scientific, catalog number 30067334). The cells are cultured at 37°C, 5% CO2, 95% humidity. The cells are subcultured for no more than 25 times.

[0232] (2) Construction of mouse cecal orthotopic tumor model

[0233] The schematic diagram of the construction of the cecal orthotopic model is shown in Figure 1. CT-26-luc in the logarithmic growth phase was taken and adjusted to a concentration of 1 x 10 6 / 50 μL on ice, and the orthotopic tumor loading was completed within 1 hour. The mice previously starved for 24 hours were transferred to a gas anesthesia device for anesthesia. The mouse toes were lightly clamped with tweezers, and the mouse was anesthetized without response. The mouse abdomen was disinfected with alcohol, a sterile straight-point tissue scissors was used to cut an opening of about 1.5 cm on the skin, the muscle tissue around the abdominal wall was clamped with tweezers, the abdominal contents were moved away with tweezers, the cecal tissue was slowly and gently pulled out of the abdominal cavity, and warm normal saline was used to keep the cecum moist. A 27G needle was used to inject 1 x 10 6The needle was slowly withdrawn after 1 min, and the needle was observed to have no obvious liquid leakage, and the wound was sutured. The mouse was tilted at 45°, and the needle was slowly inserted along the angle of the mouse's abdominal cavity, and 0.1-0.2 mL / 10 g of body weight of antibiotics was injected to prevent infection. On the 20th day, the mouse was anesthetized and killed, and the mouse was dissected, and the tumor tissue was collected.

[0234] (3) Cysteine engineered bacteria inhibit the development of colon cancer

[0235] The mice were randomly divided into groups. Two days before the construction of the cecal orthotopic tumor model, the mice were pre-gavaged, the mouse tail was lifted, the left thumb and index finger of the hand were pinched behind the ears of the mouse, the mouse was turned over and placed in the palm, and the hind limbs were straightened. The gavage device was gently pressed against the head of the mouse to align the oral cavity with the esophagus, and the gavage needle was gently inserted along the palate wall into the esophagus. When the gavage needle was inserted about 3 cm, it reached the stomach. The mouse could swallow the drug by itself, and the gavage needle was gently withdrawn after the bacteria were injected. After the construction of the cecal orthotopic tumor model, gavage was performed every two days, and the total amount of bacteria injected each time was 10 OD (about 1 x 10 10 The mice were randomly divided into groups. Two days before the construction of the cecal orthotopic tumor model, the mice were pre-gavaged, the mouse tail was lifted, the left thumb and index finger of the hand were pinched behind the ears of the mouse, the mouse was turned over and placed in the palm, and the hind limbs were straightened. The gavage device was gently pressed against the head of the mouse to align the oral cavity with the esophagus, and the gavage needle was gently inserted along the palate wall into the esophagus. When the gavage needle was inserted about 3 cm, it reached the stomach. The mouse could swallow the drug by itself, and the gavage needle was gently withdrawn after the bacteria were injected. After the construction of the cecal orthotopic tumor model, gavage was performed every two days, and the total amount of bacteria injected each time was 10 OD (about 1 x 10

[0236] Anatomize while collecting the intestinal contents of mice, and use the cysteine content detection kit (item number: BC0180; Solarbio) to detect the cysteine content. Weigh an appropriate amount of intestinal contents, add cysteine extraction solution, grind thoroughly on ice, transfer to a 4°C pre-cooled centrifuge, centrifuge at 11000 rpm for 10 min, take the supernatant, add the reagent in the kit in proportion, stand at room temperature for 15 min, detect at 600 nm wavelength on a microplate reader, and calculate the cysteine content of each group of intestinal contents by standard curve (see Huang Q, Wang M, Xia Z. The SULTR gene family in maize (Zea mays L.): gene cloning and expression analyses under sulfate starvation and abiotic stress [J]. Journal of plant physiology, 2018, 220: 24-33.). The measurement results are shown in Figure 3. Figure 3 shows the cysteine detection analysis of the intestinal contents of mice gavaged with engineered bacteria. The intestinal contents of mice with tumors in situ were obtained after 9 times of gavage intervention with 10 OD, and the cysteine was quantitatively detected. The average value with SEM (n = 4), (*P < 0.05).

[0237] The results show that the engineered bacteria BV1608 prepared in Example 1 can significantly reduce the cysteine content in the intestine, which is conducive to inhibiting the further development of tumors.

[0238] Example 4: Application of genetically engineered bacteria EcN in pan-cancer

[0239] To further evaluate the treatment effect of genetically modified bacteria on tumors, this example uses the evaluation scheme of Example 3 to evaluate the application of E. coli EcN (including engineered bacteria EcN-cyuP and engineered bacteria EcN-cyuA) prepared in Example 2 in situ in colon cancer and skin cancer.

[0240] (1) Experimental cell lines and animals

[0241] The cell lines are CT-26-luc (mouse colon cancer cells) and B16F10 (mouse melanoma cells) from the cell bank of Peking University First Hospital. The cancer cell lines are maintained in DMEM medium (item number: 10566016; Gibco; containing 4.5 g / L glucose, GlutaMAX and phenol red, without glutamine sodium pyruvate) added with 10% fetal bovine serum (item number: 30067334; Thermo Scientific). The cells are cultured at 37°C, 5% CO2, 95% humidity. The cells are subcultured for no more than 25 times.

[0242] (2) Construction of mouse tumor model

[0243] The method for constructing the mouse cecal in situ tumor model is the same as in Example 3.

[0244] Construction of a mouse skin cancer tumorigenesis model: B16F10 cells in the logarithmic growth phase were used, and the cell concentration was adjusted to 2×10⁻⁶ cells with pre-cooled PBS. 6 200 μL of melanoma cells were placed on ice and administered in situ within 1 hour. Hair at the injection site was removed beforehand with depilatory cream. The needle was inserted at an angle, the skin was lifted, and 200 μL of melanoma cells were injected subcutaneously. The length and width of the mouse tumor tissue were measured periodically using calipers. Mice were anesthetized and sacrificed 18 days after the model was established, and the tumor tissue was collected.

[0245] (3) Engineered bacteria EcN inhibits tumor development (in colorectal cancer model and melanoma model)

[0246] The treatment plan for the cecal in situ tumor model is the same as above.

[0247] Treatment protocol for melanoma model: After the melanoma has developed normally for 7 days, the genetically engineered bacteria EcN is injected into the melanoma tissue in situ at a volume of 50 μL and a concentration of 0.05 OD / 50 μL. On the 18th day, the mice are anesthetized and sacrificed to obtain intact tumor tissue, which is photographed, weighed, and its volume is measured.

[0248] The results are shown in Figure 4. (A) represents 10 OD (approximately 1 × 10⁻⁶) from mice with orthotopic cecal tumors. 10 (A) and (B) are images of tumor tissue obtained after 9 gavage interventions (n=5) of cells. (C) shows the volume and weight data of the tumor tissue in A, with SEM values ​​(*P<0.05). (D) shows the tumor tissue obtained after orthotopic injection of 0.05 OD (approximately 5 × 10⁻⁶ cells) into melanoma-bearing mice. 7 (Number of cells), tumor tissue images obtained on day 18, where control and EcN-WT were treated with equal volumes of PBS and unedited EcN bacteria in situ, respectively. (E)(F) show the weight and volume growth data of tumor tissue in D, with SEM mean (n=8) (***P<0.001). The results show that the technical solution disclosed herein can still inhibit tumor development in different bacterial species and cancer types.

[0249] Example 5: Therapeutic effects of engineered bacteria BV1608 and EcN-cyuP on colorectal cancer induced by dextran sulfate sodium (DSS) chronic enteritis.

[0250] (1) Experimental materials and animals

[0251] The chronic intestinal inflammation inducer used is dextran sulfate sodium DSS (item number 0216011090; MP Biomedicals), and azoxymethane AOM (item number 25843-45-2; Sigma-Aldrich). The experimental animals are C57BL / 6 mice, male, 7 weeks old, weighing about 19-21 g; purchased from Vantianlihua Experimental Animal Technology Co., Ltd.

[0252] (2) Construction of a mouse chronic intestinal inflammation-induced intestinal cancer model

[0253] The mice were weighed and labeled, and AOM was dissolved in sterile water. The experimental group of mice was injected intraperitoneally with AOM (10 mg / kg), and then fed with conventional drinking water for 1 week. The conventional drinking water was replaced with newly configured DSS (2% concentration) every two days, and the mice were fed for 1 week. The mice were fed with conventional drinking water for 2 weeks. This operation was repeated three times, and the colorectal samples of the mice were collected at week 10.

[0254] (3) Cysteine-modified bacteria inhibit the development of colon cancer

[0255] During the model establishment process, the cysteine-modified bacteria were gavaged into the experimental group of mice every two days, with a total of 10 OD of bacteria gavaged each time. The mouse tail was raised, the thumb and index finger were pinched on the skin behind the ears and the back of the neck, the mouse was turned over to the palm, and the hind legs were straightened. The gavage device was gently pressed against the head of the mouse to make the oral cavity and esophagus form a straight line, and then the gavage needle was gently inserted along the upper palate wall into the esophagus. When the gavage needle was about 3 cm long, it reached the stomach. The mouse could swallow the medicine by itself, and the gavage needle was gently pulled out after the gavage was completed. After the construction of the cecal orthotopic tumor model was completed, the body weight change was recorded.

[0256] The results showed that wild-type EcN (EcN-WT) or ordinary Bacteroides (BV-WT) could not alleviate the decrease in body weight and mortality of mice caused by the development of colorectal tumors in the AOM / DSS model; while the engineered bacteria BV1608 and EcN-cyuP could alleviate the decrease in body weight of mice (FIGS. 6A and 6C) and reduce the mortality of mice (FIGS. 6B and 6D).

[0257] After 26 gavages, the colorectal samples of the mice were collected at week 10. The mice were dissected, and the colorectum was retained to measure the length and weight of the colorectum. The results showed that wild-type EcN or ordinary Bacteroides could not alleviate the shortening of the colorectum caused by the development of intestinal inflammation and the excessive proliferation of cells to form tumors; while the engineered bacteria BV1608 and EcN-cyuP could alleviate the shortening of the colorectum caused by the development of inflammation and tumor proliferation in the AOM / DSS model (FIG. 7), and inhibit the further development of intestinal tumors.

[0258] Example 6: Therapeutic effect of engineered bacteria in an acute intestinal inflammation model

[0259] The mice were fed according to the pattern in FIG. 8A using DSS (sodium sulfate dextran) to make a mouse acute enteritis model, and the mice were sacrificed after 10 days for further colon sampling. It can be seen that the weight loss trend, DAI inflammatory damage score and colon shortening degree of the mice in the cyuP engineered bacteria intervention group were obviously improved (FIGS. 8B-8E). Then pathological section staining and immunohistochemical staining were performed, and it can be seen that the intestinal damage of the colon in the cyuP engineered bacteria intervention group (including inflammatory infiltration, tissue edema, damage depth and crypt damage) was obviously improved, and the positive proportion after treatment with the engineered bacteria was obviously decreased compared with the DSS model group through MPO (myeloperoxidase) staining (FIGS. 8F-8G).

[0260] Example 7: Treatment effect of engineered bacteria in chronic enteritis model

[0261] The mice were fed according to the pattern in FIG. 9A using DSS to make a mouse chronic enteritis model, and the mice were sacrificed after 9 weeks for further colon sampling. It can be seen that the weight loss trend and colon shortening degree of the mice in the cyuP engineered bacteria intervention group were obviously improved (FIGS. 9B-9D). Then pathological section staining and immunohistochemical staining were performed, and it can be seen that the intestinal damage of the colon in the cyuP engineered bacteria intervention group (including inflammatory infiltration, tissue edema, damage depth and crypt damage) was obviously improved, and the positive proportion after treatment with the engineered bacteria was obviously decreased compared with the DSS model group through MPO (myeloperoxidase) staining (FIGS. 9E-9G).

[0262] Example 8: Change of cysteine content and detection of barrier function of mice after gavage with engineered bacteria

[0263] The cysteine content in the feces and colon epithelium of the mice was determined using a cysteine detection kit (FIGS. 10A-10B), and the acute enteritis model was taken as an example. The results showed that after cyuP engineered bacteria intervention, the cysteine content in the feces of the mice increased and the cysteine content in the intestinal epithelium decreased. In addition, serum FD-40 determination was also performed, which reflects the intestinal permeability and barrier function. Compared with the model group, the intestinal permeability decreased and the loss of barrier function was alleviated after the intervention of the engineered bacteria (FIGS. 10C-10D). Finally, the serum content of three common inflammatory factors was determined, and it can be seen that compared with the DSS model group, the three inflammatory factors IL-6, IL-1β and TNF-α were obviously decreased after the intervention of the engineered bacteria (FIGS. 10E-10G).

Claims

1. An engineered bacterium comprising one or more exogenous genes encoding a protein for reducing the abundance of cysteine in an environment, the exogenous gene being an exogenous cyuP gene and / or an exogenous cyuA gene; the exogenous cyuP gene encoding a cysteine transporter; the exogenous cyuA gene encoding a cysteine desulfurase.

2. The engineered bacterium of claim 1, the engineered bacterium being selected from the group consisting of Bacteroides bacteria, Enterobacteriaceae bacteria (e.g., Escherichia), Lactococcus bacteria, Lactobacillus bacteria, and Bifidobacterium bacteria; Preferably, the engineered bacterium is selected from the group consisting of B. vulgatus, B. fragilis, E. coli, L. reuteri, and B. adolescentis.

3. The engineered bacterium of claim 1 or 2, the engineered bacterium being B. vulgatus or E. coli.

4. The engineered bacterium of any one of claims 1-3, wherein the exogenous cyuP gene, the exogenous cyuA gene is from an Enterobacteriaceae bacterium; preferably, the exogenous cyuP gene, the exogenous cyuA gene is from E. coli, E. huberi, C. freudii, S. flexneri, S. enterica, or Y. enterocolitica; more preferably, from E. coli.

5. The engineered bacterium of any one of claims 1-4, the cysteine transporter comprising an amino acid sequence set forth in any one of SEQ ID NO: 32, SEQ ID NO: 35-39, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 32, SEQ ID NO: 35-39; and / or the cysteine desulfurase comprising an amino acid sequence set forth in any one of SEQ ID NO: 33, SEQ ID NO: 45-49, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 33, SEQ ID NO: 45-49.

6. The engineered bacterium of any one of claims 1-5, the exogenous cyuP gene comprising a nucleotide sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 40-44, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 2, SEQ ID NO: 40-44; and / or the exogenous cyuA gene comprising a nucleotide sequence set forth in any one of SEQ ID NO: 3, SEQ ID NO: 46-50, or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 3, SEQ ID NO: 46-50. ​ The exogenous cyuA gene comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 34, SEQ ID NO: 50-54 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to any one of SEQ ID NO: 34, SEQ ID NO: 50-54.

7. The engineered bacterium of any one of claims 1-6, wherein the environment is an environment in which tumor cells and / or tumor tissues are located.

8. The engineered bacterium of any one of claims 1-6, wherein the environment is an intestinal microenvironment.

9. The engineered bacterium of any one of claims 1-8, wherein the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacterium. Preferably, the exogenous cyuP gene and / or the exogenous cyuA gene is integrated into the genome of the engineered bacterium using genetic recombination or CRISPR-Cas9 technology.

10. A composition comprising the engineered bacterium of any one of claims 1-9 and optionally a pharmaceutically acceptable carrier.

11. The composition of claim 10, which is formulated in a form for oral administration, enteral administration, intravenous injection administration or in situ injection administration to a tumor.

12. Use of the engineered bacterium of any one of claims 1-9 or the composition of any one of claims 10-11 in the preparation of a medicament for treating cancer or a medicament for treating an inflammatory disease.

13. A method for treating cancer or an inflammatory disease, the method comprising administering to a subject in need thereof an effective amount of the engineered bacterium of any one of claims 1-9 or the composition of any one of claims 10-11; preferably, the administration comprises oral administration, enteral administration or parenteral administration; preferably, the parenteral administration comprises intravenous injection and / or in situ injection to a tumor.

14. The use of claim 12 or the method of claim 13, wherein the cancer is selected from a solid tumor, preferably the solid tumor is selected from a gastrointestinal cancer, a melanoma, a pancreatic cancer or a breast cancer; preferably, the gastrointestinal cancer is a colorectal cancer, more preferably, the colorectal cancer is a chronic intestinal inflammation-induced colorectal cancer.

15. The use of claim 12 or the method of claim 13, wherein the inflammatory disease is an intestinal inflammatory disease, preferably the intestinal inflammatory disease is selected from intestinal inflammation, gastric inflammation, gastroenteritis, preferably the intestinal inflammation is acute intestinal inflammation or chronic intestinal inflammation; preferably, the chronic intestinal inflammation is inflammatory bowel disease, more preferably, the inflammatory bowel disease is Crohn’s disease or ulcerative colitis.

16. Use of the engineered bacterium of any one of claims 1-9 or the composition of any one of claims 10-11 in the preparation of an agent for reducing the abundance of cysteine in an environment.

17. The use of claim 16, wherein the environment is an environment in which tumor cells and / or tumor tissues are located. Preferably, the environment is an intestinal microenvironment.

Images