Immune cells expressing an inducible therapeutic agent and uses thereof
Genetically modified immune cells with nucleic acid constructs enhance therapeutic efficacy by optimizing expression in pathologic environments, addressing the limitations of CAR T-cell therapy in solid tumors and other pathologies.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-15
- Publication Date
- 2026-04-02
AI Technical Summary
Existing adoptive cell therapies, such as CAR T-cell therapy, face challenges in effectively targeting solid tumors and other pathologies due to the suppressive tumor microenvironment and immune cell exhaustion, leading to reduced therapeutic efficacy and potential side effects.
Development of immune cells genetically modified with nucleic acid constructs containing expression regulatory elements that enhance therapeutic agent expression in response to pathologic environments, utilizing signal-responsive transcription factors and cell-type specific motifs to optimize immune cell function.
Enhances the therapeutic potential of immune cells by improving their ability to infiltrate and function within tumor microenvironments and modulate immune responses without causing unwanted side effects, thereby improving treatment outcomes for cancers and other pathologies.
Smart Images

Figure IMGF000057_0001 
Figure IMGF000086_0001 
Figure IMGF000087_0001
Abstract
Description
[0001] IMMUNE CELLS EXPRESSING AN INDUCIBLE THERAPEUTIC AGENT AND USES THEREOF
[0002] RELATED APPLICATIONS
[0003] This application claims the benefit of priority of IL Patent Application No. 315881 filed on September 24, 2024, IL Patent Application No. 316631 filed on October 28, 2024, and IL Patent Application No, 319662 filed on March 17, 2025, the contents of which are incorporated herein by reference in their entirety. iNCE LISTING STATEMENT
[0004] The XML file, entitled 104685. xml, created on 14 September, 2025, comprising 2,289,664 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
[0005] FIELD AND BACKGROUND OF THE INVENTION
[0006] The present invention, in some embodiments thereof, relates to immune cells expressing an inducible therapeutic agent and uses thereof.
[0007] Adoptive cell therapy (ACT) has been suggested for the treatment of various diseases, such as cancer, autoimmune disorders, and neurological diseases. Chimeric antigen receptor (CAR) T- cell therapy, for example, has shown significant success in treating hematological cancers, such as B-cell malignancies, by engineering T cells to specifically recognize and attack tumor antigens.
[0008] Despite the promising potential of ACT, several challenges limit its widespread application across different pathologies. In the case of cancer, especially solid tumors, the complex environment within the tumor can hinder the effectiveness of treatments. This environment, known as the tumor microenvironment, often suppresses immune responses, preventing immune cells from infiltrating the tumor or functioning optimally. Additionally, disease-related factors such as the loss of specific target molecules and the exhaustion of immune cells can reduce the long-term success of therapies like CAR T cells. Similar barriers exist in the treatment of other pathologies, where the immune system’s activity needs to be carefully modulated without causing unwanted side effects. In autoimmune diseases, for example, overactive immune cells must be controlled without leading to widespread immune suppression. In neurological disorders, the intricate interactions between the immune system and the nervous system create additional complexities. Addressing these obstacles through improved cell therapies, combination treatments, and a deeper understanding of pathologic environments could significantly enhance the therapeutic potential of ACT.
[0009] Additional background art includes:
[0010] Tousley AM et al. Nature. 2023 615(7952): 507-516, doi: 10.1038 / s41586-023-05778-2;
[0011] Roybal KT, et al. Cell. 2016 Oct 6;167(2):419-432.el6, doi: 10.1016 / j.cell.2016.09.011.
[0012] Axel Hyrenius-Wittsten et al. Sci. Transl. Med. 13,eabd8836 (2021), doi: 10.1126 / scitranslmed.abd8836;
[0013] Joseph H. Choe et al. Sci. Transl. ed.l3,eabe7378 (2021), doi: 10.1126 / scitranslmed.abe7378;
[0014] Ramirez-Chacon A, et al. Front Immunol. 2022 Sep 12;13:932559. doi: 10.3389 / fimmu.2022.932559;
[0015] Smole et al. Cancer Cell. 2022 December 12; 40(12): 1470-1487.e7. doi: 10.1016 / j.ccell.2022.11.006;
[0016] Zhang et al. Mol Ther. 2011 Apr; 19(4): 751-9. doi: 10.1038 / mt.2010.313;
[0017] Brempelis et al., Journal for ImmunoTherapy of Cancer 2020; 8:e001356. doi: 10.1136 / jitc-2020-001356,
[0018] Chinn et al. J. Immunother Cancer 2022, 10:e003770. doi: 10.1136 / jitc-2021-003770;
[0019] Fowler et al., Cancers (Basel). 2021 Dec; 13(23): 6000;
[0020] Colucci-D'Amato L et al., Int J Mol Sci. 2020, 21(20): 7777. doi: 10.3390 / ijms21207777;
[0021] Zhang, L et al., Journal of hematology & oncology 2020, 13: 1-5. doi: 10.1186 / sl3045- 020-00983-2;
[0022] Sharabi, O. et al., Scientific Reports 2022, 12(1): 7169. doi: 10.1038 / s41598-022-11021- 1; US Patent Application Publication Nos. 20200155597, 20200268802, 20210032661, US2018186855 and US2020155597;
[0023] US Patent Nos. US9670281 and US 10525082;
[0024] Chinese Patent Application Publication Nos: CN112004823 and CN118685362;
[0025] EP Patent Application Publication No: EP3680338; and
[0026] International Patent Application Publication Nos. W02020160217, WO2021244654, W02018200496, WO2017075537, W02020095044, WO2022204326 and WO 2020095044.
[0027] SUMMARY OF THE INVENTION
[0028] According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct comprising at least one expression regulatory element comprising an enhancer operably linked to a heterologous nucleic acid sequence encoding a therapeutic agent, wherein the expression regulatory element is of a gene which expression is increased in an immune cell subjected to a pathologic environment relative to a non-pathologic environment.
[0029] According to some embodiments of the invention, the at least one expression regulatory element comprises at least one signal-responsive transcription factor binding motif and at least one cell type specific transcription factor binding motif.
[0030] According to some embodiments of the invention, the expression regulatory element binds a transcription factor selected from the group consisting of STAT, NFkB, AP-1, NFAT, IRF, NFkB, MAF, NFE, HIF-1 alpha, HIF-2alpha, SMAD, ZEB, BATE and PU.l.
[0031] According to some embodiments of the invention, the expression regulatory element is of a gene which expression is increased in a tumor associated macrophage (TAM) relative to a macrophage not in a tumor environment.
[0032] According to some embodiments of the invention, the gene is selected from the group consisting of Btgl, C9, Ccl4, Cd2ap, Cldnl, Cldnl6, Csflr, Cx3crl, Cxcll l, Cxcl2, Dcstamp, Dock4, Dusp2, Dusp4, Fcho2, Fgfr2, Filipll, Fmnl2, Hdac2, Hilpda, Hmgal, Husl, Igfl, Illa, I17r, Itgax, Itgb5, Itgb7, Lhfpl2, Lrpl, Mepe, Metrnl, Mucl3, Ndrgl, Nfatc2, Nr4a3, Nrpl, Pdgfrb, Pdpn, Pfkp, Pgsl, Ptgs2os2, Rab31, Rap2b, Rel, Sbf2, Slamf7, Slc2al, Slc30a4, Socs3, Sox5, Spef2, Tefm, Tg, Tgfbi, Tgfbrl, Trem2, Tremll and Zscan2.
[0033] According to some embodiments of the invention, the expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 104-970 and 1017.
[0034] According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 104-970 and 1017.
[0035] According to some embodiments of the invention, the expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1108- 1973, 970 and 1017.
[0036] According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1108-1973, 970 and 1017.
[0037] According to some embodiments of the invention, the expression regulatory element is of a gene which expression is increased following activation and / or exhaustion of a T cell.
[0038] According to some embodiments of the invention, the expression regulatory element is of a gene downstream of IL-2 signaling. According to some embodiments of the invention, the gene is selected from the group consisting of IL2RA, LT A and SOCS1.
[0039] According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid selected from the group consisting of SEQ ID NOs: 60-63, ttcaaagaa, tccagtgaa, ttcgtggag, ttcagggaa, ttcccagag, ttcccagaa and tgccaagaa.
[0040] According to some embodiments of the invention, the gene is selected from the group consisting of HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB1, GZMB, PRF1, CD244, IFNG, CD83, SLAMF6, XCL1, CRTAM, EBI3, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB 1, PSMA1, TANK, SUB 1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3 and PMF1.
[0041] According to some embodiments of the invention, the gene is selected from the group consisting of HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB1, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB1, PSMA1, TANK, SUB 1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3 and PMF1.
[0042] According to some embodiments of the invention, the expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1054- 1067.
[0043] According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1054-1067.
[0044] According to some embodiments of the invention, the expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1098- 1104.
[0045] According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1098-1104.
[0046] According to some embodiments of the invention, the expression regulatory element is of a gene downstream of TNFa signaling.
[0047] According to some embodiments of the invention, the gene is selected from the group consisting of TNFAIP3, Nfkbia, Nfkb2, Ldha, Tnfrsflb, Irfl, Ltb and Junb.
[0048] According to some embodiments of the invention, the expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1022- 1052. According to some embodiments of the invention, the expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1022-1052.
[0049] According to some embodiments of the invention, the expression regulatory element comprises a promoter operably linked to the nucleic acid sequence encoding the therapeutic agent.
[0050] According to some embodiments of the invention, the promoter and the enhancer are heterologous to each other.
[0051] According to some embodiments of the invention, the promoter is a weak promoter.
[0052] According to some embodiments of the invention, the promoter is the minimal TATA-box promoter or the minimal CMV promoter.
[0053] According to some embodiments of the invention, the promoter is as set forth in SEQ ID NOs: 85, 71 or 971.
[0054] According to some embodiments of the invention, the therapeutic agent is selected from the group consisting of a cytokine, a chemokine, a growth factor, an RNA silencing agent, a soluble receptor, a T cell engager, a chimeric receptor and an immune reprogramming factor.
[0055] According to some embodiments of the invention, the therapeutic agent is a cytokine.
[0056] According to some embodiments of the invention, the cytokine is selected from the group consisting of IL-2, IL-12, IL-15, IL-18 and IL-21.
[0057] According to some embodiments of the invention, the cytokine is selected from the group consisting of IL-2, IL-4, IL-10, IL-17, IL-23 and TNFa.
[0058] According to some embodiments of the invention, the therapeutic agent is a neurotrophic factor.
[0059] According to some embodiments of the invention, the neurotrophic factor is BDNF.
[0060] According to some embodiments of the invention, the therapeutic agent is a soluble TNFRb.
[0061] According to an aspect of some embodiments of the present invention there is provided an immune cell genetically modified to express the nucleic acid construct.
[0062] According to an aspect of some embodiments of the present invention there is provided an immune cell genetically modified to express a nucleic acid construct encoding a soluble TNFRb as a therapeutic agent.
[0063] According to an aspect of some embodiments of the present invention there is provided a method of generating an immune cell expressing an inducible therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct.
[0064] According to an aspect of some embodiments of the present invention there is provided a method of generating an immune cell expressing a soluble TNFRb as a therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct encoding a soluble TNFRb.
[0065] According to some embodiments of the invention, the introducing is effected in-vitro or ex-vivo.
[0066] According to some embodiments of the invention, the nucleic acid construct further comprises a nucleic acid sequence encoding a targeting receptor comprising a transmembrane domain and an extracellular binding domain to a target associated with the pathologic environment, wherein the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the targeting receptor are under distinct expression regulatory elements.
[0067] According to some embodiments of the invention, the nucleic acid sequence encoding the targeting receptor is operably linked to an expression regulatory element comprising a constitutive promoter.
[0068] According to some embodiments of the invention, the extracellular binding domain is of a receptor or a ligand.
[0069] According to some embodiments of the invention, the extracellular binding domain is of an antibody.
[0070] According to some embodiments of the invention, the binding domain comprises a scFv.
[0071] According to some embodiments of the invention, the targeting receptor further comprises an intracellular signaling domain, such that upon binding of the extracellular binding domain to a target thereof, activation of signaling via the signaling domain occurs in an immune cell expressing the targeting receptor.
[0072] According to some embodiments of the invention, the targeting receptor is a chimeric receptor.
[0073] According to some embodiments of the invention, activation of signaling via the signaling domain induces activation of an immune cell expressing the targeting receptor.
[0074] According to some embodiments of the invention, activation of signaling via the signaling domain increases expression of the gene.
[0075] According to some embodiments of the invention, activation of signaling via the signaling domain directly increases an activity of a transcription factor that binds the expression regulatory element.
[0076] According to some embodiments of the invention, activation of signaling via the signaling domain indirectly increases an activity of a transcription factor that binds the expression regulatory element. According to some embodiments of the invention, the signaling domain induces cytotoxic activity of an immune cell expressing the targeting receptor.
[0077] According to some embodiments of the invention, the signaling domain does not induce cytotoxic activity of an immune cell expressing the targeting receptor.
[0078] According to some embodiments of the invention, activation of the immune cell is manifested by activation of an IL-2 receptor signaling cascade.
[0079] According to some embodiments of the invention, the signaling domain is of a receptor selected from the group consisting of a ligand-gated receptor, a G-protein coupled receptor and an enzyme-linked receptor.
[0080] According to some embodiments of the invention, the signaling domain is of a receptor selected from the group consisting of a T cell receptor (TCR), a cytokine receptor, a co-stimulatory receptor, a co-inhibitory receptor, a growth factor receptor and an Fc receptor.
[0081] According to some embodiments of the invention, the signaling domain initiates a kinase or phosphatase cascade.
[0082] According to some embodiments of the invention, the signaling domain activates a JAK / STAT pathway.
[0083] According to some embodiments of the invention, the signaling domain is of a protein selected from the group consisting of CD3zeta, CD28, 4- IBB and IL-2R.
[0084] According to some embodiments of the invention, the transmembrane domain of a protein selected from the group consisting of CD8, CD28, 4- IBB and IL-2R.
[0085] According to some embodiments of the invention, the nucleic acid construct, being a single nucleic acid construct comprising the nucleic acid sequence encoding the therapeutic agent and the nucleic acid sequence encoding the targeting receptor.
[0086] According to some embodiments of the invention, the nucleic acid construct being a nucleic acid construct system comprising two distinct nucleic acid constructs one comprising the nucleic acid sequence encoding the therapeutic agent and the other comprising the nucleic acid sequence encoding the targeting receptor.
[0087] According to an aspect of some embodiments of the present invention there is provided a method of treating a pathology in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the immune cell, wherein the disease can benefit from the therapeutic agent, thereby treating the pathology in the subject.
[0088] According to an aspect of some embodiments of the present invention there is provided the immune cell, for use in treating a pathology in a subject in need thereof, wherein the pathology can benefit from the therapeutic agent. According to some embodiments of the invention, the immune cell is autologous to the subject.
[0089] According to some embodiments of the invention, the pathology is selected from the group consisting of cancer, autoimmune disease, neurological disease and a metabolic disorder.
[0090] According to some embodiments of the invention, the pathology comprises cancer.
[0091] According to some embodiments of the invention, the target is selected from the group consisting of TREM2, GPNMB, CTLA4 and SPP1.
[0092] According to some embodiments of the invention, the pathology comprises a neurological disease.
[0093] According to some embodiments of the invention, the neurological disease comprises a CNS injury.
[0094] According to some embodiments of the invention, the neurological disease comprises a neurodegenerative disease.
[0095] According to some embodiments of the invention, the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, Amyotrophic lateral sclerosis (ALS) and multiple sclerosis (MS).
[0096] According to some embodiments of the invention, the target is selected from the group consisting of Aβ, Myelin Oligodendrocyte Glycoprotein (MOG) and TDP-43.
[0097] According to some embodiments of the invention, the pathology is an autoimmune disease.
[0098] According to some embodiments of the invention, the autoimmune disease is selected from the group consisting of rheumatoid arthritis (RA) and multiple sclerosis (MS).
[0099] According to some embodiments of the invention, the target is selected from the group consisting of PD-1, IL23R, CXCR6 and CXCR3.
[0100] According to some embodiments of the invention, the immune cell is a T cell.
[0101] According to some embodiments of the invention, the immune cell is a macrophage or a monocyte.
[0102] According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct or construct system comprising:
[0103] (i) a nucleic acid sequence encoding a chimeric receptor comprising an extracellular binding domain and an intracellular signaling domain, such that upon binding of the extracellular binding domain to a target thereof, activation of signaling via the signaling domain occurs in an immune cell expressing the chimeric receptor; and
[0104] (ii) an expression regulatory element comprising an enhancer operably linked to a nucleic acid sequence encoding a therapeutic agent, wherein the expression regulatory element binds to a transcription factor whose amount and / or activity is increased following the activation of the signaling.
[0105] According to some embodiments of the invention, the extracellular binding domain is heterologous to the intracellular signaling domain.
[0106] According to some embodiments of the invention, the extracellular binding domain is of a receptor or a ligand.
[0107] According to some embodiments of the invention, the extracellular binding domain is of an antibody.
[0108] According to some embodiments of the invention, the binding domain comprises a scFv.
[0109] According to some embodiments of the invention, the target of the extracellular binding domain is associated with a disease.
[0110] According to some embodiments of the invention, the signaling domain induces activation of an immune cell expressing the chimeric receptor.
[0111] According to some embodiments of the invention, the signaling domain induces cytotoxic activity of an immune cell expressing the chimeric receptor.
[0112] According to some embodiments of the invention, the signaling domain does not induce cytotoxic activity of an immune cell expressing the chimeric receptor.
[0113] According to some embodiments of the invention, the activation of the immune cell is manifested by activation of an IL-2 receptor signaling cascade.
[0114] According to some embodiments of the invention, the signaling domain is of a receptor selected from the group consisting of a ligand-gated receptor, a G-protein coupled receptor and an enzyme-linked receptor.
[0115] According to some embodiments of the invention, the signaling domain is of a receptor selected from the group consisting of a T cell receptor (TCR), a cytokine receptor, a co-stimulatory receptor, a co-inhibitory receptor, a growth factor receptor and an Fc receptor.
[0116] According to some embodiments of the invention, the signaling domain initiates a kinase or phosphatase cascade.
[0117] According to some embodiments of the invention, the signaling domain activates a JAK / STAT pathway.
[0118] According to some embodiments of the invention, the signaling domain is of a protein selected from the group consisting of CD3zeta, CD28, 4- IBB and IL-2R.
[0119] According to some embodiments of the invention, the chimeric receptor comprises a transmembrane domain heterologous to the extracellular binding domain and / or the intracellular signaling domain. According to some embodiments of the invention, the chimeric receptor comprises a transmembrane domain of a protein selected from the group consisting of CD8, CD28, 4- IBB and IL-2R.
[0120] According to some embodiments of the invention, the transcription factor is selected from the group consisting of STAT, NFkB, AP-1 and NF AT.
[0121] According to some embodiments of the invention, the transcription factor is STAT.
[0122] According to some embodiments of the invention, the enhancer comprises a nucleic acid selected from the group consisting of SEQ ID NOs: ttcaaagaa, tccagtgaa, ttcgtggag, ttcagggaa, ttcccagag, ttcccagaa and tgccaagaa.
[0123] According to some embodiments of the invention, the nucleic acid construct or construct system being a single nucleic acid construct comprising the (i) and the (ii).
[0124] According to some embodiments of the invention, the nucleic acid construct or construct system being a nucleic acid construct system comprising two distinct nucleic acid constructs one comprising the (i) and the other comprising the (ii).
[0125] According to an aspect of some embodiments of the present invention there is provided an immune cell genetically modified to express the nucleic acid construct or construct system.
[0126] According to an aspect of some embodiments of the present invention there is provided a method of generating an immune cell expressing an inducible therapeutic agent, the method comprising introducing into the immune cell the nucleic acid construct or construct system, under conditions which allow expression of the chimeric receptor.
[0127] According to some embodiments of the invention, the introducing is effected in-vitro or ex-vivo.
[0128] According to an aspect of some embodiments of the present invention there is provided a method of treating a disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the immune cell, wherein the disease is associated with the target of the extracellular binding domain, thereby treating the disease in the subject.
[0129] According to an aspect of some embodiments of the present invention there is provided the immune cell, for use in treating a disease in a subject in need thereof, wherein the disease is associated with the target of the extracellular binding domain.
[0130] According to some embodiments of the invention, the immune cell is autologous to the subject.
[0131] According to some embodiments of the invention, the disease is selected from the group consisting of cancer, autoimmune disease, neurological disease and a metabolic disorder. According to some embodiments of the invention, the disease comprises a neurological disease.
[0132] According to some embodiments of the invention, the neurological disease comprises a CNS injury.
[0133] According to some embodiments of the invention, the neurological disease comprises a neurodegenerative disease.
[0134] According to some embodiments of the invention, the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease, Amyotrophic lateral sclerosis (ALS) and multiple sclerosis.
[0135] According to some embodiments of the invention, the target is selected from the group consisting of Aβ, Myelin Oligodendrocyte Glycoprotein (MOG) and TDP-43.
[0136] According to some embodiments of the invention, the therapeutic agent is a cytokine.
[0137] According to some embodiments of the invention, the cytokine is selected from the group consisting of IL-2, IL-4 and TNFα.
[0138] According to some embodiments of the invention, the therapeutic agent is a neurotrophic factor.
[0139] According to some embodiments of the invention, the neurotrophic factor is BDNF.
[0140] According to some embodiments of the invention, the immune cell is a T cell.
[0141] According to an aspect of the present invention, there is provided a genetically modified immune cell comprising a nucleic acid construct, the construct comprising:
[0142] (i) a nucleic acid sequence which encodes at least one therapeutic agent; and
[0143] (ii) at least one expression regulatory element which is operatively linked to the nucleic acid sequence, the expression regulatory element capable of selectively enhancing expression of the at least one therapeutic agent in a tumor associated macrophage (TAM), wherein the regulatory element is not a promoter.
[0144] According to an aspect of the present invention, there is provided a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the genetically modified immune cells described herein, thereby treating the cancer.
[0145] According to an aspect of the present invention, there is provided a genetically modified immune cell comprising a nucleic acid construct, the construct comprising:
[0146] (i) a nucleic acid sequence which encodes at least one therapeutic agent; and
[0147] (ii) at least one expression regulatory element which is operatively linked to the nucleic acid sequence, the expression regulatory element being capable of selectively enhancing expression of the at least one therapeutic agent in the immune cell when in a tumor environment as compared to expression in the immune cell when in a non-tumor environment, wherein when the genetically modified immune cell is a macrophage or monocyte, the expression regulatory element is capable of selectively enhancing expression of the at least one therapeutic agent in a tumor associated macrophage, wherein the regulatory element is not a promoter.
[0148] According to an aspect of the present invention, there is provided a method of generating genetically modified cells useful for treating cancer of a subject comprising transfecting immune cells or pluripotent stem cells with an expression construct which comprises:
[0149] (i) a nucleic acid sequence which encodes at least one therapeutic agent useful for treating the cancer; and
[0150] (ii) at least one expression regulatory element which is operatively linked to the nucleic acid sequence, the expression regulatory element being capable of selectively enhancing expression of the at least one therapeutic agent in a tumor associated macrophage, thereby generating the genetically modified cells.
[0151] According to an aspect of the present invention, there is provided a nucleic acid construct comprising:
[0152] (i) a nucleic acid sequence which encodes at least one therapeutic agent; and
[0153] (ii) at least one expression regulatory element which is operatively linked to the nucleic acid sequence, the expression regulatory element being capable of selectively enhancing expression of the at least one therapeutic agent in a tumor associated macrophage.
[0154] According to embodiments of the invention, the expression regulatory element binds to at least one transcription factor whose amount and / or activity is increased in a tumor microenvironment relative to in a non-tumor microenvironment.
[0155] According to embodiments of the invention, the at least one therapeutic agent comprises:
[0156] (i) IL- 18 decoy resistant (DR);
[0157] (ii) IL15, IL-21 and IL-18DR;
[0158] (iii) IL12 and IL-15;
[0159] (iv) IL12, IL- 15 and IL21;
[0160] (v) IL12, IL-18DR and IL21;
[0161] (vi) IL12, IL-15 and IL-18DR;
[0162] (vii) IL12, IL-15, IL-18DR and IL-21;
[0163] (viii) IL- 12 and IL-18DR; or
[0164] (ix) IL- 15 and IL-18DR. According to embodiments of the invention, the at least one regulatory element is in an intergenic region adjacent to a gene whose expression is up-regulated in a tumor microenvironment.
[0165] According to embodiments of the invention, the expression regulatory element is between 100-1000 base pairs.
[0166] According to embodiments of the invention, the expression regulatory element is between 200-400 base pairs.
[0167] According to embodiments of the invention, the regulatory element binds to transcription factors of a plurality of signaling pathways in a tumor microenvironment.
[0168] According to embodiments of the invention, the transcription factor belongs to a family selected from the group consisting of STAT, IRF, NFKB, MAF, NFE, API and TGFB.
[0169] According to embodiments of the invention, the regulatory element is devoid of a sequence that binds to a transcription factor selected from the group consisting of SNAI3, SNAI2, ZEB1, Rbpjl, Ddit3:Cebpa, cebp-1, CEBPA, CEBPB, CEBPD, CEBPE, CEBPG, HLF, NFIL3, Pdpl and slbo.
[0170] According to embodiments of the invention, the at least one regulatory element comprises at least two regulatory elements, each of the at least two regulatory elements being naturally comprised in an intergenic region adjacent to a non-identical gene whose expression is up- regulated in a tumor microenvironment.
[0171] According to embodiments of the invention, the gene is selected from the group consisting of APOE, SPP1, CTSD, CTSL, CTSZ, GPNMB, LDHA, MMP12, LIPA, PGK1, PLD3, CD81, TPM4, TREM2, CREG1, CALM3, STAT1, LILRB4, IL7R, PLA2G7, CPM, GM2A, PDXK, TUMA1C, TSPAN4, HM13, TSC22D1, SDS, RALA, GPR137B, IL4I1, SLAMF8, SDC2, BCAT1, KCNMA1, ACP2, ERO1A, ATF3, ATF5, SLC43A3, NR1H3, MFSD12, OTO1, PPP1R14B, SLC39A8, ADAM8, SLAMF7, BNIP3, FAM20C, IL18BP, AMPD3, MATK, PDPN and SLC2A5.
[0172] According to embodiments of the invention, the immune cell is a myeloid cell.
[0173] According to embodiments of the invention, the myeloid cell is a macrophage, or a monocyte.
[0174] According to embodiments of the invention, the immune cell is a hematopoietic progenitor cell or a hematopoietic stem cell.
[0175] According to embodiments of the invention, the expression regulatory element is a transcriptional regulatory element.
[0176] According to embodiments of the invention, the at least one therapeutic agent is a cytokine. According to embodiments of the invention, the cytokine is selected from the group consisting of IL-2, IL-4, IL-6, IL-12, IL-15, IL-18, IL-21, TNF, IL-10, TGFb, IL-lbp, IL-18bp, INFg and INFa / b.
[0177] According to embodiments of the invention, the therapeutic agent is a T cell engager or an immune reprogramming factor.
[0178] According to embodiments of the invention, the at least one therapeutic agent is a chemokine.
[0179] According to embodiments of the invention, the chemokine is selected from the group consisting of CCL3, CCL4 and CCL5.
[0180] According to embodiments of the invention, the genetically modified immune is for use in treating cancer.
[0181] According to embodiments of the invention, the cancer is selected from the group consisting of lung cancer, breast cancer, colon cancer, glioblastoma and head and neck cancer.
[0182] According to embodiments of the invention, the method further comprises administering to the subject an immune modulating agent.
[0183] According to embodiments of the invention, the immune modulating agent is a checkpoint inhibitor.
[0184] According to embodiments of the invention, the immune modulating agent comprises CAR-T cells.
[0185] According to embodiments of the invention, the genetically modified immune cells are autologous to the subject.
[0186] According to embodiments of the invention, the immune cells comprise CD34+ hematopoietic stem cells.
[0187] According to embodiments of the invention, the pluripotent stem cells comprise induced pluripotent stem cells.
[0188] According to embodiments of the invention, the immune cells or the pluripotent stem cells are derived from the subject.
[0189] According to embodiments of the invention, the method comprises transfecting CD34+ hematopoietic stem cells or pluripotent stem cells and the method further comprises culturing the CD34+ hematopoietic stem cells or the pluripotent stem cells in a culture medium which comprises at least one differentiation factor under conditions that promote differentiation of the CD34+ hematopoietic stem cells or the pluripotent stem cells into an immune cell selected from the group consisting of a monocyte, a dendritic cell and a macrophage. According to embodiments of the invention, the at least one differentiation factor is GM- CSF and IL-4.
[0190] According to embodiments of the invention, the expression construct is comprised in a viral vector selected from the group consisting of HCMV, vaccinia virus, adenovirus, adeno- associated virus, retrovirus, and lentivirus.
[0191] According to embodiments of the invention, the viral vector is a lentivirus.
[0192] According to embodiments of the invention, the regulatory region is in an intergenic region adjacent to a gene whose expression is up-regulated in a tumor microenvironment.
[0193] According to embodiments of the invention, the therapeutic agent is selected from the group consisting of a chemokine, a cytokine, a T cell engager and an immune reprogramming factor.
[0194] According to embodiments of the invention, the gene is selected from the group consisting of APOE, SPP1, CTSD, CTSL, CTSZ, GPNMB, LDHA, MMP12, LIPA, PGK1, PLD3, CD81, TPM4, TREM2, CREG1, CALM3, STAT1, LILRB4, IL7R, PLA2G7, CPM, GM2A, PDXK, TUMA1C, TSPAN4, HM13, TSC22D1, SDS, RALA, GPR137B, IL4I1, SLAMF8, SDC2, BCAT1, KCNMA1, ACP2, ERO1A, ATF5, SLC43A3, NR1H3, MFSD12, OTO1, PPP1R14B, SLC39A8, ADAM8, SLAMF7, BNIP3, FAM20C, IL18BP, AMPD3, MATK, PDPN and SLC2A5.
[0195] According to embodiments of the invention, the nucleic acid construct further comprises a promoter.
[0196] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0197] BRIEF DESCRIPTION OF THE DRAWINGS
[0198] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0199] In the drawings:
[0200] FIG. 1. Tumor macrophages harbor an exclusive gene expression program in lung, breast and colon human tumors. A differential gene expression analysis of a total of 128,658 myeloid cells, including TAMs, resident macrophages and monocytes, from 179 patient samples taken from breast, colon and lung tumors.
[0201] FIG. 2 is a scheme illustrating an exemplary selection of TROJAN element from a library of TAM-specific elements chosen based on transactivation strength (GFP intensity) and cell type / disease state specificity (tumor macrophage vs tumor monocyte). The synthesis of thousands of elements cloned and transduced into macrophages of either tumor like or tissue like origin. The elements driving the highest GFP signal are tested individually for validation in tissue like macrophages and tumor like macrophages.
[0202] FIG. 3 is an exemplary heatmap showing TF motifs that are exclusively enriched in either monocytes or TAMs. The list represents a differential motif enrichment analysis between monocytes (green bar) and TAMs (off-white bar). Each significantly enriched motif is presented with its consensus sequence and the name of its corresponding transcription factor (shown on the left). The heatmaps on the right of each figure show the motif enrichment score in log2 transformation and the adjusted p-value in log 10 transformation.
[0203] FIG. 4 is a schematic representation of an exemplary TF motif that is exclusive in TAM- specific elements. For each element, the genomic location on linear DNA is shown for elements of the TAM -related gene Atf3. Each motif is denoted by the corresponding transcription factor name and by the degree of conservation across 35 different species.
[0204] FIG. 5 is an exemplary schematic illustration of TROJAN elements combined with effector molecules validation. Each such combination will be transduced into macrophages and tested by qPCR and ELISA to quantify the effector molecule expression and secretion. Transduced macrophages will be co-cultured with T-cells to measure INFy secretion and T-cells proliferation. Finally, a tumor killing assay will be used to measure the effect of the TROJAN payload and single-cell sequencing will be used to measure the TME immune remodeling.
[0205] FIG. 6 demonstrates that the construct containing the TROJAN element drives high expression of the cargo cytokines in macrophages grown under tumor like conditions only. Top panel showing qPCR analysis of IL-15, IL-12 and IL-2 expression in macrophages transduced with TROJAN elements combined with the three different cytokines. Bottom panel showing IFNg ELISA analysis of naive T-cells, activated T-cells, activated T-cells co-cultured with suppressive macrophages, and TROJAN transduced suppressive macrophages with IL-2, IL- 12 or IL-21 effector molecules.
[0206] FIGs. 7A-B. (A) FACS analysis of TROJAN transduced macrophages or T-cells with eGFP as payload in MCA205 mouse tumor model. Macrophages containing TROJAN-cell circuits are activated in tumor while T-cell containing Trojan circuits are not activated in tumor. (B) FACS analysis of TROJAN transduced macrophages in MCA205 tumor TME compared to TROJAN transduced macrophages from the tumor free spleen microenvironment.
[0207] FIGs. 8A-C demonstrate that the cargo tested showed significant efficacy across a period of 21-23 days as compared to controls. Figure 8A shows the tumor volume in mice transplanted with TROJAN cargo vs control across a span of 21-23 days. Figure 8B shows different immune populations that shift in numbers in the reprogrammed TME when comparing TROJAN IL2SK (IL-2 Trojan Cell) with controls. This strong effect on the TME explains the high efficacy of the TROJAN cell carrying the IL2SK cargo and the lack of IL2 levels detected in the peripheral circulation confirms the specificity of the TROJAN cell to the tumor microenvironment. Figure 8C shows an ELISA assay to quantify IL2SK levels in serum from the in vivo experiment (first six samples) and from in-vitro bone marrow derived macrophages transduced with TROJAN IL2SK construct (next 5 samples), as controls for the assay. IL2SK levels were not detected in both the control and the IL2SK Trojan samples. The controls from the BMDM cultures show high levels of IL2 in the culture supernatant, 4 days post-transduction. The BMDM GFP was used as a negative control for the in vitro culture assay.
[0208] FIGs. 9A-D demonstrate analysis of publicly available transcriptomics data of mouse (Figures 9A-B) and human (Figures 9C-D) T cell genes induced at different timepoints following IL-2 stimulation. Figure 9A demonstrates that IL-2 regulates mouse T cell genes at 0.5, 2, 4, and 24 hours after stimulation. Figure 9B is a graph assessing mouse genes by absolute induction and not only fold-change. Figure 9C demonstrates that IL-2 regulates human CD8 T cell genes at 4 hours after stimulation. Figure 9D is a graph assessing human genes by absolute induction and not only fold-change.
[0209] FIG. 10 is a graph demonstrating logic-gated IL-2-induced BDNF secretion in-vitro by harnessing the natural IL-2 signaling. Shown is BDNF controlled secretion at 72 hours following stimulation with increasing concentrations of IL-2 and / or aCD3 / CD28 which induce activation of regulatory elements taken from enhancers of the candidate genes, using ELISA for BDNF. FIG. 11 is a graph demonstrating logic-gated CAR-induced BDNF secretion in-vitro upon antigen stimulation using co-transduction. Shown is BDNF controlled secretion at 72 hours following stimulation with antigens, IL-2 and aCD3 / CD28 which induce activation of regulatory elements taken from enhancers of the candidate genes, using ELISA for BDNF.
[0210] FIG. 12 is a graph demonstrating logic-gated CAR-induced BDNF secretion in-vitro upon antigen stimulation using a single construct design. Shown is BDNF controlled secretion at 72 hours following stimulation measured using ELISA for BDNF.
[0211] FIGs. 13A-B demonstrate analysis of publicly available data of CD8+ T cells in several activation levels; naive, activated, and exhausted. Figure 13A shows RNA-seq z-scored values from both CAR-T cells and endogenous T cells at different activation levels. Figure 13B shows ATAC-seq average z-score value per gene from T cells arriving from both tumor microenvironment and from chronic inflammation.
[0212] FIGs. 14A-E demonstrate that TNFa mediates altered gene signatures in autoimmune diseases, and top gene candidates for regulatory elements with both an increase in absolute expression and log-fold change for both CD4 and CD8 T cells in response to TNFa stimulation were identified. Figure 14A shows integration and batch correction. Figure 14B is a UMAP revealing unique gene signatures following TNFa stimulation. Figure 14C is a graph demonstrating T cell target genes that are upregulated following TNFa stimulation. Figure 14D shows CD8 and CD4 gene candidates that are upregulated following TNFa stimulation. Figure 14E shows gene signatures following TNFa stimulation of cells derived from Arthritis patients and healthy controls.
[0213] FIG. 15 demonstrates TME sensors that are specific for TAMs. On the left, distribution of expression of two TAM-specific genes, from single-cell RNA-seq data, which is projected onto the myeloid landscape derived from lung, breast, and colon cancer. On the right, a snapshot of the genomic locus from the two candidate genes from single-cell ATAC-seq data. The peaks represent the degree of accessibility of potential regulatory elements, comparing a tissue macrophage (blue peaks) with a tumor macrophage. The differential peaks are putative TME sensors that respond to tumor signaling and drive the expression of TAM-specific core genes.
[0214] FIG. 16 demonstrates the effect of different culturing conditions on GFP expression, using a prototype CRE (an enhancer from the TREM2 locus, SEQ ID 970) + minimal CMV promoter (SEQ ID 971) driving GFP expression. The experiment was carried out in triplicates, and the GFP units (% * intensity) were normalized for every replicate against dTomato units driven by a constitutive SFFV promoter (SEQ ID 972). FIG. 17. TAM CREs were filtered against CREs from peripheral monocytes, resident macrophages, and tumor monocytes. The CREs were designed to be 200 bps long, taking the middle of the ATAC peak and moving 100 bps sideways. CREs from known housekeeping genes (HKGs) and viral enhancer sequences were chosen from databases and used as positive controls. Scrambled CRE sequences and ATAC peaks from monocytes and T-cells were included as negative controls.
[0215] FIG. 18. The library was cloned in a lentiviral vector containing the CRE library cloned 5’ of a mini-promoter (mCMV 30 bps long, SE QID NO: 971), and each CRE was assigned a barcode (pink color - BC). Insulator sequences flank the construct to downscale the ectopic regulation from genomic sites caused by random integration. Each CRE was flanked by an adapter sequence common to all CREs in the library (SEQ ID NOs: 973-974). The library was then amplified using primers binding to the adapters (SEQ ID NOs: 1068-1069), followed by a second PCR to include the Barcode for each element.
[0216] FIG. 19 shows quantification of GFP units from each individual CRE cultured in either MCSF+IL4 or GMCSF conditions.
[0217] FIGs. 20A-C demonstrates that Trem2 enhancer / promoter activity is detected in tumor macrophages, but not in tumor-draining lymph nodes or spleens. Figure 20A is a schematic representation of the outline of the experimental approach to test Trem2 element activity in-vivo. Figure 20B shows a FACS analysis of Trem2 / GFP expression in tumor, tumor-draining lymph nodes (tdLN) and spleens of mice transplanted with the lentivirus-transduced stem / progenitor cells and challenged with MC38 tumor cells. Figure 20C shows FACS analysis of the macrophage marker (CD1 lb, F4 / 80) expression in tumor-derived cells with high GFP expression (GFP+, active Trem2 elements) and with low GFP expression (GFP-).
[0218] FIGs. 21A-E demonstrate that CARaTREM2 T cells activate and initiate an effective and specific cytotoxic response toward TREM2-expressing cells. Figure 21 A is a schematic representation of the anti-TREM2 CAR T cells generation and the receptor’s design. Figure 2 IB is a schematic representation of the structure of the CARaTREM2 construct. Figure 21C shows flow cytometry analysis for activation of CARaTREM2 cells after 24 hours of co-culture with HEK293-TREM2. Figure 21D shows IFN-y ELISA assay of CARaTREM2 cells co-cultured with HEK293-TREM2. Figure 21E shows flow cytometry FSC-SSC gating of human TAM-like cells (M2) after 20 hours co-culture with CARaTREM2 cells and Mock CAR-T cells.
[0219] FIGs. 22A-D demonstrates that TROJAN regulatory element governs cargo expression and secretion in TROJAN CAR-T cells. Figure 22 A is a schematic representation of constructs containing the anti-TREM2 CAR + TROJAN element TrojRE5 (SEQ ID NO: 1058) controlling the expression of GFP (ZsGreen-1), and the control construct under the control of CD19RE. Figure 22B shows flow cytometry GFP+ / GFP- gating of transduced T-cells after 24 hours coculture with 293HEK cells, HEK-TREM2 or CD3 / CD28 activation beads. Figure 22C is a schematic representation of constructs containing the anti-TREM2 CAR + TROJAN element TrojRE5 (SEQ ID NO: 1058) controlling the expression of an Il2 cargo and the control constructs under the control of CD19RE or Efl; and equivalent control constructs lacking the CAR protein. Figure 22D shows hIL2 ELISA assay of transduced T-cells after 24 hours co-culture with either 293HEK cells, HEK-TREM2 cells or without activation (NA).
[0220] FIGs. 23A-B demonstrate expression of BDNF T cells transduced with a construct encoding an anti-Aβ CAR followed by BDNF under control of a constitutive promoter. Figure 23A shows the concentration of BDNF secreted by the transduced T cells, measured by ELISA in the culture medium following 24 hours of culture. Figure 23B shows the transcriptional changes of cortical mouse neurons following administration of the medium of the transduced T cells, normalized to the medium of control T cells, resembling the response to synthetic BDNF, as measured by qPCR after 1 and 6 hours.
[0221] FIGs. 24A-B show graphs demonstrating logic-gated CAR-induced BDNF secretion in- vitro upon antigen stimulation using a single construct (Figure 24A) or a two constructs cotransduction (Figure 24B) design. Shown is BDNF controlled secretion at 72 hours following stimulation measured using ELISA for BDNF.
[0222] FIGs. 25A-T demonstrate the use of different cytokines as cargo. Figure 25A is a schematic representation of a lentiviral construct for IL- 12 variants. Figure 25B is a bar chart showing protein secretion levels for IL- 12 variants, determined by ELISA. Figure 25C is a box plot showing comparison between the two IL-12 subgroups, p≤0.005. Figure 25D shows a reporter assay for IL- 12 variants. Figure 25E shows QPCR for IL- 12 variants. Figure 25F shows schematic representations of lentiviral constructs containing IL15 variants. Figure 25G shows a reporter assay for IL- 15 variants. Figure 25H is a bar chart showing protein secretion levels for IL- 15 variants, determined by ELISA. Figure 251 shows QPCR for IL- 15 variants. Figure 25J demonstrates the results of a killing assay: Crystal violet staining of tumors cells at 1:32 T-cell to tumor cell ratios. The percentage of tumor cell survival in untreated vs. IL-12, IL-15, IL-18DR or IL-21treated is shown on the right. Figure 25K is shows schematic representations of lentiviral constructs for IL- 18, IL-18DR, IL-21. Figure 25L shows QPCR for IL- 18 and IL18DR. Figure 25M shows PCR for IL-21. Figure 25N shows ELISA for IL- 18 and IL-21. Figure 250 is a heatmap analysis of T-cell pathway enrichment in response to cytokines testing as single or in combinations, as indicated. Figure 25P shows schematic representations of lentiviral constructs with TROJAN sensor driving IL 12 or IL 15 expression.
[0223] Figure 25Q shows QPCR of IL- 12 from macrophages transduced with the TROJAN IL- 12 construct. Expression levels of IL12 are expressed in Log2 fold change. Figure 25R shows QPCR of IL- 15 from macrophages transduced with the TROJAN IL- 15 construct. Expression levels of IL-15 are expressed in Log2 fold change. Figure 25S shows ELISA for IFNy secretion by macrophages transduced with the TROJAN IL-12 and IL-15 construct. Figure 25T shows cell counts of T-cells after culturing for 72 hours with IL- 15 or IL- 12. The relevant sequences are provided in SEQ ID Nos: 978-1016.
[0224] FIGs. 26A-D demonstrate that Trem2 element-driven expression of cDCl-specific TFs leads to increased number of eDC 1 cells in the TME. Figures 26A-B show design of lentiviral cassette with GFP (Figure 26A) or cDCl-specific transcription factors (Figure 26B) and sorting gates for transduced cells within the TME. The relevant sequences are provided in SEQ ID Nos: 978-1016. Figures 26C-D show scRNA-seq analysis of myeloid cell subsets in tdLN and tumors of mice that received Trem2-GFP- or Trem2-TF- transduced cells (Figure 26C) or different dendritic cell subsets (Figure 26D) in two experimental groups.
[0225] FIG. 27 A. 48 hours after transduction, the secretion of the soluble TNFRII cargo to the cells’ supernatant was determined by ELISA and was compared to cells secreting an irrelevant cargo. Soluble TNF receptors (sTNFRs) function as decoy receptors by binding to TNF-alpha, preventing its interaction with cell surface TNF receptors, and thereby reducing inflammatory signaling.
[0226] FIG. 27B. To assess the activity of the soluble TNFRII cargo, the cargo-secreting cells were incubated for 48 hours with or without different concentrations of TNF-a and TNF-a concentration was determined in the cells’ supernatant.
[0227] FIGs. 28A-C demonstrates that TROJAN CARaTREM2 cells localize in the tumor. Figure 28A shows flow cytometry CD45.1+ / CD45.2 gating of the T-cells compartment (TCRb+CDllb-) from tumor, spleen and dLN of tumor-bearing mice, 7 days after adoptive cell transfer (ACT). Figure 28B shows BFP expression of the T cells compartment isolated from the tumor. Figure 28C shows expression of exhaustion markers on CD45.1 ACT cells isolated from tumor, spleen and dLN.
[0228] FIGs. 29A-C demonstrate spatial localization of Aβ-specific CAR T cells in the 5xFAD brain 2 weeks post i.v. administration. Figure 29A shows that CAR T cells penetrate the parenchyma through the choroid plexus. Figure 29B shows colocalization of adoptively transferred CD45.1 CAR T cells with Aβ plaques. Figure 29C shows CAR T cells in the parenchyma. FIGs. 30A-D demonstrate spatial localization of MOG-specific CAR T cells in the MCAO stroke brain 5 days post i.v. administration. Figure 30A shows transcranial optical vascular imaging (TOVI) of cortical hemodynamics in the mouse brain. Figure 30B shows H&E characterization of the damage to the brain tissue following stroke. Figure 30C demonstrates that adoptively transferred CAR T cells are colocalizing to the damaged area within the right hemisphere. Slides were cut consecutively to the H&E slides. Figure 30D - projecting of the data onto a single cell transcriptomics atlas reveals T cell-specific signatures.
[0229] FIG. 31 demonstrates that anti-MOG CAR T cells home specifically to the site of pathology. Shown are FACS plots of adoptively-transferred CD45.1 CAR T cells vs endogenous CD45.2 immune cells in the brain, spleen and lung.
[0230] FIG. 32 is a schematic representation of data driven precision drug development using single cell multiomics and Al.
[0231] FIG. 33 shows single cell atlas of human rheumatoid arthritis (RA) synovium defines 3 pathological populations.
[0232] FIG. 34 demonstrates that Tfh and CD8 cytotoxic cells highly and specifically express PDCD1 in RA patients.
[0233] FIG. 35 - a single-cell atlas of the murine mBSA-induced RA model identifies pathogenic populations similar to those in humans, with high expression of PDCD1.
[0234] FIG. 36 is a schematic representation of the mBDA murine model of RA.
[0235] FIGs. 37A-E demonstrate that a-PDl CAR T cells selectively eliminated pathogenic PD- 1+ cells in vitro. Figure 37A is a schematic representation of the experimental plan. Figure 37B shows killing assay of PDCD1 expressed T cells by a-PDl CAR-T cells in various E:T ratios. Figure 37C shows IFNy production following CAR activation (ng / ml). Figure 37D shows PDCD1 expression on exhausted CD4 T cells and a-PDl CAR-T cells. Figure 37E shows a-PDl CAR-T cells before and after killing assay.
[0236] FIG. 38 demonstrates that a-PDl CAR T cells reduced arthritis by targeting pathogenic cells in-vivo.
[0237] FIG. 39 demonstrates that a-PDl CAR-T cells specifically deplete PDCD1 expressing cells.
[0238] FIG. 40 - Single-cell atlas reveals target molecules that are upregulated in pathological T cell subtypes and in MS compared to healthy controls.
[0239] FIGs. 41A-C demonstrate the effect of anti-PDl-CAR T cells on EAE. Figure 41A shows pathogenic T cell subsets in the spinal cord of EAE mice by disease score reveal an increase in GM-CSF producing Thl7 T cells and a transition into a proliferative state as the disease progresses. Figure 4 IB shows that candidate gene markers of classical and proliferative GM-CSF producing Thl7 T cells in EAE share a similar signature to the Thl7 subset identified in the human sarcoidosis atlas. Figure 41C shows that treatment with anti-PDl-CAR T cells resulted in a complete rescue of the EAE disease.
[0240] FIGs. 42A-C demonstrate TNFa controlled secretion of IL- 10 from T cells transduced with a construct encoding IL- 10 under the control of TROJAN regulatory elements taken from enhancers (both WT and variant mutated enhancers) of the TNFAIP3 gene (SEQ ID Nos: 1022- 1053). All constructs encoded an enhancer, a mini promoter (miniTATA or miniCMV as indicated) and the downstream IL- 10 cargo. Secretion was measured by ELISA 72 hours following treatment with TNFa. All cultures treated with TNFa were also treated with IL-2 (10 ng / ml). Figure 42A shows all tested constructs; Figure 42B is a close up of SEQ ID NOs: 1030- 1053; and Figure 42C is a close up of SEQ ID NOs: 1022-1029 and 1052-1053
[0241] FIG. 43 includes a collection of graphs and schemes further supporting embodiments related to the methods of treating cancer by providing genetically modified immune cells that are capable of modulating the immune response in the tumor microenvironment.
[0242] FIG. 44A is a schematic description of aPD-1 CAR T and IL- 10 vectors used in cotransduction experiments.
[0243] FIG. 44B demonstrates mouse IL- 10 ELISA assay assessing IL- 10 secretion of control T cells, anti-PD-1 CAR T cells, IL- 10 secreting T cells or CAR T cells co-transduced with IL- 10 (n = 2 per condition). Statistical significance was determined using one-way analysis of variance (ANOVA) with Tukey’s post hoc multiple comparisons test. ****p≤0.0001.
[0244] FIG. 44C shows flow cytometry histogram assessing PD-1 protein levels on chronically activated aPD-1 CAR T cells (top) and IL-10-armored aPD-1 CAR T cells (bottom) in vitro. One- and three- days following transduction, CAR T cells were activated with anti-CD3, anti-CD28 antibodies and flow cytometry analysis of PD-1 was performed on day 4 after transduction.
[0245] FIG. 44D is a UMAP visualization of scVI embedding on single cells obtained from the spinal cord of mice induced with EAE and treated with 3M aPD-1 CAR T cells (top) or treated with 3M IL- 10 secreting anti-PD-1 CAR T cells (bottom) 4 days following immunization.
[0246] FIG. 44E is a bar plot showing the relative abundance of immune cell populations in the spinal cord of naive controls, mice induced with EAE stratified by increasing clinical severity, and mice induced with EAE treated with either 3M IL- 10 secreting T cells, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells, 4 days following immunization. Color represents the different cell-type lineages obtained by graph-based clustering and annotated by conventional markers, which are also projected on the UMAP (left).
[0247] FIG. 44 F is a dot plot showing normalized IllOra, IllOrb gene expression profiles of cell types in the spinal cord of mice induced with EAE which were either untreated or treated with 3M anti-PD-1 CAR T cells. Dot size represents the percentage of cells expressing the gene, and color represents the scaled mean gene expression of the cluster.
[0248] FIG. 44G is a UMAP visualization of sc VI embedding of microglia populations obtained from the spinal cord of mice induced with EAE and treated with 3M anti-PD-1 CAR T cells (left) or treated with 3M IL- 10 secreting anti-PD-1 CAR T cells (middle) 4 days following immunization. Color represents the different microglia populations projected on the UMAP (right).
[0249] FIG. 44H shows boxplots demonstrating activated DAM and activated microglia frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M IL- 10 secreting T cells, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after- immunization. Each dot represents a mouse. Statistical significance was determined using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test. ****p≤0.0001, *p≤0.05.
[0250] FIG. 441 shows boxplots demonstrating cDCl and cDC2 frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M atni-PD-1 CAR T cells, or 3M IL-10 secreting anti-PD-1 CAR T cells 4 days afterimmunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01.
[0251] FIG. 44J is a boxplot showing Treg frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti- PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after-immunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01.
[0252] FIG. 44 K Average EAE disease incidence and weight loss over time for treatment at day 4. EAE clinical scores and weights were monitored daily and determined for mice induced with EAE who were injected with PBS (n=9) or treated with 3M IL-10 secreting T cells (n=10), 3M aPD-1 CAR T cells (n=10), or 3M IL-10 secreting aPD-1 CAR T cells (n=10) 4 days following EAE induction. FIG. 44L shows average EAE disease incidence and weight loss over time for treatment at day 7. EAE clinical scores and weights were monitored daily and determined for mice induced with EAE who were injected with PBS (n=l 1) or treated with 3M IL- 10 secreting T cells (n=8), 3M anti-PD-1 CAR T cells (n=7), or 3M IL-10 secreting anti-PD-1 CAR T cells (n=14) 4 days following EAE induction. The arrow indicates the time (7 days after immunization) when the treatment was given.
[0253] FIG. 45A is a boxplot showing activated CD4 frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days afterimmunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01.
[0254] FIG. 45B is a heatmap showing gene expression of all leukocytes, clustered by gene modules, in the CNS of naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL-10 secreting anti-PD-1 CAR T cells 4 days afterimmunization (n = 12). The values are row-normalized z-scores of the pseudobulk gene expression. Each column represents the pooled average reads of a mouse.
[0255] FIG. 45C shows bar graphs depicting the frequencies of microglia cell subsets in the spinal cord, shown per individual mouse and stratified by naive controls and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after-immunization.
[0256] FIG. 45D is a heatmap showing gene expression of microglia, clustered by gene modules, in the CNS of naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after-immunization (n = 12). The values are row-normalized z-scores of the pseudobulk gene expression. Each column represents the pooled average reads of a mouse.
[0257] FIG. 45E shows module enrichment Z-scores of microglia in the spinal cord of naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after-immunization.
[0258] FIG. 45F is a volcano plot of pseudo-bulk differential gene expression analysis between activated DAM and activated microglia in the spinal cord of mice induced with EAE and treated with CAR T and IL- secreting CAR T. Relevant genes are highlighted and labeled as indicated. Differential gene expression has been tested using DESeq2. Dashed lines depict threshold for genes within p(adj) < 0.05. FIG. 45G is a boxplot showing activated DAM frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL-10 secreting anti-PD-1 CAR T cells 4 days afterimmunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01, *p≤0.05.
[0259] FIG. 45H is a boxplot showing activated microglia frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL-10 secreting anti-PD-1 CAR T cells 4 days afterimmunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01, *p≤0.05.
[0260] FIG. 451 is a boxplot showing DAM frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti- PD-1 CAR T cells, or 3M IL- 10 secreting anti-PD-1 CAR T cells 4 days after-immunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. **p≤0.01.
[0261] FIG. 45J is a boxplot showing monocyte-derived macrophage frequencies out of all leukocytes in the spinal cord, depicting naive controls, and mice induced with EAE who were either injected with PBS, 3M anti-PD-1 CAR T cells, or 3M IL-10 secreting anti-PD-1 CAR T cells 4 days after-immunization. Each dot represents a mouse. Statistical significance was determined using the Kruskal-Wallis test with Dunn’s multiple comparisons test. ***p≤0.001, *p ≤0.05.
[0262] FIG. 45K is a volcano plot of pseudo-bulk differential gene expression analysis between IL- 10 secreting CAR T cells and standard CAR T cells in the spinal cord. Relevant genes are highlighted and labeled as indicated. Differential gene expression has been tested using DESeq2. Dashed lines depict threshold for genes within p(adj) < 0.05.
[0263] FIG. 45L shows average EAE disease scores over time. EAE clinical scores were monitored daily and determined for mice induced with EAE who were either injected with PBS (n=9), 3M IL-10 secreting T cells (n=10), 3M anti-PD-1 CAR T cells (n=10), or 3M IL-10 secreting anti-PD-1 CAR T cells (n=10), 4 days following EAE induction. The arrow indicates the time (4 days after immunization) when the treatment was given. Statistical analysis was performed on the cumulative clinical scores using a two-sided, unpaired t-test. ****p≤0.0001, **p ≤0.01.
[0264] FIG. 45M shows average EAE disease scores over time. EAE clinical scores were monitored daily and determined for mice induced with EAE who were either injected with PBS (n=l 1), 3M IL- 10 secreting T cells (n=8), 3M anti-PD-1 CAR T cells (n=7), or 3M IL- 10 secreting anti-PD-1 CAR T cells (n=14), 7 days following EAE induction. The arrow indicates the time (7 days after immunization) when the treatment was given. Statistical analysis was performed on the cumulative clinical scores using a two-sided, unpaired t-test. ****p≤0.0001.
[0265] FIGs. 46A-D demonstrate transcription factor motif enrichment analysis of top 100 families in active versus exhausted T cells. Figure 46A is a heatmap depicting RNA expression patterns of selected genes across biological replicated of different T cells activation states: CD8+PDllow, CAR PDlhigh, CD8+PDlhigh, CAR PDlhighTIM3+, and CD8+PDlhighTIM3+. Figure 46B shows ATAC-seq decoding chromatin accessibility profiles of CD8+T cell populations under different activation states: CD8+PDllow, CAR PDlhigh, CD8+PDlhigh, CAR PDlhighTIM3+, and CD8+PDlhighTIM3+. Transcription factor (TF) motif enrichment analysis of accessible chromatin regions in naive T cells (top), T cell early activation (middle), andeffector- exhausted T cells (bottom) states. Lollipop plots show fold enrichment of representative TF motifs, with color intensity by -logw(p-value). Figure 46C shows ATAC-seq signal tracks illustrating chromatin accessibility at regulatory regions near the Cd70 loci in CAR-T and endogenous CD8+T cells across different functional states. Figure 46D shows flow cytometry analysis of NFAT-ZsGreen expression (MFI) of transduced T-cells isolated from tumors in vivo. WT mice were s.c. injected with 1 million MCA205 or MCA205 hTREM2 tumor cells per flank (day 0). Mice were intraperitoneal treated with 200 mg / kg Cyclophosphamide on day 6. The next day 10 million CD45.1+ T cells double transduced with NFAT-ZsGreen and BFP control vector or double transduced with NF AT- ZsGreen and hTREM2 CAR, were adoptively transferred via intravenous administration and harvested on day 14. Histograms depicting ZsGreen expression of co-transduced T cells isolated from the mice tumors (n=7). Dashed line represents the gating threshold used to define marker-positive cells, based on background fluorescence in the negative control.
[0266] FIGs. 47A-I demonstrate generation of synthetic regulatory elements for tumor-restricted payload expression in hTREM2 CAR T cells. Figure 47A shows integrated RNA-seq heatmap displaying gene expression profiles of CD8+T cell populations under different treatment conditions: CD8+PDllow, CAR PDlhigh, CD8+PDlhigh, CAR PDlhighTIM3+, and CD8+PDlhighTIM3+. Each row represents a gene, and each column a biological replicate. Z- scores are shown for normalized expression. Genes associated with immunoregulatory functions of the different activation states are annotated. Figure 47B shows ATAC-seq heatmap displaying chromatin accessibility profiles of CD8+T cell populations under different treatment conditions: CD8+PDllow, CAR PDlhigh, CD8+PDlhigh, CAR PDlhighTIM3+, and CD8+PDlhighTIM3+. Each row represents a gene, and each column a biological replicate. Z-scores are shown for average accessibility. Genes associated with immunoregulatory functions of the different activation states are annotated. Figures 47C-D show transcription factor (TF) motif enrichment analysis of accessible chromatin regions associated with T cell early activation (top) and effectorexhaustion (bottom) states. Barplots show fold enrichment of representative TF motifs, with color intensity indicating -log(p-value). Figure 47C shows fold enrichment in PDlhigh CAR T cells. Figure 47D shows fold enrichment in CD8+PDlhighTIM3+ T cells. Figure 47E shows ATAC- seq signal tracks illustrating chromatin accessibility at regulatory regions near the CD83 (left), Zap70 (middle) and Ezh2 (right) loci in CAR-T and endogenous CD8+T cells across different functional states (CD8+PDllow, CAR PDlhigh, CD8+PDlhigh, CAR PDlhighTIM3+, and CD8+PDlhighTIM3+ T cells). Figure 47F is a schematic description of synthethic regulatory elements linked to a minimal promoter (mp) inducing the expression of ZsGreen. Figure 47G shows flow cytometry analysis of ZsGreen expression (MFPfrequency) of transduced T-cells after 24 hours culture with HEK or HEK-TREM2. Statistical significance was assessed by Anova (* p
[0267] < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). Figure 47H shows histograms depicting ZsGreen expression of transduced T-cells after 24 hours culture with HEK or HEK-TREM2. Dashed line represents the gating threshold used to define marker-positive cells, based on background fluorescence in the negative control. Figure 471 shows flow cytometry analysis of NFAT-ZsGreen expression (MFI) of transduced T-cells isolated from tumors in vivo. WT mice were s.c. injected with 1 million MCA205 or MCA205 hTREM2 tumor cells per flank (day 0). Mice were intraperitoneal treated with 200 mg / kg Cyclophosphamide on day 6. The next day 10 million CD45.1+ T cells double transduced with NFAT-ZsGreen and BFP control vector or double transduced with NFAT-ZsGreen and hTREM2 CAR, were adoptively transferred via intravenous administration and harvested on day 14 (n=7). Statistical significance was assessed by Anova (* p
[0268] < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).
[0269] FIG. 48 is a schematic illustration of a typical enhancer in a resident macrophage in steady state conditions (Left) and a typical enhancer in tumor macrophages in three different scenarios within the tumor microenvironment. The cell type specific motifs are what drive the cell fate program of the macrophage and its active in all conditions (shown in green) bound by corresponding transcription factors. Once the macrophage migrates to the tumor, it can seed different niches across the tumor microenvironment where it responds to niche specific signals (Niche A-C) and activate different signaling specific motifs (Combinations of red, blue and yellow) across a multitude of enhancers.
[0270] DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0271] The present invention, in some embodiments thereof, relates to immune cells expressing an inducible therapeutic agent and uses thereof.
[0272] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
[0273] Specific embodiments of the present invention suggest a novel cell therapy based on immune cells genetically modified to express a therapeutic payload. The payload is expressed from a synthetically programmed nucleic acid construct which comprises elements that selectively induce expression of the payload in a pathologic environment (e.g., following activation and / or exhaustion of the immune cell, in a tumor microenvironment, in an autoimmune environment etc.), also referred to herein as “TROJAN regulatory circuit”. Specific embodiments also suggest genetically modifying the immune cells to express a chimeric receptor that can be used as a targeting and / or activating moiety.
[0274] As is illustrated hereinunder and in the examples section, which follows, using a variety of single-cell sequencing techniques, the present inventors uncovered a myriad of sequences in the intergenic region of chromatin which bind to proteinaceous binding factors in a pathologic environment and not in a healthy microenvironment (see Examples 1-5 of the Examples section which follows). Consequently, the present teachings suggest that such sequences, and especially the enhancer elements comprised therein, are useful in controlling the expression of therapeutic agents selectively at the site of pathology; and thus, the genetically modified cells will prove useful in controlling the expression of therapeutic agents selectively at the site associated with the pathology, ensuring targeted response when it is needed most (as also exemplified in the Examples section which follows).
[0275] Thus, according to an aspect of the present invention, there is provided a nucleic acid construct comprising at least one expression regulatory element comprising an enhancer operably linked to a heterologous nucleic acid sequence encoding a therapeutic agent, wherein said expression regulatory element is of a gene which expression is increased in an immune cell subjected to a pathologic environment relative to a non-pathologic environment.
[0276] A "vector" or "construct" is a nucleic acid sequence used to introduce heterologous nucleic acids into a cell that can also have regulatory elements to provide expression of the heterologous nucleic acids in the cell.
[0277] According to specific embodiments, the construct is a single construct.
[0278] According to other specific embodiments, the construct is a construct system, i.e., at least two distinct polynucleotides, as further disclosed hereinbelow.
[0279] As used herein the term “polynucleotide” or “nucleic acid sequence” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and / or a composite polynucleotide sequence (e.g., a combination of the above). This term includes polynucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide molecules composed of naturally occurring bases, sugars, and covalent intemucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and / or oligonucleotides having non-naturally occurring portions, which function similarly to the respective naturally occurring portions. Such a modified polynucleotide may comprise modification in either backbone, intemucleoside linkages or bases. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. The term "nucleic acid molecule" also includes "peptide nucleic acids," which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone.
[0280] According to specific embodiments, the nucleic acid construct or system includes at least one cis-acting regulatory element for directing expression of the nucleic acid sequence.
[0281] As used herein, the term "regulatory element for directing expression of the nucleic acid sequence” or “expression regulatory element” refers to a cis-acting nucleic acid sequence that modulates transcription of an operably linked coding nucleic acid sequence via binding of one or more transcription factors (TFs). Expression regulatory elements include, but are not limited to, promoters and enhancers, each comprising one or more transcription factor binding motifs.
[0282] Any of the expression regulatory elements described herein may be a regulatory sequence of a native gene (e.g., of a gene which expression is increased in a pathologic environment), a natural homolog of a native regulatory sequence, or a synthetic sequence. Such synthetic regulatory sequences may comprise engineered or consensus (i.e., a motif sequence not necessarily derived from a native gene) transcription factor binding sites, for which a single or multiple repeats may be present, or a combination of two or more regulatory sequences that are heterologous to each other. Such heterologous domains may originate from the same gene (albeit e.g., in different locations), from different genes or species, or may be completely synthetic (non-naturally occurring).
[0283] According to specific embodiments, the regulatory element is heterologous to the nucleic acid sequence whose expression it regulates.
[0284] Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions.
[0285] Thus, for example, a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner is included in the nucleic acid construct. Suitable promoters include, but are not limited to; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; a metallothionein-I promoter; and various art-known promoters. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g., metallothionein promoter systems, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzo thiadiazole regulated promoters, etc.), temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
[0286] According to specific embodiments, the promoter is a constitutive promoter. According to other specific embodiments, the promoter is an inducible promoter.
[0287] In some instances, the nucleic acid constructs comprise immune cell specific promoters that are expressed in one or more immune cell types, including but not limited to lymphocytes, hematopoietic stem cells and / or progeny thereof (i.e., immune cell progenitors), etc. Any convenient and appropriate promoter of an immune cell specific gene may find use in the constructs of the present disclosure. In some instances, the immune cell specific promoter is a T cell specific promoter. Examples of T cell specific promoters include lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733]. In some instances, the immune cell specific promoter is a light and / or heavy chain immunoglobulin gene promoter. In some instances, the immune cell specific promoter of the nucleic acid construct is a promoter of a B29 gene promoter, a CD 14 gene promoter, a CD43 gene promoter, a CD45 gene promoter, a CD68 gene promoter, a IFN[3 gene promoter, a WASP gene promoter, a T-cell receptor [3-chain gene promoter, a V9y(TRGV9) gene promoter, a V25 (TRDV2) gene promoter, and the like. In some instances, the promoter present in the nucleic acid constructs of the present disclosure may be a viral promoter expressed in immune cells. As such, in some instances, viral promoters useful in the nucleic acid constructs include viral promoters derived from immune cells viruses, including but not limited to, e.g., lentivirus promoters (e.g., HIV, SIV, FIV, EIAV, or Visna promoters) including e.g., LTR promoter, etc., Retroviridae promoters including, e.g., HTLV-I promoter, HTLV-II promoter, etc., and the like.
[0288] According to specific embodiments, the promoter is a strong promoter.
[0289] Non-limiting examples of such promoters are PGK promoter, EFla promoter, SFFV promoter and CMV promoter.
[0290] According to specific embodiments, the promoter is of the MSGV gamma-retrovirus plasmid which comprises a strong promoter activity in the 5’ LTR [described by the lab of Steven Rosenberg (Rosenberg SA. Et al. Blood. 2010 Nov 11 ; 116(19):3875-86. doi: 10.1182 / blood-2010- 01-265041. Epub 2010 Jul 14. PMID: 20631379; PMCID: PMC2981541) and also published on addgene - https: / / www.addgene.org / Steven_Rosenberg / , the contents of which are fully incorporated herein by reference].
[0291] According to other specific embodiments, the promoter is a weak promoter.
[0292] Non-limiting examples of such promoters are minimal promoters (also known as core promoters) with low baseline activity, such as the minimal TATA-box promoter (e.g., SEQ ID NO: 85) and the minimal CMV promoter (e.g., SEQ ID NO: 971). According to specific embodiments, the promoter is as set forth in SEQ ID NOs: 85, 71 or 971.
[0293] Typically, such minimal promoters need one or more related enhancer elements to induce robust gene expression. A detailed description on such promoters is provided in Zabidi MA and Stark A. Trends Genet. 2016 Dec;32(12):801-814. doi: 10.1016 / j.tig.2016.10.003. Epub 2016 Nov 2. PMID: 27816209; PMCID: PMC6795546, the contents of which are fully incorporated herein by reference.
[0294] The term “enhancer element” refers to a DNA-regulatory element that activates transcription of a gene or genes to higher levels than would be the case in their absence. It is known that enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. According to specific embodiments, transcription of the nucleic acid sequence is effected only upon binding of a transcription factor to the enhancer element.
[0295] Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
[0296] Additional description on enhancer elements that can be used with some embodiments of the invention is further provided hereinbelow.
[0297] In addition, a typical cloning vector may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
[0298] Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation. Two distinct sequence elements are required for accurate and efficient poly adenylation: GU or U rich sequences located downstream from the poly adenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40. The nucleic acid construct or system of some embodiments of the invention may also include or encode a signal sequence for targeting the polypeptide to the desired site in a cell. According to a specific embodiment, the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention. According to specific embodiments the signal sequence comprises a membrane trafficking sequence. Such sequences are known in the art. Non-limiting examples of amino acid sequences of such signal sequences and nucleic acid sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ IS NOs: 1 and 46, 92 and 93.
[0299] In order to assess the expression of a polypeptide or portions thereof, the expression vector can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or transduced through viral vectors.
[0300] Further, for maximal protein expression, specific embodiments contemplate adaptation of codons of the transcript gene to the typical codon usage of a host e.g., a human. In this aspect, many synthetic genes can be designed to increase their protein expression level. The design process of codon optimization can be to alter rare codons to codons known to increase maximum protein expression efficiency. In some alternatives, codon selection is described, wherein codon selection can be performed by using algorithms to create synthetic genetic transcripts optimized for high protein yield. Programs containing algorithms for codon optimization are available and include e.g., OptimumGene™, and GeneGPSR™. In some alternatives of the methods provided herein, the vectors provided for the methods are codon optimized for expression in humans.
[0301] The expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) or a self-cleavable peptide; and sequences for genomic integration of the promoter-chimeric polypeptide.
[0302] It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the polypeptide can be arranged in a "head- to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
[0303] Various methods of producing embodiments of the present invention may be employed. For example, a vector can be directly transduced into a cell, e.g., an immune cell e.g., a T cell or a NK cell. According to specific embodiments, the vector is a cloning or expression vector, e.g., a vector including, but not limited to, one or more plasmids (e.g., expression plasmids, cloning vectors, minicircles, minivectors, double minute chromosomes), retroviral and lentiviral vector constructs. According to specific embodiments, the vector is capable of expressing the polynucleotide in mammalian e.g., human T cells.
[0304] Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
[0305] Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
[0306] Suitable recombinant expression vectors that can be used with specific embodiments of the invention include, but are not limited to, viral vectors (e.g. viral vectors based on lentivirus, vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5: 1088 1097, 1999; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (see, e.g., Ali et al., Hum Gene Ther 9:81 86, 1998, Flannery et al., PNAS 94:6916 6921, 1997; Bennett et al., Invest Opthalmol Vis Sci 38:2857 2863, 1997; Jomary et al., Gene Ther 4:683 690, 1997, Rolling et al., Hum Gene Ther 10:641 648, 1999; Ali et al., Hum Mol Genet 5:591 594, 1996; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166: 154- 165; and Flotte et al., PNAS (1993) 90: 10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., PNAS 94: 10319 23, 1997; Takahashi et al., J Virol 73:78127816, 1999); aretroviral vector (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); and the like. According to a specific embodiment, the nucleic acid construct is a lentiviral construct.
[0307] The ability to select suitable vectors for transforming immune cells (e.g., T cells, macrophages / monocytes) is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
[0308] As noted, the nucleic acid construct or system comprises a nucleic acid sequence encoding a therapeutic agent.
[0309] The nucleic acid sequence encoding the therapeutic agent of some embodiments of the invention is operably linked to a heterologous expression regulatory element comprising an enhancer, such that the regulatory element selectively enhances expression of the therapeutic agent in an immune cell subjected to a pathologic environment relative to a non-pathologic environment.
[0310] As used herein, the term “heterologous” refers to a nucleic acid sequence or an amino acid sequence which is not native to the recited sequence at least in localization or is completely absent from the native sequence of the recited sequence.
[0311] The term "amino acid" or "amino acids" is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L-amino acids.
[0312] The phrase “selectively enhancing expression” or “increased expression in an immune cell subjected to a pathologic environment” refers to an upregulation of expression (e.g., by at least 1.5 fold) in an immune cell subjected to a pathologic environment relative to the level of expression of that gene in an immune cell which is in a non-pathologic environment. It should be emphasized that exposure to a pathologic environment can be imitated by exposing the immune cell to pathologic signals (e.g., by activating the cells in-vitro or ex-vivo). Thus, the term "subjected to pathologic environment" encompasses both cells directly exposed to a pathologic environment and cells exposed to pathologic signals, in each case relative to a cell not exposed to these environments or signals. Thus, for example, the regulatory element is one that enhances expression of an operably linked therapeutic agent by at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold or even 10 fold in an immune cell subjected to a pathologic environment relative to a non- pathologic environment.
[0313] Methods of determining expression are well known in thew art included e.g., PCR, ELISA, western-blot, flow cytometry, immunostaining, immunoprecipitation, etc.
[0314] The expression regulatory element may be found in an intergenic region adjacent to a gene whose expression is up-regulated in the pathologic microenvironment. The intergenic region may be up-stream or down- steam of the gene. The intergenic region may be no more than 200, no more than 500, no more than 1000, no more than 2000, no more than 3000 or no more than 5000, no more than 10,000, no more than 20,000, no more than 30,000, no more than 40,000, no more than 50,000 or in some cases no more than 100,000 bases away from the transcriptional start or end site (depending if it is located up or down-stream of the gene).
[0315] According to specific embodiments, the expression regulatory element comprises at least 10 bases, at least 20 bases, at least 30 bases, or even at least 50 bases.
[0316] According to specific embodiments, the expression regulatory element comprises up to 1000 bases, up to 900 bases, up to 800 bases, up to 700 bases, up to 600 bases, up to 500 bases, up to 400 bases, up to 300 bases, up to 200 bases, or up to 100 bases.
[0317] In one embodiment, the expression regulatory element comprises no more than 200 bases, no more than 150 bases, no more than 100 bases or no more than 50 bases. Furthermore, the expression regulatory element may comprise no more than 200, 150, 100, or 50 contiguous bases of a sequence of a human intergenic sequence, which is found adjacent to a gene whose expression is up-regulated in the pathologic microenvironment.
[0318] Such regulatory elements comprise a transcription factor binding motif.
[0319] Many types of transcription factors that can be used with specific embodiments of the invention are known in the art. Non-limiting examples of such include STAT, NFkB, AP-1, NFAT, IRF, NFkB, MAF, NFE, NRLF2, HIF-1 alpha, HIF-2alpha, SMAD, ZEB, BATE, ZNF, KLF, PU.l, C / EBPβ, RUNX1, GATA3, T-bet (TBX21), RORyt, FOXP3, BCL11B and LEF1.
[0320] According to specific embodiments, the regulatory element comprises binding motifs for a transcription factor selected from the group consisting of STAT, NFkB, AP-1, NFAT, IRF, NFkB, MAF, NFE, HIF-1 alpha, HIF-2alpha, SMAD, ZEB, BATE and PU.l.
[0321] According to specific embodiments, the regulatory element comprises a cell-type specific transcription factor binding motif.
[0322] As used herein, the term “cell type specific transcription factor binding motif’ refers to at least a minimal cis-acting nucleotide sequence that confers transcriptional activity restricted to a particular cell type or lineage by serving as a binding site for a transcription factor that is specifically (i.e., not constitutive in any cell type) or predominantly (i.e., expressed to a higher level than in other cell types) expressed in that cell type.
[0323] According to specific embodiments, transcriptional activity conferred by the cell type specific transcription factor binding motif does not depend on cell state (e.g., activated vs. nonactivated) or environment (e.g., subjected to a pathogenic or a non-pathogenic environment). Such transcription factors are known in the art and include, for example, factors involved in immune cell lineage specification and maintenance. Non-limiting examples of macrophagespecific motifs include those bound by PU.l, MAF, ZNF, FLF, IRF8, CZEBPP, and RUNX1; T cell-specific motifs include, but not limited to those bound by GATA3, T-bet (TBX21), RORyt, FOXP3, BCL11B, and LEF1. .
[0324] According to specific embodiments, the regulatory element comprises a signal-responsive transcription factor binding motif.
[0325] As used herein, the term “signal-responsive transcription factor binding motif’ refers to at least a minimal cis-acting nucleotide sequence that confers transcriptional activity restricted to a particular signaling pathway by serving as a binding site for a transcription factor whose amount and / or activity (e.g., binding activity) is upregulated (e.g., by at least 2 fold, 5 fold or even 10 fold) in an immune cell subjected to a pathologic environment relative to a non-pathologic environment.
[0326] Thus, the transcriptional activity conferred by the signal-responsive transcription factor binding motif, is dependent on cell state or environment.
[0327] Such transcription factors are known in the art and include, for example, factors induced following activation and / or exhaustion of the immune cell, or in response to environmental cues such as those present in a tumor microenvironment, an autoimmune setting, or an inflammatory lesion. Non-limiting examples include transcription factors such as STAT, NF-KB, AP-1, NF AT, IRF, HIF-1α, HIF-2α, SMAD, BATF, ZEB, NFE2 and NRLF2.
[0328] Methods of determining an increase in amount and / or activity of a transcription factor are well known in the art, and include, but are not limited to, expression assays such as PCR, Western blot, immunoprecipitation and immunohistochemistry; and activity assays such as electrophoretic mobility shift assay (EMSA) and reported genes assays.
[0329] Thus, the regulatory element of some embodiments of the invention includes a sequence that binds a transcription factor whose amount and / or activity is upregulated in an immune cell subjected to a pathologic environment.
[0330] According to specific embodiments, the regulatory element comprises at least one signal- responsive transcription factor binding motif and at least one cell type specific transcription factor binding motif. A schematic representation of this concept is presented in Figure 48 using regulatory elements associated with TAMs.
[0331] According to specific embodiments, the regulatory element comprises at least 1 transcription factor binding motif. According to specific embodiments, the regulatory element comprises at least 2, at least 3, at least 4, at least 5 or at least 6 transcription factor binding motifs. The consensus sequences of such motifs are known in the art and depend on the transcription factor. Thus, for examples for STAT the consensus motif is xxTTTCxxTTTT(C)C(T)C(T) (SEQ ID NO: 1095), for IRF, the consensus motif is C(G)TTTC(G)xxTTTCCxxxx (SEQ ID NO: 1096), for NfkB the consensus motif is xGGGxTTCCC, for MAF the consensus motif is xxxTGACTAGCxxx, for NFE the consensus motif is xxxxxTGAC(G), and for API the consensus motif is TGACTCA.
[0332] In some embodiments, the transcription factor binding motif comprises a tandem or palindromic sequence recognized by a homodimeric transcription factor, such as motifs bound by homodimers of NF-KB subunits or other symmetric TFs.
[0333] In other embodiments, the motif comprises a composite or bipartite motif comprising two adjacent or spaced recognition sequences that are cooperatively bound by distinct transcription factors, often in the form of heterodimeric complexes or higher-order assemblies. Composite motifs commonly involve transcription factors from different families, such as AP-1, IRF, and NFAT, and may include arrangements such as IRF:AP-1, NFATJRF, and NFAT:AP-1. Nonlimiting examples of such motifs are further described in Example 5 of the Examples section which follows.
[0334] In one embodiment, the regulatory element does not comprise a sequence to which the following transcription factors may bind: SNAI3, SNAI2, ZEB1, Rbpjl, Ddit3:Cebpa, cebp-1, CEBPA, CEBPB, CEBPD, CEBPE, CEB PG, HLF, NFIL3, Pdpl and slbo.
[0335] It should be emphasized that, as noted hereinabove, the regulatory element (e.g., enhancer) may be a native regulatory element (e.g., enhancer) or a synthetic one comprising at least the transcription factor binding motif.
[0336] It will be appreciated that the present invention also contemplates using more than one regulatory element for controlling the expression of the therapeutic agent in a pathologic-specific fashion in the immune cell. Thus, the nucleic acid construct may comprise 1, 2, 3, 4, 5, or more regulatory elements. Each of the regulatory elements may be situated adjacent to an identical gene, or may be situated adjacent to different genes, wherein expression of the genes are selected as being specifically up-regulated in a pathologic specific manner in immune cells. In one embodiment the regulatory element comprises binding sites for at least two, three, four or five transcription factors (which are upregulated in a pathologic microenvironment), wherein the regulatory elements are selected such that they bind to transcription factors of non-identical signaling pathways.
[0337] The term "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, an enhancer is operably linked to a coding sequence if the enhancer affects its transcription or expression. Operably linked nucleic acid sequences may but need not necessarily be adjacent. For example, in some instances a coding sequence operably linked to an enhancer may be adjacent to the enhancer. In some instances, a coding sequence operably linked to an enhancer may be separated by one or more intervening sequences, including coding and non-coding sequences. Also, in some instances, more than two sequences may be operably linked including but not limited to e.g., where two or more coding sequences are operably linked to a single enhancer.
[0338] Thus, the regulatory element of some embodiments of the invention comprises an enhancer of a gene which expression is increased in an immune cell subjected to a pathologic environment.
[0339] According to specific embodiments, the expression regulatory element (e.g., enhancer) is of a gene which expression is increased in a tumor associated macrophage (TAM) relative to a macrophage not in a tumor environment.
[0340] As used herein, the phrase "tumor microenvironment" (TME) refers to the tumorsurrounding environment that interacts (directly or indirectly) with tumor cells. A tumor microenvironment plays a role in disrupting the cancer immunity cycle and plays a critical role in multiple aspects of cancer progression. For example, the TME can decrease drug penetration, confer proliferative and anti-apoptotic advantages to surviving cells, facilitate resistance without causing genetic mutations and epigenetic changes, and collectively modify disease modality and distort clinical indices. For example, the tumor microenvironment can include the cellular environment of the tumor, surrounding blood vessels, immune cells, fibroblasts, bone marrow derived inflammatory cells, lymphocytes, signaling molecules and the extracellular matrix. The tumor microenvironment can also include tumor-infiltrating immune cells such as lymphoid and myeloid cells, which can stimulate or inhibit the antitumor immune response and stromal cells such as tumor-associated fibroblasts and endothelial cells that contribute to the tumor's structural integrity. Stromal cells can include cells that make up tumor-associated blood vessels, such as endothelial cells and pericytes, which are cells that contribute to structural integrity (fibroblasts), as well as tumor-associated macrophages (TAMs) and infiltrating immune cells including monocytes, neutrophils (PMN), dendritic cells (DCs), T and B cells, mast cells, and natural killer (NK) cells. The stromal cells make up the bulk of tumor cellularity while the dominating cell type in solid tumors is the macrophage.
[0341] The tumor microenvironment can also comprise micro-niches in which the niches are well perfused and oxygenated or poorly perfused and hypoxic. In the case in which the niche is poorly perfused and hypoxic, the niche can be particularly dangerous to the host as it can harbor resistant tumor cells that can survive a nutrient and oxygen deprived environment. The tumor can influence its surrounding environment to be immunosuppressive by the release of extracellular signals, promoting tumor angiogenesis, for example, by the upregulation of VEGF, and induce peripheral immune tolerance.
[0342] This concept is further illustrated in Figure 48, which schematically depicts a representative enhancer in a resident macrophage under steady-state conditions vs. TAMs residing in different tumor microenvironmental niches.
[0343] Exemplary genes that are up-regulated in TAMs as compared to tissue macrophages or monocytes include, but are not limited to, Btgl, C9, Ccl4, Cd2ap, Cldnl, Cldnl6, Csflr, Cx3crl, Cxcll l, Cxcl2, Dcstamp, Dock4, Dusp2, Dusp4, Fcho2, Fgfr2, Filipll, Fmnl2, Hdac2, Hilpda, Hmgal, Husl, Igfl, Illa, I17r, Itgax, Itgb5, Itgb7, Lhfpl2, Lrpl, Mepe, Metrnl, Mucl3, Ndrgl, Nfatc2, Nr4a3, Nrpl, Pdgfrb, Pdpn, Pfkp, Pgsl, Ptgs2os2, Rab31, Rap2b, Rel, Sbf2, Slamf7, Slc2al, Slc30a4, Socs3, Sox5, Spef2, Tefm, Tg, Tgfbi, Tgfbrl, Trem2, Tremll, Zscan2.
[0344] According to a specific embodiment, the gene is selected from the group consisting of TREM2, SPP1, IL7R, IL4I1 and APOE.
[0345] Exemplary expression regulatory elements uncovered by the present inventors which have been found in genes exclusively expressed in human tumor associated macrophages (TAMs) but not in human monocytes and human resident macrophages, and can be used with specific embodiments of the invention are provided in SEQ ID NOs: 104-970 and 1017.
[0346] It will be appreciated that SEQ ID NOs: 104-696 comprise the adaptor sequences used for library processing (SEQ ID NOs: 1106-1107). To render explicit, the expression regulatory elements contemplated do not comprise these adaptors, and hence the sequences without the adaptors are also provided herein as SEQ ID NOs: 1108-1973.
[0347] The length of the nucleic acid sequence varies according to the number of DNA base pairs covering the accessible chromatin site. Genomic coordinates and chromosome numbers of each and every element are listed in Table 4 hereinbelow. Computational analysis of these sequences revealed the presence of multiple transcription factor binding motifs (see Table 4 hereinabove) which can be used with specific embodiments of the invention. Thus, according to specific embodiments, the at least one regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1108-1973, 970 and 1017, each possibility represents a separate embodiment of the present invention.
[0348] According to specific embodiments, the expression regulatory element (e.g., enhancer) is of a gene which expression is increased following activation and / or exhaustion of a T cell.
[0349] As used herein, the terms "activation of a T cell" refers to the process of stimulating a T cell that results in cellular proliferation, differentiation, and / or induction of effector functions. These effector functions may include for example cytotoxicity, helper T cell functions, and the production of various cytokines.
[0350] As used herein, the terms "exhaustion of a T cell" refers to a state of functional impairment of a T cell exposed to persistent activation or antigen stimulation, manifested by loss of the ability to proliferate and / or exert its effector function (e.g., cytotoxicity, helper T cell functions, and the production of various cytokines).
[0351] Methods of determining T cells activation and / or exhaustion are known in the art and are further described herein.
[0352] According to specific embodiments, activation of the immune cell is manifested by activation of an IL-2 receptor (IL-2R) signaling cascade.
[0353] Thus, according to specific embodiments, the expression regulatory element (e.g., enhancer) is of a gene downstream of IL-2 signaling.
[0354] Exemplary genes downstream of IL-2 signaling that can be used with specific embodiments of the invention include, but not limited to, IL2RA, LTA, SOCS1, Cish, Socs2, Socs3, Osm, Idl, and IL24.
[0355] According to specific embodiments, the gene is selected from the group consisting of IL- 2RA, LTA and SOCSl.
[0356] Exemplary expression regulatory elements uncovered by the present inventors to be sensitive to IL-2 signaling that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 60-63, ttcaaagaa, tccagtgaa, ttcgtggag, ttcagggaa, ttcccagag, ttcccagaa and tgccaagaa.
[0357] Exemplary genes that are up-regulated following activation and / or exhaustion of T cells include, but are not limited to,_HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB 1, GZMB, PRF1, CD244, IFNG, CD83, SLAMF6, XCL1, CRTAM, EBI3, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB1, PSMA1, TANK, SUB 1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3 and PMF1.
[0358] According to specific embodiments, the gene is selected from the group consisting of HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB1, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB 1, PSMA1, TANK, SUB1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3 and PMF1. According to specific embodiments, the gene is selected from the group consisting of HAVCR2, KLRC1, ENTPD1, CSF1, PDCD1, GZMA, , GZMB, PRF1, CD244, IFNG, CD83, SLAMF6, XCL1, CRTAM, EBI3, MKI67, LGALS3, TOX, TIGIT, TNFRSF9, IE2RB, EAG3, CTEA4, ITM2A, GCNT1, ACOT7, NEDD9, HMGB2, SDF2E1, ETFB, EZH2, and PMF1.
[0359] Exemplary expression regulatory elements uncovered by the present inventors in genes increased following activation and / or exhaustion of T cells are provided SEQ ID Nos: 1054-1067.
[0360] Exemplary synthetic regulatory elements that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 1098-1104.
[0361] According to specific embodiments, the expression regulatory element (e.g., enhancer) is of a gene downstream of TNFa signaling.
[0362] Exemplary genes downstream of TNFa signaling that can be used with specific embodiments of the invention include, but not limited to, TNFAIP3, Nfkbia, Nfkb2, Ldha, Tnfrsflb, Irfl, Ltb and Junb.
[0363] According to specific embodiments, the gene is TNFAIP3.
[0364] Exemplary expression regulatory elements uncovered by the present inventors to be sensitive to TNFa signaling that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 1022-1052.
[0365] According to specific embodiments, the expression regulatory element further comprises a promoter operably linked to the nucleic acid sequence encoding the therapeutic agent.
[0366] Typically, to allow selective expression of the therapeutic agent in the pathologic environment, such a promoter is not a constitutive promoter nor a strong promoter.
[0367] According to specific embodiments, the promoter is a weak promoter.
[0368] According to specific embodiments, the promoter is a minimal promote.
[0369] According to specific embodiments, the promoter is heterologous to the enhancer. To render explicit, according to specific embodiments, the promoter and the enhancer do not belong to the same gene.
[0370] According to specific embodiments, the promoter is heterologous to the therapeutic agent.
[0371] Non-limiting examples of promoters that can be used with specific embodiments of the invention are provided in SEQ ID NO: 971, 85 and 71. Additional description on promoters is provided hereinabove.
[0372] The nucleic acid construct of some embodiments of the invention may further comprise a nucleic acid sequence encoding a targeting receptor comprising a transmembrane domain and an extracellular binding domain to a target associated with the pathologic environment. According to specific embodiments, the targeting receptor and the therapeutic agent are expressed from distinct constructs. Under this scenario, the construct is a construct system.
[0373] According to other specific embodiments, the targeting receptor and the therapeutic agent are expressed from a single construct in a multicistronic e.g., bicistronic manner. Such an expression can be achieved by methods well known in the art such as, but not limited to, using internal ribosome entry site (IRES) sequence and / or a nucleic acid sequence encoding a self- cleavable peptide e.g., a 2A peptide (e.g., P2A, T2A, E2A).
[0374] According to a specific embodiment, the targeting receptor and the therapeutic agent are transcribed from different cis-acting regulatory elements operatively attached therewith. Thus, for example, in order to ensure induced expression of the therapeutic agent only following binding of the targeting receptor to its target, the regulatory element, e.g., a promoter, which drives transcription of the targeting receptor is selected stronger and less specific than that of the therapeutic agent. For example, a constitutive regulatory element for driving expression of the targeting receptor and an inducible regulatory element (e.g., comprising a weak inducible promoter necessitating an enhancer element) for expression of the therapeutic agent. In a specific embodiment, such a configuration is designed in a single nucleic acid construct or from different nucleic acid constructs. Additional description on such regulatory elements is provided hereinabove and below.
[0375] According to specific embodiments, when both the targeting receptor and the therapeutic agent are configured on a single nucleic acid construct the nucleic acid sequence encoding the therapeutic agent is 5’ to the nucleic acid sequence encoding the targeting receptor.
[0376] According to specific embodiments, the targeting receptor is a native receptor; i.e., the extracellular, transmembrane and intracellular domains of the receptor are endogenous to each other. Non-limiting examples of such receptors include, but not limited to T cell receptor (TCR), Fc receptor, cytokine receptor etc.
[0377] According to other specific embodiments, the targeting receptor is a chimeric receptor.
[0378] As used herein, the term “chimeric receptor” or “chimeric polypeptide”, also known as “fusion receptor”, refers to a cell surface receptor comprising an amino acid sequence having two or more amino acid sequences which are not found together as a single protein expression product in nature, in other words they are heterologous to one another. The targeting receptor disclosed herein comprises an extracellular binding domain.
[0379] As used herein, the phrase “extracellular binding domain” refers to a proteinaceous moiety having a binding affinity (e.g., below 10’4nM) to a target of interest (e.g., a target associated with a pathologic environment). Non-limiting examples of binding domains include the binding domain of a receptor, the binding domain of a ligand, the binding domain of a hormone (e.g., leptin), and an antigen binding moiety such an antibody, as further described hereinbelow.
[0380] Assays for testing binding are well known in the art and include, but not limited to flow cytometry, bio-layer interferometry Blitz® assay, HPLC, surface plasmon resonance (e.g., Biacore).
[0381] According to specific embodiments, the extracellular binding domain binds the target with a Kd <10-6M, <10-7M, <10-8M or <10-9M, each possibility represents a separate embodiment of the present invention.
[0382] According to specific embodiments, the extracellular binding domain binds the target with a Kd <10’9M.
[0383] According to specific embodiments, the binding domain is of an antibody and the target is an antigen.
[0384] The term "antibody" as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen).
[0385] As used herein, the term "epitope" refers to any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.
[0386] According to specific embodiments, the antibody is an antibody fragment.
[0387] According to a specific embodiment, the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab')2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VE that are capable of binding to an epitope of the antigen in an HEA restricted manner.
[0388] Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv (scFv), a disulfide-stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2, or antibody fragments comprising the Fc region of an antibody.
[0389] According to specific embodiments, the identity of the amino acid residues in the antibody that make up the variable region and / or the CDRs is determined by the method of Kabat et al. (See, e.g., Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington D.C.).
[0390] Functional antibody fragments comprising whole or essentially whole variable regions of both light and heavy chains are defined as follows:
[0391] (i) Fv, defined as a genetically engineered fragment consisting of the variable region of the light chain (VL) and the variable region of the heavy chain (VH) expressed as two chains;
[0392] (ii) single chain Fv (“scFv”), a genetically engineered single chain molecule including the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
[0393] (iii) disulfide- stabilized Fv (“dsFv”), a genetically engineered antibody including the variable region of the light chain and the variable region of the heavy chain, linked by a genetically engineered disulfide bond.
[0394] (iv) Fab, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme papain to yield the intact light chain and the Fd fragment of the heavy chain which consists of the variable and CHI domains thereof;
[0395] (v) Fab’, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab’ fragments are obtained per antibody molecule);
[0396] (vi) F(ab’)2, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin (i.e., a dimer of Fab’ fragments held together by two disulfide bonds);
[0397] (vii) Single domain antibodies or nanobodies are composed of a single VH or VL domains which exhibit sufficient affinity to the antigen; and
[0398] (viii) Fcab, a fragment of an antibody molecule containing the Fc portion of an antibody developed as an antigen-binding domain by introducing antigen-binding ability into the Fc region of the antibody.
[0399] According to specific embodiments, the extracellular binding domain capable of binding the target comprises a scFv.
[0400] Methods of producing polyclonal and monoclonal antibodies as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
[0401] It will be appreciated that for human therapy, humanized antibodies are preferably used. According to specific embodiments, the antibody is a humanized antibody. Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigenbinding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
[0402] Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
[0403] According to specific embodiments, the antibody is a human antibody.
[0404] Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boemer et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boemer et al., J. Immunol., 147(l):86-95 (1991)]. Similarly, human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio / Technology 10,: 779-783 (1992); Lonberg et al., Nature 368: 856- 859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845- 51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).
[0405] According to specific embodiments, the extracellular binding domain is of a ligand and the target is a receptor of the ligand. Non-limiting examples of such ligand - receptor pairs that can be used with some embodiments of the invention (e.g. for targeting cancerous cells) include a ligand of a tyrosine kinase receptor - tyrosine kinase receptor, GPNMB / EGF - EGFR, CD 19 ligand - CD 19, GPNMB / hyaluronic acid - CD44, CD27- CD70, IL-11 - IL-1 IRa, IL- 10 - IL-10R, IL13 - IL - 13Ra2, Adnectin - EGFR, FLT3L - FLT3, GM-CSF - GMR, TPO - MPL-R, IL-2 - IL-2R, TNFa - TNF receptor 1 (TNFR1) and TNF receptor 2 (TNFR2), aTREM2 - TREM2, TGFp - TGFBR.
[0406] According to other specific embodiments, the extracellular binding domain is of a receptor and the target is a ligand of the receptor. Non-limiting examples of such receptor - ligand pairs that can be used with some embodiments of the invention (e.g., for targeting cancerous cells) include TCR - peptide / MHC complex, FC receptor - Fc ligand, PD- 1 - PDL- 1 , CD 137 - CD 137L, integrin alpha2betal - E-Cadherin, TNF receptor 1 (TNFR1) / TNF receptor 2 (TNFR2) - TNFa.
[0407] Additional examples of extracellular binding domains that can be used with specific embodiments of the invention as described in Ramirez-Chacon A, et al. Front Immunol. 2022 Sep 12;13:932559. doi: 10.3389 / fimmu.2022.932559, the contents of which are fully incorporated herein by reference.
[0408] According to specific embodiments, the target of the extracellular binding domain is associated with a pathology. Selection of the target used is well within the capability of those skilled in the art, and depends on the type of the disease and the antigens associated with the pathology. Additional description on such pathologies and the respective targets is further provided hereinbelow. Thus, for example, TREM2, GPNMB, CTLA4 and SPP1 may be used as the targets of some embodiments of the invention. These targets can be used e.g., for the treatment of cancer.
[0409] Thus, according to specific embodiments, the extracellular binding domain is the antigen binding domain is an anti-TREM2, anti-GPNMB, anti-CTLA4 or an anti-SPPl antibody.
[0410] According to specific embodiments, the extracellular domain is an anti-TREM2 antibody.
[0411] Non-limiting examples of amino acid sequences of anti-TREM2 antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 88-91.
[0412] Non-limiting examples of anti-GPNMB, anti-CTLA4 and anti-SPPl antigens antigen binding domains that can be used with specific embodiments of the invention are of commercially available antibodies obtained from e.g., eBioscience™ / ThermoFisher Scientific (GPNMB monoclonal antibody HOST5DS, CTLA4 monoclonal antibody UC10-4B9) and Bioxcell (SPP1 monoclonal antibody, cat. No. BE0382.
[0413] Other non-limiting exemplary targets that can be used with some embodiments of the invention include, Aβ, TDP-43 and / or Myelin Oligodendrocyte Glycoprotein (MOG). These targets can be used e.g., for the treatment of Alzheimer’s disease, ALS and / or multiple sclerosis.
[0414] Thus, according to specific embodiments, the extracellular binding domain is the antigen binding domain of an anti-Aβ, anti-TDP-43 and / or anti-MOG antibody.
[0415] Non-limiting examples of amino acid sequences of anti-Aβ antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 2-4 and 57.
[0416] Non-limiting examples of amino acid sequence of anti-MOG antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 5-10 and 47-48.
[0417] Non-limiting examples of amino acid sequences of anti-TDP-43 antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 11-13 and 56.
[0418] Other non-limiting exemplary targets that can be used with some embodiments of the invention include PD-1, IL23R, CXCR6 and CXCR3. These targets can be used e.g., for the treatment of autoimmune diseases e.g., rheumatoid arthritis (RA) and multiple sclerosis (MS).
[0419] According to specific embodiments, the extracellular domain is an anti-PD-1, anti-IL23R, anti-CXCR6 or anti-CXCR3 antibody.
[0420] According to specific embodiments, the extracellular domain is an anti-PD-1 antibody. Non-limiting examples of amino acid sequences of anti-PDl antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 94-95 and 98-99.
[0421] Non-limiting examples of amino acid sequences of anti-IL23R antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are described in https: / / patents.justia.com / patent / 20240376217.
[0422] Non-limiting examples of amino acid sequences of anti-CXCR6 antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are described in Australian Patent Application Publication No. AU2022281461.
[0423] Non-limiting examples of amino acid sequences of anti-CXCR3 antigen binding domains and nucleic acids sequences encoding same that can be used with specific embodiments of the invention are described in Japanese Patent No. JP6646100.
[0424] The targeting receptor disclosed herein further comprises a transmembrane domain.
[0425] According to specific embodiments, the transmembrane domain is heterologous to the extracellular binding domain and / or the intracellular signaling domain.
[0426] According to specific embodiments, the transmembrane domain is endogenous to the extracellular binding domain.
[0427] According to specific embodiments, the transmembrane domain is endogenous to the intracellular signaling domain.
[0428] Non-limiting examples of transmembrane domains that can be used with specific embodiments of the invention include an alpha, beta or zeta chain of a T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD64, CD80, CD86, CD134, CD137 (4-1BB), TNFSFR25, CD154 and IE-2R, their sequences are well known to the skilled in the art.
[0429] According to specific embodiments, the transmembrane domain is of a protein selected from the group consisting of CD8, CD28, 4- IBB and IE-2R.
[0430] Non-limiting examples of amino acid sequences of CD8 transmembrane domains and nucleic acid sequences encoding same that can used with specific embodiments of the invention are provided in SEQ ID NOs: 16-17 and 50-51.
[0431] A non-limiting example of an amino acid sequence of CD28 transmembrane and intracellular domains and nucleic acid sequences encoding same that can used with specific embodiments of the invention are provided in SEQ ID NOs: 15 and 49. According to specific embodiments, the targeting receptor is capable of forming a dimer. The dimer may be a homodimer or a heterodimer. According to specific embodiments, the dimer is a homodimer.
[0432] Thus, according to specific embodiments, the targeting receptor comprises a dimerizing moiety.
[0433] According to a specific embodiment, the targeting receptor comprises a dimerizing moiety such that the receptor is expressed in the cell as a homodimer.
[0434] As used herein, the term “dimerizing moiety” refers to an amino acid sequence capable of forming a polypeptide dimer. Such an amino acid may include for example an amino acid sequence comprising at least two cysteine residues enabling the formation of a disulfide bond between the thiol groups. Methods of determining dimerization are known in the art, including but not limited to immunoprecipitation, size exclusion chromatography, fast protein liquid chromatography (FPLC), multi-angle light scattering (SEC-MALS) analysis, SDS-PAGE analysis, nano-DSF, yeast two-hybrid system (e.g., RRS) and flow cytometry.
[0435] It will be appreciated that the dimerizing moiety of some embodiments of the invention is also capable of forming multimers (e.g., at least three).
[0436] Any known dimerizing moiety known in the art can be used with specific embodiments of the invention. According to specific embodiments, the dimerizing moiety is comprised in the transmembrane domain of the targeting receptor. Non-limiting examples of such transmembrane domains are disclosed hereinabove.
[0437] According to specific embodiments, the targeting receptor disclosed herein further comprises an intracellular signaling domain. According to specific embodiments, the intracellular domain is heterologous to the extracellular binding domain.
[0438] “Intracellular signaling domain”, as used herein refers to a domain that upon binding of the extracellular binding domain to its target, initiates a signaling cascade in an immune cell expressing the targeting receptor. Such signaling domains are well known in the art and nonlimiting examples are further provided in details infra.
[0439] To render explicit, according to specific embodiments, the targeting receptor disclosed herein does not comprise a proteolytic cleavage site that is exposed upon binding of the extracellular domain to its target to induce a release of a portion of the intracellular domain into the cytoplasm. Thus, according to specific embodiments, the intracellular signaling domain does not require proteolytic cleavage for activation (i.e., signaling activity does not depend on a protease). In other words, according to specific embodiments, the receptor disclosed herein does not read on a configuration of a SynNotch-based receptor [described in e.g., US Patent No. US9670281, US Patent Application Publication NO. US20210032661, International Patent Application Publication No. WO2022204326, Roybal, Kole T. et al. Cell, Volume 167, Issue 2, 419 - 432. el6, Axel Hyrenius-Wittsten et al. Sci. Transl. Med. 13,eabd8836(2021), Joseph H. Choe et al. Sci. Transl. Med.l3,eabe7378(2021)], wherein the receptor comprises a proteolytic cleavage site that is exposed upon binding the extracellular domain to its target, to thereby induce cleavage of a portion of the intracellular domain that functions as a transcription factor regulator. Thus, according to specific embodiments, the signaling domain is not derived from a Notch receptor. According to specific embodiments, the intracellular signaling domain (and the targeting receptor as a whole) is devoid of an amino acid sequence of a transcription factor.
[0440] Methods of determining signaling in immune cells are well known in the art, and include, but are not limited to, enzymatic activity assays such as kinase activity assays, and expression of molecules involved in the signaling cascade using e.g., PCR, Western blot, immunoprecipitation and immunohistochemistry. Additionally or alternatively, determining signaling can be effected by evaluating cell activation or function by methods well known in the art such as, but not limited to proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation, cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, cytokine secretion assays such as intracellular cytokine staining, ELISPOT and ELISA, expression of activation markers (in T cell for example markers such as CD25, CD69, CD137, CD107a, PD1, and CD62L) using flow cytometry, and the like.
[0441] According to specific embodiments, the signaling domain is of a receptor selected from the group consisting of a ligand-gated receptor, a G-protein coupled receptor and an enzyme- linked receptor.
[0442] According to specific embodiments, the signaling domain is of a receptor tyrosine kinase.
[0443] According to specific embodiments, the signaling domain transmits an activating signal to thereby induce activation of an immune cell expressing the chimeric receptor.
[0444] As used herein, the terms “activating” or "activation" refer to the process of stimulating an immune cell (e.g., T cell, macrophage / monocyte) that results in cellular proliferation, maturation, cytokine production, chemotaxis and / or induction of effector functions.
[0445] According to specific embodiments, activation of the immune cell is manifested by activation of an IL-2 receptor (IL-2R) signaling cascade.
[0446] According to specific embodiments, the signaling domain initiates (directly or indirectly) a kinase phosphatase cascade.
[0447] According to specific embodiments, the signaling domain initiates (directly or indirectly) a kinase phosphatase cascade. According to specific embodiments, the intracellular signaling domain comprises an immunoreceptor tyrosine-based activation motif (ITAM). Non-limiting examples of ITAM containing signaling sequences include those derived from a T cell receptor (TCR) e.g., CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon; Fc receptor e.g., FcR gamma, FcR beta; CD5; CD22; CD79a; CD79b; and CD66d.
[0448] Non-limiting examples of an amino acid sequence of an intracellular signaling domain of CD3zeta and a nucleic acid sequence encoding same that can be used with some embodiments of the invention are provided in SEQ ID NOs: 20-21 and 54-55.
[0449] According to specific embodiments, the signaling domain induces cytotoxic activity of an immune cell expressing the chimeric receptor. For example, TCR cytoplasmic sequences are known to activate a number of signaling pathways, some of which lead to killing by CD8+ T cells.
[0450] According to other specific embodiments, the signaling domain does not induce cytotoxic activity of an immune cell expressing the chimeric receptor. Non-limiting examples of such sequences are the signaling domains of IL-2R and PDGFR.
[0451] According to specific embodiments, the intracellular signaling domain comprises a costimulatory receptor signaling domain.
[0452] As used herein, the phrase “co- stimulatory receptor signaling domain” refers to an amino acid sequence of a co-stimulatory molecule capable of transmitting a secondary stimulatory signal resulting in activation of an immune cell (e.g., T cell). Typically, a co-stimulatory signaling domain does not comprise an ITAM domain.
[0453] Any known co-stimulatory signaling domain can be used with specific embodiments of the present invention. Non-limiting examples of co-stimulatory signaling domains include 4-1BB, CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFAl(CDl la), CD2.
[0454] Non-limiting examples of an amino acid sequence of a transmembrane and intracellular signaling domain of CD28 and a nucleic acid sequence encoding same that can be used with some embodiments of the invention are provided in SEQ ID NOs: 15 and 49.
[0455] Non-limiting examples of an amino acid sequence of intracellular signaling domains of 4- 1BB and nucleic acid sequences encoding same that can be used with some embodiments of the invention are provided in SEQ ID NOs: 18-19 and 52-53.
[0456] According to specific embodiments, the intracellular signaling domain comprises a co- inhibitory receptor signaling domain.
[0457] As used herein, the phrase “co -inhibitory receptor signaling domain” refers to an amino acid sequence of a co-inhibitory molecule capable of transmitting an inhibitory signal that dampens or suppresses the activation of an immune cell (e.g., T cell). Any known co-inhibitory signaling domain can be used with specific embodiments of the present invention. Non-limiting examples of co-inhibitory signaling domains include PD-1, CTLA-4, LAG-3, TIM-3, BTLA and TIGIT.
[0458] According to specific embodiments, the intracellular signaling domain comprises a cytokine receptor signaling domain.
[0459] As used herein, the phrase “cytokine receptor signaling domain” refers to an amino acid sequence of a cytokine receptor capable of transmitting a stimulatory signal resulting in activation of the immune cell (e.g., T cell).
[0460] Any known cytokine receptor signaling domain can be used with specific embodiments of the present invention. Non-limiting examples of cytokine receptor signaling domains include those from IL-2R (e.g. IL2Ra, IL2Rb, or ZL2Ry that is the IL2 receptor common gamma chain), the Toll / ILl receptor homology domain (TIR) that is the signaling domain of the myd88 receptor, TNF receptor intracellular domain, IL12-Rbl intracellular domain, IL12-Rbl intracellular domain, IL23 receptor intracellular domain, IFNy receptor 1 intracellular domain, IFNy receptor 2 intracellular domain, IL1 receptor intracellular domain, ILlAcP receptor intracellular domain.
[0461] According to specific embodiments, the intracellular signaling domain comprises a growth factor receptor signaling domain.
[0462] As used herein, the phrase “growth factor receptor signaling domain” refers to an amino acid sequence of a growth factor receptor capable of transmitting a signal that promotes cell proliferation, survival, differentiation, or other cellular responses in an immune cell (e.g., T cell).
[0463] Any known growth factor receptor signaling domain can be used with specific embodiments of the present invention. Non-limiting examples of growth factor receptor signaling domains include those from EGFR, PDGFR, VEGFR, FGFR, VEGFR, CSF1R, GM-CSFR, FLT3 and c-Kit (CD 117).
[0464] According to specific embodiments, the signaling domain is of a protein selected from the group consisting of CD3zeta, CD28, 4- IBB and IL-2R.
[0465] According to specific embodiments, activation of signaling induces an increase in activity of a transcription factor. The increase in activity may be a result of increasing intrinsic activity (such as by releasing from regulation of a negative regulation, or phosphorylating or dephosphorylating it etc.) or a result of increasing an amount of the transcription factor. However, it should be emphasized that the intracellular domain does not function as a transcription factor per-se and is devoid of an amino acid sequence of a transcription factor.
[0466] Methods of determining an increase in amount and / or activity of a transcription factor are well known in the art, and include, but are not limited to, expression assays such as PCR, Western blot, immunoprecipitation and immunohistochemistry; and activity assays such as electrophoretic mobility shift assay (EMSA) and reported genes assays.
[0467] According to specific embodiments, activation of signaling induces an increase in activity of the transcription factor that binds the expression regulatory element described herein.
[0468] In one embodiment, the intracellular signaling domain increases an activity of a transcription factor directly. By directly it means that the signaling domain is upstream in a single signaling cascade in which the transcription factor is part thereof and downstream to said signaling domain. For example, when the transcription factor (e.g., STAT5) is increased by activation of the IL-2R in a T cell, the intracellular domain of the targeting receptor may comprise an IL-2R signaling domain.
[0469] In an alternative embodiment, the intracellular signaling domain increases an activity of a transcription factor indirectly. By indirectly it means that the signaling domain activates a signaling cascade that in turn activates an additional distinct and consequent signaling cascade comprising a downstream transcription factor). For example, when the transcription factor (e.g., STAT5) is increased by activation of the IE-2R in a T cell, the intracellular domain of the targeting receptor may comprise e.g., a CD3zeta domain which induces activation of the T cell to thereby activated the IE-2R signaling cascade.
[0470] Many types of transcription factors that can be used with specific embodiments of the invention are known in the art. Selection of the signaling domain and the respective transcription factor are well within the capability of those skilled in the art. Non-limiting examples of intracellular signaling domains and the respective transcription factors are provided in Table 2 hereinbelow.
[0471] According to specific embodiments, the transcription factor is selected from the group consisting of STAT, NFkB, AP-1 and NF AT.
[0472] According to specific embodiments, the transcription factor is STAT (e.g., STAT5).
[0473] Thus, according to specific embodiments, the intracellular signaling domain activates (directly or indirectly) a JAK / STAT pathway.
[0474] The JAK family of signaling proteins includes JAK1, JAK2, JAK3, and TYK2. JAKs can form homodimers or heterodimers and are responsible for phosphorylating STAT transcription factors, which then propagate the signaling cascade. The STAT family includes STAT1 through STAT6, with a regulatory variant known as STAT5b also identified. Once phosphorylated, STAT proteins dimerize and translocate to the nucleus to regulate gene expression. Many receptors are known to signal through JAK / STAT cascades including, but not limited to receptor tyrosine kinases (e.g. IGFRs, tEGFR / ErbB receptors, SCFR / cKit, BDNF, EphA4, VEGFR / Flt-1 and HGFR / c-Met), hormone receptors (e.g. GffR, TpoR, EpoR, Prolactin-R), cytokine receptors, several G-protein coupled receptors (e.g. AGTR-1. 5-HT2A, PAR, PAR3, PAR4, Bradykinin- RB2, PAFR, alpha adrenergic receptors, CXCR4, CCR2, CCR5, CCR1) etc. Additional examples of intracellular signaling domains activating the JAK / STAT pathway are provided in International Patent Application Publication No. WO2017075537, the contents of which are fully incorporated herein by reference.
[0475] Table 2: list of combinations of intracellular signaling domains, the transcription factors they directly or indirectly induce and corresponding enhancers
[0476] Thus, according to specific embodiments, activation of signaling induces an increase in expression of the gene the expression regulatory element described herein is derived from. In this manner, the regulatory element selectively enhances expression of the therapeutic agent following binding of the extracellular domain of the receptor to its target and activation of the signaling in the immune cell expressing it.
[0477] Selection of the gene and its expression regulatory element based on the signaling domain and the respective transcription factor are well within the capability of those skilled in the art and are further described in the Examples section which follows. For example, the enhancer may be of a gene whose expression is upregulated following activation of the native receptor comprising the intracellular signaling domain. Non-limiting examples of such combinations are provided in Table 2 hereinabove.
[0478] According to other specific embodiments, the increase in expression of the gene the expression regulatory element described herein is derived from is independent of activation of signaling via the intracellular signaling domain.
[0479] Any of the components comprised in a single polypeptide (e.g., the targeting receptor) as described herein may be linked to each other directly of via a linker, each possibility represents a separate embodiment of the present invention. Any linker known in the art can be used with specific embodiments of the invention.
[0480] According to specific embodiments, the linker may be derived from naturally-occurring multi-domain proteins or is an empirical linker as described, for example, in Chichili et al., (2013), Protein Sci. 22(2): 153-167, Chen et al, (2013), Adv Drug Deliv Rev. 65(10): 1357-1369, the entire contents of which are hereby incorporated by reference. In some embodiments, the linker may be designed using linker designing databases and computer programs such as those described in Chen et al., (2013), Adv Drug Deliv Rev. 65(10): 1357-1369 and Crasto et al., (2000), Protein Eng. 13(5):309-312, the entire contents of which are hereby incorporated by reference.
[0481] According to specific embodiments, the linker is a synthetic linker.
[0482] According to specific embodiments, the linker is a polypeptide.
[0483] Non-limiting examples of linkers that can be used include AS, GS, GGGGS (SEQ ID NO: 76), GGGGSGGGGS (SEQ ID NO: 77), GGGGSGGGGSGGGGS (SEQ ID NO: 14), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 78), (Gly)s (SEQ ID NO: 79), (Gly)6(SEQ ID NO: 80), (EAAAK)n (n=l-3) (SEQ ID NOs: 81-83), PAPAP (SEQ ID NO: 84).
[0484] Non-limiting examples of targeting receptors encompassed by specific embodiments of the invention comprise an extracellular binding domain of an antibody (e.g., anti-MOG, anti-Aβ, anti- TDP-43, anti-PD-1, anti-TREM2), a transmembrane domain of CD8 or CD28 and intracellular signaling of CD28, 4-1BB, IL-2R (e.g., IL-2Ra, IL-2RP, IL-2Ry) and / or CD3zeta.
[0485] As the present inventors generated few novel chimeric targeting receptors, according to an aspect of the present invention, there is provided a chimeric receptor comprising an extracellular binding domain of an antibody selected from the group consisting of anti-MOG, anti-Aβ, anti- TDP-43, anti-PD-1 and anti-TREM2 antibody, a transmembrane domain of CD8 or CD28 and an intracellular signaling of CD28, 4- IBB, IL-2R and / or CD3zeta.
[0486] Non-limiting examples of amino acid sequences of each of the components in the targeting receptor and nucleic acid sequences encoding same that can be used with specific embodiments of the invention are provided in Table 1 hereinbelow.
[0487] Therapeutic agents contemplated by the present invention include polynucleotide agents and protein agents (e.g., peptides, polypeptides and proteins).
[0488] Non-limiting examples of therapeutic agents that can be used with specific embodiments of the invention include antibodies, Fc-fusions, T cell engagers, toxins, cytokines, chemokines, growth factors, hormones, enzymes, neurotrophic factors, a soluble receptor, a chimeric receptor, an immune reprogramming factor, RNA silencing agents [e.g., antisense oligonucleotides (ASOs), RNA interference (RNAi)], genome editing agents and the like. Selection of the therapeutic agent used is well within the capabilities of those skilled in the art, and depends on the type of the pathology.
[0489] According to specific embodiments, the therapeutic agent is for treating the pathology.
[0490] In one embodiment, the therapeutic agent is one that modulates the immune response. Depending on the pathology being treated, the therapeutic agent may be one that suppresses the immune response (e.g., cancer) or one which increases the immune response (e.g., infections).
[0491] Such immunomodulators can include but are not limited to interleukins, cytokines, immunomodulatory antibodies, and chemokines. Examples of immune modulating agents include, but are not limited to IL-2, G-CSF, Imiquimod, CCL3, CCL26, CSCL7, TGFBRII, IL-1, IL-6, IL-7, IL-15, IL-2, IL12, IL-18, IL21, interferon alpha, interferon beta, interferon gamma, PD-1 checkpoint binding inhibitor, CCL1, CCL2, CCL3, CCR4, CCL5, CCL7, CCL8 / MCP-2, CCL11, CCL13 / MCP-4, HCC-1 / CCL14, CTAC / CCL17, CCL19, CCL22, CCL23, CCL24, CCL26, CCL27, VEGF, PDGF, lymphotactin (XCL1), Eotaxin, FGF, EGF, IP- 10, TRAIL, GCP- 2 / CXCL6, NAP-2 / CXCL7, CXCL8, CXCL10, ITAC / CXCL11, CXCL12, CXCL13 or CXCL15.
[0492] According to specific embodiments, the therapeutic agent is a cytokine.
[0493] According to specific embodiments, the therapeutic agent is a chemokine.
[0494] Non-limiting examples of chemokines and cytokines include CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL11, CXCL10, CCL13, CCL17, CCL19, CCL22, CCL23, CCL24, CCL26, CCL27, VEGF, PDGF, lymphotactin (XCL1), Eotaxin, FGF, EGF, IP-10, TRAIL, GCP-2 / CXCL6, NAP-2 / CXCL7, CXCL8, CXCL10, ITAC / CXCL11, CXCL12, CXCL13, CXCL15, FLT-3L, Fractalkine, G-CSF, GM-CSF, GRO, IL-2, IL-4, IL-10, IL-12(p40), IL-12(p70), IL-13, IL-13, IL-15, 1118A, IL-IRA, Il-la, IL-lb, 11-2, 11-3, 11-4, 11-5, 11-6, 11-7, IL-8, IL-9, TNFa, IP-10, MCP-1, MCP-3, MDC, MIP-la, MIP-lb, PDGF-AA, PDGF-BB, RANTES, TGF-. alpha., TGF-.beta., VEGF, sCD401, 6CKINE, BCA-1, CTACK, ENA78, Eotaxin-2, Eotaxin-3, 1309, IL-16, IL-20, IL-21, IL-23, IL-28a, IL-33, LIF, MCP-2, MCP-4, MIP-ld, SCF, SDF-latb, TARC, TPO, TRAIL, TSLP, CCLlra / HCC-1, CCL19 / MIP beta, CCL20 / MIP alpha, CXCL11 / 1-TAC, CXCL6 / GCP2, CXCL7 / NAP2, CXCL9 / MIG, IL-11, IL-29 / ING-gamma, M- CSF and XCLl / Lymphotactin.
[0495] According to specific embodiments, the therapeutic agent is an interleukin.
[0496] According to specific embodiments, the cytokine / interleukin is selected from the group consisting of IL-2, IL-12, IL-15, IL-18 and IL-21.
[0497] According to specific embodiments, the cytokine is selected from the group consisting of IL-2, IL-4, IL- 10, IL- 17, IL-23 and TNFa. According to specific embodiments, the therapeutic agent is a combination of at least 2, at least 3 or at least 4 cytokines / interleukins.
[0498] According to specific embodiments, the therapeutic agent is a combination of at least 2, at least 3 or at least 4 cytokines / interleukins selected from the group consisting of IL-2, IL- 12, IL- 15, IL-18 and IL-21.
[0499] According to specific embodiments, the therapeutic agent is a combination of at least 2, at least 3 or at least 4 cytokines / interleukins selected from the group consisting of IL-2, IL-4, IL- 10, IL- 17, IL-23 and TNFa.
[0500] According to specific embodiments, the therapeutic agent is selected from the group consisting of IL-2, IL-4 and TNFa.
[0501] Non-limiting examples of amino acid and nucleic acid sequences of cytokines / interleukins that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 999- 1016.
[0502] According to another embodiment, the therapeutic agent is an interferon (e.g., interferon beta la, interferon beta lb, interferon alfa, interferon beta).
[0503] According to specific embodiments, the therapeutic agent is a neurotrophic factor.
[0504] Non-limiting examples of such a neurotrophic factor are BDNF, NGF, NT-3, NT-4 and GDNF.
[0505] According to specific embodiments, the neurotrophic factor is BDNF.
[0506] Non-limiting examples of amino acid and nucleic acid sequences of BDNF that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 58-59.
[0507] According to specific embodiments, the therapeutic agent is an immune checkpoint inhibitor. Non-limiting examples include PD-1 inhibitors (e.g., anti-PDl antibodies such as Nivolumab and Pembrolizumab), CTLA-4 inhibitors (e.g., anti-CTLA-4 such as Ipilimumab).
[0508] According to specific embodiments, the therapeutic agent is an antibody.
[0509] According to specific embodiments, the therapeutic agent is a receptor (e.g., chimeric receptor) having a targeting and / or effector (e.g., activation) function. Such receptors are well known in the art and include for example T cell receptors, chimeric T cell receptors, chimeric immunoreceptors, and chimeric antigen receptors (CARs) etc. Additional description on such receptors is further provided hereinabove and below.
[0510] Another example of a therapeutic agent is a soluble receptor.
[0511] In this respect, the present inventors were able to express a soluble TNFRb. Additional description on soluble TNFRb is provided infra. Yet another example of a therapeutic agent contemplated by specific embodiments of the present invention is an agent capable of reprograming immune cells. These could be transcription factors including for example IRF8, BATF3, CEBPB and MAFB.
[0512] Alternatively, the therapeutic agent could act as a T cell engager (forming a link between T cells and cancer cells). Non-limiting examples of such include Blinatumomab, Solitomab and Tebentafusp.
[0513] In still other embodiments, the therapeutic agent is the product of a suicide gene (e.g., Herpes Simplex Virus Thymidine Kinase (HSVTK) / Ganciclovir (GCV) suicide gene system or a Caspase suicide gene system.
[0514] In still other embodiments, the therapeutic agent is an antigenic peptide which is presented by antigen presenting cells in the pathologic microenvironment.
[0515] Another example of a therapeutic agent may be a meganuclease which is capable of genome editing. Examples of meganucleases include zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs using engineered endonucleases) and Cas9 nucleases.
[0516] As mentioned, the present invention also contemplates polynucleotide agents as therapeutic agents. Exemplary polynucleotide agents include RNA silencing agents which specifically hybridize to genes that are upregulated in the pathological microenvironment. Examples of such agents include siRNAs, gRNAs, antisense agents and miRNAs.
[0517] Additional non-limiting examples of therapeutic agents that can be used with specific embodiments of the invention are further provided hereinbelow.
[0518] Specific embodiments of the present invention also contemplate cells expressing the nucleic acid construct or construct system described herein and method of generating same. Such cells may be generated for example by transfecting immune cells with the construct or construct system discloses herein, according to methods known in the art.
[0519] Thus, according to an additional or an alternative aspect of the present invention, there an immune cell genetically modified to express the nucleic acid construct or construct system.
[0520] "Genetically modified immune cells" are made by a process referred to as genetic engineering, which can include but is not limited to manipulating a cell’s own genome or inserting a new nucleic acid into a cell. According to specific embodiments, the cells can be macrophages and can also be referred to as genetically engineered macrophages (GEMs). These techniques can be used to change the genetic makeup of the cell, and can include inserting a vector encoding a gene of interest into a cell, and genome editing using RNAi systems, meganucleases, zinc finger nucleases, transcription activator like effector nucleases (TALENS), or CRISPRs. Without being limiting, the vectors encoding the gene of interest can be a viral vector, DNA or an mRNA, as further described infra.
[0521] According to an additional or an alternative aspect of the present invention, there is provided an immune cell genetically modified to express the nucleic acid construct or construct system.
[0522] According to an additional or an alternative aspect of the present invention, there is provided a method of generating an immune cell expressing an inducible therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct or construct system disclosed herein.
[0523] In addition, the present inventors were able to express a functional soluble TNFRb in immune cells (see part 2.4 of Example 2 of the Examples section which follows).
[0524] Hence, according to an aspect of the present invention, there is provided an immune cell genetically modified to express a nucleic acid construct encoding a soluble TNFRb as a therapeutic agent.
[0525] According to an additional or an alternative aspect of the present invention there is provided a method of generating an immune cell expressing a soluble TNFRb as a therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct encoding a soluble TNFRb.
[0526] As used herein, the term “TNFRb (Tumor necrosis factor receptor b)”, also known as TNFR2, tumor necrosis factor receptor superfamily member IB (TNFRSF1B), CD120b and p75 refers to the TNFR2 TNFRSF1B gene and to its polynucleotide or polypeptide expression product. According to specific embodiments, the TNFRb refers to the human TNFRb, such as provided in Gene ID: 7133 and the following Accession Numbers: NM_001066 and NP_001057.
[0527] According to specific embodiments, the activity of the soluble TNFRb is at least binding TNFa.
[0528] Non-limiting examples of amino acid and nucleic acid sequences of soluble TNFRb that can be used with specific embodiments of the invention are provided in SEQ ID NOs: 101-102.
[0529] In addition, the present inventors were able to generate anti-PDl CAR-T cells and a sTNFRb or an IE- 10 cargo which showed efficacy in rheumatoid arthritis and multiple sclerosis mouse models, respectively (see Examples 3.5 and 3.6 of the Examples section which follows).
[0530] Hence, according to an aspect of the present invention, there is provided a T cell genetically modified to express a nucleic acid construct or system encoding:
[0531] (i) an anti-PDl chimeric antigen receptor (CAR); and
[0532] (ii) a soluble (e.g., secreted) therapeutic agent for an autoimmune disease (e.g., IE- 10, sTNFRb).
[0533] According to an additional or an alternative aspect of the present invention there is provided a method of generating a T cell expressing an anti-PDl chimeric antigen receptor (CAR) and a soluble therapeutic agent for an autoimmune disease (e.g., IL- 10, sTNFRb), the method comprising introducing into the T cell the nucleic acid construct or system encoding the anti-PDl chimeric antigen receptor (CAR) and the soluble therapeutic agent.
[0534] Non-limiting example of such nucleic acid construct system are provided in SEQ ID NOs: 101 and 102 or 101 and 1105.
[0535] Such a therapeutic agent (e.g., soluble TNFRb, IL- 10) may be under an expression regulatory element or the TROJAN regulatory circuit described herein or under a non-TROJAN regulatory circuit. Thus, according to specific embodiments, the nucleic acid construct encoding the therapeutic agent (e.g., soluble TNFRb, IL- 10) may comprise a constitutive promoter or a promoter active in a specific cell type (e.g., T cell). According to other specific embodiments, the nucleic acid construct encoding the therapeutic agent (e.g., soluble TNFRb, IL- 10) comprises the at least one expression regulatory element of a gene which expression is increased in an immune cell subjected to a pathologic environment relative to a non-pathologic environment described herein.
[0536] Additional detailed description on nucleic acid constructs is provided hereinabove.
[0537] Various methods can be used to introduce the expression vector of some embodiments of the invention into immune cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et al. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
[0538] Typically, introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since targeting specificity, higher transduction efficiency and lateral infection can be obtained due to the infectious nature of viruses.
[0539] According to specific embodiments, the introducing is effected under suitable conditions for expression of the construct. Such conditions may be for example an appropriate temperature (e.g., 37 °C), atmosphere (e.g., air plus 5 % CO2), pH, light, medium, supplements and the like. Regardless of the method used to introduce exogenous nucleic acids into the cell, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0540] According to specific embodiments, the introducing is effected in-vitro or ex-vivo.
[0541] According to other specific embodiments, the introducing is effected in-vivo.
[0542] As used herein, the term "immune cells" refers to white blood cells (leukocytes) which are derived from hematopoietic stem cells (HSC) produced in the bone marrow. In one embodiment, the immune cells are fully differentiated immune cells such as lymphocytes (T cells, B cells, natural killer (NK) cells) and myeloid-derived cells (neutrophil, eosinophil, basophil, monocyte, macrophage, dendritic cells). In another embodiment, the immune cells are hematopoietic stem cells.
[0543] Methods of obtaining immune cells are well known in the art. Thus, for example, PBMCs can be isolated by drawing whole blood from a subject and collection in a container containing an anti-coagulant (e.g., heparin or citrate); and apheresis. According to other specific embodiments, the immune cells are obtained from a tissue comprising cells associated with a pathology. Methods for obtaining a tissue sample from a subject are well known in the art and include e.g., biopsy, surgery or necropsy and preparing a single cell suspension thereof. Following, according to specific embodiments, at least one type of an immune cell is purified from the peripheral blood or from the single cell suspension. There are several methods and reagents known to those skilled in the art for purifying immune cells such as leukapheresis, sedimentation, density gradient centrifugation (e.g. ficoll), centrifugal elutriation, fractionation, chemical lysis of e.g. red blood cells (e.g. by ACK), selection of specific cell types using cell surface markers (using e.g. FACS sorter or magnetic cell separation techniques such as are commercially available e.g. from Invitrogen, Stemcell Technologies, Cellpro, Advanced Magnetics, or Miltenyi Biotec.), and depletion of specific cell types by methods such as eradication (e.g. killing) with specific antibodies or by affinity based purification based on negative selection (using e.g. magnetic cell separation techniques, FACS sorter and / or capture ELISA labeling). Such methods are described for example in THE HANDBOOK OF EXPERIMENTAL IMMUNOLOGY, Volumes 1 to 4, (D.N. Weir, editor) and FLOW CYTOMETRY AND CELL SORTING (A. Radbruch, editor, Springer Verlag, 2000). In one embodiment, the cells which are transfected are immune progenitor or stem cells (e.g., CD34+ hematopoietic stem cells). CD34+ hematopoietic stem cells may be immobilized from the bone marrow of the subject to the peripheral blood by providing the subject (e.g., patient with an intravenous dose of granulocyte stimulating factor (GCSF). GCSF disturbs bone marrow quiescence and triggers an ongoing efflux of HSCs, progenitors and mature bone marrow cells into the periphery. CD34+ cells may be enriched using a suitable sorting system (e.g., using CD34+ magnetic beads sorting system). Enriched HSCs may be stored in liquid nitrogen in aliquots for future use, or used immediately for ex vivo manipulation.
[0544] In another embodiment, the cells which are transfected are pluripotent stem cells including embryonic stem cells or induced pluripotent stem cells (iPSCs). The iPSCs may be autologous or non-autologous to the subject.
[0545] Induced pluripotent stem cells (iPS; embryonic-like stem cells), are cells obtained by dedifferentiation of adult somatic cells which are endowed with pluripotency (z.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to some embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics. According to some embodiments of the invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell. The induced pluripotent stem cells may be derived from any source including, but not limited to peripheral blood cells.
[0546] If obtained from an allogeneic source, the iPSCs can be manipulated so as to down-regulate the MHC-1 gene (e.g., using CRISPR technology) prior to their differentiation.
[0547] When progenitor cells or stem cells are used as the starting cells for transfection, the method further contemplates differentiating the stem cells into differentiated immune cells such as monocytes, dendritic cells or macrophages. Exemplary differentiating factors which can be used to differentiate the stem cells into immune cells include GM-CSF and IL-4.
[0548] An exemplary protocol which can be used to generate the cells described herein (using iPSCs as the starting material) is described herein below.
[0549] IPSCs are cultured so as to form embryoid bodies using fibroblast growth factor 2 and bone morphogenetic factor 4 (Day 0 -Day 4). The iPSCs are transduced with the constructs described herein and are further recovered in medium containing a cocktail of growth factors including Vascular Endothelial Growth Factor, stem cell factor and interleukin 3 for hematopoietic specification (Day 4- Day 8). The hematopoietic primed cells are then differentiated into hematopoietic progenitors using a cocktail of growth factors including stem cell factor, thrombopoietin, FLT3 ligand, interleukin 3 and 6 (Day 8 - Day 14). The terminal stage of macrophage differentiation is induced by the addition of macrophage colony stimulating factor for a period of 7 days.
[0550] According to a specific embodiment, the immune cells are lymphocytes.
[0551] According to specific embodiments, the immune cell is selected from the group consisting of T cells, NK cells and NKT cells.
[0552] According to specific embodiments, the immune cell is a T cell.
[0553] As used herein, the term “T cell” includes CD4+, CD8+ and NKT cells. According to specific embodiments, the T cell expresses CD3.
[0554] According to specific embodiments, the T cell is an effector cell.
[0555] As used herein, the term “effector T cell” refers to a T cell that activates or directs other immune cells e.g., by producing cytokines or has a cytotoxic activity e.g., CD4+, Thl / Th2, CD8+ cytotoxic T lymphocyte.
[0556] According to specific embodiments, the T cell is a CD4+ T helper cell.
[0557] According to other specific embodiments, the T cell is a CD8+ cytotoxic T cell.
[0558] According to specific embodiments, the T cell is a αβ T cell.
[0559] According to specific embodiments, the T cell is a γδ T cell.
[0560] According to specific embodiments, the T cell is a naive T cell.
[0561] According to specific embodiments, the T cell is a memory T cell. Non-limiting examples of memory T cells include effector memory CD4+ T cells with a CD3+ / CD4+ / CD45RA- / CCR7- phenotype, central memory CD4+ T cells with a CD3+ / CD4+ / CD45RA- / CCR7+ phenotype, effector memory CD8+ T cells with a CD3+ / CD8+ CD45RA- / CCR7 -phenotype and central memory CD8+ T cells with a CD3+ / CD8+ CD45RA- / CCR7+ phenotype.
[0562] As used herein the term “NKT cell” refers to a specialized T cell that express a variety of molecular markers that are typically associated with NK cells, such as NK1.1. NKT cells include NK1.1+ and NK1.1-, as well as CD4+, CD4-, CD8+ and CD8- cells.
[0563] According to other specific embodiments, the T cells is not an NKT cell.
[0564] According to specific embodiments, the T cell expresses an endogenous T cell receptor (TCR).
[0565] According to specific embodiments, the immune cells comprise NK cells.
[0566] As used herein the term “NK cells” refers to differentiated lymphocytes with a CD 16+ CD56+ and / or CD57+ TCR- phenotype. NK are characterized by their ability to bind to and kill cells that fail to express “self’ MHC / HLA antigens by the activation of specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells that express a ligand for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response.
[0567] According to specific embodiments, the immune cells comprise B cells.
[0568] As used herein the term “B cells” refers to a lymphocyte with a B cell receptor (BCR)+, CD 19+ and or B220+ phenotype. B cells are characterized by their ability to bind a specific antigen and elicit a humoral response.
[0569] According to a specific embodiment, the immune cells are myeloid cells (e.g., macrophage, or monocyte).
[0570] According to specific embodiments, the immune cells comprise phagocytic cells.
[0571] As used herein, the term “phagocytic cells” refer to a cell that is capable of phagocytosis and include both professional and non-professional phagocytic cells. Methods of analyzing phagocytosis are well known in the art and include for examples killing assays, flow cytometry and / or microscopic evaluation (live cell imaging, fluorescence microscopy, confocal microscopy, electron microscopy). According to specific embodiments, the phagocytic cells are selected from the group consisting of monocytes, dendritic cells (DCs) and granulocytes.
[0572] According to specific embodiments, the immune cells comprise monocytes.
[0573] According to specific embodiments, the term “monocytes” refers to both circulating monocytes and to macrophages (also referred to as mononuclear phagocytes) present in a tissue.
[0574] According to specific embodiments, the monocytes comprise macrophages. Typically, cell surface phenotype of macrophages includes CD14, CD40, CDl lb, CD64, F4 / 80 (mice) / EMRl (human), lysozyme M, MAC-l / MAC-3 and CD68.
[0575] According to specific embodiments, the monocytes comprise tumor associated macrophages.
[0576] The term “tumor associated macrophages” (also referred to as TAMs) refers to bone marrow-derived blood monocytes / monocytic MDSC (M-MDSC) that are recruited to tumors and differentiate into tumor associated macrophages. Tumor macrophages may be distinguished by a set of cell membrane markers including CD 163 and CD206. The tumor associated macrophage may express additional cell surface markers including for example CD274 and stabilin-1. In one embodiment, the TAM is a M2 macrophage (e.g., M2a, M2b, and M2c macrophage).
[0577] According to specific embodiments, the monocytes comprise circulating monocytes. Typically, cell surface phenotypes of circulating monocytes include CD14 and CD16 (e.g., CD14++ CD16-, CD14+CD16++, CD14++CD16+).
[0578] According to specific embodiments, the immune cells comprise DCs. As used herein the term “dendritic cells (DCs)” refers to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. DCs are a class of professional antigen presenting cells, and have a high capacity for sensitizing HLA- restricted T cells. DCs include, for example, plasmacytoid dendritic cells, myeloid dendritic cells (including immature and mature dendritic cells), Langerhans cells, interdigitating cells, follicular dendritic cells. Dendritic cells may be recognized by function, or by phenotype, particularly by cell surface phenotype. These cells are characterized by their distinctive morphology having veillike projections on the cell surface, intermediate to high levels of surface HLA-class II expression and ability to present antigen to T cells, particularly to naive T cells (See Steinman R, et al., Ann. Rev. Immunol. 1991; 9:271-196.). Typically, cell surface phenotype of DCs include CDla+, CD4+, CD86+, or HLA-DR. The term DCs encompasses both immature and mature DCs.
[0579] According to specific embodiments, the immune cells comprise granulocytes.
[0580] As used herein, the tern “granulocytes” refer to polymorphonuclear leukocytes characterized by the presence of granules in their cytoplasm.
[0581] According to specific embodiments, the granulocytes comprise neutrophils.
[0582] According to specific embodiments, the granulocytes comprise mast-cells.
[0583] According to specific embodiments, the cell is a human cell.
[0584] According to specific embodiments, the immune cell is of a healthy subject.
[0585] According to specific embodiments, the immune cell is of a subject suffering from a pathology.
[0586] According to specific embodiments, the immune cell can be freshly isolated, stored e.g., cryopreserved (i.e., frozen) at e.g., liquid nitrogen temperature at any stage for long periods of time (e.g., months, years) for future use; and cell lines.
[0587] Methods of cryopreservation are commonly known by one of ordinary skill in the art and are disclosed e.g., in International Patent Application Publication Nos. W02007054160 and WO 2001039594 and US Patent Application Publication No. US20120149108.
[0588] According to specific embodiments, the immune cells can be stored in a cell bank or a depository or storage facility.
[0589] According to specific embodiments, the method of generating the immune cell further comprising contacting the immune cell with the target of the extracellular binding domain.
[0590] According to specific embodiments, contacting with the target is effected in-vitro or ex- vivo.
[0591] According to other specific embodiments, contacting with the target is in fact effected in- vivo. Consequently, specific embodiments of the present teachings further suggest the use of the immune cells (e.g., T cells, macrophages / monocytes) and the methods disclosed herein as, but not limited to, a source for adoptive immune cells therapies for pathologies that can benefit from such a therapy.
[0592] Thus, according to an aspect of the present invention, the immune cells disclosed herein are for use in adoptive cell therapy.
[0593] The immune cells used according to specific embodiments of the present invention may be autologous or non-autologous; they can be syngeneic or non- syngeneic: allogeneic or xenogeneic to the subject; each possibility represents a separate embodiment of the present invention.
[0594] According to specific embodiments, the immune cells are autologous to the subject.
[0595] According to specific embodiments, the cells are non-autologous to the subject.
[0596] According to specific embodiments, the immune cells described herein are cultured, expanded and / or activated ex- vivo prior to administration to the subject.
[0597] Methods of culturing, expanding and activating immune cells are well known to the skilled in the art. For example, T cells may be activated ex- vivo in the presence of one or more molecule such as, but not limited to, an anti-CD3 antibody, an anti-CD28 antibody, anti-CD3 and anti-CD28 coated beads (such as the CD3CD28 MACSiBeads obtained from Miltenyi Biotec), IL-2, phytohemoagglutinin, an antigen-loaded antigen presenting cell [APC, e.g., dendritic cell], a peptide loaded recombinant MHC.
[0598] Since the immune cells of specific embodiments of the present invention selectively express the therapeutic pay load in a pathologic environment, they may be used for, but not limited to, treating such pathologies.
[0599] Thus, according to an aspect of the present invention, there is provided a method of treating a pathology in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the immune cell disclosed herein, wherein the disease can benefit from the therapeutic agent, thereby treating the pathology in the subject.
[0600] According to an additional or an alternative aspect of the present invention, there is provided the immune cell disclosed herein for use in treating a pathology in a subject in need thereof, wherein the pathology can benefit from the therapeutic agent.
[0601] As used herein, the term “subject” or “subject in need thereof’ includes mammals, preferably human beings at any age or gender. The subject may be healthy or showing signs of a pathology. This term also encompasses individuals who are at risk to develop the pathology. According to specific embodiments the subject is diagnosed with the pathology. As used herein the term “treating” refers to curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a pathology (also interchangeably referred to herein as “disease” or “disorder”). Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
[0602] As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.
[0603] According to specific embodiments, the pathologic environment is associated with the pathology being treated.
[0604] According to specific embodiments, when the immune cell is genetically modified to express the targeting receptor disclosed herein, the pathology is associated with the target of the extracellular binding domain of the targeting receptor.
[0605] As used herein, the phrase “pathology associated with a target of the extracellular binding domain” means that onset and / or progression of the disease is accompanied by overexpression or exclusive expression of the target, either on pathological cells as compared to non-pathological (healthy) cells or in a soluble form e.g., in blood, tissue, extracellular space, cerebrospinal fluid etc. of the subject as compared to a subject not diagnosed or pre-conditioned with the disease. Methods of determining expression are well known in thew art included e.g., flow cytometry, immuno staining, ELISA, western-blot, immunoprecipitation, etc.
[0606] According to specific embodiments, the target plays a role in the disease’s pathology.
[0607] According to specific embodiments, the pathology can benefit from activating immune cells.
[0608] As used herein the phrase “a pathology that can benefit from activating immune cells” refers to diseases in which the subject’s immune response activity may be sufficient to at least ameliorate symptoms of the disease or delay onset of symptoms, however for any reason the activity of the subject’s immune response in doing so is less than optimal.
[0609] Non-limiting examples of pathologies treated by some embodiments of the invention include hyper-proliferative diseases, diseases associated with immune suppression, immunosuppression caused by medication (e.g., mTOR inhibitors, calcineurin inhibitor, steroids) and infections.
[0610] According to specific embodiments, the pathology comprises an infection. As used herein, the term “infection” or "infectious disease" refers to a disease induced by a pathogen. Specific examples of pathogens include, viral pathogens, bacterial pathogens e.g., intracellular mycobacterial pathogens (such as, for example, Mycobacterium tuberculosis), intracellular bacterial pathogens (such as, for example, Listeria monocytogenes), or intracellular protozoan pathogens (such as, for example, Leishmania and Trypanosoma).
[0611] Specific types of viral pathogens causing infectious diseases include, but are not limited to, retroviruses, circoviruses, parvoviruses, papovaviruses, adenoviruses, herpesviruses, iridoviruses, poxviruses, hepadnaviruses, picornaviruses, caliciviruses, togaviruses, flaviviruses, reoviruses, orthomyxoviruses, paramyxoviruses, rhabdoviruses, bunyaviruses, coronaviruses, arenaviruses, and filoviruses.
[0612] Specific examples of viral infections which may be treated according to specific embodiments of the present invention include, but are not limited to, human immunodeficiency virus (HlV)-induced acquired immunodeficiency syndrome (AIDS), influenza, rhinoviral infection, viral meningitis, Epstein-Barr virus (EBV) infection, hepatitis A, B or C virus infection, measles, papilloma virus infection / warts, cytomegalovirus (CMV) infection, Herpes simplex virus infection, yellow fever, Ebola virus infection, rabies, etc.
[0613] Non-limiting examples of targets that can be used in the treatment of infectious diseases include, but are not limited to, viral surface proteins, bacterial toxins, lipopolysaccharide (LPS), bacterial cell wall components, pathogen-associated molecular patterns (PAMPs) etc.
[0614] Non-limiting examples of therapeutic agents that can be used in the treatment of infectious diseases include, but are not limited to, antibodies, antibiotics, antivirals peptides, immune modulators etc.
[0615] According to specific embodiments, the disease comprises a hyper-proliferative disease.
[0616] According to specific embodiments, the hyper-proliferative disease comprises sclerosis, fibrosis, Idiopathic pulmonary fibrosis, psoriasis, systemic sclerosis / scleroderma, primary biliary cholangitis, primary sclerosing cholangitis, liver fibrosis, prevention of radiation-induced pulmonary fibrosis, myelofibrosis or retroperitoneal fibrosis.
[0617] According to other specific embodiments, the hyper-proliferative disease comprises cancer.
[0618] Cancers which may be treated by some embodiments of the invention can be any solid or non-solid tumor (including liquid cancer), cancer metastasis and / or a pre-cancer.
[0619] According to specific embodiments, the cancer is a solid tumor.
[0620] According to specific embodiments, the cancer is a malignant cancer. Examples of cancer include but are not limited to, carcinoma, blastoma, sarcoma and lymphoma. More particular examples of such cancers include, but are not limited to, tumors of the gastrointestinal tract (colon carcinoma, rectal carcinoma, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small and / or large bowel carcinoma, esophageal carcinoma, tylosis with esophageal cancer, stomach carcinoma, pancreatic carcinoma, pancreatic endocrine tumors), endometrial carcinoma, dermatofibrosarcoma protuberans, gallbladder carcinoma, Biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms’ tumor type 2 or type 1), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma, hepatocellular cancer), bladder cancer, embryonal rhabdomyosarcoma, germ cell tumor, trophoblastic tumor, testicular germ cells tumor, immature teratoma of ovary, uterine, epithelial ovarian, sacrococcygeal tumor, choriocarcinoma, placental site trophoblastic tumor, epithelial adult tumor, ovarian carcinoma, serous ovarian cancer, ovarian sex cord tumors, cervical carcinoma, uterine cervix carcinoma, small-cell and non-small cell lung carcinoma, nasopharyngeal, breast carcinoma (e.g., ductal breast cancer, invasive intraductal breast cancer, sporadic ; breast cancer, susceptibility to breast cancer, type 4 breast cancer, breast cancer- 1, breast cancer-3; breast-ovarian cancer), squamous cell carcinoma (e.g., in head and neck), neurogenic tumor, astrocytoma, ganglioblastoma, neuroblastoma, lymphomas (e.g., Hodgkin's disease, non-Hodgkin's lymphoma, B cell, Burkitt, cutaneous T cell, histiocytic, lymphoblastic, T cell, thymic), gliomas, adenocarcinoma, adrenal tumor, hereditary adrenocortical carcinoma, brain malignancy (tumor), various other carcinomas (e.g., bronchogenic large cell, ductal, Ehrlich-Lettre ascites, epidermoid, large cell, Lewis lung, medullary, mucoepidermoid, oat cell, small cell, spindle cell, spinocellular, transitional cell, undifferentiated, carcinosarcoma, choriocarcinoma, cystadenocarcinoma), ependimoblastoma, epithelioma, erythroleukemia (e.g., Friend, lymphoblast), fibrosarcoma, giant cell tumor, glial tumor, glioblastoma (e.g., multiforme, astrocytoma), glioma hepatoma, heterohybridoma, heteromyeloma, histiocytoma, hybridoma (e.g., B cell), hypernephroma, insulinoma, islet tumor, keratoma, leiomyoblastoma, leiomyosarcoma, leukemia (e.g., acute lymphatic, acute lymphoblastic, acute lymphoblastic pre-B cell, acute lymphoblastic T cell leukemia, acute - megakaryoblastic, monocytic, acute myelogenous, acute myeloid, acute myeloid with eosinophilia, B cell, basophilic, chronic myeloid, chronic, B cell, eosinophilic, Friend, granulocytic or myelocytic, hairy cell, lymphocytic, megakaryoblastic, monocytic, monocytic- macrophage, myeloblastic, myeloid, myelomonocytic, plasma cell, pre-B cell, promyelocytic, subacute, T cell, lymphoid neoplasm, predisposition to myeloid malignancy, acute nonlymphocytic leukemia), lymphosarcoma, melanoma, mammary tumor, mastocytoma, medulloblastoma, mesothelioma, metastatic tumor, monocyte tumor, multiple myeloma, myelodysplastic syndrome, myeloma, nephroblastoma, nervous tissue glial tumor, nervous tissue neuronal tumor, neurinoma, neuroblastoma, oligodendroglioma, osteochondroma, osteomyeloma, osteosarcoma (e.g., Ewing's), papilloma, transitional cell, pheochromocytoma, pituitary tumor (invasive), plasmacytoma, retinoblastoma, rhabdomyosarcoma, sarcoma (e.g., Ewing's, histiocytic cell, Jensen, osteogenic, reticulum cell), schwannoma, subcutaneous tumor, teratocarcinoma (e.g., pluripotent), teratoma, testicular tumor, thymoma and trichoepithelioma, gastric cancer, fibrosarcoma, glioblastoma multiforme; multiple glomus tumors, Li-Fraumeni syndrome, liposarcoma, lynch cancer family syndrome II, male germ cell tumor, mast cell leukemia, medullary thyroid, multiple meningioma, endocrine neoplasia myxosarcoma, paraganglioma, familial nonchromaffin, pilomatricoma, papillary, familial and sporadic, rhabdoid predisposition syndrome, familial, rhabdoid tumors, soft tissue sarcoma, and Turcot syndrome with glioblastoma.
[0621] Particular examples of cancerous diseases but are not limited to: Myeloid leukemia such as Chronic myelogenous leukemia. Acute myelogenous leukemia with maturation. Acute promyelocytic leukemia, Acute nonlymphocytic leukemia with increased basophils, Acute monocytic leukemia. Acute myelomonocytic leukemia with eosinophilia; Malignant lymphoma, such as Birkitt's Non-Hodgkin's; Lymphoctyic leukemia, such as Acute lumphoblastic leukemia. Chronic lymphocytic leukemia; Myeloproliferative diseases, such as Solid tumors Benign Meningioma, Mixed tumors of salivary gland, Colonic adenomas; Adenocarcinomas, such as Small cell lung cancer, Kidney, Uterus, Prostate, Bladder, Ovary, Colon, Sarcomas, Liposarcoma, myxoid, Synovial sarcoma, Rhabdomyosarcoma (alveolar), Extraskeletel myxoid chonodro sarcoma, Ewing's tumor; other include Testicular and ovarian dysgerminoma, Retinoblastoma, Wilms' tumor, Neuroblastoma, Malignant melanoma, Mesothelioma, breast, skin, prostate, and ovarian.
[0622] According to specific embodiments, the cancer is a pre-malignant cancer.
[0623] Pre-cancers are well characterized and known in the art (refer, for example, to Berman JJ. and Henson DE., 2003. Classifying the pre-cancers: a metadata approach. BMC Med Inform Decis Mak. 3:8). Examples of pre-cancers include, but are not limited to, acquired small pre-cancers, acquired large lesions with nuclear atypia, precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasias and diffuse metaplasias. Non-limiting examples of small pre-cancers include HGSIL (High grade squamous intraepithelial lesion of uterine cervix), AIN (anal intraepithelial neoplasia), dysplasia of vocal cord, aberrant crypts (of colon), PIN (prostatic intraepithelial neoplasia). Non-limiting examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD (angioimmunoblastic lymphadenopathy with dysproteinemia), atypical meningioma, gastric polyp, large plaque parapsoriasis, myelodysplasia, papillary transitional cell carcinoma in-situ, refractory anemia with excess blasts, and Schneiderian papilloma. Non-limiting examples of precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer include atypical mole syndrome, C cell adenomatosis and MEA. Non-limiting examples of acquired diffuse hyperplasias and diffuse metaplasias include Paget's disease of bone and ulcerative colitis.
[0624] According to specific embodiments, the cancer is selected from the group consisting of carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
[0625] According to specific embodiments, the cancer is of a lung, such as non-small cell lung carcinoma, breast, colon, glioblastoma, head & neck, and in general tumors that are resistant to current immune checkpoint such as anti-PD-1 and anti-CTLA4.
[0626] Targets that can be used in the treatment of cancer include for example antigens overexpressed or only expressed by cancerous cells.
[0627] Non-limiting examples for known cancer antigens include TREM2, MAGE- Al, MAGE- A2, MAGE- A3, MAGE-A4, MAGE-AS, MAGE-A6, MAGE-A7, MAGE-AS, MAGE-A9, MAGE-AIO, MAGE-A11, MAGE-A12, GAGE-I, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, B AGE-1, RAGE- 1, LB33 / MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE- C1 / CT7, MAGE-C2, NY-ES0-1, LAGE-1, SSX-1, SSX-2(HOM-MEL-40), SSX-3, SSX-4, SSX-5, SCP-1 and XAGE, melanocyte differentiation antigens, p53, ras, CEA, PMSA, PSA, tyrosinase, Melan-A, MART-I, gplOO, gp75, alphaactinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferaseAS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAA0205, Mart2, Mum-2, and 3, neo-PAP, myosin class I, OS-9, pml-RAR alpha fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomerase, GnTV, Herv-K-mel, NA-88, SP17, and TRP2-Int2, (MART-I), E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, pl85erbB2, plSOerbB-3, c-met, nm-23Hl, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, alpha. -fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29VBCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, C0- 029, FGF-5, 0250, Ga733 (EpCAM), HTgp-175, M344, MA-50, MG7-Ag, M0V18, NBM70K, NYCO-I, RCASI, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, tyrosinase related proteins, TRP-1, TRP-2, EGFR, TRP-1, CD44, PDL-1, HER-2, MUC-1, MUC-16, CEA, EpCAM.
[0628] According to specific embodiments, the cancer antigen target is TREM2.
[0629] Non-limiting examples of therapeutic agents that can be used in the treatment of cancer include, but are not limited to, antibodies, fusion protein, immune modulators, chemotherapy etc.
[0630] Non-limiting examples of anti-cancer antibodies include rituximab, cetuximab, trastuzumab, edrecolomab, almetuzumab, gemtuzumab, ibritumomab, panitumumab, Belimumab, Bevacizumab, Bivatuzumab mertansine, Blinatumomab, Blontuvetmab, Brentuximab vedotin, Catumaxomab, Cixutumumab, Daclizumab, Adalimumab, Bezlotoxumab, Certolizumab pegol, Citatuzumab bogatox, Daratumumab, Dinutuximab, Elotuzumab, Ertumaxomab, Etaracizumab, Gemtuzumab ozogamicin, Girentuximab, Necitumumab, Obinutuzumab, Ofatumumab, Pertuzumab, Ramucirumab, Siltuximab, Tositumomab, Trastuzumab, Nivolumab, Pembrolizumab, Durvalumab, Atezolizumab, Avelumab and ipilimumab.
[0631] According to specific embodiments the disease is an autoimmune disease.
[0632] Autoimmune diseases include, but are not limited to, cardiovascular diseases, rheumatoid diseases, glandular diseases, gastrointestinal diseases, cutaneous diseases, hepatic diseases, neurological diseases, muscular diseases, nephric diseases, diseases related to reproduction, connective tissue diseases and systemic diseases.
[0633] Examples of autoimmune cardiovascular diseases include, but are not limited to atherosclerosis (Matsuura E. et al., Lupus. 1998;7 Suppl 2:S135), myocardial infarction (Vaarala O. Lupus. 1998;7 Suppl 2:S132), thrombosis (Tincani A. et al., Lupus 1998;7 Suppl 2:S 107-9), Wegener’s granulomatosis, Takayasu’s arteritis, Kawasaki syndrome (Praprotnik S. et al., Wien Klin Wochenschr 2000 Aug 25; 112 (15-16):660), anti-factor VIII autoimmune disease (Lacroix- Desmazes S. et al., Semin Thromb Hemost.2000;26 (2): 157), necrotizing small vessel vasculitis, microscopic polyangiitis, Churg and Strauss syndrome, pauci-immune focal necrotizing and crescentic glomerulonephritis (Noel LH. Ann Med Interne (Paris). 2000 May; 151 (3): 178), antiphospholipid syndrome (Flamholz R. et al., J Clin Apheresis 1999; 14 (4): 171), antibody- induced heart failure (Wallukat G. et al., Am J Cardiol. 1999 Jun 17;83 (12A):75H), thrombocytopenic purpura (Moccia F. Ann Ital Med Int. 1999 Apr-Jun; 14 (2): 114; Semple JW. et al., Blood 1996 May 15;87 (10):4245), autoimmune hemolytic anemia (Efremov DG. et al., Leuk Lymphoma 1998 Jan;28 (3-4):285; Sallah S. et al., Ann Hematol 1997 Mar;74 (3): 139), cardiac autoimmunity in Chagas’ disease (Cunha-Neto E. et al., J Clin Invest 1996 Oct 15;98 (8): 1709) and anti-helper T lymphocyte autoimmunity (Caporossi AP. et al., Viral Immunol 1998; 11 (1):9). Examples of autoimmune rheumatoid diseases include, but are not limited to rheumatoid arthritis (Krenn V. et al., Histol Histopathol 2000 Jul;15 (3):791; Tisch R, McDevitt HO. Proc Natl Acad Sci units S A 1994 Jan 18 ;91 (2):437) and ankylosing spondylitis (Jan Voswinkel et al., Arthritis Res 2001; 3 (3): 189).
[0634] Examples of autoimmune glandular diseases include, but are not limited to, pancreatic disease, Type I diabetes, thyroid disease, Graves’ disease, thyroiditis, spontaneous autoimmune thyroiditis, Hashimoto’s thyroiditis, idiopathic myxedema, ovarian autoimmunity, autoimmune anti-sperm infertility, autoimmune prostatitis and Type I autoimmune polyglandular syndrome, diseases include, but are not limited to autoimmune diseases of the pancreas, Type 1 diabetes (Castano L. and Eisenbarth GS. Ann. Rev. Immunol. 8:647; Zimmet P. Diabetes Res Clin Pract 1996 Oct;34 Suppl:S125), autoimmune thyroid diseases, Graves’ disease (Orgiazzi J. Endocrinol Metab Clin North Am 2000 Jun;29 (2):339; Sakata S. et al., Mol Cell Endocrinol 1993 Mar;92 (1):77), spontaneous autoimmune thyroiditis (Braley-Mullen H. and Yu S, J Immunol 2000 Dec 15;165 (12):7262), Hashimoto’s thyroiditis (Toyoda N. et al., Nippon Rinsho 1999 Aug;57 (8): 1810), idiopathic myxedema (Mitsuma T. Nippon Rinsho. 1999 Aug;57 (8): 1759), ovarian autoimmunity (Garza KM. et al., J Reprod Immunol 1998 Feb;37 (2):87), autoimmune anti-sperm infertility (Diekman AB. et al., Am J Reprod Immunol. 2000 Mar;43 (3): 134), autoimmune prostatitis (Alexander RB. et al., Urology 1997 Dec;50 (6):893) and Type I autoimmune polyglandular syndrome (Hara T. et al., Blood. 1991 Mar 1;77 (5): 1127).
[0635] Examples of autoimmune gastrointestinal diseases include, but are not limited to, chronic inflammatory intestinal diseases (Garcia Herola A. et al., Gastroenterol Hepatol. 2000 Jan;23 (1): 16), celiac disease (Landau YE. and Shoenfeld Y. Harefuah 2000 Jan 16; 138 (2): 122), colitis, ileitis and Crohn’s disease.
[0636] Examples of autoimmune cutaneous diseases include, but are not limited to, autoimmune bullous skin diseases, such as, but are not limited to, pemphigus vulgaris, bullous pemphigoid and pemphigus foliaceus.
[0637] Examples of autoimmune hepatic diseases include, but are not limited to, hepatitis, autoimmune chronic active hepatitis (Franco A. et al., Clin Immunol Immunopathol 1990 Mar;54 (3):382), primary biliary cirrhosis (Jones DE. Clin Sci (Colch) 1996 Nov;91 (5):551; Strassburg CP. et al., Eur J Gastroenterol Hepatol. 1999 Jun; 11 (6):595) and autoimmune hepatitis (Manns MP. J Hepatol 2000 Aug;33 (2):326).
[0638] Examples of autoimmune neurological diseases include, but are not limited to, multiple sclerosis (Cross AH. et al., J Neuroimmunol 2001 Jan 1 ; 112 (1-2): 1), Alzheimer’s disease (Oron L. et al., J Neural Transm Suppl. 1997;49:77), myasthenia gravis (Infante AJ. And Kraig E, Int Rev Immunol 1999;18 (l-2):83; Oshima M. et al., Eur J Immunol 1990 Dec;20 (12):2563), neuropathies, motor neuropathies (Kornberg AJ. J Clin Neurosci. 2000 May;7 (3): 191); Guillain- Barre syndrome and autoimmune neuropathies (Kusunoki S. Am J Med Sei. 2000 Apr;319 (4):234), myasthenia, Lambert-Eaton myasthenic syndrome (Takamori M. Am J Med Sei. 2000 Apr;319 (4):204); paraneoplastic neurological diseases, cerebellar atrophy, paraneoplastic cerebellar atrophy and stiff-man syndrome (Hiemstra HS. et al., Proc Natl Acad Sci units S A 2001 Mar 27;98 (7):3988); non-paraneoplastic stiff man syndrome, progressive cerebellar atrophies, encephalitis, Rasmussen’s encephalitis, amyotrophic lateral sclerosis, Sy deham chorea, Gilles de la Tourette syndrome and autoimmune polyendocrinopathies (Antoine JC. and Honnorat J. Rev Neurol (Paris) 2000 Jan;156 (1):23); dysimmune neuropathies (Nobile- Orazio E. et al., Electroencephalogr Clin Neurophysiol Suppl 1999;50:419); acquired neuromyotonia, arthrogryposis multiplex congenita (Vincent A. et al., Ann N Y Acad Sci. 1998 May 13 ;841 :482), neuritis, optic neuritis (Soderstrom M. et al., J Neurol Neurosurg Psychiatry 1994 May;57 (5): 544) and neurodegenerative diseases.
[0639] Examples of autoimmune muscular diseases include, but are not limited to, myositis, autoimmune myositis and primary Sjogren’s syndrome (Feist E. et al., Int Arch Allergy Immunol 2000 Sep; 123 (1):92) and smooth muscle autoimmune disease (Zauli D. et al., Biomed Pharmacother 1999 Jun;53 (5-6):234).
[0640] Examples of autoimmune nephric diseases include, but are not limited to, nephritis and autoimmune interstitial nephritis (Kelly CJ. J Am Soc Nephrol 1990 Aug;l (2): 140).
[0641] Examples of autoimmune diseases related to reproduction include, but are not limited to, repeated fetal loss (Tincani A. et al., Lupus 1998;7 Suppl 2:S 107-9).
[0642] Examples of autoimmune connective tissue diseases include, but are not limited to, ear diseases, autoimmune ear diseases (Yoo TJ. et al., Cell Immunol 1994 Aug;157 (1):249) and autoimmune diseases of the inner ear (Gloddek B. et al., Ann N Y Acad Sci 1997 Dec 29;830:266).
[0643] Examples of autoimmune systemic diseases include, but are not limited to, systemic lupus erythematosus (Erikson J. et al., Immunol Res 1998;17 (l-2):49) and systemic sclerosis (Renaudineau Y. et al., Clin Diagn Lab Immunol. 1999 Mar;6 (2): 156); Chan OT. et al., Immunol Rev 1999 Jun; 169: 107).
[0644] Non-limiting examples of targets that can be used in the treatment of autoimmune diseases include, but are not limited to, myelin basic protein (MBP) or MOG in multiple sclerosis; rheumatoid factor and anti-citrullinated protein antibodies (ACPA) in rheumatoid arthritis; and PD-1 in multiple sclerosis and rheumatoid arthritis. Non-limiting examples of therapeutic agents that can be used in the treatment of autoimmune diseases include, but are not limited to, monoclonal antibodies (e.g., infliximab, adalimumab, rituximab), soluble receptor proteins (e.g., soluble TNFRb, etanercept), fusion proteins (e.g., abatacept) etc.
[0645] According to specific embodiments, the disease is a neurological disease.
[0646] As used herein the phrase “neurological disease” refers to any disease, disorder or condition which is characterized by an acute and / or progressive damage and / or loss of neuronal cells and / or glial cells.
[0647] Non-limiting examples of pathologies caused by an acute or sudden damage to neuronal cells include brain injury, spinal injury, head injury, and stroke.
[0648] According to specific embodiments, the neurological disease comprises a CNS injury According to some embodiments of the invention, the neurological disease is chronic. According to some embodiments of the invention, the neurological disease is cancer. Nonlimiting examples of such cancers include glioblastoma, neuroblastoma, adenocarcinoma of the brain, as well as metastases of a distant cancers such as breast cancer, lung cancer, and the like.
[0649] According to some embodiments of the invention, the neurological disease comprises a neurodegenerative disease.
[0650] Exemplary neurodegenerative diseases or conditions include, but are not limited to multisystem atrophy, stroke, progressive supranuclear palsy, fronto-temporal dementia with parkinsonism linked to chromosome 17, traumatic brain injury (TBI), Pick's disease, multiple sclerosis, Lupus eruthromatosis, Alzheimer's disease, Parkinson's Disease, senile dementia, amyotrophic lateral sclerosis, Down's Syndrome, Dutch Type Hereditary Cerebral Hemorrhage Amyloidosis, Reactive Amyloidosis, Familial Mediterranean Fever, Familial Amyloid Nephropathy with Urticaria and Deafness, Muckle-Wells Syndrome, Idiopathic Myeloma, Macroglobulinemia- Associated Myeloma, Familial Amyloid Polyneuropathy, Familial Amyloid Cardiomyopathy, Isolated Cardiac Amyloid, Systemic Senile Amyloidosis, Adult Onset Diabetes, Insulinoma, Isolated Atrial Amyloid, Medullary Carcinoma of the Thyroid, Familial Amyloidosis, Hereditary Cerebral Hemorrhage with Amyloidosis, Familial Amyloidotic Polyneuropathy, Scrapie, Creutzfeldt-Jacob Disease, Gerstmann Straussler-Scheinker Syndrome, Bovine Spongiform Encephalitis, a Prion-mediated disease, and Huntington's Disease.
[0651] According to a specific embodiment, the neurodegenerative disease is Alzheimer's disease. According to a specific embodiment, the neurodegenerative disease is multiple sclerosis.
[0652] According to specific embodiments, the neurodegenerative disease is Amyotrophic lateral sclerosis (ALS) and multiple sclerosis. Non-limiting examples of targets that can be used in the treatment of neurological diseases include, but are not limited to, myelin basic protein (MBP) or MOG in multiple sclerosis or CNS injury, Aβ in Alzheimer’s disease, TDP-43 in ALS and FTD, a-Synuclein in Parkinson’s disease.
[0653] Non-limiting examples of therapeutic agents that can be used in the treatment of neurological diseases include, but are not limited to, IL-4, BDNF, cholinesterase inhibitors, NMDA receptor antagonists, anti-Aβ antibodies, ASOs, dopamine etc.
[0654] According to specific embodiments, the disease is a metabolic disease.
[0655] Non-limiting examples of metabolic diseases include diabetes, hypercholesterolemia, triglyceride disorders, phenylketonuria, galactosemia, lysosomal storage diseases such as Hurler, Hunter, Maroteaux-Lamy, Sly, MLD, GLD, Niemann pick, Tay Sachs, Sandhoff, Farber, Alpha- mannosidosis, Fucosidosis, Aspartylglycosminuria, Wolmann syndrome, Pompe.
[0656] Non-limiting examples of therapeutic agents that can be used in the treatment of metabolic diseases include, but are not limited to, enzyme replacement therapy, substrate reduction therapy, genome editing etc.
[0657] According to specific embodiments, the immune cells disclosed herein can be administered to a subject in combination with other established or experimental therapeutic regimen to treat the diseases disclosed herein including, but not limited to analgesics, chemotherapeutic agents, radiotherapeutic agents, cytotoxic therapies (conditioning), hormonal therapy, immunotherapy, anti-bacterial agent, anti-viral agent, and other treatment regimens (e.g., surgery) which are well known in the art.
[0658] In one embodiment, the genetically modified immune cells described herein are administered in conjunction with a chemotherapeutic drug.
[0659] Chemotherapeutic drugs can include but are not limited to antibody-drug conjugates (for example, an antibody attached to a drug by a linker), nanoparticles (for example a nanoparticle can be 1-1000 nanometer sized particle for promoting tumor selectivity and aid in delivering low- solubility drugs), electochemo therapy, alkylating agents, antimetabolites (for example, 5- fluorouracil (5-FU), 6-mercaptopurine (6-MP), Capecitabine (XelodaRTM), Cladribine, Clofarabine, Cytarabine (Ara-CRTM), Floxuridine, Fludarabine, Gemcitabine (GcmzarR I M), Hydroxyurea, Methotrexate, Pemetrexed (AlimtaRTM), Pentostatin, and Thioguanine), anti-tumor antibiotics, topoisomerase inhibitors, mitotic inhibitors, corticosteroids, DNA intercalating agents, or checkpoint inhibitors (for example checkpoint kinases CHK1, or CHK2). In some alternatives of the methods described herein, the genetically modified immune cells or compositions comprising genetically modified immune cells are administered in combination with one or more anti-cancer agents, such as any one or more of the foregoing compounds or therapies. In some alternatives, the one or more anti-cancer agent that is co-administered or administered in conjunction with the genetically modified immune cells, comprises antibody-drug conjugates, nanoparticles, electrochemotherapy, alkylating agents, antimetabolites, anti-tumor antibiotics, topoisomerase inhibitors, mitotic inhibitors, corticosteroids, DNA intercalating agents, or checkpoint inhibitors. In some alternatives, the antimetabolites comprises 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), Capecitabine (XelodaRTM), Cladribine, Clofarabine, Cytarabine (Ara- CRTM), Floxuridine, Fludarabine, Gemcitabine (GemzarRTM), Hydroxyurea, Methotrexate, Pemetrexed (AlimtaRTM), Pentostatin, or Thioguanine.
[0660] In another embodiment, the genetically modified immune cells described herein are administered with a checkpoint inhibitor.
[0661] In still other embodiments, the genetically modified immune cells described herein are administered with a small molecule inhibitor that target a protein of interest. The proteins can be e.g., proteins that are secreted by tumor cells or proteins secreted during cellular stress. Small molecule inhibitors can include but are not limited to kinase inhibitors, inhibitors of Bcl-2 family proteins for cancer therapy, MC1-1 inhibitors, or tyrosine kinase inhibitors. Tyrosine kinase inhibitors can include but are not limited to Imatinib mesylate (approved for chronic myelogenous leukemia, gastrointestinal stromal tumor and some other types of cancer), Gefitinib (Iressa, also known as ZD 1839); targets the epidermal growth factor receptor (EGFR) tyrosine kinase) Erlotinib (marketed as Tarceva), Sorafenib, Sunitinib (Sutent), Dasatinib (Srycel), Lapatinib (Tykerb), Nilotinib (Tasigna), Bortezomib (Velcade), Janus kinase inhibitors, ALK inhibitors, crizotinib Bcl-2 inhibitors, obatoclax, navitoclax, gossypol, PARP inhibitors, Iniparib, Olaparib, PI3K inhibitors, perifosine, Apatinib, VEGF Receptor 2 inhibitors, AN-152, Braf inhibitors, vemurafenib, dabrafenib, LGX818, MEK inhibitors, trametinib, MEK162, CDK inhibitors, PD- 0332991, Hsp90 inhibitors, or salinomycin. In some alternatives, the one or more anti-cancer agents that is co-administered or administered in conjunction with the genetically modified immune cells or genetically engineered macrophages (GEMs) comprises one or more of such small molecule inhibitors. In some alternatives, the small molecule inhibitors that are used comprise kinase inhibitors. In some alternatives, the small molecule inhibitors comprise inhibitors of Bcl-2 family proteins. In some alternatives, the small molecule inhibitors comprise MC1-1 inhibitors. In some alternatives, the small molecule inhibitors comprise tyrosine kinase inhibitors. In some alternatives, the small molecule inhibitor is Imatinib. In some alternatives, the small molecule inhibitor is mesylate. In some alternatives, the small molecule inhibitor is Gefitinib. In some alternatives, the small molecule inhibitor is Erlotinib. In some alternatives, the small molecule inhibitor is Sorafenib. In some alternatives, the small molecule inhibitor is Sunitinib (Sutent). In some alternatives, the small molecule inhibitor is Dasatinib. In some alternatives, the small molecule inhibitor is Lapatinib (Tykerb). In some alternatives, the small molecule inhibitor is Nilotinib (Tasigna). In some alternatives, the small molecule inhibitor is Bortezomib (Velcade). In some alternatives, the small molecule inhibitors are Janus kinase inhibitors. In some alternatives, the small molecule inhibitor is an ALK inhibitor. In some alternatives, the small molecule inhibitor is crizotinib. In some alternatives, the small molecule inhibitors are Bcl-2 inhibitors. In some alternatives, the small molecule inhibitor is obatoclax. In some alternatives, the small molecule inhibitor is navitoclax. In some alternatives, the small molecule inhibitor is gossypol. In some alternatives, the small molecule inhibitors are PARP inhibitors. In some alternatives, the small molecule inhibitor is Iniparib. In some alternatives, the small molecule inhibitor is Olaparib. In some alternatives, the small molecule inhibitor is PI3K inhibitors. In some alternatives, the small molecule inhibitor is perifosine. In some alternatives, the small molecule inhibitor is Apatinib. In some alternatives, the small molecule inhibitors are tyrosine VEGF Receptor 2 inhibitors. In some alternatives, the small molecule inhibitor is AN-152. In some alternatives, the small molecule inhibitors are Braf inhibitors. In some alternatives, the small molecule inhibitor is vemurafenib. In some alternatives, the small molecule inhibitor is dabrafenib. In some alternatives, the small molecule inhibitor is LGX818. In some alternatives, the small molecule inhibitors are MEK inhibitors. In some alternatives, the small molecule inhibitor is trametinib. In some alternatives, the small molecule inhibitor is MEK162. In some alternatives, the small molecule inhibitors are CDK inhibitors. In some alternatives, the small molecule inhibitor is PD-0332991. In some alternatives, the small molecule inhibitors are Hsp90 inhibitors. In some alternatives, the small molecule inhibitor is salinomycin.
[0662] According to specific embodiments, the method of treatment involves first using a preconditioning protocol for cell therapy. Thus, the method of some embodiments comprises administering a pre-conditioning agent prior to administering the immune cells (e.g., T cells, macrophages / monocytes). For example, pre-conditioning patients prior to T cell therapies typically improves the efficacy of the T cell therapy by reducing the number of endogenous lymphocytes and increasing the serum level of homeostatic cytokines and / or pro-immune factors present in the patient. This creates a more optimal microenvironment for the transplanted T cells to proliferate once administered to the patient, and reduces the number of endogenous lymphocytes. Non-limiting examples of pre-conditioning agents include cyclophosphamide and / or fludrabine.
[0663] The immune cells disclosed herein can be administered to the subject per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients. As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
[0664] Herein the term "active ingredient" refers to the immune cells accountable for the biological effect. The immune cells, as described herein, by way of expression are accountable for the effect.
[0665] Hereinafter, the term "pharmaceutically acceptable carrier" refers to a carrier or a diluent that does not cause significant irritation to a subject and does not abrogate the biological activity and properties of the administered compound. Examples, without limitations, of carriers are propylene glycol; saline; emulsions; buffers; culture medium such as DMEM or RPMI; hypothermic storage medium containing components that scavenge free radicals, provide pH buffering, oncotic / osmotic support, energy substrates and ionic concentrations that balance the intracellular state at low temperatures; and mixtures of organic solvents with water.
[0666] Typically, the pharmaceutical carrier preserves the number of cells (e.g., is not reduced by more than 90 %) in the composition for at least 24 hours, at least 48 hours or even at least 96 hours.
[0667] Inert substance may be added to the pharmaceutical composition to further facilitate administration of the composition and maintain cell viability at a pre-determined temperature for a suitable period of time before transplantation / injection. Examples, without limitation, of such substances include albumin, plasma, serum and cerebrospinal fluid (CSF), antioxidants such as N- Acetylcysteine (NAC) or resveratrol.
[0668] According to a preferred embodiment of the present invention, the pharmaceutical carrier is an aqueous solution of buffer or a culture medium such as DMEM.
[0669] Techniques for formulation and administration of drugs may be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
[0670] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. Preferably, a dose is formulated in an animal model to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
[0671] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. Further information may be obtained from clinical studies.
[0672] The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition, (see e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l.
[0673] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer and additional agents as described herein above.
[0674] Dosage amount and interval may be adjusted individually to levels of the active ingredient which are sufficient to effectively cause an immunomodulatory effect. Dosages necessary to achieve the desired effect will depend on individual characteristics and route of administration.
[0675] Depending on the severity and responsiveness of the condition to be treated, dosing of cells can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or months depending when diminution of the disease state is achieved.
[0676] The amount of a composition to be administered will, of course, be dependent on the individual being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. The dosage and timing of administration will be responsive to a careful and continuous monitoring of the individual changing condition.
[0677] Since non- autologous cells are likely to induce an immune reaction when administered to the body several approaches have been developed to reduce the likelihood of rejection of non- autologous cells. These include either suppressing the recipient immune system or encapsulating the non- autologous cells or tissues in immunoisolating, semipermeable membranes before transplantation.
[0678] Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludag, H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).
[0679] Methods of preparing microcapsules are known in the arts and include for example those disclosed by Lu MZ, et al., Cell encapsulation with alginate and alpha-phenoxycinnamylidene- acetylated poly (allylamine). Biotechnol Bioeng. 2000, 70: 479-83, Chang TM and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. Mol Biotechnol. 2001, 17: 249-60, and Lu MZ, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha-cyanocinnamylideneacetate). J Microencapsul. 2000, 17: 245-51.
[0680] For example, microcapsules are prepared by complexing modified collagen with a terpolymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 pm. Such microcapsules can be further encapsulated with additional 2-5 pm ter-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S.M. et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 2002 23: 849-56).
[0681] Other microcapsules are based on alginate, a marine polysaccharide (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Thechnol. Ther. 2003, 5: 665-8) or its derivatives. For example, microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.
[0682] It will be appreciated that cell encapsulation is improved when smaller capsules are used. Thus, the quality control, mechanical stability, diffusion properties, and in vitro activities of encapsulated cells improved when the capsule size was reduced from 1 mm to 400 pm (Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002;13: 783-96). Moreover, nanoporous biocapsules with well-controlled pore size as small as 7 nm, tailored surface chemistries and precise microarchitectures were found to successfully immunoisolate microenvironments for cells (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999, 10: 6-9; Desai, T.A. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002, 2: 633-46).
[0683] Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient e.g. in a syringe ready for use. The syringe may be labeled with the name of the cells and their source. The labeling may also comprise information related to the function of the cells (e.g. the amount of therapeutic agent secreted therefrom). The syringe may be packaged in a packaging which is also labeled with information regarding the cells. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
[0684] According to specific embodiments, any of the genes, polynucleotides, proteins, polypeptides and / or proteinaceous moieties described herein may have a sequence of a human gene, polynucleotide, protein, polypeptide and / or proteinaceous moiety or a functional fragment or homolog thereof which exhibit the desired activity as described herein.
[0685] According to specific embodiments, the gene, polynucleotide, protein, polypeptide and / or proteinaceous moiety is of a human origin.
[0686] According to other specific embodiments, the gene, polynucleotide, protein, polypeptide and / or proteinaceous moiety is a homolog of a human gene, polynucleotide, protein, polypeptide and / or proteinaceous moiety. Such homologues can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the human sequence.
[0687] According to specific embodiments, the sequence of any of the genes, polynucleotides, proteins, polypeptides and / or proteinaceous moieties described herein may refer to a fragment or a homolog of the amino acid sequence or nucleic acid sequence disclosed herein which exhibit the desired activity as defined herein. The homolog (naturally occurring or synthetically / recombinantly produced) can be, for example, at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide sequence provided herein or a functional fragment thereof which exhibit the desired activity as defined herein; or at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical to the polynucleotide sequence encoding same.
[0688] Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.
[0689] The homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including a conservative and non-conservative amino acid substitution, as further described hereinbelow. According to specific embodiments, the amino acid sequences described herein may comprise conservative and / or non-conservative amino acid substitutions.
[0690] The term “conservative substitution” as used herein, refers to the replacement of an amino acid present in the native sequence in the peptide with a naturally or non-naturally occurring amino or a peptidomimetics having similar steric properties. Where the side-chain of the native amino acid to be replaced is either polar or hydrophobic, the conservative substitution should be with a naturally occurring amino acid, a non-naturally occurring amino acid or with a peptidomimetic moiety which is also polar or hydrophobic (in addition to having the same steric properties as the side-chain of the replaced amino acid).
[0691] As naturally occurring amino acids are typically grouped according to their properties, conservative substitutions by naturally occurring amino acids can be easily determined bearing in mind the fact that in accordance with the invention replacement of charged amino acids by sterically similar non-charged amino acids are considered as conservative substitutions.
[0692] For producing conservative substitutions by non-naturally occurring amino acids it is also possible to use amino acid analogs (synthetic amino acids) well known in the art. A peptidomimetic of the naturally occurring amino acid is well documented in the literature known to the skilled practitioner.
[0693] When affecting conservative substitutions, the substituting amino acid should have the same or a similar functional group in the side chain as the original amino acid.
[0694] The phrase "non-conservative substitutions" as used herein refers to replacement of the amino acid as present in the parent sequence by another naturally or non-naturally occurring amino acid, having different electrochemical and / or steric properties. Thus, the side chain of the substituting amino acid can be significantly larger (or smaller) than the side chain of the native amino acid being substituted and / or can have functional groups with significantly different electronic properties than the amino acid being substituted. Examples of non-conservative substitutions of this type include the substitution of phenylalanine or cycohexylmethyl glycine for alanine, isoleucine for glycine, or -NH-CH[(-CH2)5-COOH]-CO- for aspartic acid.
[0695] Non-limiting exemplary combinations of pathologies, genes, expression regulatory elements comprising enhancers and / or cargos that can be used with specific embodiments are provided in Table 3 hereinbelow.
[0696] Table 3: Table 4: TF binding motifs identified in TAM-specific elements of some embodiments of the invention
[0697]
[0698] As used herein the term “about” refers to ± 10 %.
[0699] The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".
[0700] The term “consisting of’ means “including and limited to”.
[0701] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0702] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
[0703] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0704] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0705] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0706] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0707] Each patent, publication, and non-patent literature cited in the application is hereby incorporated by reference in its entirety as if each was incorporated by reference individually.
[0708] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0709] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0710] EXAMPLES
[0711] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.
[0712] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. MATERIALS AND METHODS
[0713] Analysis of Publicly available mouse and human T cells - To identify the top IL-2 responsive genes following stimulation with IL-2 from previously published gene expression data, the publicly available raw RNA-seq data from GEO database (mouse - GSE102317; human - GSE64713) was downloaded and processed.
[0714] Generation of CNS-specific, PD-1 specific or TREM-specific CAR T cells - All CARs were cloned into retroviral vectors and screenings of different combinations of binding and transmembrane domains of CARs targeting CNS-relevant antigens were performed. The CAR constructs were designed to specifically engage Aβ fibrils for Alzheimer's disease (AD), TDP-43 protein for ALS, myelin protein MOG for other CNS disorders, TREM2 expressed on macrophages, or PD-1 expressed on activated and autoreactive T cells. To design the CARs against the targets of choice, a signal sequence was used to direct the protein to be transported to and inserted into the cellular membrane (SEQ ID NO: 1, 46, 92) followed by sequences of known antibodies that were used and the variable parts of the heavy and light chains of antibodies against Aβ (International Patent Application Publication No. W02014089500, SEQ ID NO: 2, composed of a light chain set forth in SEQ ID NO: 3, a linker set forth in SEQ ID NO: 14 and a heavy chain set forth in SEQ ID NO: 4), MOG (Korean Patent Application Publication No. KR20190097067, SEQ ID NO: 5, composed of a light chain set forth in SEQ ID NO: 6, a linker set forth in SEQ ID NO: 14 and a heavy chain set forth in SEQ ID NO: 7; or SEQ ID NO: 8, composted of a light chain set forth in SEQ ID NO: 9, a linker set forth in SEQ ID NO: 14 and a heavy chain set forth in SEQ ID NO: 10) or TDP-43 (SEQ ID NO: 11, composed of a light chain set forth in SEQ ID NO: 12, a linker set forth in SEQ ID NO: 14 and a heavy chain set forth in SEQ ID NO: 13) were selected as CNS targets. Anti PD-1 and TREM2 heavy and light chains are provided. Different combinations of TM and intracellular (IC) domains were evaluated: mouse CD28 TM and IC (SEQ ID NO: 15), mouse CD8 TM (SEQ ID NO: 16), human CD8 (SEQ ID NI: 17), mouse 4-1BB IC (SEQ ID NO: 18), human 4- IBB IC (SEQ ID NO: 19) mouse CD3z IC (SEQ ID NO: 20) and / or human CD3z IC (SEQ ID NO: 21). The constructs were transduced into mouse T cells as described hereinbelow. 24 hours following stimulation with the target antigens, IFNy concentrations secreted by the CAR T cells to the media were determined by an ELISA MAX Deluxe Set Mouse IFN-y (BioLegend, Cat no: 430816) to establish antigen- specific activation of these CAR T cells in vitro, in comparison to control T cells transduced with a BFP reporter. Constructs with minimal response in the absence of the antigen were screened for, and combinations of binding and transmembrane domains for each target that yield CAR T cells that are not leaky at baseline and secrete ZFNy in response to antigen stimulation were identified. All constructs used are provided in Table 1 hereinbelow
[0715] Generation of CNS-specific CAR T cells expressing a therapeutic cargo - BDNF (SEQ ID NO: 58) was chosen as a proof-of-concept therapeutic cargo. The constructs comprised an enhancer, a mini promoter (SEQ ID NO: 71) and the nucleic acid sequence encoding BDNF (SEQ ID NO: 59). The following enhancers were used (STAT5 recognition sites are highlighted in bold):
[0716] IL2RA enhancer (SEQ ID NO: 60): ttacacctcagcatagcctcagcctctttttttccccctgaatgtatgtagctcaggglggcttagaaattcatgaaglgattaaggctaalctcaa actcctgatcactccaccttacttacacgtctggagttcactctggtaggacctcctcaggaccctgctagtcttagatcctgtattctctgaatc cttctgttaccttcaaagagcagcctggggtgttttccttgcatctgatagcatttcaaagaagtcacagcagcagagtctgggctagcaacc ggcaaaacagaggaaattctgagcacctttggccatgagtcaccacaccttctgagcacctttggccatgagtcaccacaccttgttcagga attgccatctctgcccacagaatcgcccactgttttctgtgtgggaccaaaatagatacctccttcataaactttgtgtgtgtgtgtgtgtgtgtgt gtgttctctctctctctctctctctctctctctctctctctctctcttggtaataaaaaacaaaagacaaagatgggtatgtgcttccaagggcagac taagaagccacttacaggtgagtgtgacaggtgagaggaaccgtggcaaggaacaccctaccctggtggcagagcttctcgatatttgtat gtctgctgctttgcttctcagttcattcatgatctattgagcaacttcacgcaaggtta
[0717] LTA enhancer (SEQ ID NO: 61): ggagttccagtgaacggccgagcaattcgtggagagggt
[0718] SOCS1 enhancer (SEQ ID NO: 62) ttcagggaactgaacttcccagagctttcccagaa
[0719] Synthetic IL2R.A enhancer (referred to herein as “I12ra enhancer STAT5 repeats”, SEQ ID NO: 63): tagcattcaaagaagtcacatagcatttcaaagaagtcacatagcatttcaaagaagtcacatagcatttcaaagaagtcacatagcatt tcaaagaagtcacatagcatttcaaagaagtcaca
[0720] IL2RA promoter (SEQ ID NO: 1097, used as a control): cacgaccttgcttctcagtctttgttgagtcttctgggggagaatccccctagaggactcagtttacaaaaccctaagtgagaccactgccaa gaagtgcttgctcacccctcctgccgcggcagggaatccccctttccttgtacaggcaaaacacaaaaaaggactcataagtgaagcctga tccttctcaccaaacactgcccacacctcctagtaattgaacttgaaaaaaaaaactggtttgaaaaattaccgcaaaccatattgtcataaaaa aaaaaaaaaacacttcctataagagatcacagaacagagtaggcac
[0721] All constructs used are provided in Table 1 hereinbelow.
[0722] Transduction of mouse T cells to obtain the CNS-specific CAR T cells - retroviral supernatant obtained from a Plat-E packaging cell line was used to transduce activated murine CD45.1+ T cells by “spin-infection” on RetroNectin plates (IM cells / well). T cells from CD45.1+ mice were activated with anti-CD3 antibody from eBioscience (145-2C11, Catalog Number 16- 0031-82) and anti-CD28 antibody from BioLegend (Cat No. 102102), and lOO U / mL of IL-2 for 1 day prior to transduction. Transduced murine lymphocytes were expanded for 4 days before in vitro assays. Transduction efficiency was estimated by FACS analysis of BFP expression on retrovirally transduced cells.
[0723] CNS-specific CAR T cell antigen recognition - IFN-y secretion - Murine (2 * 105cells) CAR T cells in RPMI complete media were starved of IL-2 for 24 hours and logic-gated cargo secretion was evaluated at 24, 48 and 72 hours timepoints following no stimulation, antigen stimulation, direct stimulation with different IL-2 concentrations, or with anti-CD3 / CD28 activation. For antigen stimulation, CAR T cells were cultured with 10 pg / ml Aβ fibrils or mouse myelin. Supernatants were harvested and assayed for IFNY 24 and 48 hours later using the mouse IFNy ELISA Kit (BioLegend).
[0724] Protein levels of the BDNF cargo - protein levels of BDNF were assessed using a BDNF ELISA Kit (R&D systems, Human / Mouse BDNF DuoSet ELISA Cat No. DY248) according to the manufacturer’s instructions.
[0725] Mice -_Wild-type C57B1 / 6 mice were purchased from Harlan. B6.SJL mice were bred inhouse. Mice were housed in the Weizmann Institute animal facility, under pathogen-free conditions. For the experiments, 8-14-week-old mice were used. Experiments were approved by an Institutional Animal Care Committee (IACUC).
[0726] Molecular cloning of constructs used in experiments designed to harness tumor environment- specific transcriptional activity of selected regulatory elements in order to manipulate cell states in the TME - Trem2 enhancer / promoter sequences (SEQ ID Nos: 1017- 1021) were PCR amplified directly from the genome of bone marrow macrophages from C57B1 / 6 mice. Lentiviral vectors encoding GFP or murine cDCl-specific TFs (Irf8-P2A-Batf3, SEQ ID NOs: 1019-1021) downstream of the Trem2 enhancer / promoter (SEQ ID NOs: 1017-1018), followed by SFFV-dTomato (SEQ ID NO: 972) were generated using standard cloning techniques. Coding sequences of TFs were amplified from gBlocks gene fragments (IDT Technologies) and cloned into pScalps vector backbone (Addgene). Sequences were verified by the whole plasmid sequencing by Plasmidsaurus.
[0727] Viral production - Lentivirus was produced using the 2ndgeneration system. Briefly, human embryonic kidney (HEK) 293T cells were seeded in 10 cm plates to reach ~80 % confluency and transfected with 5.76 pg packaging plasmid (psPAX2), 1.88 pg VSV-G-encoding envelope plasmid (pMD2), and 7.5 pg transfer plasmid, together with 30 pl of jetPEI transfection reagent (Polyplus). Virus-containing supernatants were collected after 48 and 72 hours, filtered using 0.45 pm filters, concentrated with Amicon centrifugal filters (Sigma- Aldrich) and stored at -80 °C. Lentiviral titers were quantified with the Lenti-X qRT-PCR titration kit (Takara) following the manufacturer’s protocol.
[0728] Bone marrow cell isolation - B6.SJL mice were sacrificed by cervical dislocation. Total bone marrow (BM) was isolated by crushing long bones of the legs (tibias and femurs). Cells were harvested in MACS buffer (PBS + 2mM EDTA + 0.5 % BSA), filtered with a 70 pm cell strainer, followed by the red blood cell lysis. To isolate stem / progenitor cells, BM was incubated with CD 117 (c-kit) MicroBeads (Miltenyi Biotec) according to the manufacturer’s instructions and c-kit+ cells were positively selected with LS columns and QuadroMACS separator (Miltenyi Biotec). Cells were conditioned for 8-9 hours in serum-free StemSpan SFEM II medium (STEMCELL Technologies) supplemented with mouse IL-6 (20 ng / ml), SCF (100 ng / ml), Flt3L (100 ng / ml) and TPO (50 ng / ml; all from Peprotech), at IxlO6c-kit+ cells / ml.
[0729] Lentiviral transduction - Non-TC-treated plates were coated with retronectin (30 pg / ml, Takara) for 3 hours at room temperature (RT). After washing with PBS, previously concentrated lentivirus in DMEM was added to wells and plates were centrifuged for 2 hours, 1000g, at 32 °C.
[0730] Viral medium was removed and pre-conditioned c-kit+ cells were transferred to wells. Polybrene (Sigma-Aldrich) was added to a final concentration of 5 pg / ml and plates with cells were spinoculated for 1-1.5 hours, 1000g, at 32 °C, followed by an overnight incubation at 37 °C.
[0731] Bone marrow transplantation - After an overnight (12-16 hours) incubation, lentiviral- transduced c-kit+ cells were collected, washed with PBS and intravenously injected into lethally irradiated (8 Gy) C57B1 / 6 mice.
[0732] Tumor model and organ processing - 9 weeks post-bone marrow reconstitution, MC38 cell line (1.5xl06cells) were implanted subcutaneously on the right flank of mice and tumor volumes were measured every 2 days with an electronic caliper. Mice were sacrificed 15 days after tumor injection. Tumors underwent mechanical (gentleMACSTM C tube, Miltenyi Biotec) and enzymatic digestion with 13 pg / ml DNase type I (Roche) and 1 mg / ml Collagenase IV (Worthington) in RPML1640. Cells were filtered through 100 pm cell strainer and washed with ice-cold MACS buffer. Spleens and tumor-draining lymph nodes (tdLNs) were mashed with a syringe plunger through a 100 pm nylon cell strainer. Spleens were treated with ammoniumchloride potassium (ACK) lysing buffer to remove erythrocytes.
[0733] FACS and sorting for scRNA-seq - Single cell suspensions from tumors and tdLN were washed with PBS and stained with Zombie fixable viability dye (BioLegend). After blocking nonspecific binding by incubation with anti-FcyR antibodies (BioLegend) for 10 minutes on ice, cells were stained with anti-mouse fluorophore-conjugated antibodies and sorted using BD FACSArialll (BD Biosciences) cell sorter. Single cells were sorted into 384-well capture plates containing barcoded poly(T) reverse-transcription (RT) primers, lysis solution composed of 0.5 U / pL Ribolock (Thermo Fisher Scientific) and 0.2 % Triton X-100 (Sigma- Aldrich), and 3 pl mineral oil (Sigma-Aldrich). Plates were spun down, snap-frozen on dry ice and stored at -80 °C until further processing. Cells were analyzed using BD FACSDIVA software (BD Bioscience) and FlowJo software (FlowJo, LLC). Single-cell libraries were prepared and initial analysis was done as previously described (Yofe I., et al. Cancer Discov 2023).
[0734] Single-cell RNAseq data analysis - Single-cell gene expression datasets were analyzed using the Scanpy library (v 1.10.0) (Wolf et al., Genome Biology 2018). Cells with less than 300 UMIs and those with mitochondrial gene content exceeding 20 % were excluded. Additionally, genes detected in fewer than ten cells were removed. Total gene UMI per cell was normalized to a target sum of 104and subjected to a log Ip transformation. Subsequently, highly variable features were identified based on a minimum and maximum mean expression of 0.0125 and 3, respectively, and a minimum dispersion of 0.5. Principal component analysis was utilized for dimensionality reduction, and 50 principal components were employed for constructing a neighborhood graph with default parameters. The Leiden algorithm was employed for clustering across resolutions ranging from 0.2 to 0.6. The dataset was visualized in two dimensions using uniform manifold approximation and projection (UMAP) with a minimum distance of 0.5 and a learning rate of 1. For in-depth analysis of cell types, the initial dataset was subset and re-clustered following the abovementioned methodology. Clusters were annotated using canonical markers.
[0735] Retrovirus cloning and T-cells transduction - Genes of interest were cloned into retroviral vectors to create the different constructs. The resulting plasmid was then transfected into Plat-E cells which were incubated for 48 hours to produce retroviral particles. Pan T-cells were isolated from spleen of 8-10-week-old C57BL / 6 J or B6.SJL CD45.1 mice for in-vivo experiments. T- cells were plated on CD3 / CD28 coated plates and incubated for 28 hours prior to transduction. Transduced T-cells were then expanded in culture in an IL2-enriched media for 4 days.
[0736] In-vitro activation assay - Transduced T-cells were activated with human CD14+ cells, CD3 / CD28 beads or with HEK-TREM2 cells for 24 hours. HEK-TREM2 cells are HEK-293 cells that were engineered to express the TREM2 molecule. Cell numbers as well as FACS analysis was performed to assess killing.
[0737] ELISA - IFNy and hIL2 ELISA assays [ELISA MAX Deluxe Set Mouse IFN-y (BioLegend, Cat no: 430816) and ELISA MAX Deluxe Set Human IL-2 (BioLegend, Cat no: 431804), respectively] were used to detect and quantify cytokine production by the transduced T- cells. TrojCAR T-cells were be stimulated with CD3 / CD28 beads or HEK-TREM2 cells and cytokine production was measured in the culture supernatant after 24 hours.
[0738] Cloning of cytokines - Coding sequences for cargo (IL2 wild type, IL2 H9-superkine, IL12b-IL12a, IL15-IL15RAsushi, IL18DR; SEQ ID NOs: 999-1016) were ordered from IDT or Twist Biosciences as gene blocks with overhangs to be directly cloned using Gibson reaction in a pLEX lentiviral backbone linearized with Mlul and Barnhl. Regulatory elements were amplified directly from the genome of bone marrow macrophages harvested from Black 6 mice, which were PCR amplified with primers containing overhangs to be directly cloned using Gibson reaction in a pLEX lentiviral backbone linearized with Agel and Barnhl.
[0739] Differentiation and polarization of bone marrow-derived macrophages and monocytes - Bone marrows were flushed from tibias and femurs of 8-12-week-old mice, subjected to red cell lysis, and differentiated towards macrophages in RPMI medium supplemented with 10 % FBS (v / v), 1 % P / S (v / v), 1 % HEPES (v / v), 1 % a-MEM (v / v), 0.1 % B -mercaptoethanol (v / v), 1 % Glutamine (v / v) and 1 % Pyruvate (v / v). Cultures were either started with human macrophage colony-stimulating factor, hMCSF, (30 ng / mL) (PeproTech Cat no. 300-25-100) for macrophage differentiation for 6 days and polarized for another 24 hours with murine IL-4 (20 ng / mL) (Peprotech PeproTech Cat no. 214-14-5), or cultured in murine GM-CSF (20 ng / mL) (- PeproTech Cat no. 315-03-5) for 7 days. Cells were harvested by light detachment using Accutase (Sigma), incubated for 30 minutes at 37 °C, and washed 2x with PBS. Polarization of macrophages was also tested with different cytokines, including mIL-10 (20 ng / mL) PeproTech Cat no. 210- 10-10, mIL-11 (20 ng / mL) PeproTech Cat no. 220-11-10, mIL-13 (20 ng / mL) PeproTech Cat no. 220-13-10, mTGFb (20 ng / mL) Enco Cat no. BLG-763102, and mIFNG (20 ng / mL) PeproTech Cat no. 315-05-20.
[0740] Library Preparation: Screening for cis-regulatory elements - Genomic sequences of 200 bps obtained from processed ATAC-seq data were ordered as a single-stranded library (Twist Biosciences) flanked by adaptor sequences in a lyophilized vial. The library was reconstituted in 10 mM Tris pH8.0 and double- stranded with 10 PCR cycles using PCR primers specific for adaptor sequences. A second PCR was performed to add barcodes and 30 bps flanking overhangs on each side. The library was inserted using Gibson reaction into the plasmid linearized with Agel and Sbfl. One vial of NEB 10 beta / Stable bacteria (lOOuls) was electroporated with 50 ng of circularized plasmid library and then plated on 10 x 15cm agar plates supplemented with Ampicillin. After 16 hours, bacterial colonies were scraped off from all plates, grown in liquid broth cultures for 8 hours, and plasmid library was harvested and purified. The resulting plasmid was then amplified with indexed p5 and p7 Illumina primers and sequenced with a NovaSeq Illumina platform.
[0741] Table 1: list of constructs
[0742]
[0743]
[0744] EXAMPLE 1 TROJAN REGULATORY CIRCUITS
[0745] In an effort to develop immune cells that secret a therapeutic agent (i.e., cargo) in an inducible manner at the site of pathology (referred to herein as “TROJAN cell”) the present inventors used extensive single-cell genomic approaches, in silico and functional screens to thereby identify candidate complex distal regulatory elements comprising enhancers with multiple TF binding which can serve as specific sensors for gene-expression activators in the diseased tissue. Following, these different enhancers (referred to herein as “TROJAN circuits” or “TROJAN elements”) of active regulatory elements specific to T cells and myeloid cells were coupled to a minimal promoter upstream to a reporter gene or a cargo molecule. To systematically characterize the functions of candidate TROJAN elements uncovered by the analysis, a pooled screen approach was implemented that evaluates the activity of each regulatory element in an in- vitro disease-context developed by the present inventors that recapitulates disease signals. This entails generating a plasmid library of disease- specific regulatory elements, covering diverse tumor microenvironment (TME), neurodegeneration and autoimmunity signaling pathways, in order to increase specificity and sensitivity, and further evolving them in an iterative approach to establish TROJAN cell candidates with the highest sensitivity and specificity.
[0746] Part 1.1 - Harnessing T cell activation and exhaustion for engineering TROJAN T cells:
[0747] CAR-T cells, like other tumor-infiltrating lymphocytes, undergo exhaustion when reaching the solid tumor microenvironment due to chronic antigen stimulation and exposure to immunosuppressive signals - making current CAR T efforts for solid tumor ineffective. The present inventors’ approach leverages the signaling associated to activation or exhaustion machinery in T cells to identify elements that are strongly active, exclusively within the TME to robustly activate the CAR T specifically when they enter the tumor environment but not in irrelevant tissues. For this purpose, both CAR-dependent and independent signals can be used to manipulate and optimize the intracellular response cascade in T cells.
[0748] In order to determine the regulation on which the cargo secretion will be dependent, publicly available and single cell datasets were analyzed, including bulk RNA-seq, ATAC-seq and H3K27ac profiling of mouse CD8+ tumor-infiltrating lymphocytes and CD8+ lymphocytes from chronic inflammation.
[0749] To identify the candidates, CD8+ T cells at different activation levels (naive, active, and exhausted) were analyzed for 34 known T cell exhaustion-related genes. Top candidate genes were selected based on log2 fold-change in RNA expression between activation levels (Figure 13 A). Differential peak analysis was conducted using ATAC-seq data to identify significant changes in chromatin accessibility, with peaks filtered by log2 fold-change and adjusted p-value to select the most relevant ones (Figure 13B). These findings were subsequently validated using acetylation data.
[0750] This analysis identified key genes induced through the exhaustion mechanism, along with several regulatory elements that could be specifically activated in the target environment. Specifically, the following genes were upregulated: HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB 1, GZMB, PRF1, CD244, IFNG, CD83, SLAMF6, XCL1, CRTAM, EBI3, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB1, PSMA1, TANK, SUB1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3, and PMF1. Moreover, the TROJAN elements identified are provided in SEQ ID Nos: 1054-1067.
[0751] Part 1.2 - Harnessing the IL-2 downstream transcriptional machinery in T cells for engineering IL-2 controlled TROJAN T cells
[0752] Since constitutive secretion of cargos can be cytotoxic and would result in unwanted off- target effects, the present inventors envisaged CAR T cells that release therapeutic cargos on-target by tight regulation. To this end, specific embodiments suggest harnessing the transcriptional programs induced in T cells by CAR activation to control cargo release by testing and evolving natural and synthetic regulatory elements (enhancers) downstream of specific signaling pathway activated following T cells activation. When CAR T cells engage their target and are activated, one of the induced signaling pathways is IL-2 signaling that will drive further T cell proliferation. IL-2 signaling is also induced naturally following TCR activation (which is mimicked by the CAR). To determine the regulation which the cargo secretion will be dependent upon, publicly a vailable single cell data sets of mouse [Li P., et al. (2017). Proceedings of the National Academy of Sciences, 774(46), 12111-12119] and human (Mitra, S., et al. (2015). Immunity, 42(5), 826-838] T cells were analyzed to find the top candidate genes that are highly induced following IL-2 stimulation and are conserved across mouse and human.
[0753] Analysis of mouse T cell transcriptomics at different timepoints following IL-2 stimulation revealed a dynamic regulation of highly induced genes and top STAT5-regulated gene candidates (Figure 9A). Top candidates were selected not only by the highest log2 fold-change, but also by the highest absolute expression (Figure 9B), to ensure optimal release of the cargo, specificity and activity. Analysis of human T cell transcriptomics at 4 hours after IL-2 stimulation (Figure 9C) revealed similar induced genes as the mouse.
[0754] Taken together, this analysis revealed top candidate genes that are conserved across mouse and human and are highly induced by IL-2 when considering both absolute expression and amplitude change of expression, including e.g., IL2RA, LTA, SOCS1, Cish, Socs2, Socs3, Osm, Idl, and IL24. Out of these candidate genes, IL2RA, LTA and SOCS1 (Figures 9B and 9D) were selected as the pivotal regulatory locus for further evaluation.
[0755] Following, the distal regulatory elements (enhancers) both upstream and downstream of the candidate genes were mapped. As these genes have super-enhancers containing many different enhancers and regulatory elements, the present inventors have identified their T cell-specific enhancer sequences which they utilized for the IL-2 natural and synthetic enhancers controlling cargo secretion. To design the constructs the identified enhancer sequences which contain the relevant transcription factor recognition site were used - in the case of the IL-2 signaling pathway, the chosen enhancer sequences include the STAT5 recognition motif. The enhancers of the IL2RA, LTA and SOCS 1 genes that were established as top candidates in the analysis were cloned, followed by a minimal promoter to control cargo expression upon IL-2 specific activation. A synthetic optimized IL2RA enhancer, referred to herein as “I12ra enhancer STAT5 repeats” (SEQ ID NO: 63), was designed by cloning six repeats of the sequence that includes the STAT5 recognition site of the native IL2RA enhancer. This synthetic enhancer has optimized induced expression of BDNF following IL-2 signaling, with minimal basal expression.
[0756] Following, to demonstrate logic-gated IL-2-induced cargo secretion by harnessing the natural IL-2 signaling, T cells were starved of IL-2 for 24 hours and logic-gated cargo secretion was evaluated at different timepoints following no stimulation, direct stimulation with different IL-2 concentrations, or with anti-CD3 / CD28 activation. Anti-CD3 / CD28 stimulation represents TCR activation, which indirectly induces IL-2 signaling. Protein levels of the cargo, BDNF, were assessed using ELISA (Figure 10). The synthetic optimized IL2ra enhancer has optimized induced expression of BDNF following IL-2 signaling, with minimal basal expression.
[0757] Part 1.3 - Harnessing the TNFa downstream transcriptional machinery in T cells for engineering TNFa controlled TROJAN T cells
[0758] Another major pathway for reprogramming T cells suggested by specific embodiments using TROJAN circuits is the TNFa pathway. TNFa is a disease-specific signal and a key driver of autoimmunity and inflammation in multiple pathological conditions; and thus, the present inventors suggest developing regulatory TROJAN-circuits downstream to TNFa and additional inflammatory signal to induce controlled expression and secretion of a therapeutic cargo. TNFa mediates altered gene signatures in autoimmune diseases (Figures 14A-B). The present inventors have identified top gene candidates with both an increase in absolute expression (Figure 14C) and log-fold change (Figures 14D-E) for both CD4 and CD8 T cells in response to TNFa stimulation, including e.g., TNFAIP3, Nfkbia, Nfkb2, Ldha, Irfl, Ltb, and Junb. Out of these candidate genes, TNFAIP3 was selected as the pivotal regulatory locus for further evaluation.
[0759] To test the TROJAN approach, enhancers of the TNFAIP3 locus cloned upstream of a mini promoter followed by the selected marker or therapeutic cargo are screened, testing both WT alleles and alternative enhancer variants which are functionally associated with an increased risk for various autoimmune diseases. The TROJAN elements identified are provided in SEQ ID Nos: 1022-1052.
[0760] Part 1.4 - Tumor associated macrophage (TAM l-specific TROJAN elements
[0761] Macrophages exhibit high adaptability to various environments, including tissue resident macrophages aiming to resolve tissue damage and restore organ function. Their native genetic networks evolved to compute multi-functional outputs derived from complex signal input layers under different tissue stimuli. In tumorigenesis, macrophages have been shown to play a crucial role in supporting tumor growth and metastasis. Bone marrow-derived monocytes migrate, infiltrate the tumor, and undergo terminal differentiation towards tumor associated macrophages. Upon terminal differentiation, macrophages adopt a program of biological sensors that enables them to exert their functions via engagement with the environment through signaling pathways conveyed from distinct niches inside the tumor (Figure 43). The diverse tumor signaling pathways converge into a unique and dedicated transcription factor circuit that activates specific gene modules and differentiates the monocytes into tumor-associated macrophages (TAMs).
[0762] Identifying TAM-specific cis-regulatory elements: Gene expression programs are critical in studying cell type specificity. To characterize the exclusive gene expression program of TAMs, single-cell RNA- sequencing was carried out on 179 patient samples taken from breast, colon, and lung tumors. A differential gene expression analysis was conducted on approximately 200,000 myeloid cells, including TAMs, resident macrophages and monocytes (Figure 1). This TAM- specific core program is shared across major tumor subtypes, including breast, colon and lung tumors. Core genes expressed and shared by TAMs across the different tumors but not in monocytes or tissue macrophages include: Btgl, C9, Ccl4, Cd2ap, Cldnl, Cldnl6, Csflr, Cx3crl, Cxcll l, Cxcl2, Dcstamp, Dock4, Dusp2, Dusp4, Fcho2, Fgfr2, Filipll, Fmnl2, Hdac2, Hilpda, Hmgal, Husl, Igfl, Illa, I17r, Itgax, Itgb5, Itgb7, Lhfpl2, Lrpl, Mepe, Metrnl, Mucl3, Ndrgl, Nfatc2, Nr4a3, Nrpl, Pdgfrb, Pdpn, Pfkp, Pgsl, Ptgs2os2, Rab31, Rap2b, Rel, Sbf2, Slamf7, Slc2al, Slc30a4, Socs3, Sox5, Spef2, Tefm, Tg, Tgfbi, Tgfbrl, Trem2, Tremll, Zscan2.
[0763] TAM-specific genes are flanked by intergenic regions, which contain putative distal regulatory elements (enhancers), known as cis-regulatory elements (CREs), that are accessible only in macrophages and only under tumor signaling. When compared to other tissue resident macrophages using genome wide ATAC-seq and CHIP-seq or accessible genomic regions, TAMs exhibit an exclusive signature of accessible regulatory elements, making these sequences as potentially ideal specific sensors of the tumor environment. To this end, the present inventors developed state-of-the-art single-cell technologies and machine-learning analytics to characterize these putative regulatory regions that control gene expression programs in tumor macrophages. Landscapes of such TAM regulatory elements were generated and compared to circulating monocytes and resident macrophages, to generate a rich database of putative TAM- specific TROJAN regulatory elements (Figure 15).
[0764] Functional testing of the elements in vitro: The aim was to generate an in-vitro cell culture system to mimic tumor like conditions and resident-like conditions in order to select CREs based on activity and specificity. A prototype CRE (SEQ ID NO: 970) that has activity under immunosuppressive conditions was used and cloned 5’ of a CMV minimal promoter (SEQ ID NO: 971). This CRE was tested under several growth factor conditions (Figure 16) and found that the best conditions are MCSF+IL4 for tumor-like conditions, whereas GMCSF showed low responsive rates in comparison to IFNy to be used for resident-like conditions.
[0765] CRE screening using a lentiviral massive parallel reporter assay (MPRA) in murine
[0766] BMDMs: The machine learning (ML) tools and single-cell profiles can generate comprehensive models of tumor- specific signaling regulation. To further create a macrophage tumor- specific sensory tool set, a robust screening procedure to identify which elements are transcriptionally active and have the appropriate specificity was developed. Based on our ML model (CREsted https: / / github.com / aertslab / CREsted) a library of thousands of TAM-specific elements was generated, each containing multiple pathway sensory units. These libraries were then synthesized and cloned into a reporter plasmid and tested in in-vitro conditions comparing tumor-like conditions (MCSF+IL4) to tissue macrophages and circulating monocytes conditions (GMCSF). This ultra-high throughput regulatory screening technology contained the putative CRE under investigation (total of 1200 CREs including controls) and a basal promoter driving the expression of a mRNA that contains a 15 bp barcode. A unique barcode was assigned to each element. Then, the full 1.2k CRE library was packaged into a lentiviral construct to transduce bone marrow- derived macrophages (BMDMs) in cultures, which were then polarized toward tumor-like or resident-like conditions. On day 7 the RNA was harvested from both conditions (MCSF+IL4 and GMCSF) and a library was generated. The library was then amplified with illumina primers and sequenced by next-generation sequencing. The library output was measured by the mRNA counts derived from each barcode (Figures 17, 18) and normalized against positive and negative controls. Validation of top element candidates: The CREs that were active only in the MCSF+IL4 conditions were considered as TAM-specific sensors, which were further validated individually in-vitro. An exemplary small sample of six CREs tested and validated in-vitro is shown in Figure 19. Each CRE was cloned upstream of a minimal promoter driving GFP expression and values were normalized for transductions using a dTomato cassette driven by a constitutive SFFV promoter. Three of the sensors tested showed high specificity and activity under tumorigenic conditions, whereas resident macrophages exhibited minimal activity. Others show activity in both and were therefore excluded from further applications (Figure 19).
[0767] TAM-specific TROJAN elements identified by the methods described hereinabove are provided in SEQ ID Nos: 1108-1973 (corresponding to 104-969 with the adaptors of SEQ ID NOs: 1106-1107), 970 and 1017. Computational analysis of these sequences revealed the presence of multiple transcription factor binding motifs (see Table 4 hereinabove). Specifically, each native sequence was scanned computationally using FIMO (Find Individual Motif Occurrences) for identifying consensus transcription factor binding sequences from JASPAR database that covers consensus motifs of 850 mammalian transcription factors. The enriched motifs for each sequence are listed in the table and each sequence is ranked accordingly. A proof-of-principle experiment designed to harness tumor environment- specific transcriptional activity of selected regulatory elements in order to manipulate cell states in the TME was further performed. Previous work (e.g., Katzenelenbogen, Y. et al. Cell 2020; and Molgora, M. et al. Cell 2020) identified Trem2 as a phenotypic marker of TAMs and monocytes in mice and humans. TAMs are prevalent in the tumor microenvironment and contribute to immunosuppression of the anti-tumor response and subsequently uncontrolled tumor growth and poor prognosis. The ATAC-seq data confirmed Trem2 promoter and putative enhancer to be active in tumor-derived macrophages, indicating capacity of those DNA sequences to respond uniquely to the TME signaling. Trem2 regulatory elements were exploited to target immunosuppressive macrophages and remodel the TME to boost the anti-tumor response. Briefly, expression cassette containing the transgenes of interest or GFP downstream of Trem2 enhancer / promoter, followed by the dTomato reporter, was inserted into stem / progenitor cells using lentivirus (SEQ ID NO: 976). Transduced cells were transferred to irradiated mice, and following reconstitution of the immune system, mice were challenged with tumor cells (Fig 20A). Analysis of harvested tissues showed that Trem2 enhancer / promoter activity (as measured by GFP expression) can be detected in the tumor, but not in the tumordraining lymph nodes or spleens (Figure 20B). FACS analysis of tumor GFP+ cells showed their predominantly macrophage phenotype as ~90 % of cells expressed F4 / 80 (Figure 20C). This experiment validated Trem2 regulatory element activity to be tumor signaling- and TAM- specific and allowed harnessing it to drive expression of a chosen genetic cargo (as further described hereinbelow) as part of novel immunotherapy approach.
[0768] EXAMPLE 2
[0769] EXEMPLARY THERAPEUTIC AGENTS
[0770] The rational of some embodiments of the invention is that the TROJAN regulatory element induces regulated expression of a therapeutic secreted cargo molecule or a receptor e.g., CAR relevant in a disease specific context. To this end, several exemplary pro- or anti-inflammatory cytokines and neuroprotective molecules and combination thereof were selected:
[0771] In the context of cancer: inflammatory cytokines known to activate robust immune activation of different arms in the TME such as IL-2, IL-12, IL-15, IL-18 and IL-21; and transcription factors promoting direct reprogramming towards a specific cell fate such as DC or other antigen presenting cells or immune cells.
[0772] In the context of neurodegeneration: BDNF, IL-4 and IL- 10 as they have been shown to be neuroprotective and to mediate learning and memory effects, including in AD animal models.
[0773] In the context of autoimmunity: anti-inflammatory cytokines known to be beneficial in suppressing immune responses, such as IL- 10 and anti-TNF, namely sTNFRb (for some indications such as rheumatoid arthritis).
[0774] Part 2.1 - Cargo for solid tumors
[0775] In the context of solid tumors, it has been shown that increased expression of cytokines such as interleukin (IL) 2, IL12, IL15, IL18, IL21 or IL23 improve CAR-T anti-tumor function. Sustained expansion of CAR-T cells, decreased apoptosis, enhanced cytotoxicity, induction of innate response, reprogramming of suppressor cells in the TME and an overall powerful anticancer immune response has been reported. Although effective, the transgenic expression of cytokines is highly associated with systemic toxicities. One clear benefit of the TROJAN technology specific cargo release mechanism is the ability to target novel antigens, given the increase in efficacy and decrease of toxicity from the on-site cargo release. In cancer and especially solid tumors this opens the possibility of targeting non tumor associated antigens (TAA) which have shown limited efficacy and toxicities and focus on targeting TME enriched signals such as tumor associated macrophage markers.
[0776] Triggering-Receptor- Expressed on Myeloid cells 2 (TREM2) was identified as a determinant of immunosuppressive TAMs in cancer. Further, TREM2 is consistently expressed by TAMs across solid tumor types and TREM2+ TAMs account for resistance to immune checkpoint blockade (ICB) and CAR-T treatments. In light of TREM2 specificity to the tumor site and the potent immunosuppressive phenotype of TAMs, an anti-TREM2 CAR-T cell (CARaTREM2) was designed for the depletion of the TREM2 expressing myeloid cells. Specifically, a high-affinity recognition domain based on the monoclonal human anti-TREM2 EC37 clone previously designed and generated an anti-TREM2-CD28-m41BB-CD3^ CAR (Figures 21A-B, SEQ ID NOs: 86-87). Following, the CARaTREM2 T cells were tested by a series of in-vitro co-culture assays with HEK293 cells expressing the human TREM2 antigen (HEK-TREM2) or differentiated human CD14+; wherein cytotoxicity and activity was evaluated using flow cytometry and I Ny ELISA. The results demonstrate that CARaTREM2 T cells can initiate an effective and specific cytotoxic response toward TREM2-expressing cells (Figures 21C- D). In addition, the CARaTREM2 T cells were able to effectively deplete human TREM2- expressing myeloid cells in-vitro (Figure 2 IE).
[0777] To establish the TROJAN machinery in CAR-T cells, a CARaTREM2 construct with either GFP reporter gene or an IL2 cargo, under the regulation of a synthetic TCR regulatory sequence TrojRE5 (SEQ ID NO: 1058, also referred to herein as “TRI”), designed to be active upon T-cells activation. A construct containing the CD19-regulatory element (which is not active in T-cells regardless of cell state) was used as a negative control; and a construct containing a constitutive Efl -regulatory element (a strong promoter) was used as a positive control (Figures 22A and C). To test the TROJAN cassette, mice T-cells were transduced with these constructs and co-cultured in-vitro for 24 hours with either HEK293 cells, HEK-TREM2 cells or CD3 / CD28 activation beads. Activity was determined using flow cytometry (CD25high, CD69high, PD-1+), and cargo expression was evaluated either by flow cytometry (GFP+) or hIL2 ELISA. The results show that in cells transduced with the TROJAN-based construct, cargo expression was restricted without an activator signal; however, significantly enhanced expression was observed upon CAR-antigen signaling (Figure 22B, D).
[0778] Part 2.2 - Brain-derived neurotrophic factor (BDNF)
[0779] As BDNF has been shown to be neuroprotective and to mediate learning and memory effects including in AD animal models, the present inventors suggest TROJAN T cells secreting BDNF as a biologically active cargo and test their efficacy to modify neuronal and immune responses in- vitro. To assess the biological function of the BDNF cargo, a constitutive expression of BDNF was first established by designing an anti-Aβ-mCD28-CD3^ CAR (anti-Aβ CAR) construct followed by a T2A skip sequence and the mouse BDNF gene. Following transduction of this construct into mouse T cells, successful constitutive secretion of BDNF was detected (Figure 23A). Moreover, transcriptional changes of cortical mouse neurons following administration of the medium was measured using qPCR (Figure 23B). These data show that successfully establishment of CAR T cell-secreted BDNF as a biologically active cargo that induces neuronal transcriptional responses in-vitro.
[0780] Following, T cells were co-transduced with a plasmid containing the synthetic enhancer (SEQ ID NO: 75) and cargo, as well as a plasmid containing an anti-Aβ, an anti-MOG CAR or an anti-TDP-43. T cells were starved of IL-2 for 24 hours and logic-gated BDNF secretion was evaluated at different timepoints following no stimulation, stimulation with the antigen (in this case Aβ, myelin or TDP-43), stimulation with IL-2 and / or with anti-CD3 / CD28 beads (Figures 11 and 24B). As demonstrated in Figure 11, by harnessing the IL-2 downstream transcriptional machinery in T cells, induced expression of the cargo following antigen stimulation of CAR T cells, with minimal basal expression in the absence of the antigen was established. A single construct containing the synthetic enhancer and cargo, followed by the CAR was also designed, which resulted in xlOO fold induction of cargo secretion compared to baseline, similar to TCR activation with anti-CD3 / CD28 beads (Figures 12 and 24A).
[0781] Part 2.3 - Screening for anti-tumor cargo released by macrophages
[0782] These experiments were designed to develop anti-tumor cytokines and clone them in TROJAN circuits to assess their bioactivity through reporter assays and T-cell assays. The cargo chosen for the first tier of the TROJAN cell contained pro- inflammatory cytokines with documented pre-clinical potent anti-tumor effects. The cytokines include the IL-2, IL- 12, IL- 15, IL- 18 and IL-21 and their synthetic engineered variants. All cytokines have strong cytotoxic effects when bound to their target receptors, which are mainly expressed on cytotoxic T- cells, NK cells and macrophages. In preclinical and clinical studies, such cytokines have shown potent antitumor effects. However, current approaches used to deliver anti-tumor cytokines in the circulatory system come with shortcomings, mostly short half-life and high cytotoxicity, which hinder their therapeutic potential and generally fail to proceed in the clinic. TROJAN's approach is designed to overcome these caveats and reduce the risk of systemic toxicity while achieving high efficacy. The cytokines are also generated in a synthetic engineered version to promote immune activation within the TME.
[0783] Carso Selection: Multiple variants for IL- 12, IL- 15, IL- 18 and IL-21 were generated and cloned downstream of a constitutive promoter (EFla) for screening or downstream of the TROJAN sensors (SEQ ID NO: 970). All were screened in HEK293 cells by transient transfections for production, secretion and bioactivity. After screening for bioactivity in HEK293T cells, one lead variant from each cytokine was introduced into the TROJAN-Cell construct, infected into bone marrow-derived macrophages (BMDMs) and tested for production and bioactivity of each cytokine.
[0784] The following IL- 12 variants were used: (a) Four different linkers of different sizes, (b) Four variants (4 linkers) with two signal peptides, one for IL- 12a and one for IL- 12b subunit; four variants (4 linkers) with one signal peptide, see figures 25A-D. In total, 8 variants were enlisted, which vary in the following:
[0785] 1. linker sizes: of which the original linker sequence (G4S)3 was obtained from Kaczanowska et al 2021,
[0786] 2. signal peptides: Double signal peptide (one for each the alpha and beta subunit of IL- 12; or single signal peptide (one for IL 12 beta subunit only).
[0787] The lead variant of IL- 12 (SSP-A) was selected based on its RNA and protein expression levels as well as its bioactivity. This variant was further cloned under the TROJAN sensors and tested in BMDMs grown under tumor like conditions.
[0788] Eight IL-15 variants were tested SEQ ID Nos: 999-1012), see figure 25E. IL-15 variants 1-4 showed significantly high bioactivity as compared to full-length IL-15RA in the IL- 15 reporter cells (Figure 25G). The IL- 15 variant 4 showed the highest RNA and protein (Figures 25H-I) secreted levels, and, therefore, was chosen for additional functional validation experiments. Bioactivity of the IL-15 variants was tested on T-cells, where they induced high proliferation rates compared to untreated controls and high cytotoxic activity demonstrated by effective killing of B16 OVA cells (Figure 25J).
[0789] A variant of IL- 18 was generated to inhibit binding of IL- 18 with its binding protein, IL- 18BP (SEQ ID NOs 1013-1014). IL-18BP has high affinity to bind IL-18 (pM range) causing pro-tumorigenic effects. The variant, known as IL- 18 decoy resistant (IL-18DR), is resistant to the binding of IL-18BP and has promising anti-tumor effects. All cytokines showed adequate levels of expression of RNA and protein secretion levels (Figures 25K-N). These cytokines were further evaluated for cytotoxic effects on T-cells, both showing efficacy on killing B16 melanoma cells (Figure 25J).
[0790] In addition, combinations of cytokines were tested for synergistic effects using proprietary scRNA- seq technologies and analytics (Figure 250). T-cells activation outcomes were measured by scRNA-seq following incubation with tumor cells and TROJAN-Cell macrophages secreting the designated cytokines. The present inventors opted for the cytokine combination that preserve the survival of the cells (apoptotic signal: caused by increase cell death by corresponding cytokine combination), increase in proliferation (denoted as cycling) to expand the clones and inflammatory / cytotoxic potential to kill the tumor cells and recruit / activate additional effector cells. The combination that fulfills these criteria was selected for further testing in-vivo.
[0791] In the next step, the engineered IL12, IL15 and IL18DR cytokines were cloned under the TROJAN sensor (SEQ ID NO: 970). Bone marrow derived macrophages were differentiated in enriched cell culture medium to mimic tumor-like conditions. The sensor becomes active under these cell culture conditions, and upon lentiviral delivery, the cells start producing the corresponding cytokines which was confirmed at the mRNA level after terminal differentiation at day 7 (Figures 25P-R). T-cells were cultured separately in the presence of supernatants containing the TROJAN-cell secreted cytokines. Both cytokines activated high levels of IFNy when added to the T-cells (Figure 25S) and showed varied effects on T cell proliferation (Figure 25T), in line with single cell RNA- seq data from Figure 250.
[0792] One of the strategies for myeloid- specific TROJAN technology to treat cancer relies on eliminating immunosuppressive TAMs by the TROJAN regulatory element- dependent overexpression of transcription factors inducing cell fate reprogramming in-situ. Conventional type 1 dendritic cell (cDCl) was selected as the desired target cell state. These myeloid cells are highly specialized in cross-presentation of tumor antigens to effector CD8+ T cells, a feature required for tumor rejection and are critical for the success of T cell-based immunotherapies. In order to shift macrophage gene expression program to that of cDCl, lentiviral cassette containing as a cargo cDCl fate-driving transcription factors Batf3 and Irf8 downstream of Trem2 enhancer / promoter (Trem2-TF) were introduced into immune cells (SEQ ID NOs: 1017-1021). A Eentiviral construct with GFP downstream of the Trem2 elements (Trem2-GFP) was used as a control (Figures 26A-B). After tumor induction, analysis of the reporter-positive (dTomato+) immune cell composition in the TME (by FACS and scRNA-seq) showed an approximate 300 % increase of cDCl (from ~0.5 % to -2 %) as compared to tumors from mice treated with a control lentiviral vector (Figure 26D). Numbers of other myeloid cell subsets, including different dendritic cell types, i.e., cDC2, mature regulatory (mregDC) or plasmacytoid DC (pDC) were not affected by the reprogramming strategy (Figures 26C-D). This is the first demonstration of effective and tumor site-limited reprogramming of endogenous tumor-promoting macrophages into tumor-controlling cDCl cells. It opens a wide spectrum of possibilities for correcting pathogenic gene expression programs in cancer by utilizing TAM-specific DNA regulatory elements.
[0793] Part 2.4 - Cargo released in autoimmune diseases
[0794] Tumor necrosis factor (TNF) is a critical mediator in the pathogenesis of autoimmune diseases, particularly rheumatoid arthritis (RA), where it drives synovial inflammation, promotes joint destruction, and exacerbates immune dysregulation. TNF inhibitors, such as etanercept, have revolutionized RA treatment by targeting this cytokine, reducing disease activity, and preventing long-term damage. Etanercept is a TNF inhibitor consisting of a soluble TNF receptor II (sTNFRII) fused to an IgG Fc region, which binds and neutralizes TNF-a and TNF-p. The sTNFRII component acts as a decoy receptor, blocking TNF from interacting with cell surface receptors and thereby mitigating inflammation in RA and other autoimmune disease.
[0795] Incorporating a gene for sTNFRII under the control of a TROJAN regulatory element into CAR T cells enables targeted secretion of therapeutic cargo within the inflamed tissue. In the first step, the present inventor employed a lentiviral vector system with a strong CMV promoter to achieve constitutive expression of sTNFR-II in murine T cells. The construct included cDNA encoding the soluble extracellular domain of TNFR-II along with a signal peptide to ensure efficient secretion. Secretion of sTNFR-II was confirmed by quantifying its levels in the culture supernatant 48 hours post-transduction using EEISA. To further validate the cargo's function as a TNF chelator, transduced T cells expressing sTNFR-II were incubated with varying concentrations of TNFa in the medium. TNFa levels in the supernatant were then measured by ELISA 48 hours post-incubation, with comparisons made between T cells expressing sTNFR-II and those transduced with a control cargo. Elevated levels of sTNFR-II in the supernatant of T cells transduced with the construct were observed (Figure 27 A). Additionally, TNFa levels were significantly reduced, reaching basal levels equivalent to a medium without TNFa, in samples incubated with sTNFR-II-expressing T cells (Figure 27B). This demonstrates the effectiveness of the cargo in neutralizing TNFa.
[0796] EXAMPLE 3
[0797] EXEMPLARY INDICATIONS
[0798] The TROJAN cell toolset was established in a three-pronged approach with the objective of advancing their use in solid tumor, neurodegeneration, and autoimmunity.
[0799] Part 3.1 - Solid tumor Troian CAR T cells
[0800] To define the therapeutic activity of Trojan CARaTREM2 cells on tumor immunity, cytotoxic T cells were examined in in-vivo settings for infiltration, persistence, and effective function. First, an in-vivo experiment was performed to validate their ability to localize in the TME and persist on site. To this end, humanized-TREM2 45.2 mice were inoculated with MC38 which is known to be a TAMs abundant tumor model. TROJAN CARaTREM2 cells with an IL2 cargo, and a constitutively expressed BFP marker, were generated from a CD45.1 donor. Once a tumor was established, 6xl06TROJAN CARaTREM2 cells were adoptively transferred into the blood stream. On day 7 post adoptive cells transfer (ACT), tumor, dLN and spleens were harvested and analyzed by flow cytometry. The results indicate that the TROJAN CARaTREM2 cells localized in the tumor niche and not in the spleen or lymph node (Figure 28A). Further, out of the CD45.1 T-cell population, which is the adoptively transferred cells, about 95 % express BFP. This indicates that only the positively transduced cells which received the TROJAN CARaTREM2 construct survive and persist in the tumor (Figure 28B). Additionally, the adoptively transferred cells in the tumor niche express significantly higher levels of T-cells exhaustion markers such as PD1 and TIM3 (Figure 28C).
[0801] In the next step, the TOJAN CARaTREM2 cell’s ability to deliver cytokines in-vivo specifically to the TME while accounting for off-target secretion is evaluated. The temporal dynamics of facilitated killing of the myeloid compartment and tumor progression is determined. Lastly, alteration of the TME composition and phenotype due to TROJAN CARaTREM2 treatment using FACS sorting and scRNA-seq is characterized.
[0802] Part 3.2 - Solid tumor macrophages
[0803] These experiments were designed to engineer donor bone marrow cells with the TROJAN- cargo construct and study efficacy in tumors grown in recipient mice.
[0804] Background: From all the cytokine variants screened in-vitro, one variant was chosen from each of the human IL2 (Superkine H9 variant), the human IL-15 (mutated IL15 fused to the IL15RA-sushi domain with a flexible linker), and the murine IL18 (decoy resistant to IL18 binding protein - IL18bp). Independent cohorts of recipient mice were transplanted with engineered bone marrow cells carrying one of each cytokine variant. All three cohorts and an empty vector control cohort were studied for efficacy in a syngeneic tumor model, and the IL2SK cohort was further studied for reprogramming and systemic secretion of the cytokine in the peripheral circulation.
[0805] Experimental Approach: To have a continuous replenishment of TROJAN cells to the tumor, bone marrow transplantations were conducted, and following reconstitution mice were implanted with syngeneic tumors for efficacy. Bone marrow cells infected with the lentiviral construct containing the TROJAN cargo, empty vector control (or EV) (n=6), IL-2 (n=6), IL15 (n=6) and IL 18 (n=6) were transplanted in irradiated recipient mice. After 8 weeks of bone marrow reconstitution, syngeneic tumors were implanted subcutaneously on flanks. Tumor volume was measured for efficacy started on day 6 until day 21-23, and each mouse cohort was compared to the empty vector control. At Day 23, mice were sacrificed, and tumors were harvested from the flanks and peripheral blood was withdrawn retro-orbitally. Tumor samples were dissociated to get single cell suspensions and stained for the immune compartment to be further analyzed by flow cytometry and single cell RNA-seq for reprograming in the TME. Serum from IL2SK mice and controls was collected and tested for IL2 levels in the peripheral circulation.
[0806] Results: All the cargo tested showed significant efficacy across a period of 21-23 days as compared to controls (Figure 8A). The IL2SK cohort was further analyzed for reprograming by focusing on effector immune cells and the TROJAN cells (macrophages). The number of immunosuppressive macrophages was reduced, whereas the number of effector cells, including inflammatory macrophages, activated dendritic cells and effector T-cells, was increased; indicating a strong and efficient reprogramming effect (Figure 8B). The figure shows an EEISA assay to quantify IL2SK levels in serum from the in-vivo experiment and from in-vitro bone marrow derived macrophages transduced with TROJAN IL2SK construct, as controls for the assay. IL2SK levels were not detected in both the control and the IL2SK Trojan samples. The controls from the BMDM cultures showed high levels of IE2 in the culture supernatant, 4 days post-transduction. The BMDM GFP was used as a negative control for the in-vitro culture assay.
[0807] Part 3.3 - Alzheimer’s disease using the 5xFAD model
[0808] The Aβ-specific mCD28-CD3^ CAR constructs were transduced into mouse CD45.1 T cells and 7xl06T cells were adoptively transferred into 16-month-old 5xFAD mice. CD45.1 adoptively transferred Aβ-specific CAR T cells infiltrated the parenchyma (Figure 29C), were enriched in the choroid plexus (Figure 29 A), and colocalized with Aβ plaques (Figure 29B).
[0809] In the next step, TROJAN CAR constructs are transduced into mouse T cells and adoptively transferred into 5xFAD mice aged 12-18 months. 1 month following administration, the effect on cognitive measures is measured using a behavioral test battery, including the Novel Object Recognition (NOR), Y maze and Morris Water Maze. Following the behavioral tests the brain tissue, spleen, CSF and draining lymph nodes are collected for FACS sorting and scRNA- seq.
[0810] Part 3.4 - Brain injury: Design novel CAR T constructs for minimizing stroke damage.
[0811] The present inventors developed TROJAN CAR T cells that home in on the damaged hemisphere following stroke and release therapeutic cargo under tight control while minimizing cytotoxicity.
[0812] T cells have been shown to play a protective role following spinal cord and CNS injuries and their presence at the pathological site has been associated with improved recovery. Middle cerebral artery occlusion (MCAO) model is an established method to mimic permanent and transient focal cerebral ischemia. The present inventors suggest that MOG-targeting TROJAN CAR T cells have a therapeutic impact for stroke associated pathologies and may selectively and effectively migrate to the damaged area following stroke, proliferate and release therapeutic cargo mitigating cytotoxicity associated to neuronal damage, and help in CNS recovery.
[0813] To this end, following 60-minute occlusion of the right middle cerebral artery, MOG- specific mCD28-CD3^ CAR T cells were adoptively transferred. 5-14 days following stroke, brains were collected for FACS and immunohistochemistry. Ischemia was validated by transcranial optical vascular imaging (TOVI) of cortical hemodynamics in the mouse brain (Figure 30A). CD45.1 adoptively transferred MOG-specific CAR T cells infiltrated the parenchyma and were enriched in the damaged tissue (Figures 30B-C). The computational approach using VAE allowed creating a stroke atlas while implementing batch correction and projected the single cell transcriptomics data onto large publicly available scRNA-seq databases of brain and blood immune landscape in a stroke MCAO model, revealing T cell- specific programs and allowing the present inventors to iteratively improve the in-vitro culturing protocols to achieve a signature resembling the proliferative state identified in the atlas (Figure 30D).
[0814] The anti-MOG CAR T cells were found to home specifically to the site of brain pathology. lOxlO6CD45.1 CAR T cells were adoptively transferred into WT mice immediately following the stroke surgery by i.v. retro-orbital injection. The anti-MOG CAR T cells were enriched in the right hemisphere, found much less in the left hemisphere, and almost absent from peripheral organs such as the spleen and lung 10 days post stroke and injection of CAR T cells (Figure 31).
[0815] In the next step, the safety and efficacy of MOG-targeting TROJAN CAR T cells in mediating improved brain injury recovery trajectories is evaluated in vivo.
[0816] Part 3.5 - Autoimmunity
[0817] Despite advancements in therapy, many patients with autoimmune diseases remain refractory or experience frequent relapses, resulting in organ damage and increased mortality. While B -cell-depleting antibodies like rituximab provide limited efficacy, CAR-T cell therapy targeting CD 19 has demonstrated transformative, long-term remission in systemic lupus erythematosus (SLE) and shows promise in other B -cell-mediated autoimmune diseases such as multiple sclerosis (MS) and dermatomyositis. Unlike conventional therapies, CAR-T cells can reset immune tolerance, offering the potential for durable remission or even a cure.
[0818] However, current CAR-T therapies target broad markers, such as CD 19, rather than specific pathogenic subsets within affected tissues, which limits treatment efficacy, reduces precision, and increases off-target effects. The present inventors suggest the used of TROJAN CAR-T cells in autoimmune diseases that specifically target and eliminate pathogenic tissueresident cells identified through multi-omics analysis of human and murine target organs. Additionally, these TROJAN CAR-T cells are designed to deliver therapeutic cargo to neutralize inflammation within the tissue microenvironment, enhancing specificity and efficacy in autoimmune diseases, with rheumatoid arthritis (RA) serving as a proof of concept (Figure 32).
[0819] RA is a common autoimmune disease treated with conventional, biological, and synthetic DMARDs targeting cytokines (e.g., anti-TNF agents), co- stimulation (e.g., CTLA4-Ig), and cell depletion (e.g., rituximab). However, 5-10 % of patients remain refractory or develop resistance and adverse effects, and no current therapies achieve immune reset or drug-free remission, highlighting an urgent need for innovative approaches in rheumatology. To address the limitations of current therapies, the present inventors aimed to develop CAR-T cells that specifically recognize and eliminate pathogenic cells in the synovium while secreting anti-inflammatory cargo, offering a targeted and potentially curative solution for refractory RA. Single-cell RNA sequencing of synovial tissue from RA patients identified three major pathogenic T-cell populations enriched compared to controls (osteoarthritis, Figure 33):
[0820] 1. T Follicular Helper (Tfh) Cells: Drive autoimmunity, promote B-cell activation, cytokine secretion (e.g., TNF-a, IL-21, IL-23), and activate macrophages and fibroblasts.
[0821] 2. CD8+ Cytotoxic T Cells: Target synovial cells, amplify inflammation, and mediate tissue destruction.
[0822] 3. CD4+ Memory T Cells: Sustain chronic inflammation by activating B cells, macrophages, and fibroblasts.
[0823] After identifying distinct pathogenic T cells in RA patients, extracellular targets uniquely expressed on these cells but absent on normal immune or stromal cells were screened for. PDCD1, encoding the PD-1 receptor, emerged as the most specific marker, being highly overexpressed on pathogenic T cells, mainly Tfh and CD8 cytotoxic cells while absent in control human synovial tissue (osteoarthritis, Figure 34).
[0824] Several murine models of RA were calibrated and a single-cell atlas was generated. The murine mBSA-induced arthritis model revealed pathogenic cell populations shared with human RA, with notable overexpression of PDCD1 (Figure 35). The mBSA model is a well-established system for studying localized inflammation and immune-mediated joint damage. Arthritis is induced via intra- articular injection of methylated bovine serum albumin (mBSA) with adjuvants like CFA and pertussis toxin to enhance immune activation. This model enables the study of acute and chronic arthritis phases, relapse mechanisms, and serves as a platform for developing antigenspecific CAR-T cell therapies (Figure 36).
[0825] Following, an anti-PDl (a-PDl) CAR-T cells were developed using murine systems, selecting the heavy and light chain variable regions from known a-PDl antibodies (SEQ ID Nos: 95 and 99). Both 4- IBB and CD28 were used as transmembrane domains, achieving a high transduction efficiency (80-90 %) in mouse T cells, as indicated by mCherry expression. To evaluate functionality, CD45.1 CAR-T cells (effectors, E) were incubated with CFS...
Claims
1. WHAT IS CLAIMED IS:
1. A nucleic acid construct comprising at least one expression regulatory element comprising an enhancer operably linked to a heterologous nucleic acid sequence encoding a therapeutic agent, wherein said expression regulatory element is of a gene which expression is increased in an immune cell subjected to a pathologic environment relative to a non-pathologic environment.
2. The nucleic acid construct of claim 1, wherein said at least one expression regulatory element comprises at least one signal-responsive transcription factor binding motif and at least one cell type specific transcription factor binding motif.
3. The nucleic acid construct of any one of claims 1-2, wherein said expression regulatory element binds a transcription factor selected from the group consisting of STAT, NFkB, AP-1, NFAT, IRF, NFkB, MAF, NFE, HIF-1 alpha, HIF-2alpha, SMAD, ZEB, BATF and PU.l.
4. The nucleic acid construct of any one of claims 1-3, wherein said expression regulatory element is of a gene which expression is increased in a tumor associated macrophage (TAM) relative to a macrophage not in a tumor environment.
5. The nucleic acid construct of anyone of claims 1-4, wherein said gene is selected from the group consisting of Btgl, C9, Ccl4, Cd2ap, Cldnl, Cldnl6, Csflr, Cx3crl, Cxcll l, Cxcl2, Dcstamp, Dock4, Dusp2, Dusp4, Fcho2, Fgfr2, Filip 11, Fmnl2, Hdac2, Hilpda, Hmgal, Husl, Igfl, Illa, I17r, Itgax, Itgb5, Itgb7, Lhfpl2, Lrpl, Mepe, Metrnl, Mucl3, Ndrgl, Nfatc2, Nr4a3, Nrpl, Pdgfrb, Pdpn, Pfkp, Pgsl, Ptgs2os2, Rab31, Rap2b, Rel, Sbf2, Slamf7, Slc2al, Slc30a4, Socs3, Sox5, Spef2, Tefm, Tg, Tgfbi, Tgfbrl, Trem2, Tremll and Zscan2.
6. The nucleic acid construct of anyone of claims 1-5, wherein said expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1108-1973, 970 and 1017.
7. The nucleic acid construct of any one of claims 1-3, wherein said expression regulatory element is of a gene which expression is increased following activation and / or exhaustion of a T cell.
8. The nucleic acid construct of anyone of claims 1-3 and 7, wherein said expression regulatory element is of a gene downstream of IL-2 signaling.
9. The nucleic acid construct of anyone of claims 1-3 and 7-8, wherein said gene is selected from the group consisting of IL2RA, LT A and SOCS1.
10. The nucleic acid construct of any one of claims 1-3 and 7-9, wherein said expression regulatory element comprises a nucleic acid selected from the group consisting of SEQ ID NOs: 60-63, ttcaaagaa, tccagtgaa, ttcgtggag, ttcagggaa, ttcccagag, ttcccagaa and tgccaagaa.
11. The nucleic acid construct of anyone of claims 1-3 and 7, wherein said gene is selected from the group consisting of HAVCR2, KLRC1, SRGAP3, FABP5, ENTPD1, CSF1, PDCD1, TNFSF4, GZMA, MKI67, LGALS3, TOX, TIGIT, FUT8, TNFRSF9, IL2RB, LAG3, NAB1, GZMB, PRF1, CD244, IFNG, CD83, SLAMF6, XCL1, CRTAM, EBI3, SLC2A8, CTLA4, ITM2A, GCNT1, PSMB8, PLSCR1, KCNK5, TNIP3, BUB1, PSMA1, TANK, SUB 1, ACOT7, NEDD9, HMGB2, SDF2L1, ETFB, EZH2, MCM3, MIS18BP1, RAD21, PSMD9, SLC43A3 and PMF1.
12. The nucleic acid construct of any one of claims 1-3, 7 and 11, wherein said expression regulatory element is comprised in a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1054-1067.
13. The nucleic acid construct of any one of claims 1-3, 7 and 11, wherein said expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1098-1104.
14. The nucleic acid construct of anyone of claims 1-3 and 7, wherein said expression regulatory element is of a gene downstream of TNFa signaling.
15. The nucleic acid construct of anyone of claims 1-3, 7 and 14, wherein said gene is selected from the group consisting of TNFAIP3, Nfkbia, Nfkb2, Ldha, Tnfrsflb, Irfl, Ltb and Junb.
16. The nucleic acid construct of any one of claims 1-3, 7 and 14-15, wherein said expression regulatory element comprises a nucleic acid sequence selected from the group consisting of SEQ ID Nos: 1022-1052.
17. The nucleic acid construct of any one of claims 1-16, wherein said expression regulatory element comprises a promoter operably linked to said nucleic acid sequence encoding said therapeutic agent.
18. The nucleic acid construct of claim 17, wherein said promoter and said enhancer are heterologous to each other.
19. The nucleic acid construct of any one of claims 1-18, wherein said therapeutic agent is selected from the group consisting of a cytokine, a chemokine, a growth factor, an RNA silencing agent, a soluble receptor, a T cell engager, a chimeric receptor and an immune reprogramming factor.
20. The nucleic acid construct of any one of claims 1-18, wherein said therapeutic agent is a cytokine, and optionally wherein said cytokine is selected from the group consisting of IL-2, IL-12, IL-15, IL-18 and IL-21; or wherein said cytokine is selected from the group consisting of IL-2, IL-4, IL- 10, IL- 17, IL- 23 and TNFa.
21. The nucleic acid construct of any one of claims 1-18, wherein said therapeutic agent is a neurotrophic factor, and optionally wherein said neurotrophic factor is BDNF.
22. The nucleic acid construct of any one of claims 1-18, wherein said therapeutic agent is a soluble TNFRb.
23. An immune cell genetically modified to express the nucleic acid construct of any one of claims 1-22.
24. An immune cell genetically modified to express a nucleic acid construct encoding a soluble TNFRb as a therapeutic agent.
25. A method of generating an immune cell expressing an inducible therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct of any one of claims 1-22.
26. A method of generating an immune cell expressing a soluble TNFRb as a therapeutic agent, the method comprising introducing into the immune cell or a pluripotent stem cell the nucleic acid construct encoding a soluble TNFRb.
27. The nucleic acid construct of any one of claim 1-22, the immune cell of any one of claims 23-24 or the method of any one of claims 25-26, wherein said nucleic acid construct further comprises a nucleic acid sequence encoding a targeting receptor comprising a transmembrane domain and an extracellular binding domain to a target associated with said pathologic environment, wherein said nucleic acid sequence encoding said therapeutic agent and said nucleic acid sequence encoding said targeting receptor are under distinct expression regulatory elements.
28. The nucleic acid construct, the immune cell or the method of claim 27, wherein said extracellular binding domain is of a receptor or a ligand.
29. The nucleic acid construct, the immune cell or the method of claim 27, wherein said extracellular binding domain is of an antibody.
30. The nucleic acid construct, the immune cell or the method of claim 29, wherein said binding domain comprises a scFv.
31. The nucleic acid construct, the immune cell or the method of any one of claims 27-30, wherein said targeting receptor further comprises an intracellular signaling domain, such that upon binding of said extracellular binding domain to a target thereof, activation of signaling via said signaling domain occurs in an immune cell expressing said targeting receptor.
32. The nucleic acid construct, the immune cell or the method of any one of claims 27-31, wherein said targeting receptor is a chimeric receptor.
33. The nucleic acid construct, the immune cell or the method of any one of claims 31- 32, wherein activation of signaling via said signaling domain induces activation of an immune cell expressing said targeting receptor.
34. The nucleic acid construct, the immune cell or the method of claim 31-33, wherein activation of signaling via said signaling domain increases expression of said gene.
35. The nucleic acid construct, the immune cell or the method of any one of claims 31- 34, wherein said signaling domain is of a receptor selected from the group consisting of a T cell receptor (TCR), a cytokine receptor, a co- stimulatory receptor, a co-inhibitory receptor, a growth factor receptor and an Fc receptor.
36. The nucleic acid construct, the immune cell or the method of any one of claims 31- 34, wherein said signaling domain initiates a kinase or phosphatase cascade.
37. The nucleic acid construct, the immune cell or the method of claim 36, wherein said signaling domain activates a JAK / STAT pathway.
38. The nucleic acid construct, the immune cell or the method of any one of claims 31-37, wherein said signaling domain is of a protein selected from the group consisting of CD3zeta, CD28, 4-1BB and IL-2R.
39. The nucleic acid construct, the immune cell or the method of any one of claims 27-38, wherein said transmembrane domain of a protein selected from the group consisting of CD8, CD28, 4-1BB and IL-2R.
40. The immune cell of any one of claims 23-24 and 27-39, for use in treating a pathology in a subject in need thereof, wherein said pathology can benefit from said therapeutic agent.
41. The immune cell for use of claim 40, wherein said pathology is selected from the group consisting of cancer, autoimmune disease, neurological disease and a metabolic disorder.
42. The immune cell for use of claim 40, wherein said pathology comprises cancer.
43. The nucleic acid construct, the immune cell, the method or the immune cell for use of any one of claims 27-42, wherein said target is selected from the group consisting of TREM2, GPNMB, CTLA4 and SPP1.
44. The immune cell for use of claim 40, wherein said pathology comprises a neurological disease.
45. The immune cell for use of any one of claims 41 and 44, wherein said neurological disease comprises a CNS injury.
46. The immune cell for use of any one of claims 41 and 44, wherein said neurological disease comprises a neurodegenerative disease.
47. The nucleic acid construct or construct system, the immune cell, the method or the immune cell for use of any one of claims 27-41 and 44-46, wherein said target is selected from the group consisting of Aβ, Myelin Oligodendrocyte Glycoprotein (MOG) and TDP-43.
48. The immune cell for use of claim 40, wherein said pathology is an autoimmune disease.
49. The nucleic acid construct or construct system, the immune cell, the method or the immune cell for use of any one of claims 27-41 and 48, wherein said target is selected from the group consisting of PD-1, IL23R, CXCR6 and CXCR3.
50. The nucleic acid construct or construct system, the immune cell, the method or the immune cell for use of any one of claims 1-49, wherein said immune cell is a T cell, a macrophage or a monocyte.
Citation Information
Patent Citations
Modified monocytes / macrophages / dendritic cells expressing chimeric antigen receptors and uses in diseases and disorders associated with protein aggregates
CN112004823A
Cancer environment response type adoptive mononuclear or macrophage immunotherapy biological product and application thereof in tumor resistance
CN118685362A
Genetically engineered t cell and application thereof
EP3680338A1
Anti-CXCR3 antibody
JP6646100B2
Genetic engineering of macrophages for immunotherapy
US10525082B2