Use of colanic acid-containing composition in skin Anti-aging

Abstract

Provided is the use of a composition containing a colanic acid or a physiologically acceptable salt thereof in skin anti-aging, wherein a collagen promoter is combined with the colanic acid or the physiologically acceptable salt thereof to synergistically improve skin anti-aging effects.

Description

Use of colanic acid-containing compositions in skin anti-aging TECHNICAL FIELD

[0001] The present disclosure belongs to the field of skin care and medicine, and in particular to the use of compositions comprising colanic acid or a physiologically acceptable salt thereof in skin anti-aging. BACKGROUND

[0002] Colanic acid (CA) is a bacterial exopolysaccharide produced by most strains of Escherichia coli and other species of Enterobacteriaceae. It is a polysaccharide synthesized by bacteria during life activities to adapt to environmental changes and improve their survival rate. CA has a large molecular weight and loosely wraps around the surface of the bacterial cell, making the cell appear mucous. It prevents cell dehydration, protects cells, and resists harmful substances. In adverse environmental conditions, such as dryness, low pressure, and low pH, mucoid strains have stronger survivability than wild-type strains. In 2017, Han et al. reported that feeding purified CA or E. coli that can secrete CA can significantly prolong the lifespan of Caenorhabditis elegans. In addition, CA, as a unique active biopolymer, has special biological characteristics and physiological parameters, and has broad application prospects.

[0003] Current studies have shown that sodium colanic acid of different molecular weights has good effects on promoting the regeneration of type I and type III collagen. However, there is no study on the effect of sodium colanic acid combined with different small molecule active compounds on promoting collagen regeneration. Based on existing work, the present study combined sodium colanic acid with a series of active molecules and found that the combination had a very significant promoting effect on the production of type I collagen by human fibroblasts. SUMMARY

[0004] In one aspect, the present disclosure provides the use of a collagen promoter in the preparation of a skin anti-aging function enhancer of colanic acid or a physiologically acceptable salt thereof, the collagen promoter being selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodotin, hydroxytyrosol, taurine, nicotinamide, retinol propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9, and alpha-ketoglutaric acid.

[0005] In another aspect, the present disclosure provides use of a composition comprising a collagen promoter selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinol propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9, and alpha-ketoglutaric acid, and colanic acid or a physiologically acceptable salt thereof in the manufacture of a product for skin anti-aging.

[0006] In another aspect, the present disclosure provides a method for skin anti-aging, comprising administering to a subject a combination of a collagen promoter selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinol propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9, and alpha-ketoglutaric acid, and colanic acid or a physiologically acceptable salt thereof.

[0007] In some embodiments, the concentration of the collagen promoter is 0.01-20000 pg / mL.

[0008] In some embodiments, the concentration of the colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, for example, it can be 10-3000 pg / mL or 100-1000 pg / mL.

[0009] In some embodiments, the molecular weight of the colanic acid or a physiologically acceptable salt thereof is selected from 1-50 kDa and 1000-2000 kDa, preferably selected from 10-20 kDa and 20-50 kDa.

[0010] In some embodiments, the concentration of glutathione is 0.1-100 pg / mL, preferably 0.3-35 pg / mL; the concentration of fisetin is 1-50 pg / mL, preferably 1-6 pg / mL; the concentration of urolithin A is 1-50 pg / mL, preferably 2-15 pg / mL; the concentration of beta-nicotinamide mononucleotide is 100-5000 pg / mL, preferably 600-2500 pg / mL; the concentration of ergothioneine is 0.01-1 pg / mL, preferably 0.03-0.12 pg / mL; the concentration of salidroside is 0.1-10 pg / mL, preferably 0.3-3 pg / mL; the concentration of hydroxytyrosol is 1-200 pg / mL, preferably 7-200 pg / mL, more preferably 7-150 pg / mL; the concentration of taurine is 500-10000 pg / mL, preferably 1000-7000 pg / mL, more preferably 1000-5000 pg / mL; the concentration of nicotinamide is 10-5000 pg / mL, preferably 20-1000 pg / mL, more preferably 100-1000 pg / mL; the concentration of retinyl propionate is 1000-10000 pg / mL; the concentration of gamma-aminobutyric acid is 0.1-50 pg / mL, preferably 0.1-15 pg / mL, more preferably 5-15 pg / mL; the concentration of ceramide is 1-50 pg / mL, preferably 5-25 pg / mL; the concentration of N-acetylneuraminic acid is 1-50 pg / mL, preferably 2-10 pg / mL, preferably 5-10 pg / mL; the concentration of acetyl tetrapeptide-2 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL; the concentration of hexapeptide-9 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 pg / mL, preferably 10-1500 pg / mL.

[0011] In some embodiments, the skin anti-aging comprises one or more of skin anti-wrinkling, skin anti-aging, increasing collagen content in the skin, preferably type I and / or type III collagen content.

[0012] In some embodiments, the skin anti-aging comprises one or more of promoting SOD1 expression, promoting GPX1 expression, promoting ELN expression.

[0013] In some embodiments, the collagen promoter, the colanic acid or a physiologically acceptable salt thereof, or the composition is formulated for topical, oral, intramuscular, subcutaneous, or intravenous administration.

[0014] In some embodiments, the collagen promoter is administered simultaneously or sequentially with the colanic acid or the physiologically acceptable salt thereof.

[0015] In another aspect, the present disclosure also provides a composition comprising a collagen promoter selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinol propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9 and alpha-ketoglutaric acid, and colanic acid or a physiologically acceptable salt thereof.

[0016] In some embodiments, the weight ratio of the colanic acid or the physiologically acceptable salt thereof to the collagen promoter is 100:0.01-20000, preferably 100:0.01-2000.

[0017] In some embodiments, the concentration of the collagen promoter is 0.01-20000 pg / mL.

[0018] In some embodiments, the concentration of the colanic acid or the physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, for example, it can be 10-3000 pg / mL or 100-1000 pg / mL.

[0019] In some embodiments, the molecular weight of the colanic acid or the physiologically acceptable salt thereof is selected from 1-50 kDa and 1000-2000 kDa, preferably selected from 10-20 kDa and 20-50 kDa.

[0020] In some embodiments, the concentration of glutathione is 0.1-100 μg / mL, preferably 0.3-35 μg / mL; the concentration of fisetin is 1-50 μg / mL, preferably 1-6 μg / mL; the concentration of urolithin A is 1-50 μg / mL, preferably 2-15 μg / mL; the concentration of beta-nicotinamide mononucleotide is 100-5000 μg / mL, preferably 600-2500 μg / mL; the concentration of ergothioneine is 0.01-1 μg / mL, preferably 0.03-0.12 μg / mL; the concentration of salidroside is 0.1-10 μg / mL, preferably 0.3-3 μg / mL; the concentration of hydroxytyrosol is 1-200 μg / mL, preferably 7-200 μg / mL, more preferably 7-150 μg / mL; the concentration of taurine is 500-10000 μg / mL, preferably 1000-7000 μg / mL, more preferably 1000-5000 μg / mL; the concentration of nicotinamide is 10-5000 μg / mL, preferably 20-1000 μg / mL, more preferably 100-1000 μg / mL; the concentration of retinyl propionate is 1000-10000 μg / mL; the concentration of gamma-aminobutyric acid is 0.1-50 μg / mL, preferably 0.1-15 μg / mL, more preferably 5-15 μg / mL; the concentration of ceramide is 1-50 μg / mL, preferably 5-25 μg / mL; the concentration of N-acetylneuraminic acid is 1-50 μg / mL, preferably 2-10 μg / mL, more preferably 5-10 μg / mL; the concentration of acetyl tetrapeptide-2 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; the concentration of hexapeptide-9 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 μg / mL, preferably 10-1500 μg / mL.

[0021] In some embodiments, the composition is a pharmaceutical composition or a cosmetic composition.

[0022] In some embodiments, the composition is a single complex formulation or a combination of two separate formulations.

[0023] In some embodiments, the composition is formulated for topical, oral, intramuscular, subcutaneous, or intravenous administration. In some embodiments, the composition is formulated for topical administration.

[0024] In some embodiments, the composition further contains a cosmetically or pharmaceutically acceptable additive.

[0025] In some embodiments, the physiologically acceptable salt of colanic acid is sodium colanic acid. Advantages

[0026] The present disclosure provides a series of collagen-promoting synergistic agents of colanic acid or its salts, which can synergistically improve the collagen-promoting activity when compounded with colanic acid or its salts. DETAILED DESCRIPTION

[0027] The following description of the disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be interpreted as limiting the scope of the disclosure. It is obvious to those skilled in the art that various equivalent, changes and modifications can be made without departing from the scope of the disclosure, and it should be understood that these equivalent embodiments will be included herein. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0028] In the present disclosure, colanic acid (CA) or colanic acid salt can be prepared by any method as long as the desired molecular weight is obtained. Specifically, the molecular weight of colanic acid or its physiologically acceptable salt can be selected from 1-50 kDa and 1000-2000 kDa, such as 1 kDa, 2 kDa, 3 kDa, 4 kDa, 5 kDa, 6 kDa, 7 kDa, 8 kDa, 9 kDa, 10 kDa, 11 kDa, 12 kDa, 13 kDa, 14 kDa, 15 kDa, 16 kDa, 17 kDa, 18 kDa, 19 kDa, 20 kDa, 25 kDa, 30 kDa, 35 kDa, 40 kDa, 45 kDa, 50 kDa, 1000 kDa, 1100 kDa, 1200 kDa, 1300 kDa, 1400 kDa, 1500 kDa, 1600 kDa, 1700 kDa, 1800 kDa, 1900 kDa, 2000 kDa, etc. or any range formed by the above molecular weights. For example, the molecular weight of colanic acid or its physiologically acceptable salt can be in any of the following ranges: 1-10 kDa, 1-8 kDa, 1-6 kDa, 1-5 kDa, 1-4 kDa, 1-3 kDa, 1-2 kDa, 2-10 kDa, 2-8 kDa, 2-6 kDa, 2-4 kDa, 2-3 kDa, 3-6 kDa, 4-10 kDa, 4-8 kDa, 4-6 kDa, 5-10 kDa, 5-8 kDa, 6-10 kDa, 6-8 kDa, 10-20 kDa, 10-18 kDa, 10-15 kDa, 10-12 kDa, 1000-2000 kDa, etc.

[0029] For example, colanic acid or a physiologically acceptable salt thereof can be prepared by the method of CN115287314B. In addition, colanic acid or a physiologically acceptable salt thereof can also be purified by the method of CN114957509A. It will be understood by those skilled in the art that colanic acid or a colanic acid salt of different molecular weight ranges can be obtained by conventional preparation methods.

[0030] The term "physiologically acceptable salt" can be any salt derived from colanic acid. In the present disclosure, these salts are not limited to a specific kind as long as they can be used in cosmetic and pharmaceutical compositions. Specific examples thereof include alkali metal salts such as sodium, potassium, and lithium salts; alkaline earth metal salts such as calcium, magnesium, barium, and zinc salts; alkylamine salts such as ammonia, methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, propylamine, butylamine, tetrabutylamine, amylamine, and hexylamine; alkanolamine salts such as ethanolamine, diethanolamine, triethanolamine, propanolamine, dipropanolamine, isopropanolamine, and diisopropanolamine; salts of other organic amines such as piperazine and piperidine; salts of basic amino acids such as lysine, arginine, histidine, tryptophan, and the like. In the present disclosure, the physiologically acceptable salt of colanic acid can be sodium colanic acid.

[0031] The "collagen promoter" in the present disclosure refers to a substance that promotes the formation of collagen, and is classified into a collagen promoter having antioxidant activity and a collagen promoter not having antioxidant activity according to its antioxidant activity. The "collagen promoter" is also referred to as an "active compound" in the present disclosure. Specifically, the collagen promoter having antioxidant activity includes glutathione (GSH), Fisetin, Urolithin A, β-nicotinamide mononucleotide (NMN), Ergothioneine (EGT), Salidroside, and Hydroxytyrosol; and the collagen promoter not having antioxidant activity includes Taurine, Nicotinamide, Retinyl propionate, γ-aminobutyric acid (GABA), Ceramide, N-glycolylneuraminic acid, Acetyl tetrapeptide-2, Hexapeptide 9 (CAS: 1228371-11-6), and α-ketoglutaric acid or α-ketoglutarate. In the present disclosure, a physiologically acceptable salt thereof can also be used as the collagen promoter.

[0032] In the present disclosure, the concentration of the collagen promoter can be, for example, 0.01-20000 pg / mL. Specifically, the concentration of the collagen promoter can be 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 16000, 17000, 18000, 19000, or 20000 pg / mL, or any range of the above concentrations.

[0033] In the composition of the present disclosure, the concentration of carbenicillin or a physiologically acceptable salt thereof can be selected as needed, for example, can be 10-10000 pg / mL, preferably 100-10000 pg / mL, for example, can be 100-3000 pg / mL or 100-1000 pg / mL, for example, can be 10 mg, 50 mg, 100 pg / mL, 200 pg / mL, 300 pg / mL, 400 pg / mL, 500 pg / mL, 600 pg / mL, 700 pg / mL, 800 pg / mL, 900 pg / mL, 1000 pg / mL, 1500 pg / mL, 2000 pg / mL, 2500 pg / mL, 3000 pg / mL, 3500 pg / mL, 4000 pg / mL, 4500 pg / mL, 5000 pg / mL, 5500 pg / mL, 6000 pg / mL, 6500 pg / mL, 7000 pg / mL, 7500 pg / mL, 8000 pg / mL, 8500 pg / mL, 9000 pg / mL, 9500 pg / mL, or 10000 pg / mL, or any range of the above concentrations.

[0034] In the present disclosure, the weight ratio of the colanic acid or a physiologically acceptable salt thereof to the collagen promoter may, for example, be 100:0.01-20000. Specifically, the weight ratio of the colanic acid or a physiologically acceptable salt thereof to the collagen promoter may, for example, be 100:0.01, 100:0.02, 100:0.03, 100:0.04, 100:0.05, 100:0.06, 100:0.07, 100:0.08, 100:0.09, 100:0.1, 100:0.2, 100:0.3, 100:0.4, 100:0.5, 100:0.6, 100:0.7, 100:0.8, 100:0.9, 100:1, 100:2, 100:3, 100:4, 100:5, 100:6, 100:7, 100:8, 100:9, 100:10, 100:20, 100:30, 100:40, 100:50, 100:60, 100:70, 100:80, 100:90, 100:100, 100:200, 100:300, 100:400, 100:500, 100:600, 100:700, 100:800, 100:900, 100:1000, 100:2000, 100:3000, 100:4000, 100:5000, 100:6000, 100:7000, 100:8000, 100:9000, 100:10000, 100:11000, 100:12000, 100:13000, 100:14000, 100:15000, 100:16000, 100:17000, 100:18000, 100:19000, 100:20000, or the like or any range of the above weight ratios.

[0035] For better anti-aging effect, preferably, the concentration of glutathione is 0.1-100 μg / mL, preferably 0.3-35 μg / mL, for example 0.1, 0.3, 1, 3, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 μg / mL; the concentration of fisetin is 1-50 μg / mL, preferably 1-6 μg / mL, for example 1, 2, 5, 6, 10, 20, 30, 40, 50 or 60 μg / mL; the concentration of urolithin A is 1-50 μg / mL, preferably 2-15 μg / mL, for example 1, 2, 5, 10, 20, 30, 40 or 50 μg / mL; the concentration of β-nicotinamide mononucleotide is 100-5000 μg / mL, preferably 600-2500 μg / mL, for example 100, 500, 1000, 2000, 3000, 4000 or 5000 μg / mL; the concentration of ergothioneine is 0.01-1 μg / mL, preferably 0.03-0.12 μg / mL, for example 0.01, 0.03, 0.05, 0.1, 0.2, 0.3, 0.5, 0.7, 1 or 1.2 μg / mL; the concentration of salidroside is 0.1-10 μg / mL, preferably 0.3-3 μg / mL, for example 0.1, 0.3, 0.5, 1, 2, 3, 4, 5, 7 or 10 μg / mL; the concentration of hydroxytyrosol is 1-200 μg / mL, preferably 7-200 μg / mL, more preferably 7-150 μg / mL, for example 1, 5, 7, 10, 20, 30, 50, 100, 150, 170, 180 or 200 μg / mL; the concentration of taurine is 500-10000 μg / mL, preferably 1000-5000 μg / mL, for example 500, 1000, 1200, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 μg / mL; the concentration of nicotinamide is 10-5000 μg / mL, preferably 20-1000 μg / mL, for example 20, 50, 100, 200, 500, 1000, 2000, 3000, 4000 or 5000 μg / mL; the concentration of retinyl propionate is 1000-10000 μg / mL, for example 1000, 2000, 5000, 8000 or 10000 μg / mL; the concentration of gamma-aminobutyric acid is 0.1-50 μg / mL, preferably 0.1-15 μg / mL, for example 0.1, 0.5, 1, 3, 5, 7, 10, 20, 30, 40 or 50 pg / mL; the concentration of ceramide is 1-50 pg / mL, preferably 5-25 pg / mL, for example 1, 5, 10, 15, 20, 25, 30, 40 or 50 pg / mL; the concentration of N-acetylneuraminic acid is 1-50 pg / mL, preferably 2-10 pg / mL, for example 1, 2, 5, 10, 20, 30, 40 or 50 pg / mL; the concentration of acetyl tetrapeptide-2 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL, for example 1, 5, 10, 20, 30, 50, 80, 100, 110, 120, 150, 200, 300, 400 or 500 pg / mL; the concentration of hexapeptide-9 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL, for example 1, 5, 10, 50, 100, 200, 250, 300, 400 or 500 pg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 pg / mL, preferably 10-1500 pg / mL, for example 1, 10, 15, 20, 50, 100, 200, 500, 750, 1000, 1250, 1500, 1750 or 2000 pg / mL.

[0036] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and glutathione. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of glutathione is 0.1-100 pg / mL, preferably 0.3-35 pg / mL.

[0037] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and farnesol. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of farnesol is 1-50 pg / mL, preferably 1-6 pg / mL.

[0038] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and urolithin A. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of urolithin A is 1-50 pg / mL, preferably 2-15 pg / mL.

[0039] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and beta-nicotinamide mononucleotide. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of beta-nicotinamide mononucleotide is 100-5000 pg / mL, preferably 600-2500 pg / mL.

[0040] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and ergothioneine. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of ergothioneine is 0.01-1 pg / mL, preferably 0.03-0.12 pg / mL.

[0041] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and salidroside. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of salidroside is 0.1-10 pg / mL, preferably 0.3-3 pg / mL.

[0042] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and hydroxytyrosol. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of hydroxytyrosol is 1-200 pg / mL, preferably 7-200 pg / mL, more preferably 7-160 pg / mL.

[0043] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and taurine. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of taurine is 500-10000 pg / mL, preferably 1000-7000 pg / mL.

[0044] In some preferred embodiments, the composition or combination comprises curcumin or a physiologically acceptable salt thereof and nicotinamide. Preferably, the concentration of curcumin or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of nicotinamide is 10-5000 pg / mL, preferably 20-1000 pg / mL.

[0045] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and retinol propionate. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, more preferably 200-10000 pg / mL; and the concentration of retinol propionate is 1000-10000 pg / mL.

[0046] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and gamma-aminobutyric acid. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, more preferably 200-10000 pg / mL; and the concentration of gamma-aminobutyric acid is 0.1-50 pg / mL, preferably 0.1-15 pg / mL, more preferably 0.1-10 pg / mL.

[0047] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and ceramide. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of ceramide is 1-50 pg / mL, preferably 5-25 pg / mL.

[0048] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and N-acetylneuraminic acid. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of N-acetylneuraminic acid is 1-50 pg / mL, preferably 2-10 pg / mL.

[0049] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and acetyl tetrapeptide-2. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of acetyl tetrapeptide-2 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL.

[0050] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and hexapeptide-9. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of hexapeptide-9 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL.

[0051] In some preferred embodiments, the composition or combination comprises colanic acid or a physiologically acceptable salt thereof and alpha-ketoglutaric acid. Preferably, the concentration of colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL; and the concentration of alpha-ketoglutaric acid is 1-2000 pg / mL, preferably 10-1500 pg / mL.

[0052] The composition or skin anti-aging product of the present disclosure can be a pharmaceutical composition or a cosmetic composition. The dosage form of the composition can be specifically selected as needed. For example, the dosage form of the cosmetic composition can include emulsion, cream, lotion, serum, pack, gel, powder, lip balm, cosmetic base, foundation, wash, ointment, patch, beauty liquid, stain-removing foam, stain-removing cream, cleansing water, soap, or spray. The dosage form of the pharmaceutical composition can include tablet, capsule, emulsion, dispersion, suspension, solution, syrup, granule, transdermal patch, gel, powder, cream, ointment, suppository, or spray. The pharmaceutical composition can be formulated for topical, oral, intramuscular, subcutaneous, or intravenous administration.

[0053] The composition of the present disclosure can be a single complex preparation or a combination of two separate preparations. When it is a combination of two separate preparations, it can be administered simultaneously or sequentially.

[0054] In addition, the pharmaceutical composition or cosmetic composition of the present disclosure can contain, as needed, additives (also referred to as cosmetically or pharmaceutically acceptable additives) that are usually added to pharmaceutical compositions or cosmetic compositions, in addition to the essential active ingredients. Examples of the additives include oily ingredients, humectants, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, antibacterial agents, antioxidants, plant extracts, pH adjustors, alcohols, colorants, fragrances, blood circulation promoters, cooling agents, antiperspirants, and water, etc.

[0055] The term "subject" in the present disclosure refers to an organism to be subjected to skin anti-aging by the combination of the present disclosure. In the present disclosure, the organism is preferably a mammal, such as, but not limited to, a human, a non-human primate, a livestock (such as a sheep, a cow, a horse, a donkey, a pig), a pet (such as a dog, a cat), a laboratory test animal (such as a mouse, a rabbit, a rat, a guinea pig, a hamster), or a captured wild animal (such as a fox, a deer). The subject is preferably a primate. In certain embodiments, the subject is a mammal, preferably the subject is a human. In certain embodiments, the subject is an adult, a child, or an infant.

[0056] The term "administering" as used herein refers to the direct administration of a pharmaceutical composition to a subject by a physician or a health care provider. The specific administration modes include topical, oral, intramuscular, subcutaneous, or intravenous administration, etc.

[0057] In the present disclosure, the molecular weight of carbenoxolide or its physiologically acceptable salt is determined by a liquid chromatography method. The specific method is as follows: accurately weigh the sample and the standard, prepare the sample into a 2 mg / mL solution, filter into a 1.8 mL sample vial with a 0.22 μm needle filter after fully dissolving. Chromatographic column: PolySep-GFC-P (35*7.8 mm); PolySep-GFC-P 4000 (300*7.8 mm); PolySep-GFC-P 6000 (300*7.8 mm); mobile phase: 0.02 M NaCl solution; flow rate: 0.6 mL / min, column temperature: 40 °C; sample size: 20 μL; detector: differential detector 1260-RID.

[0058] Preparation method

[0059] In the following examples, sodium carbenoxolide is prepared by the following method.

[0060] 1. Solid-liquid separation

[0061] 1) Dilution: Pump the fermentation broth into a storage tank, dilute 3-20 times with a 10-60% calcium chloride solution (calcium chloride is used in an amount of 2% (w / v) of the fermentation broth) and purified water, and stir for 2-3 h until fully dissolved.

[0062] 2) Flocculation: After adjusting the pH to 9.0-12.0 by adding sodium carbonate solid, flocculate for 1-2 h, and then premix diatomite (diatomite is used in an amount of 1% (w / v) of the fermentation broth).

[0063] 3) Plate and frame filtration: According to the plate and frame filter press operation sop, install the filter cloth and compress the filter plate. Recycle the plate and frame filter press system with 0.5 M sodium hydroxide solution for 15 min, and then wash with purified water until the pH test paper is neutral. Start the feed pump to pump in the diatomite suspension (the pre-coating amount is 0.5 kg / m 2Precoat diatomite into the plate frame. After the precoat is finished, connect the inlet to the liquid storage tank to pump the flocculation liquid into the plate and frame filter for circulating filtration, control the working pressure <0.2 MPa. Connect the inlet to the filtrate collection tank for circulating filtration, and after the liquid at the outlet is clear (turbidity ≤30 NTU), start collecting the filtrate. After the end, top wash 1-2 times the dead volume of purified water.

[0064] 2. Activated carbon adsorption

[0065] 1) Adsorption: Add 0.5% of injection grade activated carbon based on the weight of the fermentation broth, adjust the pH to 4-6 with 0.1 M HC1, and stir for 1-2 h. After adsorption is complete, pre-mix diatomite (the amount of diatomite is 0.1-5% (w / v) of the fermentation broth).

[0066] 2) Plate and frame filtration: According to the operation SOP of the plate and frame filter press, install the filter cloth and compress the filter plate. Start the feed pump to pump the diatomite suspension (the precoat amount is 0.5 kg / m 2 ), and precoat diatomite into the plate frame. After the precoat is finished, connect the inlet to the liquid storage tank to pump the flocculation liquid into the plate and frame filter for circulating filtration, control the working pressure <0.2 MPa. Connect the inlet to the filtrate collection tank for circulating filtration, and after the liquid at the outlet is clear (turbidity ≤30 NTU), start collecting the filtrate. After the end, top wash 1-2 times the dead volume of purified water.

[0067] 3. Precision filtration

[0068] Adjust the pH of the filtrate to 7.0 ± 0.2 with sodium carbonate solid, then perform precision filtration of the filtrate using a 20-inch ultra-high precision PP filter cartridge in series with a PES filter cartridge. Slowly increase the feed flow rate so that the filtration pressure is ≤0.1 MPa, and if the pressure is too high, backflush the empty liquid and replace the filter to perform filtration again. When there is continuous liquid flow from the exhaust port, close the exhaust valve to collect the filtered liquid.

[0069] 4. Ceramic membrane concentration

[0070] 1) Cleaning: Connect the ceramic membrane ultrafiltration system, and sequentially use 2% citric acid, purified water, and 0.5 M NaOH solution to circulate and rinse the ceramic membrane system for 15-30 min, then rinse with purified water until the pH test paper at the permeate end is neutral.

[0071] 2) Concentration: Pump the filtrate into the ceramic membrane circulation tank, connect the return end outlet to the circulation tank, then open the tank low valve. Open the return valve and the one end permeation valve completely. Start the system, control the frequency at 10-80 Hz, thus controlling the feed flow rate at 100-1500 L / h. Control the inlet pressure <0.1 MPa by setting the alarm pressure at 0.1 MPa (if the pressure is too high, reduce the feed flow rate). Stop the concentration when the fermentation liquid volume is reduced to 1 / 2 or the inlet pressure is >0.1 MPa. Close the permeation end valve, use 1-5 times the system dead volume of purified water to rinse the ceramic membrane system for 5-30 min, then empty the return end liquid again. Repeat the above rinsing and collecting operations twice. Combine the concentrated liquid and the rinsing liquid.

[0072] 5. Alcohol precipitation

[0073] 1) Sodium salt treatment: Add 10-40% sodium chloride solution (final concentration of sodium chloride 1-5%) to the concentrated liquid and the rinsing liquid, and stir well. Then use a 20-inch ultra-high precision PP filter core in series with a PES filter core for fine filtration. Slowly increase the feed flow rate so that the filtration pressure is <0.1 MPa. If the pressure is too high, backflush the liquid, replace the filter, and filter again. Collect the filtrate.

[0074] 2) Ethanol precipitation: Wash the alcohol precipitation tank with citric acid, purified water, and NaOH solution in sequence for 15-30 min, then rinse with purified water until the pH test paper is neutral. Pump the filtrate from the above step into the alcohol precipitation tank, start stirring, and slowly add 2 times the volume of 95% ethanol. After stirring until a large amount of white flocculent precipitate is produced, stop stirring. Let it stand for 2-4 h, remove the supernatant, and collect the precipitate.

[0075] 6. Washing and dehydration

[0076] 1) Washing: Add 1-10 times the volume of 70% ethanol (containing 1% sodium chloride) to the CA sugar precipitate, stir for 20 min, let it stand for 1-8 h, remove the supernatant, and collect the precipitate. Then repeat the washing 2 more times and collect the precipitate.

[0077] 2) Dehydration: Add 1-10 times the volume of 95% ethanol to the precipitate, stir for 2 h, let it stand for 1-2 h, and remove the supernatant. Repeat the above dehydration operation once more and collect the precipitate. After vacuum filtration of the precipitate to reduce the residual liquid, add 1-10 times the volume of 95% ethanol for dehydration. Collect the precipitate, remove the liquid by filtration again, and weigh the wet sample.

[0078] 7. Drying

[0079] Put the wet sample into the vacuum drying oven (the sample thickness is not more than 2 cm), set the drying temperature to 45℃, and dry for 15h. Turn the material every 4h.

[0080] 8. Pulverization and sieving

[0081] After the secondary drying is completed, the sample is pulverized again using a pulverizer, sieved through a 100-mesh sieve, and packed into aluminum foil bags.

[0082] 9. Enzymatic preparation of sodium colanic acid with different molecular weights

[0083] The obtained colanic acid product is mixed with different concentrations (1000 U / L, 2000 U / L, 3000 U / L, 5000 U / L) of colanic acid-degrading enzyme (Bailin Biological Production, see SEQ ID No. 2 in CN116334039B) at 37℃ for 10-12h, the sample is collected and heated to inactivate the enzyme, then purified by DEAE ion column, and the small amount of non-uniform molecular weight part and impurities are removed to obtain sodium colanic acid products with different molecular weights, and the molecular weight of sodium colanic acid is in the range of 10-20kDa, 20-50kDa or 1000-2000kDa. Subsequently, the final colanic acid product can be obtained by freeze-drying or spray-drying.

[0084] Specifically, the preparation method of sodium colanic acid with a molecular weight of 10-20kDa is as follows: high molecular weight sodium colanic acid is obtained by bacterial fermentation, then 0.05-5U / mL of colanic acid-degrading enzyme is added for enzymatic hydrolysis at 37℃ for 6-24h, and finally the obtained low molecular weight sodium colanic acid is purified by DEAE ion column to obtain sodium colanic acid with a molecular weight in the range of 10-20kDa.

[0085] Embodiment

[0086] In order to enable personnel in the technical field to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present disclosure, not all.

[0087] Embodiment 1

[0088] The ColⅠ kit provided by Huawamei Biological, item number: CSB-E08082h (abbreviation: ColⅠ kit) is used to determine the I-type collagen regeneration effect of the collagen promoter and sodium colanic acid complex.

[0089] 1. Experimental principle:

[0090] The purified antibody is used to coat the microplate to make a solid phase carrier. The sample to be tested or the standard sample, biotin-labeled anti-Collagen I antibody, and HRP-labeled avidin are sequentially added to the microplate coated with the anti-Collagen I antibody. After thorough washing, the substrate TMB is used for color development. TMB is converted into blue under the catalysis of peroxidase and into final yellow under the action of acid. The color depth is positively correlated with the amount of Collagen I in the sample. The absorbance (OD value) is measured at 450 nm wavelength by an enzyme-labeled instrument, and the sample concentration is calculated.

[0091] 2. Composition of Collagen I kit

[0092] Table 1

[0093] 3. Reagent preparation:

[0094] (1) Standard sample:

[0095] a) Take out a bottle of standard sample, centrifuge for 30 seconds, then re-dissolve with 1 mL of sample diluent, and mix well.

[0096] b) Prepare serial dilutions. Take 7 1.5 mL centrifuge tubes and add 250 μL of sample diluent to each. Re-dissolve the standard sample of 100 ng / mL to prepare serial concentration standard samples with a 2-fold decrease.

[0097] Table 2

[0098] (2) Washing solution: dilute the concentrated washing solution with deionized water at a ratio of 1:25 to obtain 1x washing solution.

[0099] (3) Biotin-labeled antibody working solution: dilute the biotin-labeled antibody at a ratio of 1:100.

[0100] (4) HRP-labeled avidin working solution: dilute the HRP-labeled avidin at a ratio of 1:100.

[0101] 4. Operation steps:

[0102] (1) Sample preparation: take the corresponding mass of sodium lactate and collagen promoter, and use complete culture medium (4.5 g / L D-Glucose, 4.5 g / L L-Glutamine, 110 mg / L Sodium Pyruvate, 10% serum, 1% penicillin, 1% streptomycin) as the solvent to prepare the compound sample with corresponding concentration.

[0103] (2) Cell culture: Take 200 μL of the prepared sample and add it to a 96-well plate containing 8000 HDF cells per well (Guangdong Boxi Biotechnology Co., Ltd., 3*10^6 / 1.5 mL), and incubate at 37°C for 24 hours.

[0104] (3) Reagent equilibration: Prepare the reagents as described above and equilibrate all reagents to room temperature (18-25°C) for at least 30 minutes.

[0105] (4) Sample addition: Take 10 μL of the supernatant obtained in step (2) and dilute it 20-fold with 190 μL of sample diluent to obtain the test sample. Prepare a 96-well enzyme-labeled plate by adding 100 μL of the standard or test sample to each well, mix gently, cover the plate with a seal, and incubate at 37°C for 2 hours.

[0106] (5) Discard the liquid in the wells, do not wash the plate.

[0107] (6) Add 100 μL of biotin-labeled antibody working solution to each well, cover the plate with a new seal, and incubate at 37°C for 1 hour.

[0108] (7) Discard the liquid in the wells, spin dry, and wash the plate 3 times with 200 μL / well of 1x wash solution, soaking for 2 minutes each time.

[0109] (8) Add 100 μL of horseradish peroxidase-labeled avidin working solution to each well and incubate at 37°C for 1 hour.

[0110] (9) Wash the plate 5 times as described above.

[0111] (10) Add 90 μL of TMB substrate solution to each well and develop the color at 37°C for 15 minutes in the dark.

[0112] (11) Add 50 μL of stop solution to each well, and immediately after the reaction is stopped, read the optical density (OD value) at 450 nm.

[0113] 5. Result calculation:

[0114] Use professional software ("Curve Expert") to plot the standard curve.

[0115] (1) Standard curve plotting:

[0116] With OD450 as the horizontal axis, the standard concentration (ng / mL) as the vertical axis, using Curve Expert software with Maximum Degree of Polynomial to Consider 4 to draw Rational Function, Exp. Association (3), Quadratic Fit, MMF. Model, Logistic Model, Heat Capacity Model, Linear Fit, User-Defined Model, Harris Model, Exponential Association curve respectively.

[0117] (2) Data linearization:

[0118] Select the curve Rational Function with the highest r value (0.99999393) in the above curves as the standard curve of this experiment. The standard curve is as follows: y = (a + bx) / (1 + cx + dx2)

[0119] Wherein,

[0120] x is the OD450 value, y is the standard concentration (ng / mL);

[0121] a = -6.17786729260E-001;

[0122] b = 1.84152320609E+001;

[0123] c = -3.38669342304E-001;

[0124] d = 3.94882425823E-002.

[0125] (3) Calculation of sample concentration:

[0126] The sample is diluted 20 times for detection, and the final read concentration value needs to be multiplied by the dilution factor 20, that is: concentration (ng / mL) = y x 20.

[0127] Example 2

[0128] The collagen promoters with and without antioxidant activity were respectively compounded with sodium colaurate at corresponding concentrations, and the procollagen regeneration effects were tested by the method of Example 1. The collagen promoters with antioxidant activity included glutathione (Alladin, G105426), fisetin (Alladin, F156691-1g), urolithin A (Alladin, U287598-1g), beta-nicotinamide mononucleotide (NMN, Alladin, N131850), ergothioneine (Zhongke Xinyang, 01R23041803), rhodioloside (Alladin, S101157-100mg), and hydroxytyrosol (Alladin, H306005-1g); the collagen promoters without antioxidant activity included taurine (Hunan Xinglufang Pharmaceutical Co., Ltd., 23062402), nicotinamide (Alladin, N108087-100g), retinol propionate (Foshan Xian'an Chemical Trade Co., Ltd., 2.5BHT), gamma-aminobutyric acid (Alladin, A293557-5g), ceramide (Alladin, C130555-5mg), N-acetylneuraminic acid (Alladin, G115995-25mg), acetyl tetrapeptide-2 (Nanjing Leion Biological Technology Co., Ltd., P20230719-1), hexapeptide-9 (Nanjing Leion Biological Technology Co., Ltd., P20240221-0), and alpha-ketoglutaric acid (Alladin, K105571-25g).

[0129] In the above experiments, the concentrations shown are the concentrations of the collagen promoters with and without antioxidant activity; the concentration of sodium colaurate used in each group is 100.0 μg / mL, and the molecular weight is 10-20 kDa. The BC group (blank control group) indicates no addition of composition or CA.

[0130] Table 3

[0131] Table 4

[0132] In order to compare the procollagen effects of each collagen promoter alone, CA alone, and the combination of the two, the type I collagen concentration data in Tables 3 and 4 were subtracted from the type I collagen concentration of the blank control group (BC) to obtain the results in Table 5. The combination of sodium colaurate at concentrations of 0.2 mg / mL, 1 mg / mL, 5 mg / mL, and 10 mg / mL with each collagen promoter was tested in the same way, and the results are shown in Tables 6-9, respectively.

[0133] Table 5 (CA concentration: 0.1 mg / mL)

[0134] Table 6 (CA concentration: 0.2 mg / mL)

[0135] Table 7 (CA concentration: 1 mg / mL)

[0136] Table 8 (CA concentration: 5 mg / mL)

[0137] Table 9 (CA concentration: 10 mg / mL)

[0138] Example 3

[0139] 1. Human dermal fibroblasts (HDF, passage number within 10 passages) were cultured using DMEM high glucose medium (GIBCO) + 10% FBS (fetal bovine serum GIBCO) + 1% P / S (penicillin-streptomycin GIBCO) and subcultured at least once before use.

[0140] 2. The cultured HDF cells were taken out, the supernatant was carefully discarded, the cells were washed once with D-PBS, 1 mL (10 cm culture dish) of trypsin was added, and the cells were digested in a 37°C CO2 incubator for 2 min.

[0141] 3. Under a microscope, when most of the cells were rounded and in a suspended state, 3 mL of serum-containing DMEM medium was added to terminate the digestion, and the cells were collected into a centrifuge tube and centrifuged at 1000 r / min for 3 min.

[0142] 4. After centrifugation, the supernatant was discarded, 4 mL of serum-containing DMEM complete medium was added to the centrifuge tube, the cells were mixed well with a 1 mL pipette, and the cells were counted using a cell counter.

[0143] 5. The cells were diluted with DMEM complete medium to the inoculation density, inoculated into a 6-well plate, 3 x 10 5 cells were plated per well, and 2 mL of cell suspension was added to each well.

[0144] 6. After overnight culture, the cells were attached, the samples were added according to the experimental design, and the cell culture plate was irradiated with UVA at 10 J / cm 2 to model (covered with a culture plate cover), treated with UVA once every 24 h, and continuously treated with UVA for 3 days to model.

[0145] 7. After 4 days of sample addition, the supernatant was discarded, the cells were washed once with D-PBS, and the RNA in each group of cells was extracted using a high-purity RNA rapid extraction kit (Maike, MKG-865):

[0146] (1) After thoroughly aspirating the culture medium, wash the cells with PBS once in each well, and then add 600 μL of Lysis Buffer directly to each well and repeatedly pipette to lyse the cells.

[0147] (2) Add the lysis buffer to the DNA removal column and centrifuge at 13000 rpm for 1 min. Take the filtrate into a 1.5 mL centrifuge tube and add 0.5 times the volume of anhydrous ethanol to the filtrate.

[0148] (3) Add the mixture to the adsorption column RA, centrifuge at 13000 rpm for 30 seconds, and discard the filtrate.

[0149] (4) Add 700 μL of protein removal solution RW1 to the adsorption column, let it stand at room temperature for 30 seconds, centrifuge at 13000 rpm for 30 seconds, and discard the filtrate.

[0150] (5) Add 500 μL of washing solution RW to the adsorption column, centrifuge at 13000 rpm for 30 seconds and discard the filtrate. Repeat once.

[0151] (6) Place the adsorption column RA back into the empty collection tube and centrifuge at 13000 rpm for 2 min.

[0152] (7) Place the adsorption column RA into a new 1.5 mL EP tube, add 30 μL RNase free water, incubate at room temperature for 1 min, and centrifuge at 13000 rpm for 1 min to obtain the RNA solution.

[0153] 8. Use a nanodrop instrument to detect the purity and concentration of RNA.

[0154] 9. Reverse transcription: using HiSlid TM The cDNA Synthesis Kit for qPCR (with dsDNase) (MKG840) was used to reverse transcribe RNA. 500 ng of RNA was added to each sample for reverse transcription. After mixing according to the table below, the sample was incubated at 37°C for 2 min; then at 55°C for 15 min; after the reaction was complete, the sample was incubated at 85°C for 5 min to terminate the reaction. The obtained cDNA was then immediately placed on ice for subsequent experiments.

[0155] 10. qPCR detection: Use "2×" qPCR technology from Shenzhen Maikes Biotechnology Co., Ltd. qPCR mix(with Lowrox)” (MKG802-10) for qPCR detection. Among them, GAPDH-F: AATTC CATGGCACCGTCAAG (SEQ ID NO: 1); GAPDH-R: ATCGCCCCACTTGATTTTGG (SEQ ID NO: 2); SOD1-F: AAAGATGGTGTGGCCGATGT (SEQ ID NO: 3); SOD1-R: CAAGCCAAACGACTTCCAGC (SEQ ID NO: 4); GPX1-F: AGTCGGTGTATGCCTTCTCG (SEQ ID NO: 5); GPX1-R: CAGCTCGTTCATCTGGGTGT (SEQ ID NO: 6); ELN-F: GCAGGAGTTAAGCCCAAGG (SEQ ID NO: 7); ELN-R: TGTAGGGCAGTCCATAGCCA (SEQ ID NO: 8).

[0156] (1) Preparation of reaction system:

[0157] The reaction system was prepared using a 96-well PCR plate, and the specific reaction system is as follows:

[0158] After preparation, shake and mix, and cover with a sealing film.

[0159] (2) Reaction program setting:

[0160] 11. qPCR detection result analysis

[0161] The relative expression amount of each target gene was calculated according to the 2-ΔΔCt method and plotted.

[0162] (1) Calculate ΔCt value: ΔCt = Ct (target gene) - Ct (internal reference gene).

[0163] (2) Calculate ΔΔCt value: ΔΔCt = ΔCt (experimental group) - ΔCt (control group).

[0164] (3) Calculate 2-ΔΔCt value: 2-ΔΔCt = 2^(-ΔΔCt).

[0165] Table 10 (CA concentration: 3 mg / mL)

[0166] Table 11 (CA concentration: 3 mg / mL)

[0167] Table 12 (CA concentration: 3 mg / mL)

[0168] In the results of Tables 5-9, it can be seen that a series of active compounds can significantly promote the production of collagen when compounded with sodium colforsate, wherein [A+B] is less than [C] indicates that sodium colforsate has a synergistic effect with the active compound, which has the effect of increasing CA to promote collagen production.

[0169] In the results of Tables 10-11, it can be seen that a series of active compounds have the effects of promoting SOD1 and GPX1 and can significantly promote the transcription of the corresponding genes when compounded with sodium colforsate, wherein [A+B] is less than [C] indicates that sodium colforsate has a synergistic effect with the active compound.

[0170] In the results of Table 12, it can be seen that a series of active compounds have the effect of promoting elastin (ELN) and can significantly promote the transcription of the corresponding genes when compounded with sodium colforsate, wherein [A+B] is less than [C] indicates that sodium colforsate has a synergistic effect with the active compound.

[0171] INCORPORATED BY REFERENCE

[0172] The entire contents of each patent and scientific document referred to herein is incorporated by reference for all purposes.

[0173] EQUIVALENCIES

[0174] The present disclosure can be embodied in other specific forms without departing from the spirit or essential characteristics thereof. Accordingly, the foregoing embodiments are to be considered in all respects as illustrative only; not as restrictive. The scope of the disclosure is, therefore, indicated by the appended claims, rather than by the foregoing description, and all changes that come within the meaning and range of equivalents are intended to be embraced therein.

Claims

1. Use of a collagen stimulator for the preparation of a potentiator of the anti-aging function of the skin as a triclosan or a physiologically acceptable salt thereof, characterized in that, The collagen promoter is selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinyl propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9, and alpha-ketoglutaric acid.

2. Use of a composition comprising a collagen booster and a carnosic acid or a physiologically acceptable salt thereof in the manufacture of a product for the anti-aging of the skin, characterized in that, The collagen promoter is selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinyl propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9, and alpha-ketoglutaric acid.

3. Use according to claim 1 or 2, wherein, The concentration of the collagen promoter is 0.01-20000 pg / mL; and / or The concentration of the colanic acid or the physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, more preferably 10-3000 pg / mL or 100-1000 pg / mL; and / or The molecular weight of the colanic acid or the physiologically acceptable salt thereof is selected from 1-50 kDa and 1000-2000 kDa, preferably from 10-20 kDa and 20-50 kDa.

4. The use according to any one of claims 1 to 3, wherein, The concentration of glutathione is 0.1-100 pg / mL, preferably 0.3-35 pg / mL; The concentration of fisetin is 1-50 pg / mL, preferably 1-6 pg / mL; The concentration of urolithin A is 1-50 pg / mL, preferably 2-15 pg / mL; The concentration of beta-nicotinamide mononucleotide is 100-5000 pg / mL, preferably 600-2500 pg / mL; The concentration of ergothioneine is 0.01-1 pg / mL, preferably 0.03-0.12 pg / mL; The concentration of rhodioloside is 0.1-10 pg / mL, preferably 0.3-3 pg / mL; The concentration of hydroxytyrosol is 1-200 pg / mL, preferably 7-200 pg / mL, more preferably 7-150 pg / mL; The concentration of taurine is 500-10000 pg / mL, preferably 1000-7000 pg / mL, more preferably 1000-5000 pg / mL; The concentration of nicotinamide is 10-5000 pg / mL, preferably 20-1000 pg / mL, more preferably 100-1000 pg / mL; The concentration of retinyl propionate is 1000-10000 pg / mL; The concentration of gamma-aminobutyric acid is 0.1-50 pg / mL, preferably 0.1-15 pg / mL, more preferably 5-15 pg / mL; The concentration of ceramide is 1-50 pg / mL, preferably 5-25 pg / mL; The concentration of N-acetylneuraminic acid is 1-50 pg / mL, preferably 2-10 pg / mL, more preferably 5-10 pg / mL; The concentration of acetyl tetrapeptide-2 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL; The concentration of hexapeptide-9 is 1-500 pg / mL, preferably 5-200 pg / mL, more preferably 5-100 pg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 pg / mL, preferably 10-1500 pg / mL.

5. The use according to any one of claims 1 to 4, wherein, The skin anti-aging comprises one or more of skin anti-wrinkling, skin anti-aging, increasing the collagen content in the skin, preferably the content of type I and / or type III collagen.

6. The use according to any one of claims 1 to 5, wherein, The collagen promoter, the colanic acid or a physiologically acceptable salt thereof, or a composition comprising colanic acid or a physiologically acceptable salt thereof is formulated for topical, oral, intramuscular, subcutaneous or intravenous administration.

7. A composition characterized in that, The composition comprises a collagen promoter selected from one or more of glutathione, fisetin, urolithin A, beta-nicotinamide mononucleotide, ergothioneine, rhodioloside, hydroxytyrosol, taurine, nicotinamide, retinol propionate, gamma-aminobutyric acid, ceramide, N-acetylneuraminic acid, acetyl tetrapeptide-2, hexapeptide-9 and alpha-ketoglutaric acid, and colanic acid or a physiologically acceptable salt thereof.

8. The composition of claim 7, wherein, The weight ratio of the colanic acid or a physiologically acceptable salt thereof to the collagen promoter is 100:0.01-20000.

9. The composition according to claim 7 or 8, wherein, The concentration of the collagen promoter is 0.01-20000 pg / mL; and / or The concentration of the colanic acid or a physiologically acceptable salt thereof is 10-10000 pg / mL, preferably 100-10000 pg / mL, more preferably 10-3000 pg / mL or 100-1000 pg / mL; and / or The molecular weight of the colanic acid or a physiologically acceptable salt thereof is selected from 1-50 kDa and 1000-2000 kDa, preferably from 10-20 kDa and 20-50 kDa.

10. The composition according to any one of claims 7-9, wherein, The concentration of glutathione is 0.1-100 pg / mL, preferably 0.3-35 pg / mL; The concentration of fisetin is 1-50 pg / mL, preferably 1-6 pg / mL; The concentration of urolithin A is 1-50 pg / mL, preferably 2-15 pg / mL; The concentration of beta-nicotinamide mononucleotide is 100-5000 pg / mL, preferably 600-2500 pg / mL; The concentration of ergothioneine is 0.01-1 pg / mL, preferably 0.03-0.12 pg / mL; The concentration of rhodioloside is 0.1-10 pg / mL, preferably 0.3-3 pg / mL; The concentration of hydroxytyrosol is 1-200 pg / mL, preferably 7-200 pg / mL, more preferably 7-150 pg / mL; The concentration of taurine is 500-10000 pg / mL, preferably 1000-7000 pg / mL, more preferably 1000-5000 pg / mL; The concentration of nicotinamide is 10-5000 pg / mL, preferably 20-1000 pg / mL, more preferably 100-1000 pg / mL; The concentration of retinol propionate is 1000-10000 pg / mL; The concentration of gamma-aminobutyric acid is 0.1-50 μg / mL, preferably 0.1-15 μg / mL, more preferably 5-15 μg / mL; The concentration of ceramide is 1-50 μg / mL, preferably 5-25 μg / mL; The concentration of N-acetylneuraminic acid is 1-50 μg / mL, preferably 2-10 μg / mL, preferably 5-10 μg / mL; The concentration of acetyl tetrapeptide-2 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; The concentration of hexapeptide-9 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 μg / mL, preferably 10-1500 μg / mL. The concentration of gamma-aminobutyric acid is 0.1-50 μg / mL, preferably 0.1-15 μg / mL, more preferably 5-15 μg / mL; The concentration of ceramide is 1-50 μg / mL, preferably 5-25 μg / mL; The concentration of N-acetylneuraminic acid is 1-50 μg / mL, preferably 2-10 μg / mL, preferably 5-10 μg / mL; The concentration of acetyl tetrapeptide-2 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; The concentration of hexapeptide-9 is 1-500 μg / mL, preferably 5-200 μg / mL, more preferably 5-100 μg / mL; and / or the concentration of alpha-ketoglutaric acid is 1-2000 μg / mL, preferably 10-1500 μg / mL.

Images