Parvovirus compositions and methods for gene therapy

Abstract

The present disclosure provides technologies comprising parvovirus compositions, preparations, constructs, and methods for gene therapy.

Description

Docket No.: 2017359-0091 PARVOVIRUS COMPOSITIONS AND METHODS FOR GENE THERAPY CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Application Serial No.63 / 698907 filed on September 25, 2024, the disclosure of which is hereby incorporated by reference in its entirety. BACKGROUND

[0002] Gene therapy has been widely used in clinical trials since the 1990s with many successful cases reporting using viral or non-viral vectors to deliver therapeutic genes.

[0003] Cystic fibrosis (CF) is an autosomal recessive genetic disorder caused by mutations in the gene encoding cystic fibrosis transmembrane conductance regulator (CFTR). Although CF is a systemic disease affecting multiple organs, CF pulmonary disease is the most life-threatening.

[0004] Recombinant adeno-associated viral (rAAV) vectors have been pursued for CF lung gene therapy. rAAV vectors have demonstrated good safety profiles in clinical trials and most rAAV serotypes appear to be effectively endocytosed from the apical surface of airway epithelia. However, rAAV vectors have had varying efficiencies of gene transduction in vivo. First, post-entry barriers in virion processing following infection appear to limit nuclear translocation, and thus transgene expression, in a proteasome-dependent manner. Second, efficient CFTR transgene delivery is limited by the packaging capacity of rAAV vectors (approximately 4.9 kb) that necessitates the use of small, weak promoters and / or shortened CFTR transgenes (e.g., CFTR mini-genes, or CFTR cDNA where non-critical sequences have been removed). However, efforts to push the packaging limits of rAAV can lead to inconsistent deletions at the 5ˈ end of the rAAV genome affecting genome stability and transgene expression. SUMMARY

[0005] The present disclosure recognizes a need for improvements in gene therapy technologies. For example, among other things, the present disclosure recognizes a need for improved compositions, preparations, constructs, virions, populations of virions, host cells, etc. Furthermore, the present disclosure specifically recognizes a need for improved production and 13002505v1Docket No.: 2017359-0091 manufacturing of virions that comprise or otherwise utilize one or more parvovirus capsid polypeptide.

[0006] In some embodiments, the present disclosure provides a construct comprising an expression cassette, wherein the expression cassette comprises: a 5ˈ inverted terminal repeat (ITR); a heterologous transgene encoding cystic fibrosis transmembrane conductance regulator (CFTR); and a 3ˈ ITR.

[0007] In some embodiments a 5ˈ ITR and / or a 3ˈ ITR is a dependoparvovirus ITR, a bocaparvovirus ITR, a protoparvovirus ITR, a tetraparvovirus ITR, an erythroparvovirus ITR, or a copiparvovirus ITR. In some embodiments, a 5ˈ ITR and a3ˈ ITR are dependoparvovirus ITRs. In some embodiments, a 5ˈ ITR and a 3ˈ ITR are adeno-associated virus (AAV) ITRs (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 ITRs).

[0008] In some embodiments, a 5ˈ ITR comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2 and / or a 3ˈ ITR comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3.

[0009] In some embodiments, a heterologous transgene comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6. In some embodiments, a heterologous transgene comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.

[0010] In some embodiments, a heterologous transgene is operably linked at its 5ˈ end to a promoter (e.g., a chicken β-actin (CBA) promoter, a cytomegalovirus (CMV) promoter, a CAG promoter, a CB7 promoter, a tissue-specific promoter, or a lung-specific promoter). 2 13002505v1Docket No.: 2017359-0091

[0011] In some embodiments, a heterologous transgene is operably linked at its 3ˈ end to a polyadenylation signal.

[0012] In some embodiments, an expression cassette further comprises an enhancer (e.g., a CMV enhancer) and / or one or more transcription regulatory elements (e.g., an enhancer, a transcription termination sequence, a 5ˈ untranslated region (UTR), a 3ˈ UTR, a proximal promoter element, a locus control region, a polyadenylation signal sequence, or a combination thereof). In some embodiments, an expression cassette comprises a Kozak sequence. In some embodiment an expression cassette is CpG depleted.

[0013] In some embodiments, a construct of the present disclosure comprises a Rep polypeptide-dependent origin of replication (ori) (e.g., a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 21 or SEQ ID NO: 22).

[0014] In some embodiments, a construct of the present disclosure comprises a selection marker (e.g., a kanamycin-resistant selection marker).

[0015] In some embodiments, a construct of the present disclosure comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 34, SEQ ID NO: 35, or SEQ ID NO: 36. In some embodiments, a construct is single-stranded or double-stranded DNA. In some embodiments, a construct is linear or circularized.

[0016] In some embodiments, the present disclosure provides a virion comprising a construct as described herein and one or more recombinant parvovirus capsid polypeptides. In some embodiments, a parvovirus capsid polypeptide comprises a bocaparvovirus capsid polypeptide, a protoparvovirus capsid polypeptide, an erythroparvovirus capsid polypeptide, a tetraparvovirus capsid polypeptide, or a copiparvovirus capsid polypeptide (e.g., a human bocavirus capsid polypeptide).

[0017] In some embodiments, a virion comprises a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, 3 13002505v1Docket No.: 2017359-0091 at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 37.

[0018] In some embodiments, a virion comprises a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:40 or SEQ ID NO: 41.

[0019] In some embodiments, a virion comprises a VP3, fragment thereof, or variant thereof, capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 43 or SEQ ID NO: 44.

[0020] The present disclosure also provides a population of virions described herein, pharmaceutical composition comprising a virion described herein and a pharmaceutically acceptable carrier.

[0021] In some embodiments, the present disclosure provides a cell comprising a construct described herein and one or more parvovirus capsid polypeptides as described herein (e.g., a human bocavirus capsid polypeptide).

[0022] In some embodiments, the present disclosure provides a cell comprising: (i) a construct as described herein; (ii) a second construct comprising one or more helper sequences and encoding one or more recombinant parvovirus capsid polypeptide as described herein; and (iii) a third construct encoding one or more recombinant parvovirus capsid polypeptide described herein and one or more Rep polypeptides.

[0023] In some embodiments, a second construct comprises a promoter (e.g., a CMV promoter, a tissue-specific promoter, or a lung-specific promoter). In some embodiments, a second construct comprises an enhancer (e.g., a CMV enhancer). In some embodiments, a second construct comprises an SV40 intron. In some embodiments, a second construct comprises one or more transcription regulatory elements (e.g., an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, 4 13002505v1Docket No.: 2017359-0091 or a combination thereof). In some embodiments, a second construct comprises a polyadenylation signal (e.g., a bovine growth hormone polyadenylation signal). In some embodiments, a second construct comprises a selection marker (e.g., a neomycin / kanamycin resistance selection marker).

[0024] In some embodiments, a second construct comprises one or more adenovirus helper sequences (e.g., an Ad5 E2A sequence, an Ad5 E4 ORF1 sequence, an Ad5 E4 ORF2 sequence, an Ad5 E4 ORF3 sequence, an Ad5 E4 ORF6 sequence, an Ad5 E4 ORF6 / 7 sequence or a combination thereof).

[0025] In some embodiments, a second construct comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 172, or SEQ ID NO: 173. In some embodiments, a construct is single- stranded or double-stranded DNA. In some embodiments, a construct is linear or circularized.

[0026] In some embodiments, a third construct comprises a promoter (e.g., a CMV promoter, a tissue-specific promoter, or a lung-specific promoter). In some embodiments, a second construct comprises an enhancer (e.g., a CMV enhancer). In some embodiments, a second construct comprises an SV40 intron. In some embodiments, a second construct comprises one or more transcription regulatory elements (e.g., an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof). In some embodiments, a second construct comprises a polyadenylation signal (e.g., a bovine Kozak sequence. In some embodiments, a second construct comprises a selection marker (e.g., a neomycin / kanamycin resistance selection marker).

[0027] In some embodiments, a third construct encodes one or more Rep polypeptides. In some embodiments, a third construct encodes an AAV2 Rep 78 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 153. In some embodiments, a third construct encodes one or more Rep polypeptides. In some embodiments, a third construct encodes an AAV2 Rep 52 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, 5 13002505v1Docket No.: 2017359-0091 at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 155.

[0028] In some embodiments, the present disclosure provides a method of producing a virion comprising contacting a cell with a construct described herein, a second construct described herein, and a third construct described herein.

[0029] The present disclosure additionally provides a method of preventing a CFTR deficiency or treating a subject having a CFTR deficiency or reduced expression of CFTR, comprising administering to the subject an effective amount of a virion described herein, a population of virions, or a pharmaceutical composition comprising a virion described herein and a pharmaceutically acceptable carrier.

[0030] In some embodiments, a method comprises delivery of a virion, population of virions or pharmaceutical composition via inhalation (e.g., in the form of an aerosol from a nebulizer or a pressurized container comprising a propellant, e.g., CO2), or injection (e.g., via intravenous, subcutaneous, intramuscular, intradermal, or intraperitoneal injection).

[0031] In some embodiments, the present disclosure provides a method of preventing a CFTR deficiency or treating a subject having a CFTR deficiency or reduced expression of CFTR, comprising: (i) obtaining a plurality of cells; (ii) transducing the plurality of cells with a virion described herein to produce transduced cells; and (iii) administering an effective amount of the transduced cells to the subject.

[0032] In some embodiments, the present disclosure also provides methods of characterizing a virion, population of virions, or pharmaceutical composition described herein. In some embodiments, the present disclosure also provides methods of manufacturing an intermediate of a virion, population of virions, or pharmaceutical composition described herein. In some embodiments, the present disclosure provides systems comprising a cell described herein. In some embodiments, the present disclosure provides methods of manufacturing a medicament comprising a virion, a population of virions, a pharmaceutical composition, or a cell described herein. The present disclosure also provides a kit comprising a construct, a virion, a population, a pharmaceutical composition or a cell described herein. The present disclosure also provides a method of restoring chloride current across a cell comprising contacting the cell with 6 13002505v1Docket No.: 2017359-0091 a construct described herein, a virion described herein, a population of virions described herein, or a pharmaceutical composition described herein. DEFINITIONS

[0033] The scope of the present disclosure is defined by the claims appended hereto and is not limited by certain embodiments described herein. Those skilled in the art, reading the present specification, will be aware of various modifications that may be equivalent to such described embodiments, or otherwise within the scope of the claims. In general, terms used herein are in accordance with their understood meaning in the art, unless clearly indicated otherwise. Explicit definitions of certain terms are provided below; meanings of these and other terms in particular instances throughout this specification will be clear to those skilled in the art from context.

[0034] Use of ordinal terms such as “first,” “second,” “third,” etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.

[0035] The articles “a” and “an,” as used herein, should be understood to include plural referents unless clearly indicated to the contrary. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. In some embodiments, exactly one member of a group is present in, employed in, or otherwise relevant to a given product or process. In some embodiments, more than one, or all group members are present in, employed in, or otherwise relevant to a given product or process. It is to be understood that the present disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where elements are presented as lists (e.g., in Markush group or similar format), it is to be understood 7 13002505v1Docket No.: 2017359-0091 that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where embodiments or aspects are referred to as “comprising” particular elements, features, etc., certain embodiments or aspects “consist,” or “consist essentially of,” such elements, features, etc. For purposes of simplicity, those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any embodiment or aspect can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification.

[0036] Throughout the specification, whenever a polynucleotide or polypeptide is represented by a sequence of letters (e.g., A, C, G, and T, which denote adenosine, cytidine, guanosine, and thymidine, respectively, in the case of a polynucleotide), such polynucleotides or polypeptides are presented in 5ˈ to 3ˈ or N-terminus to C-terminus order, from left to right.

[0037] Administration: As used herein, the term “administration” typically refers to administration of a composition to a subject or system to achieve delivery of an agent to a subject or system. In some embodiments, an agent is, or is included in, a composition; in some embodiments, an agent is generated through metabolism of a composition or one or more components thereof. A variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human are described herein. For example, in some embodiments, administration may be systematic or local. In some embodiments, a systematic administration can be intravenous. In some embodiments, administration can be local. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.

[0038] Amelioration: As used herein, the term “amelioration” refers to prevention, reduction or palliation of a state, or improvement of a state of a subject. Amelioration may include, but does not require, complete recovery or complete prevention of a disease, disorder or condition. 8 13002505v1Docket No.: 2017359-0091

[0039] Amino acid: In its broadest sense, as used herein, the term “amino acid” refers to any compound and / or substance that can be incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds. In some embodiments, an amino acid has a general structure, e.g., H2N–C(H)(R)–COOH. In some embodiments, an amino acid is a naturally- occurring amino acid. In some embodiments, an amino acid is a non-natural amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L- amino acid. “Standard amino acid” refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides. “Nonstandard amino acid” refers to any amino acid, other than standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source. In some embodiments, an amino acid, including a carboxy- and / or amino-terminal amino acid in a polypeptide, can contain a structural modification as compared with general structure as shown above. For example, in some embodiments, an amino acid may be modified by methylation, amidation, acetylation, pegylation, glycosylation, phosphorylation, and / or substitution (e.g., of an amino group, a carboxylic acid group, one or more protons, and / or a hydroxyl group) as compared with a general structure. In some embodiments, such modification may, for example, alter circulating half-life of a polypeptide containing a modified amino acid as compared with one containing an otherwise identical unmodified amino acid. In some embodiments, such modification does not significantly alter a relevant activity of a polypeptide containing a modified amino acid, as compared with one containing an otherwise identical unmodified amino acid.

[0040] Approximately or About: As used herein, the terms “approximately” or “about” may be applied to one or more values of interest, including a value that is similar to a stated reference value. In some embodiments, the term “approximately” or “about” refers to a range of values that fall within ^10% (greater than or less than) of a stated reference value unless otherwise stated or otherwise evident from context (except where such number would exceed 100% of a possible value). For example, in some embodiments, the term “approximately” or “about” may encompass a range of values that within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of a reference value.

[0041] Associated: As used herein, the term “associated” describes two events or entities as “associated” with one another, if the presence, level and / or form of one is correlated with that 9 13002505v1Docket No.: 2017359-0091 of the other. For example, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc.) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and / or form correlates with incidence of and / or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and / or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.

[0042] Biologically active: As used herein, the term “biologically active” refers to an observable biological effect or result achieved by an agent or entity of interest. For example, in some embodiments, a specific binding interaction is a biological activity. In some embodiments, modulation (e.g., induction, enhancement, or inhibition) of a biological pathway or event is a biological activity. In some embodiments, presence or extent of a biological activity is assessed through detection of a direct or indirect product produced by a biological pathway or event of interest.

[0043] Characteristic portion: As used herein, the term “characteristic portion,” in the broadest sense, refers to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found in a given substance and in related substances that share a particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In some embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a “characteristic portion” of a protein or polypeptide is one that contains a continuous stretch of amino acids, or a collection of continuous stretches of amino acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. In general, a characteristic portion of a substance (e.g., of a protein, antibody, etc.) is one that, in 10 13002505v1Docket No.: 2017359-0091 addition to a sequence and / or structural identity specified above, shares at least one functional characteristic with the relevant intact substance. In some embodiments, a characteristic portion may be biologically active.

[0044] Characteristic sequence: As used herein, the term “characteristic sequence” is a sequence that is found in all members of a family of polypeptides or nucleic acids, and therefore can be used by those of ordinary skill in the art to define members of the family.

[0045] Characteristic sequence element: As used herein, the phrase “characteristic sequence element” refers to a sequence element found in a polymer (e.g., in a polypeptide or nucleic acid) that represents a characteristic portion of that polymer. In some embodiments, presence of a characteristic sequence element correlates with presence or level of a particular activity or property of a polymer. In some embodiments, presence (or absence) of a characteristic sequence element defines a particular polymer as a member (or not a member) of a particular family or group of such polymers. A characteristic sequence element typically comprises at least two monomers (e.g., amino acids or nucleotides). In some embodiments, a characteristic sequence element includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., contiguously linked monomers). In some embodiments, a characteristic sequence element includes at least first and second stretches of contiguous monomers spaced apart by one or more spacer regions whose length may or may not vary across polymers that share a sequence element.

[0046] Cleavage: As used herein, the term “cleavage” refers to generation of a break in DNA. For example, in some embodiments, cleavage could refer to either a single-stranded break or a double-stranded break depending on a type of nuclease that may be employed to cause such a break.

[0047] Combination therapy: As used herein, the term “combination therapy” refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, two or more agents may be administered simultaneously. In some embodiments, two or more agents may be administered sequentially. In some embodiments, two or more agents may be administered in overlapping dosing regimens. 11 13002505v1Docket No.: 2017359-0091

[0048] Comparable: As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, subjects, populations, etc., that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of agents, entities, situations, sets of conditions, subjects, populations, etc. are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, subjects, populations, etc. to be considered comparable. For example, sets of agents, entities, situations, sets of conditions, subjects, populations, etc. are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, stimuli, agents, entities, situations, sets of conditions, subjects, populations, etc. are caused by or indicative of the variation in those features that are varied.

[0049] Construct: As used herein, the term “construct” refers to a composition including a polynucleotide capable of carrying at least one heterologous polynucleotide. In some embodiments, a construct can be a plasmid, a transposon, a cosmid, an artificial chromosome (e.g., a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), or a P1-derived artificial chromosome (PAC)) or a viral construct, and any Gateway® plasmids. A construct can, e.g., include sufficient cis-acting elements for expression; other elements for expression can be supplied by the host primate cell or in an in vitro expression system. A construct may include any genetic element (e.g., a plasmid, a transposon, a cosmid, an artificial chromosome, or a viral construct, etc.) that is capable of replicating when associated with proper control elements. Thus, in some embodiments, “construct” may include a cloning and / or expression construct and / or a viral construct (e.g., an adeno-associated virus (AAV) construct, an adenovirus construct, a lentivirus construct, or a retrovirus construct).

[0050] Conservative: As used herein, the term “conservative” refers to instances describing a conservative amino acid substitution, including a substitution of an amino acid 12 13002505v1Docket No.: 2017359-0091 residue by another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change functional properties of interest of a protein, for example, ability of a receptor to bind to a ligand. Examples of groups of amino acids that have side chains with similar chemical properties include: aliphatic side chains such as glycine (Gly, G), alanine (Ala, A), valine (Val, V), leucine (Leu, L), and isoleucine (Ile, I); aliphatic-hydroxyl side chains such as serine (Ser, S) and threonine (Thr, T); amide-containing side chains such as asparagine (Asn, N) and glutamine (Gln, Q); aromatic side chains such as phenylalanine (Phe, F), tyrosine (Tyr, Y), and tryptophan (Trp, W); basic side chains such as lysine (Lys, K), arginine (Arg, R), and histidine (His, H); acidic side chains such as aspartic acid (Asp, D) and glutamic acid (Glu, E); and sulfur-containing side chains such as cysteine (Cys, C) and methionine (Met, M). Conservative amino acids substitution groups include, for example, valine / leucine / isoleucine (Val / Leu / Ile, V / L / I), phenylalanine / tyrosine (Phe / Tyr, F / Y), lysine / arginine (Lys / Arg, K / R), alanine / valine (Ala / Val, A / V), glutamate / aspartate (Glu / Asp, E / D), and asparagine / glutamine (Asn / Gln, N / Q). In some embodiments, a conservative amino acid substitution can be a substitution of any native residue in a protein with alanine, as used in, for example, alanine scanning mutagenesis. In some embodiments, a conservative substitution is made that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al., 1992, Science 256:1443-1445, which is incorporated herein by reference in its entirety. In some embodiments, a substitution is a moderately conservative substitution wherein the substitution has a nonnegative value in the PAM250 log-likelihood matrix. One skilled in the art would appreciate that a change (e.g., substitution, addition, deletion, etc.) of amino acids that are not conserved between the same protein from different species is less likely to have an effect on the function of a protein and therefore, these amino acids should be selected for mutation. Amino acids that are conserved between the same protein from different species should not be changed (e.g., deleted, added, substituted, etc.), as these mutations are more likely to result in a change in function of a protein. 13 13002505v1Docket No.: 2017359-0091 CONSERVATIVE AMINO ACID SUBSTITUTIONS For Amino Acid Code Replace With - - r -g of a “control” being a standard against which results are compared. Typically, controls are used to augment integrity in experiments by isolating variables in order to make a conclusion about such variables. In some embodiments, a control is a reaction or assay that is performed simultaneously with a test reaction or assay to provide a comparator. For example, in one experiment, a “test” (i.e., a variable being tested) is applied. In a second experiment, a “control,” the variable being tested is not applied. In some embodiments, a control is a historical control (e.g., of a test or assay performed previously, or an amount or result that is previously known). In some embodiments, a control is or comprises a printed or otherwise saved record. In some 14 13002505v1Docket No.: 2017359-0091 embodiments, a control is a positive control. In some embodiments, a control is a negative control.

[0052] CpG: As used herein, “CpG” refers to dinucleotide regions of a nucleic acid where cytosine is immediately followed by guanine. In some embodiments, CpG dinucleotides can be methylated to form 5-methylcytosines. In some embodiments, 5-methylcytosines are susceptible to spontaneous mutations to thymines.

[0053] Detarget and detargeting: As used herein, the term “detarget” or “detargeting” may be used to refer to a composition, preparation, or virion that is not targeted to a tissue of interest.

[0054] Determining, measuring, evaluating, assessing, assaying and analyzing: As used herein, the terms “determining,” “measuring,” “evaluating,” “assessing,” “assaying,” and “analyzing” may be used interchangeably to refer to any form of measurement, and include determining if an element is present or not. These terms include both quantitative and / or qualitative determinations. Assaying may be relative or absolute. For example, in some embodiments, “Assaying for the presence of” can be determining an amount of something present and / or determining whether or not it is present or absent.

[0055] Editing: As used herein, the term “edit,” “editing,” or “edited” refers to a method of altering a nucleic acid sequence of a polynucleotide (e.g., a wild type naturally occurring nucleic acid sequence or a mutated naturally occurring sequence) by selective deletion of a specific nucleic acid sequence (e.g., a genomic target sequence), a given specific inclusion of new sequence through use of an exogenous nucleic acid sequence, or a replacement of nucleic acid sequence with an exogenous nucleic acid sequence. In some embodiments, such a specific genomic target includes, but may be not limited to, a chromosomal region, mitochondrial DNA, a gene, a promoter, an open reading frame or any nucleic acid sequence.

[0056] Engineered: In general, as used herein, the term “engineered” refers to an aspect of having been manipulated by the hand of man. For example, a cell or organism is considered to be “engineered” if it has been manipulated so that its genetic information is altered (e.g., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, 15 13002505v1Docket No.: 2017359-0091 or by mating protocols). As is common practice and is understood by those in the art, progeny of an engineered polynucleotide or cell are typically still referred to as “engineered” even though the actual manipulation was performed on a prior entity.

[0057] Excipient: As used herein, the term “excipient” refers to an inactive (e.g., non- therapeutic) agent that may be included in a pharmaceutical composition, for example to provide or contribute to a desired consistency or stabilizing effect. In some embodiments, suitable pharmaceutical excipients may include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

[0058] Expression: As used herein, the term “expression” of a nucleic acid sequence refers to generation of any gene product (e.g., transcript, e.g., mRNA, e.g., polypeptide, etc.) from a nucleic acid sequence. In some embodiments, a gene product can be a transcript. In some embodiments, a gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5ˈcap formation, and / or 3ˈ end formation); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0059] Expression Cassette: As used herein, the term “expression cassette” refers to a nucleic acid component of a vector DNA or construct that contains a gene and one or more regulatory sequence.

[0060] Functional: As used herein, the term “functional” describes something that exists in a form in which it exhibits a property and / or activity by which it is characterized. For example, in some embodiments, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized. In some such embodiments, a functional biological molecule is characterized relative to another biological molecule which is non-functional in that the “non-functional” version does not exhibit the same or equivalent property and / or activity as the “functional” molecule. A biological molecule may have one function, two functions (i.e., bifunctional) or many functions (i.e., multifunctional).

[0061] GC Content: As used herein, the term “GC content” refers to the percentage of guanine or cytosine in a nucleic acid. 16 13002505v1Docket No.: 2017359-0091

[0062] Gene: As used herein, the term “gene” refers to a DNA sequence in a chromosome that codes for a gene product (e.g., an RNA product, e.g., a polypeptide product). In some embodiments, a gene includes coding sequence (i.e., sequence that encodes a particular product). In some embodiments, a gene includes non-coding sequence. In some embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequence. In some embodiments, a gene may include one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type-specific expression, inducible expression, etc.). As used herein, the term “gene” generally refers to a portion of a nucleic acid that encodes a polypeptide or fragment thereof; the term may optionally encompass regulatory sequences, as will be clear from context to those of ordinary skill in the art. This definition is not intended to exclude application of the term “gene” to non-protein-coding expression units but rather to clarify that, in most cases, the term as used in this document refers to a polypeptide-coding nucleic acid. In some embodiments, a gene may encode a polypeptide, but that polypeptide may not be functional, e.g., a gene variant may encode a polypeptide that does not function in the same way, or at all, relative to the wild-type gene. In some embodiments, a gene may encode a transcript which, in some embodiments, may be toxic beyond a threshold level. In some embodiments, a gene may encode a polypeptide, but that polypeptide may not be functional and / or may be toxic beyond a threshold level.

[0063] Genome Editing System: As used herein, the term “genome editing system” refers to any system having DNA editing activity. Among other things, DNA editing activity can include deleting, replacing, or inserting a DNA sequence in a genome. In some embodiments, a genome editing system comprises RNA-guided DNA editing activity. In some embodiments, a genome editing system of the present disclosure includes more than one component. In some embodiments, a genome editing system includes at least two components adapted from naturally occurring CRISPR systems: a guide RNA (gRNA) and an RNA-guided nuclease. In some embodiments, these two components form a complex that is capable of associating with a specific nucleic acid sequence and editing DNA in or around that nucleic acid sequence, for instance by making one or more of a single-strand break (an SSB or nick), a double-strand break (a DSB) and / or a point mutation. In some embodiments, genome editing systems of the present disclosure lack a component having cleavage activity but maintain a component(s) having DNA 17 13002505v1Docket No.: 2017359-0091 binding activity. In some such embodiments, a genome editing system of the present disclosure comprises a component(s) that functions as an inhibitor of DNA activity, e.g., transcription, translation, etc. In some embodiments, a genome editing system of the present disclosure comprises a component(s) fused to modulators to modulate target DNA expression.

[0064] Genomic modification: As used herein, the term “genomic modification” refers to a change made in a genomic region of a cell that permanently alters a genome (e.g., an endogenous genome) of that cell. In some embodiments, such changes are in vitro, ex vivo, or in vivo. In some embodiments, every cell in a living organism is modified. In some embodiments, only a particular set of cells such as, e.g., in a specific organ, is modified. For example, in some embodiments, a genome is modified by deletion, substitution, or addition of one or more nucleotides from one or more genomic regions. In some embodiments, a genomic modification is performed in a stem cell or undifferentiated cell. In some such embodiments, progeny of a genomically modified cell or organism will also be genomically modified, relative to a parental genome prior to modification. In some embodiments, a genomic modification is performed on a mature or post-mitotic cell such that no progeny will be generated and thus, no genomic modifications propagated other than in a particular cell.

[0065] Helper Sequences or Helper Polypeptides: As used herein, the terms “helper sequences” or “helper polypeptides” refers to polynucleotide sequences or proteins, respectively, necessary for recombinant adeno-associated virus (AAV) packaging and / or replication.

[0066] Heterologous: As used herein, the term “heterologous” may be used in reference to one or more regions of a particular molecule as compared to another region and / or another molecule. For example, in some embodiments, heterologous polypeptide domains, refers to the fact that polypeptide domains do not naturally occur together (e.g., in the same polypeptide). For example, in fusion proteins generated by the hand of man, a polypeptide domain from one polypeptide may be fused to a polypeptide domain from a different polypeptide. In such a fusion protein, two polypeptide domains would be considered “heterologous” with respect to each other, as they do not naturally occur together. In some embodiments, a heterologous polynucleotide or gene, refers to a polynucleotide or gene that do not naturally occur in a cell, tissue, or system, and / or has been artificially introduced into a cell, tissue, or system. 18 13002505v1Docket No.: 2017359-0091

[0067] Identity: As used herein, the term “identity” refers to overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In some embodiments, a length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of length of a reference sequence; nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as a corresponding position in the second sequence, then the two molecules (i.e., first and second) are identical at that position. Percent identity between two sequences is a function of the number of identical positions shared by the two sequences being compared, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17, which is herein incorporated by reference in its entirety), which has been incorporated into the ALIGN program (version 2.0). In some embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

[0068] Improve, increase, enhance, inhibit or reduce: As used herein, the terms “improve,” “increase,” “enhance,” “inhibit,” “reduce,” or grammatical equivalents thereof, indicate values that are relative to a baseline or other reference measurement. In some embodiments, a value is statistically significantly difference that a baseline or other reference measurement. In some embodiments, an appropriate reference measurement may be or comprise a measurement in a particular system (e.g., in a single individual) under otherwise comparable conditions absent presence of (e.g., prior to and / or after) a particular agent or treatment, or in 19 13002505v1Docket No.: 2017359-0091 presence of an appropriate comparable reference agent. In some embodiments, an appropriate reference measurement may be or comprise a measurement in comparable system known or expected to respond in a particular way, in presence of the relevant agent or treatment. In some embodiments, an appropriate reference is a negative reference; in some embodiments, an appropriate reference is a positive reference.

[0069] Modulating: As used herein, the term “modulating,” means mediating a detectable increase or decrease in a level of a response in a subject compared with a level of a response in a subject in absence of a treatment or compound, and / or compared with a level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.

[0070] Nuclease: As used herein, the term “nuclease” refers to an agent, for example a protein or a small molecule, capable of cleaving a phosphodiester bond connecting nucleotide residues in a nucleic acid molecule. In some embodiments, a nuclease is a protein, e.g., an enzyme that can bind a nucleic acid molecule and cleave a phosphodiester bond connecting nucleotide residues within a nucleic acid molecule. A nuclease may be an endonuclease, cleaving a phosphodiester bond within a polynucleotide chain, or an exonuclease, cleaving a phosphodiester bond at the end of the polynucleotide chain. In some embodiments, a nuclease is a site-specific nuclease, binding and / or cleaving a specific phosphodiester bond within a specific nucleotide sequence, which is also referred to herein as the “recognition sequence,” the “nuclease target site,” or the “target site.” In some embodiments, a nuclease is a RNA-guided (i.e., RNA-programmable) nuclease, which complexes with (e.g., binds with) an RNA having a sequence that complements a target site, thereby providing the sequence specificity of a nuclease. In some embodiments, a nuclease recognizes a single stranded target site, while in some embodiments, a nuclease recognizes a double-stranded target site, for example a double-stranded DNA target site. Target sites of many naturally occurring nucleases, for example, many naturally occurring DNA restriction nucleases, are well known to those of skill in the art. In many cases, a DNA nuclease, such as EcoRI, HindIII, or BamHI, recognize a palindromic, double-stranded DNA target site of 4 to 10 base pairs in length, and cut each of the two DNA strands at a specific position within a target site. Some endonucleases cut a double-stranded nucleic acid target site 20 13002505v1Docket No.: 2017359-0091 symmetrically, i.e., cutting both strands at the same position so that the ends comprise base- paired nucleotides, also referred to herein as blunt ends. Other endonucleases cut a double- stranded nucleic acid target sites asymmetrically, i.e., cutting each strand at a different position so that the ends comprise unpaired nucleotides. Unpaired nucleotides at an end of a double- stranded DNA molecule are also referred to as “overhangs,” e.g., as “5′-overhang” or as “3′- overhang,” depending on whether unpaired nucleotide(s) form(s) the 5′ or the 3′ end of a given DNA strand. Double-stranded DNA molecule ends ending with unpaired nucleotide(s) are also referred to as sticky ends, as they can “stick to” other double-stranded DNA molecule ends comprising complementary unpaired nucleotide(s). A nuclease protein typically comprises a “binding domain” that mediates interaction of a protein with a nucleic acid substrate, and also, in some cases, specifically binds to a target site, and a “cleavage domain” that catalyzes the cleavage of a phosphodiester bond within a nucleic acid backbone. In some embodiments, a nuclease protein can bind and cleave a nucleic acid molecule in a monomeric form, while, in some embodiments, a nuclease protein has to dimerize or multimerize in order to cleave a target nucleic acid molecule. Binding domains and cleavage domains of naturally occurring nucleases, as well as modular binding domains and cleavage domains that can be fused to create nucleases binding specific target sites, are well known to those of skill in the art.

[0071] Nucleic acid: As used herein, the term “nucleic acid”, in its broadest sense, refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, “nucleic acid” refers to an individual nucleic acid residue (e.g., a nucleotide and / or nucleoside); in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a “nucleic acid” is or comprises RNA; in some embodiments, a “nucleic acid” is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and / or 5ˈ-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of 21 13002505v1Docket No.: 2017359-0091 one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2ˈ -fluororibose, ribose, 2ˈ -deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded. In some embodiments, a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is complementary to a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.

[0072] Operably linked: As used herein, refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control element “operably linked” to a functional element is associated in such a way that expression and / or activity of the functional element is achieved under conditions compatible with the control element. In some embodiments, “operably linked” control elements are contiguous (e.g., covalently linked) with coding elements of interest; in some embodiments, control elements act in trans to or otherwise at a from the functional element of interest. In some embodiments, “operably linked” refers to functional linkage between a regulatory sequence and a heterologous 22 13002505v1Docket No.: 2017359-0091 nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. In some embodiments, for example, a functional linkage may include transcriptional control. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.

[0073] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, a pharmaceutical composition may be specially formulated for administration in solid or liquid form, including those adapted for, e.g., administration, for example, an injectable formulation that is, e.g., an aqueous or non- aqueous solution or suspension or a liquid drop designed to be administered into an ear canal. In some embodiments, a pharmaceutical composition may be formulated for administration via injection either in a particular organ or compartment, e.g., directly into an ear, or systemic, e.g., intravenously. In some embodiments, a formulation may be or comprise drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes, capsules, powders, etc. In some embodiments, an active agent may be or comprise an isolated, purified, or pure compound.

[0074] Pharmaceutically acceptable: As used herein, the term “pharmaceutically acceptable” which, for example, may be used in reference to a carrier, diluent, or excipient used to formulate a pharmaceutical composition as disclosed herein, means that a carrier, diluent, or excipient is compatible with other ingredients of a composition and not deleterious to a recipient thereof.

[0075] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such 23 13002505v1Docket No.: 2017359-0091 as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting a subject compound from one organ, or portion of a body, to another organ, or portion of a body. Each carrier must be is “acceptable” in the sense of being compatible with other ingredients of a formulation and not injurious to a patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0076] Polypeptide: As used herein, the term “polypeptide” refers to any polymeric chain of residues (e.g., amino acids) that are typically linked by peptide bonds. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that is engineered in that it is designed and / or produced through action of the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at a polypeptide’s N-terminus, at a polypeptide’s C-terminus, or any combination thereof. In some embodiments, such pendant groups or modifications may be acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments, polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. In some embodiments, useful modifications may be or include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, a protein may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. 24 13002505v1Docket No.: 2017359-0091 The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, a protein is antibodies, antibody fragments, biologically active portions thereof, and / or characteristic portions thereof.

[0077] Polynucleotide: As used herein, the term “polynucleotide” refers to any polymeric chain of nucleic acids. In some embodiments, a polynucleotide is or comprises RNA; in some embodiments, a polynucleotide is or comprises DNA. In some embodiments, a polynucleotide is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a polynucleotide is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a polynucleotide analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. Alternatively or additionally, in some embodiments, a polynucleotide has one or more phosphorothioate and / or 5ˈ -N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a polynucleotide is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a polynucleotide is, comprises, or consists of one or more nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a polynucleotide comprises one or more modified sugars (e.g., 2ˈ -fluororibose, ribose, 2ˈ -deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a polynucleotide has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a polynucleotide includes one or more introns. In some embodiments, a polynucleotide is prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a polynucleotide is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 25 13002505v1Docket No.: 2017359-0091 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a polynucleotide is partly or wholly single stranded; in some embodiments, a polynucleotide is partly or wholly double stranded. In some embodiments, a polynucleotide has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a polynucleotide has enzymatic activity.

[0078] Protein: As used herein, the term “protein” refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and / or may be otherwise processed or modified. In some embodiments, a “protein” can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a genotypic variant thereof. In some embodiments, a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means.

[0079] Recombinant: As used herein, the term “recombinant” is intended to refer to polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and / or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression construct transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and / or direct expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof; and / or polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and / or otherwise generating a nucleic acid that encodes and / or directs expression of a polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof. In some embodiments, one or more of such selected sequence elements is found in nature. In some embodiments, one or more of such selected sequence elements is designed in silico. In some embodiments, one or more such selected sequence elements results from mutagenesis (e.g., in 26 13002505v1Docket No.: 2017359-0091 vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.).

[0080] Reference: As used herein, the term “reference” describes a standard or control relative to which a comparison is performed. For example, in some embodiments, an agent, animal, individual, population, sample, sequence or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, a reference or control is tested and / or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference or control is determined or characterized under comparable conditions or circumstances to those under assessment. Those skilled in the art will appreciate when sufficient similarities are present to justify reliance on and / or comparison to a particular possible reference or control. In some embodiments, a reference is a negative control reference; in some embodiments, a reference is a positive control reference.

[0081] Regulatory Element: As used herein, the term “regulatory element” or “regulatory sequence” refers to non-coding regions of DNA that regulate, in some way, expression of one or more particular genes. In some embodiments, such genes are apposed or “in the neighborhood” of a given regulatory element. In some embodiments, such genes are located quite far from a given regulatory element. In some embodiments, a regulatory element impairs or enhances transcription of one or more genes. In some embodiments, a regulatory element may be located in cis to a gene being regulated. In some embodiments, a regulatory element may be located in trans to a gene being regulated. For example, in some embodiments, a regulatory sequence refers to a nucleic acid sequence which is regulates expression of a gene product operably linked to a regulatory sequence. In some such embodiments, this sequence may be an enhancer sequence and other regulatory elements which regulate expression of a gene product.

[0082] Sample: As used herein, the term “sample” typically refers to an aliquot of material obtained or derived from a source of interest. In some embodiments, a source of interest is a biological or environmental source. In some embodiments, a source of interest may be or comprise a cell or an organism, such as a microbe (e.g., virus), a plant, or an animal (e.g., a 27 13002505v1Docket No.: 2017359-0091 human). In some embodiments, a source of interest is or comprises biological tissue or fluid. In some embodiments, a biological tissue or fluid may be or comprise amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, cerumen, chyle, chime, ejaculate, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, perilymph, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vitreous humor, vomit, and / or combinations or component(s) thereof. In some embodiments, a biological fluid may be or comprise an intracellular fluid, an extracellular fluid, an intravascular fluid (blood plasma), an interstitial fluid, a lymphatic fluid, and / or a transcellular fluid. In some embodiments, a biological fluid may be or comprise a plant exudate. In some embodiments, a biological tissue or sample may be obtained, for example, by aspirate, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, washing or lavage (e.g., bronchioalveolar, ductal, nasal, ocular, oral, uterine, vaginal, or other washing or lavage). In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and / or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques such as amplification or reverse transcription of nucleic acid, isolation and / or purification of certain components, etc.

[0083] Subject: As used herein, the term “subject” refers an organism, typically a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is a non-human primate. In some embodiments a non-human primate is a cynomolgus macaque. In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or 28 13002505v1Docket No.: 2017359-0091 condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered.

[0084] Substantially: As used herein, the term “substantially” refers to a qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. As described herein, biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture a potential lack of completeness inherent in many biological and chemical phenomena.

[0085] Treatment: As used herein, the term “treatment” (also “treat” or “treating”) refers to any administration of a therapy that partially or completely alleviates, ameliorates, eliminates, reverses, relieves, inhibits, delays onset of, reduces severity of, and / or reduces incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. Alternatively, or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of a given disease, disorder, and / or condition.

[0086] Variant: As used herein, the term “variant” refers to a version of something, e.g., a gene sequence, that is different, in some way, from another version. To determine if something is a variant, a reference version is typically chosen and a variant is different relative to that reference version. In some embodiments, a variant can have the same or a different (e.g., increased or decreased) level of activity or functionality than a wild type sequence. For example, in some embodiments, a variant can have improved functionality as compared to a wild-type sequence if it is, e.g., mutated to confer reduced toxicity in a cell. As another example, in some embodiments, a variant can have improved functionality as compared to a wild-type sequence if it is, e.g., mutated to confer improved protein production in a cell. 29 13002505v1Docket No.: 2017359-0091

[0087] VP1 capsid coding sequence: As used herein, in some embodiments, the term “VP1 capsid coding sequence” can refer to a reference VP1 capsid coding sequence. A “reference VP1 capsid coding sequence” as used herein is a native VP1 capsid coding sequence (or wild-type VP1 capsid coding sequence). As used herein, in some embodiments, the term “VP1 capsid coding sequence” can refer to a variant VP1 capsid coding sequence. A “variant VP1 capsid coding sequence” as used herein is a VP1 capsid polypeptide that comprises one or more mutations relative to a reference VP1 capsid coding sequence.

[0088] VP1 capsid polypeptide: As used herein, in some embodiments, the term “VP1 capsid polypeptide” can refer to a reference VP1 capsid polypeptide. A “reference VP1 capsid polypeptide” as used herein is a native VP1 capsid polypeptide (or wild-type VP1 capsid polypeptide). As used herein, in some embodiments, the term “VP1 capsid polypeptide” can refer to a variant VP1 capsid polypeptide. A “variant VP1 capsid polypeptide” as used herein is a VP1 capsid polypeptide that comprises one or more mutations relative to a reference VP1 capsid polypeptide.

[0089] VP2 capsid coding sequence: As used herein, in some embodiments, the term “VP2 capsid coding sequence” can refer to a reference VP2 capsid coding sequence. A “reference VP2 capsid coding sequence” as used herein is a native VP2 capsid coding sequence (or wild-type VP2 capsid coding sequence). As used herein, in some embodiments, the term “VP2 capsid coding sequence” can refer to a variant VP2 capsid coding sequence. A “variant VP2 capsid coding sequence” as used herein is a VP2 capsid polypeptide that comprises one or more mutations relative to a reference VP2 capsid coding sequence.

[0090] VP2 capsid polypeptide: As used herein, in some embodiments, the term “VP2 capsid polypeptide” can refer to a reference VP2 capsid polypeptide. A “reference VP2 capsid polypeptide” as used herein is a native VP2 capsid polypeptide (or wild-type VP2 capsid polypeptide). As used herein, in some embodiments, the term “VP2 capsid polypeptide” can refer to a variant VP2 capsid polypeptide. A “variant VP2 capsid polypeptide” as used herein is a VP2 capsid polypeptide that comprises one or more mutations relative to a reference VP2 capsid polypeptide.

[0091] VP3 capsid coding sequence: As used herein, in some embodiments, the term “VP3 capsid coding sequence” can refer to a reference VP3 capsid coding sequence. A 30 13002505v1Docket No.: 2017359-0091 “reference VP3 capsid coding sequence” as used herein is a native VP3 capsid coding sequence (or wild-type VP3 capsid coding sequence). As used herein, in some embodiments, the term “VP3 capsid coding sequence” can refer to a variant VP3 capsid coding sequence. A “variant VP3 capsid coding sequence” as used herein is a VP3 capsid polypeptide that comprises one or more mutations relative to a reference VP3 capsid coding sequence.

[0092] VP3 capsid polypeptide: As used herein, in some embodiments, the term “VP3 capsid polypeptide” can refer to a reference VP3 capsid polypeptide. A “reference VP3 capsid polypeptide” as used herein is a native VP3 capsid polypeptide (or wild-type VP3 capsid polypeptide). As used herein, in some embodiments, the term “VP3 capsid polypeptide” can refer to a variant VP3 capsid polypeptide. A “variant VP3 capsid polypeptide” as used herein is a VP3 capsid polypeptide that comprises one or more mutations relative to a reference VP3 capsid polypeptide. BRIEF DESCRIPTION OF THE DRAWING

[0093] FIG.1 is a graph showing the sedimentation coefficient values of an exemplary bocavirus virion preparation of the present disclosure as determined by analytical ultracentrifugation.

[0094] FIG.2A and FIG.2B show density gradient ultracentrifugation analysis of exemplary bocavirus capsid polypeptides. FIG.2A is an image of a western blot analysis of purified bocavirus capsid polypeptides prepared from exemplary bocaviruses of the present disclosure separated by density gradient ultracentrifugation. RI = Refractive Index. FIG.2B is a graph showing bocavirus capsid polypeptide chromatographic profiles of exemplary bocaviruses of the present disclosure separated by density gradient ultracentrifugation.

[0095] FIG.3A and FIG.3B are graphs showing the correlation of bocavirus capsid VP3B / VP3A ratios and the incorporation of CFTR-encoding DNA. FIG.3A is a graph showing a percent of human bocavirus capsids (hBoV1) incorporating CFTR-encoding DNA (Full Capsids) as it correlates to the composition ratio of VP3B / VP3A in the hBoV1 capsid. FIG.3B is a graph showing potency (CFTR mRNA) of human bocavirus capsids (hBoV1) incorporating CFTR-encoding DNA (Full Capsids) as it correlates to the composition ratio of VP3B / VP3A in an exemplary hBoV1 capsid. 31 13002505v1Docket No.: 2017359-0091

[0096] FIG.4 is a workflow chart showing an exemplary protocol for differentiating human bronchial / tracheal epithelial cells in an air-liquid interface culture system according to an embodiment of the present disclosure.

[0097] FIG.5 is an image of a western blot analysis of lysates prepared from primary human bronchial epithelial (HBE) cells derived from cystic fibrosis donors and transduced with human bocavirus containing a full-length CFTR transgene (hBov1-CFTR) and cultured in various concentrations of doxorubicin. Lysates prepared from 16HBE cells, non-transduced human bronchial / tracheal epithelial cells cultured in the absence of doxorubicin (No Vector / No Dox) are shown as a control. Western blots were probed with anti-CFTR antibody (UNC596) and β-actin (loading control).

[0098] FIG.6A and FIG.6B are diagrams depicting exemplary experimental buffer conditions using an Ussing chamber for measuring short circuit current, potential difference, and / or electrical resistance across HBE cells. FIG.6A is a diagram showing a “symmetrical” buffer system in an Ussing apparatus where the chloride concentration on the apical and basolateral side of the HBE cells are the same. FIG.6B is a diagram showing an “asymmetrical” buffer system in an Ussing apparatus where the chloride concentration on the basolateral side of the HBE cells is higher than the chloride concentration on the apical side of the human bronchial / tracheal epithelial cells.

[0099] FIG.7A and FIG.7B are bar graphs showing the recovery of symmetrical chloride ion current in primary ΔF508 HBE cells transduced with human bocavirus containing a full-length CFTR transgene (hBoV1-CFTR). FIG.7A is a bar graph showing the change in short circuit chloride ion current (ΔIsc) across HBE cells transduced with human bocavirus containing a full-length CFTR transgene (hBoV1-CFTR) and cultured in various concentrations of doxorubicin (Dox) in a symmetrical buffered Ussing chamber as depicted in FIG.6A. Amiloride (10 μM) was added to the buffers to inhibit the sodium channel, ENaC. Forskolin (10 μM) and IBMX (100 μM) were added to stimulate CFTR activity, followed by addition of CFTR-inh172 to inhibit CFTR activity. ΔIsc was determined as the difference in current between the forskolin / IMBX stimulation signal and the CFTR-inh172 signal. Wild-type HBE cells from a healthy donor (WT), ΔF508 HBE cells treated with VX-661 / 445 (VX-661 / 445), non-transduced / treated HBE cells (no vector / no dox), HBE cells transduced with human 32 13002505v1Docket No.: 2017359-0091 bocavirus containing a GFP transgene (GFP), non-transduced HBE cells cultured in 2.5 μM doxorubicin (no vector (2.5 μM dox)), and non-transduced HBE cells cultured in 2.5 μM doxorubicin in an asymmetrical buffered Ussing chamber(2.5 uM dox (chl.grad.)) were included as controls. FIG.7B is a bar graph showing the change in short circuit chloride ion current (ΔIsc) across the HBE cells treated as described in FIG.7A plotted as a percentage of the change in short circuit chloride ion current (ΔIsc) across wild-type HBE cells.

[0100] FIGS.8A -FIG.8F are bar graphs showing the recovery of symmetrical chloride ion current in primary HBE cells derived from a single ΔF508 CFTR donor transduced with human bocavirus containing a full-length CFTR transgene (hBoV1-CFTR). FIG.8A – FIG.8C are bar graphs showing the change in short circuit chloride ion current (ΔIsc) across HBE cells transduced with human bocavirus containing a full-length CFTR transgene (hBoV1-CFTR) and cultured in 0.3 μM doxorubicin in a symmetrical buffered Ussing chamber as depicted in FIG. 6A. Amiloride (10 μM) was added to the buffers to inhibit the sodium channel, ENaC. Forskolin (10 μM) and IBMX (100 μM) were added to stimulate CFTR activity, followed by addition of CFTR-inh172 to inhibit CFTR activity. ΔIsc was determined as the difference in current between the forskolin / IMBX stimulation signal and the CFTR-inh172 signal. Wild-type HBE cells from a healthy donor (WT), ΔF508 HBE cells treated with VX-661 / 445 (VX- 661 / 445), and non-transduced / treated HBE cells (no vector / no dox) were included as controls. FIG.8D – FIG.8F are bar graphs showing the change in short circuit chloride ion current (ΔIsc) across the HBE cells treated as described in FIG.8A – FIG.8C plotted as a percentage of the change in short circuit chloride ion current (ΔIsc) across wild-type HBE cells.

[0101] FIG.9 is an image of a western blot analysis of lysates prepared from CuFi-8 cells derived from a ΔF508 cystic fibrosis donor and differentiated into functional airway cells by air-liquid interface culture and transduced with various multiplicities of infection (MOIs) of human bocavirus containing a full-length CFTR transgene (hBov1-CFTR). Western blots were probed with anti-CFTR antibody (UNC596) and β-actin (loading control).

[0102] FIG.10 is a line graph showing the copies per CFTRA mRNA relative to GAPDH mRNA (determined by digital droplet PCR (ddPCR)) and recovery of symmetrical chloride ion current in CuFi-8 cells transduced with various MOIs of human bocavirus containing a full-length CFTR transgene (hBoV1-CFTR) using a symmetrical buffered Ussing 33 13002505v1Docket No.: 2017359-0091 chamber as depicted in FIG.6A. Amiloride (10 μM) was added to the buffers to inhibit the sodium channel, ENaC. Forskolin (10 μM) and IBMX (100 μM) were added to stimulate CFTR activity, followed by addition of CFTR-inh172 to inhibit CFTR activity. ΔIsc was determined as the difference in current between the forskolin / IMBX stimulation signal and the CFTR-inh172 signal.

[0103] FIG.11A and FIG.11B are images of fluorescence micrographs of HBE cells derived from a ΔF508 cystic fibrosis donor, cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene. FIG.11A is a fluorescence micrograph of HBE cells 7 days after transduction with human bocavirus containing a GFP transgene. Cells were stained for the nuclear basal cell marker p63. FIG.11B is a fluorescence micrograph of HBE cells 30 days after transduction with human bocavirus containing a GFP transgene.

[0104] FIG.12A -FIG.12D are images of fluorescence micrographs of HBE cells derived from a ΔF508 cystic fibrosis donor cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene (MOI 1.0 x 104) and cultured in 5 μM doxorubicin. FIG.12C is a fluorescence micrograph of HBE cells 7 days after transduction and stained for the ionocyte cell marker BSND. FIG.12D is the fluorescence micrograph of FIG.12C showing GFP-positive cells. FIG.12B is an overlay of FIG.12C and FIG.12D. FIG.12A is an overlay of FIG.12 and nuclear staining with Hoescht. Scale bars represent 200 μm.

[0105] FIG.13 is an overlay image of a fluorescence micrograph of HBE cells derived from a ΔF508 cystic fibrosis donor cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene (MOI 1.0 x 104) and cultured in 5 μM doxorubicin. HBE cells were fixed 7 days after transduction and stained for the goblet cell marker MUC5A. Insets are micrographs of the hatched region in the overlay image showing Hoescht nuclear staining (top), GFP-positive cells (center), and MUC5A-positive cells (bottom). Scale bars represent 100 μm.

[0106] FIG.14 is an overlay image of a fluorescence micrograph of HBE cells derived from a ΔF508 cystic fibrosis donor cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene (MOI 1.0 x 104) and cultured in 5 μM 34 13002505v1Docket No.: 2017359-0091 doxorubicin. HBE cells were fixed 7 days after transduction and stained for the goblet cell marker MUC5B. Insets o are micrographs of the hatched region in the overlay image showing Hoescht nuclear staining (top), GFP-positive cells (center), and MUC5B-positive cells (bottom). Scale bars represent 100 μm.

[0107] FIG.15A and FIG.15B are brightfield micrographs of HBE cells derived from a ΔF508 cystic fibrosis donor, cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene (MOI 1.0 x 104) and cultured in the absence (FIG. 15A) or presence (FIG.15B) of 5 μM doxorubicin.

[0108] FIG.16A and FIG.16B are bar graphs showing the percent cellular distributions (ciliated cells, basal cells, secretory cells, and all other cells (rest)) of HBE cells derived from a ΔF508 cystic fibrosis donor, cultured in an air-liquid interface system, and transduced with human bocavirus containing a GFP transgene (MOI 1.0 x 104) and cultured in 0 to 5 μM doxorubicin. FIG.16A is a bar graph showing the percent cellular distributions of all HBE cells in the air-liquid interface culture. FIG.16B is a bar graph showing the percent cellular distributions of GFP-positive (i.e., transduced) HBE cells in the air-liquid interface culture.

[0109] FIG.17A shows a schematic depicting workflow of organ collection, agarose infusion, lung tissue slicing, culture of precision-cut lung tissue slices, and transduction with human bocavirus capsids (hBoV1). FIG.17B shows fluorescence images of human-derived precision-cut lung slices (PCLS) transduced with hBoV1-GFP. Precision-cut lung slices (Anabios) were incubated in Neuma-cult-S media for six days. Independent PCLS were then transduced with hBoV1-GFP at an approximated MOI of 1E5-1E6, or vehicle control, in the presence of 1.6 µM doxorubicin. GFP expression was evaluated under UV microscope at different magnifications.

[0110] FIG.18 shows histological images of human-derived PCLS transduced with hBoV1-GFP, ex-vivo. Independent PCLS were then transduced with hBoV1-GFP at an approximated MOI of 1E5-1E6, or vehicle control, in the presence of 1.6 µM doxorubicin. Data show co-localization of GFP and SCGB1A1 (secretory club cells marker), confirming transduction of Cystic Fibrosis-relevant cells in ex vivo human lung tissue. DAPI was used to identify cell nucleus. Other GFP positive cells show characteristic morphology and localization of alveolar type I and type II cells. 35 13002505v1Docket No.: 2017359-0091

[0111] FIG.19 shows histological images of human-derived PCLS transduced with hBoV1-GFP, ex-vivo, at an approximated MOI of 1E5-1E6, or vehicle control, in the presence of 1.6 µM doxorubicin. Co-localization of GFP and SCGB1A1 (secretory club cells marker), showing transduction of cystic fibrosis-relevant cells in ex vivo human lung tissue.

[0112] FIG.20A shows a bar graph depicting hBoV1-CFTR delivery in non-human primates (NHP) across the lung in right cranial region, left caudal region, left cranial region, right middle region, and trachea, and in the liver. Vector genomes detection in liver were below the limit of detection of the assay. FIG.20B shows a table depicting dosing for nebulized delivery of hBoV1-CFTR in NHP for a 28-day exposure study.

[0113] FIG.21 shows a table depicting presence or absence of hCFTR expression in right cranial region, left caudal region, left cranial region, right middle region, and trachea of the lung and in the liver in NHP treated with hBoV1-CFTR at a dose of 3E14 vg / animal, in the absence or presence of doxorubicin (50 µM) or with vehicle. All tested lung samples from treated animals were positive for hCFRT mRNA, demonstrating expression across different regions of the NHP lung. hCFTR mRNA signal in all liver samples were below the quantification limit (BQL).

[0114] FIG.22 shows immunohistochemistry (IHC) analysis of trachea and right caudal lobe cells in the lungs of untreated NHP and NHP treated with hBoV1-CFTR at a dose of 3E14 vg / animal, in the absence or presence of doxorubicin (50 µM). NHP treated with hBoV1-CFTR showed a significant increase in CFTR signal relative to untreated animals. Available antibodies do not discriminate between human and NHP CFTR protein.

[0115] FIGs.23A-23C shows bar graphs depicting chloride channel activity (ΔIsc FSK / IBMX activation (µA)) across human bronchoalveolar epithelial cells (HBEC) (F508D cells). FIG.23A shows a bar graph depicting chloride channel activity in HBEC treated with hBoV1-CFTR, Trikafta, or hBoV1-GFP. FIG.23B shows a bar graph depicting contribution of hBoV1 to both CFTR activation and inactivation combined in HBEC treated with hBoV1-CFTR, Trikafta, or hBoV1-GFP. FIG.23C shows chloride channel activity across Cufi-8 (F508D) HBEC cells treated with DMSO (Mock), VX-661 / 445 (Tezacaftor (VX- 661) / Elexacaftor / (VX445) cocktail), and hBoV1-CFTR. hBoV1-CFTR recovers more CFTR chloride channel activity relative to Trikafta in (F508D) HBEC cells and relative to a Tezacaftor 36 13002505v1Docket No.: 2017359-0091 (VX-661) / Elexacaftor / (VX445) cocktail in Cufi-8 (F508D) HBEC cells as measured by channel activation, specific inhibition, or both combined.

[0116] FIG.24 shows a bar graph depicting chloride ion current measured as percent chloride ion current relative to wild-type human bronchial epithelia (HBE) in HBE treated with hBoV1-CFTR, hBoV1-GFP or MOCK using an MOI of 1E5 vg / cell. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0117] The present disclosure provides constructs (e.g., polynucleotides) comprising a heterologous nucleic acid comprising a transgene. In some embodiments, the present disclosure provides virions, populations of virions, and pharmaceutical compositions comprising the virions, wherein the virions comprise a construct comprising a heterologous nucleic acid comprising the transgene. In some embodiments, the present disclosure further provides host cells comprising a construct comprising a heterologous nucleic acid comprising a transgene. The present disclosure also provides methods of manufacturing virions comprising the constructs and methods of preventing or treating a subject in need thereof by administering to the subject the virion, population of virions, or pharmaceutical composition comprising the virions. I. TRANSGENE CONSTRUCTS

[0118] Among other things, the present disclosure provides a transgene construct, e.g., a polynucleotide transgene construct, comprising an expression cassette and a polynucleotide backbone. In some embodiments, an expression cassette comprises a heterologous transgene. In some embodiments, an expression cassette further comprises one or more elements that promotes the expression of a polypeptide encoded by the heterologous transgene, when the construct is introduced (e.g., transduced or transfected) into a cell. In some embodiments, a transgene construct disclosed herein comprises one or more elements that facilitate the incorporation of the construct into a virion capsid.

[0119] In some embodiments, a transgene construct of the disclosure may comprise an expression cassette incorporating (i) a 5ˈ inverted terminal repeat (ITR), (ii) a heterologous nucleic acid comprising a transgene encoding a therapeutic polypeptide, and (iii) a 3ˈ ITR. 37 13002505v1Docket No.: 2017359-0091

[0120] In some embodiments, a transgene construct of the present disclosure may be packaged within a parvovirus capsid to produce a virion. In some embodiments, a parvovirus capsid comprises (i) a VP1 capsid polypeptide, functional fragment thereof, or variant thereof; (ii) a VP2 capsid polypeptide, functional fragment thereof, or variant thereof; (iii) aVP3 capsid polypeptide, functional fragment thereof, or variant thereof; or (iv) any combination thereof. In some embodiments, a virion is delivered to a selected target cell.

[0121] In some embodiments, a transgene encodes a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest and is heterologous to one or more other sequences of a transgene construct. In some embodiments, a transgene is operatively linked to one or more regulatory components in a manner which permits transgene transcription, translation, and / or expression in a cell.

[0122] A transgene construct as described in the present disclosure may include one or more additional elements as described herein (e.g., regulatory elements, e.g., one or more of a promoter, an enhancer, a polyA sequence, and an IRES).

[0123] In some embodiments, a transgene construct of the present disclosure may be at least 3 Kb, at least 3.1 Kb, at least 3.2 Kb, at least 3.3 Kb, at least 3.4 Kb, at least 3.5 Kb, at least 4.0 Kb, at least 4.1Kb, at least 4.2 Kb, at least 4.3 Kb, at least 4.4 Kb, at least 4.5 Kb, at least 4.6 Kb, at least 4.7 Kb, at least 4.8 Kb, at least 4.9 Kb, at least 5.0 Kb, at least 5.1 Kb, at least 5.2 Kb, at least 5.3 Kb, at least 5.4 Kb, at least 5.5 Kb, at least 5.6 Kb, at least 5.7 Kb, at least 5.8 Kb, at least 5.9 Kb, at least 6.0 Kb, at least 6.1 Kb, at least 6.2 Kb, at least 6.3 Kb, at least 6.4 Kb, at least 6.5 Kb, at least 6.6 Kb, at least 6.7 Kb, at least 6.8 Kb, at least 6.9 Kb, at least 7.0 Kb, at least 7.1 Kb, at least 7.2 Kb, at least 7.3 Kb, at least 7.4 Kb, at least 7.5 Kb, at least 7.6 Kb, at least 7.7 Kb, at least 7.8 Kb, at least 7.9 Kb, or at least 8.0 Kb.

[0124] In some embodiments, a transgene construct of the present disclosure may be about 3 Kb to about 8.0 Kb, about 3.1 Kb to about 8.0 Kb, about 3.2 Kb to about 8.0 Kb, about 3.3 Kb to about 8.0 Kb, about 3.4 Kb to about 8.0 Kb, about 3.5 Kb to about 8.0 Kb, about 3.6 Kb to about 8.0 Kb, about 3.7 Kb to about 8.0 Kb, about 3.8 Kb to about 8.0 Kb, about 3.9 Kb to about 8.0 Kb, about 4.0 Kb to about 8.0 Kb, about 4.1 Kb to about 8.0 Kb, about 4.2 Kb to about 8.0 Kb, about 4.3 Kb to about 8.0 Kb, about 4.4 Kb to about 8.0 Kb, about 4.5 Kb to about 8.0 Kb, about 4.6 Kb to about 8.0 Kb, about 4.7 Kb to about 8.0 Kb, about 4.8 Kb to about 8.0 Kb, 38 13002505v1Docket No.: 2017359-0091 about 4.9 Kb to about 8.0 Kb, about 5.0 Kb to about 8.0 Kb, about 5.1 Kb to about 8.0 Kb, about 5.2 Kb to about 8.0 Kb, about 5.3 Kb to about 8.0 Kb, about 5.4 Kb to about 8.0 Kb, about 5.5 Kb to about 8.0 Kb, about 5.6 Kb to about 8.0 Kb, about 5.7 Kb to about 8.0 Kb, about 5.8 Kb to about 8.0 Kb, about 5.9 Kb to about 8.0 Kb, about 6.0 Kb to about 8.0 Kb, about 6.1 Kb to about 8.0 Kb, about 6.2 Kb to about 8.0 Kb, about 6.3 Kb to about 8.0 Kb, about 6.4 Kb to about 8.0 Kb, about 6.5 Kb to about 8.0 Kb, about 6.6 Kb to about 8.0 Kb, about 6.7 Kb to about 8.0 Kb, about 6.8 Kb to about 8.0 Kb, about 6.9 Kb to about 8.0 Kb, about 7.0 Kb to about 8.0 Kb, about 7.1 Kb to about 8.0 Kb, about 7.2 Kb to about 8.0 Kb, about 7.3 Kb to about 8.0 Kb, about 7.4 Kb to about 8.0 Kb, about 7.5 Kb to about 8.0 Kb, about 7.6 Kb to about 8.0 Kb, about 7.7 Kb to about 8.0 Kb, about 7.8 Kb to about 8.0 Kb, about 7.9 Kb to about 8.0 Kb, about 3 Kb to about 7.8 Kb, about 3.1 Kb to about 7.8 Kb, about 3.2 Kb to about 7.8 Kb, about 3.3 Kb to about 7.8 Kb, about 3.4 Kb to about 7.8 Kb, about 3.5 Kb to about 7.8 Kb, about 3.6 Kb to about 7.8 Kb, about 3.7 Kb to about 7.8 Kb, about 3.8 Kb to about 7.8 Kb, about 3.9 Kb to about 7.8 Kb, about 4.0 Kb to about 7.8 Kb, about 4.1 Kb to about 7.8 Kb, about 4.2 Kb to about 7.8 Kb, about 4.3 Kb to about 7.8 Kb, about 4.4 Kb to about 7.8 Kb, about 4.5 Kb to about 7.8 Kb, about 4.6 Kb to about 7.8 Kb, about 4.7 Kb to about 7.8 Kb, about 4.8 Kb to about 7.8 Kb, about 4.9 Kb to about 7.8 Kb, about 5.0 Kb to about 7.8 Kb, about 5.1 Kb to about 7.8 Kb, about 5.2 Kb to about 7.8 Kb, about 5.3 Kb to about 7.8 Kb, about 5.4 Kb to about 7.8 Kb, about 5.5 Kb to about 7.8 Kb, about 5.6 Kb to about 7.8 Kb, about 5.7 Kb to about 7.8 Kb, about 5.8 Kb to about 7.8 Kb, about 5.9 Kb to about 7.8 Kb, about 6.0 Kb to about 7.8 Kb, about 6.1 Kb to about 7.8 Kb, about 6.2 Kb to about 7.8 Kb, about 6.3 Kb to about 7.8 Kb, about 6.4 Kb to about 7.8 Kb, about 6.5 Kb to about 7.8 Kb, about 6.6 Kb to about 7.8 Kb, about 6.7 Kb to about 7.8 Kb, about 6.8 Kb to about 7.8 Kb, about 6.9 Kb to about 7.8 Kb, about 7.0 Kb to about 7.8 Kb, about 7.1 Kb to about 7.8 Kb, about 7.2 Kb to about 7.8 Kb, about 7.3 Kb to about 7.8 Kb, about 7.4 Kb to about 7.8 Kb, about 7.5 Kb to about 7.8 Kb, about 7.6 Kb to about 7.8 Kb, about 7.7 Kb to about 7.8 Kb, about 3 Kb to about 7.6 Kb, about 3.1 Kb to about 7.6 Kb, about 3.2 Kb to about 7.6 Kb, about 3.3 Kb to about 7.6 Kb, about 3.4 Kb to about 7.6 Kb, about 3.5 Kb to about 7.6 Kb, about 3.6 Kb to about 7.6 Kb, about 3.7 Kb to about 7.6 Kb, about 3.8 Kb to about 7.6 Kb, about 3.9 Kb to about 7.6 Kb, about 4.0 Kb to about 7.6 Kb, about 4.1 Kb to about 7.6 Kb, about 4.2 Kb to about 7.6 Kb, about 4.3 Kb to about 7.6 Kb, about 4.4 Kb to about 7.6 Kb, about 4.5 Kb to about 7.6 Kb, about 4.6 Kb to about 7.6 Kb, about 4.7 Kb to about 7.6 Kb, about 4.8 Kb to about 7.6 Kb, about 39 13002505v1Docket No.: 2017359-0091 4.9 Kb to about 7.6 Kb, about 5.0 Kb to about 7.6 Kb, about 5.1 Kb to about 7.6 Kb, about 5.2 Kb to about 7.6 Kb, about 5.3 Kb to about 7.6 Kb, about 5.4 Kb to about 7.6 Kb, about 5.5 Kb to about 7.6 Kb, about 5.6 Kb to about 7.6 Kb, about 5.7 Kb to about 7.6 Kb, about 5.8 Kb to about 7.6 Kb, about 5.9 Kb to about 7.6 Kb, about 6.0 Kb to about 7.6 Kb, about 6.1 Kb to about 7.6 Kb, about 6.2 Kb to about 7.6 Kb, about 6.3 Kb to about 7.6 Kb, about 6.4 Kb to about 7.6 Kb, about 6.5 Kb to about 7.6 Kb, about 6.6 Kb to about 7.6 Kb, about 6.7 Kb to about 7.6 Kb, about 6.8 Kb to about 7.6 Kb, about 6.9 Kb to about 7.6 Kb, about 7.0 Kb to about 7.6 Kb, about 7.1 Kb to about 7.6 Kb, about 7.2 Kb to about 7.6 Kb, about 7.3 Kb to about 7.6 Kb, about 7.4 Kb to about 7.6 Kb, about 7.5 Kb to about 7.6 Kb, about 3 Kb to about 7.4 Kb, about 3.1 Kb to about 7.4 Kb, about 3.2 Kb to about 7.4 Kb, about 3.3 Kb to about 7.4 Kb, about 3.4 Kb to about 7.4 Kb, about 3.5 Kb to about 7.4 Kb, about 3.6 Kb to about 7.4 Kb, about 3.7 Kb to about 7.4 Kb, about 3.8 Kb to about 7.4 Kb, about 3.9 Kb to about 7.4 Kb, about 4.0 Kb to about 7.4 Kb, about 4.1 Kb to about 7.4 Kb, about 4.2 Kb to about 7.4 Kb, about 4.3 Kb to about 7.4 Kb, about 4.4 Kb to about 7.4 Kb, about 4.5 Kb to about 7.4 Kb, about 4.6 Kb to about 7.4 Kb, about 4.7 Kb to about 7.4 Kb, about 4.8 Kb to about 7.4 Kb, about 4.9 Kb to about 7.4 Kb, about 5.0 Kb to about 7.4 Kb, about 5.1 Kb to about 7.4 Kb, about 5.2 Kb to about 7.4 Kb, about 5.3 Kb to about 7.4 Kb, about 5.4 Kb to about 7.4 Kb, about 5.5 Kb to about 7.4 Kb, about 5.6 Kb to about 7.4 Kb, about 5.7 Kb to about 7.4 Kb, about 5.8 Kb to about 7.4 Kb, about 5.9 Kb to about 7.4 Kb, about 6.0 Kb to about 7.4 Kb, about 6.1 Kb to about 7.4 Kb, about 6.2 Kb to about 7.4 Kb, about 6.3 Kb to about 7.4 Kb, about 6.4 Kb to about 7.4 Kb, about 6.5 Kb to about 7.4 Kb, about 6.6 Kb to about 7.4 Kb, about 6.7 Kb to about 7.4 Kb, about 6.8 Kb to about 7.4 Kb, about 6.9 Kb to about 7.4 Kb, about 7.0 Kb to about 7.4 Kb, about 7.1 Kb to about 7.4 Kb, about 7.2 Kb to about 7.4 Kb, about 7.3 Kb to about 7.4 Kb, about 3 Kb to about 7.2 Kb, about 3.1 Kb to about 7.2 Kb, about 3.2 Kb to about 7.2 Kb, about 3.3 Kb to about 7.2 Kb, about 3.4 Kb to about 7.2 Kb, about 3.5 Kb to about 7.2 Kb, about 3.6 Kb to about 7.2 Kb, about 3.7 Kb to about 7.2 Kb, about 3.8 Kb to about 7.2 Kb, about 3.9 Kb to about 7.2 Kb, about 4.0 Kb to about 7.2 Kb, about 4.1 Kb to about 7.2 Kb, about 4.2 Kb to about 7.2 Kb, about 4.3 Kb to about 7.2 Kb, about 4.4 Kb to about 7.2 Kb, about 4.5 Kb to about 7.2 Kb, about 4.6 Kb to about 7.2 Kb, about 4.7 Kb to about 7.2 Kb, about 4.8 Kb to about 7.2 Kb, about 4.9 Kb to about 7.2 Kb, about 5.0 Kb to about 7.2 Kb, about 5.1 Kb to about 7.2 Kb, about 5.2 Kb to about 7.2 Kb, about 5.3 Kb to about 7.2 Kb, about 5.4 Kb to about 7.2 Kb, about 5.5 Kb to about 7.2 Kb, about 5.6 Kb to about 7.2 Kb, about 5.7 40 13002505v1Docket No.: 2017359-0091 Kb to about 7.2 Kb, about 5.8 Kb to about 7.2 Kb, about 5.9 Kb to about 7.2 Kb, about 6.0 Kb to about 7.2 Kb, about 6.1 Kb to about 7.2 Kb, about 6.2 Kb to about 7.2 Kb, about 6.3 Kb to about 7.2 Kb, about 6.4 Kb to about 7.2 Kb, about 6.5 Kb to about 7.2 Kb, about 6.6 Kb to about 7.2 Kb, about 6.7 Kb to about 7.2 Kb, about 6.8 Kb to about 7.2 Kb, about 6.9 Kb to about 7.2 Kb, about 7.0 Kb to about 7.2 Kb, about 7.1 Kb to about 7.2 Kb, about 3 Kb to about 7.0 Kb, about 3.1 Kb to about 7.0 Kb, about 3.2 Kb to about 7.0 Kb, about 3.3 Kb to about 7.0 Kb, about 3.4 Kb to about 7.0 Kb, about 3.5 Kb to about 7.0 Kb, about 3.6 Kb to about 7.0 Kb, about 3.7 Kb to about 7.0 Kb, about 3.8 Kb to about 7.0 Kb, about 3.9 Kb to about 7.0 Kb, about 4.0 Kb to about 7.0 Kb, about 4.1 Kb to about 7.0 Kb, about 4.2 Kb to about 7.0 Kb, about 4.3 Kb to about 7.0 Kb, about 4.4 Kb to about 7.0 Kb, about 4.5 Kb to about 7.0 Kb, about 4.6 Kb to about 7.0 Kb, about 4.7 Kb to about 7.0 Kb, about 4.8 Kb to about 7.0 Kb, about 4.9 Kb to about 7.0 Kb, about 5.0 Kb to about 7.0 Kb, about 5.1 Kb to about 7.0 Kb, about 5.2 Kb to about 7.0 Kb, about 5.3 Kb to about 7.0 Kb, about 5.4 Kb to about 7.0 Kb, about 5.5 Kb to about 7.0 Kb, about 5.6 Kb to about 7.0 Kb, about 5.7 Kb to about 7.0 Kb, about 5.8 Kb to about 7.0 Kb, about 5.9 Kb to about 7.0 Kb, about 6.0 Kb to about 7.0 Kb, about 6.1 Kb to about 7.0 Kb, about 6.2 Kb to about 7.0 Kb, about 6.3 Kb to about 7.0 Kb, about 6.4 Kb to about 7.0 Kb, about 6.5 Kb to about 7.0 Kb, about 6.6 Kb to about 7.0 Kb, about 6.7 Kb to about 7.0 Kb, about 6.8 Kb to about 7.0 Kb, about 6.9 Kb to about 7.0 Kb, about 3 Kb to about 6.8 Kb, about 3.1 Kb to about 6.8 Kb, about 3.2 Kb to about 6.8 Kb, about 3.3 Kb to about 6.8 Kb, about 3.4 Kb to about 6.8 Kb, about 3.5 Kb to about 6.8 Kb, about 3.6 Kb to about 6.8 Kb, about 3.7 Kb to about 6.8 Kb, about 3.8 Kb to about 6.8 Kb, about 3.9 Kb to about 6.8 Kb, about 4.0 Kb to about 6.8 Kb, about 4.1 Kb to about 6.8 Kb, about 4.2 Kb to about 6.8 Kb, about 4.3 Kb to about 6.8 Kb, about 4.4 Kb to about 6.8 Kb, about 4.5 Kb to about 6.8 Kb, about 4.6 Kb to about 6.8 Kb, about 4.7 Kb to about 6.8 Kb, about 4.8 Kb to about 6.8 Kb, about 4.9 Kb to about 6.8 Kb, about 5.0 Kb to about 6.8 Kb, about 5.1 Kb to about 6.8 Kb, about 5.2 Kb to about 6.8 Kb, about 5.3 Kb to about 6.8 Kb, about 5.4 Kb to about 6.8 Kb, about 5.5 Kb to about 6.8 Kb, about 5.6 Kb to about 6.8 Kb, about 5.7 Kb to about 6.8 Kb, about 5.8 Kb to about 6.8 Kb, about 5.9 Kb to about 6.8 Kb, about 6.0 Kb to about 6.8 Kb, about 6.1 Kb to about 6.8 Kb, about 6.2 Kb to about 6.8 Kb, about 6.3 Kb to about 6.8 Kb, about 6.4 Kb to about 6.8 Kb, about 6.5 Kb to about 6.8 Kb, about 6.6 Kb to about 6.8 Kb, about 6.7 Kb to about 6.8 Kb, about 3 Kb to about 6.6 Kb, about 3.1 Kb to about 6.6 Kb, about 3.2 Kb to about 6.6 Kb, about 3.3 Kb to about 6.6 Kb, about 3.4 Kb to about 6.6 Kb, about 3.5 Kb to 41 13002505v1Docket No.: 2017359-0091 about 6.6 Kb, about 3.6 Kb to about 6.6 Kb, about 3.7 Kb to about 6.6 Kb, about 3.8 Kb to about 6.6 Kb, about 3.9 Kb to about 6.6 Kb, about 4.0 Kb to about 6.6 Kb, about 4.1 Kb to about 6.6 Kb, about 4.2 Kb to about 6.6 Kb, about 4.3 Kb to about 6.6 Kb, about 4.4 Kb to about 6.6 Kb, about 4.5 Kb to about 6.6 Kb, about 4.6 Kb to about 6.6 Kb, about 4.7 Kb to about 6.6 Kb, about 4.8 Kb to about 6.6 Kb, about 4.9 Kb to about 6.6 Kb, about 5.0 Kb to about 6.6 Kb, about 5.1 Kb to about 6.6 Kb, about 5.2 Kb to about 6.6 Kb, about 5.3 Kb to about 6.6 Kb, about 5.4 Kb to about 6.6 Kb, about 5.5 Kb to about 6.6 Kb, about 5.6 Kb to about 6.6 Kb, about 5.7 Kb to about 6.6 Kb, about 5.8 Kb to about 6.6 Kb, about 5.9 Kb to about 6.6 Kb, about 6.0 Kb to about 6.6 Kb, about 6.1 Kb to about 6.6 Kb, about 6.2 Kb to about 6.6 Kb, about 6.3 Kb to about 6.6 Kb, about 6.4 Kb to about 6.6 Kb, about 6.5 Kb to about 6.6 Kb, about 3 Kb to about 6.4 Kb, about 3.1 Kb to about 6.4 Kb, about 3.2 Kb to about 6.4 Kb, about 3.3 Kb to about 6.4 Kb, about 3.4 Kb to about 6.4 Kb, about 3.5 Kb to about 6.4 Kb, about 3.6 Kb to about 6.4 Kb, about 3.7 Kb to about 6.4 Kb, about 3.8 Kb to about 6.4 Kb, about 3.9 Kb to about 6.4 Kb, about 4.0 Kb to about 6.4 Kb, about 4.1 Kb to about 6.4 Kb, about 4.2 Kb to about 6.4 Kb, about 4.3 Kb to about 6.4 Kb, about 4.4 Kb to about 6.4 Kb, about 4.5 Kb to about 6.4 Kb, about 4.6 Kb to about 6.4 Kb, about 4.7 Kb to about 6.4 Kb, about 4.8 Kb to about 6.4 Kb, about 4.9 Kb to about 6.4 Kb, about 5.0 Kb to about 6.4 Kb, about 5.1 Kb to about 6.4 Kb, about 5.2 Kb to about 6.4 Kb, about 5.3 Kb to about 6.4 Kb, about 5.4 Kb to about 6.4 Kb, about 5.5 Kb to about 6.4 Kb, about 5.6 Kb to about 6.4 Kb, about 5.7 Kb to about 6.4 Kb, about 5.8 Kb to about 6.4 Kb, about 5.9 Kb to about 6.4 Kb, about 6.0 Kb to about 6.4 Kb, about 6.1 Kb to about 6.4 Kb, about 6.2 Kb to about 6.4 Kb, about 6.3 Kb to about 6.4 Kb, about 3 Kb to about 6.2 Kb, about 3.1 Kb to about 6.2 Kb, about 3.2 Kb to about 6.2 Kb, about 3.3 Kb to about 6.2 Kb, about 3.4 Kb to about 6.2 Kb, about 3.5 Kb to about 6.2 Kb, about 3.6 Kb to about 6.2 Kb, about 3.7 Kb to about 6.2 Kb, about 3.8 Kb to about 6.2 Kb, about 3.9 Kb to about 6.2 Kb, about 4.0 Kb to about 6.2 Kb, about 4.1 Kb to about 6.2 Kb, about 4.2 Kb to about 6.2 Kb, about 4.3 Kb to about 6.2 Kb, about 4.4 Kb to about 6.2 Kb, about 4.5 Kb to about 6.2 Kb, about 4.6 Kb to about 6.2 Kb, about 4.7 Kb to about 6.2 Kb, about 4.8 Kb to about 6.2 Kb, about 4.9 Kb to about 6.2 Kb, about 5.0 Kb to about 6.2 Kb, about 5.1 Kb to about 6.2 Kb, about 5.2 Kb to about 6.2 Kb, about 5.3 Kb to about 6.2 Kb, about 5.4 Kb to about 6.2 Kb, about 5.5 Kb to about 6.2 Kb, about 5.6 Kb to about 6.2 Kb, about 5.7 Kb to about 6.2 Kb, about 5.8 Kb to about 6.2 Kb, about 5.9 Kb to about 6.2 Kb, about 6.0 Kb to about 6.2 Kb, about 6.1 Kb to about 6.2 Kb, about 3 Kb to about 6.0 Kb, about 3.1 Kb to about 42 13002505v1Docket No.: 2017359-0091 6.0 Kb, about 3.2 Kb to about 6.0 Kb, about 3.3 Kb to about 6.0 Kb, about 3.4 Kb to about 6.0 Kb, about 3.5 Kb to about 6.0 Kb, about 3.6 Kb to about 6.0 Kb, about 3.7 Kb to about 6.0 Kb, about 3.8 Kb to about 6.0 Kb, about 3.9 Kb to about 6.0 Kb, about 4.0 Kb to about 6.0 Kb, about 4.1 Kb to about 6.0 Kb, about 4.2 Kb to about 6.0 Kb, about 4.3 Kb to about 6.0 Kb, about 4.4 Kb to about 6.0 Kb, about 4.5 Kb to about 6.0 Kb, about 4.6 Kb to about 6.0 Kb, about 4.7 Kb to about 6.0 Kb, about 4.8 Kb to about 6.0 Kb, about 4.9 Kb to about 6.0 Kb, about 5.0 Kb to about 6.0 Kb, about 5.1 Kb to about 6.0 Kb, about 5.2 Kb to about 6.0 Kb, about 5.3 Kb to about 6.0 Kb, about 5.4 Kb to about 6.0 Kb, about 5.5 Kb to about 6.0 Kb, about 5.6 Kb to about 6.0 Kb, about 5.7 Kb to about 6.0 Kb, about 5.8 Kb to about 6.0 Kb, about 5.9 Kb to about 6.0 Kb, about 3 Kb to about 5.8 Kb, about 3.1 Kb to about 5.8 Kb, about 3.2 Kb to about 5.8 Kb, about 3.3 Kb to about 5.8 Kb, about 3.4 Kb to about 5.8 Kb, about 3.5 Kb to about 5.8 Kb, about 3.6 Kb to about 5.8 Kb, about 3.7 Kb to about 5.8 Kb, about 3.8 Kb to about 5.8 Kb, about 3.9 Kb to about 5.8 Kb, about 4.0 Kb to about 5.8 Kb, about 4.1 Kb to about 5.8 Kb, about 4.2 Kb to about 5.8 Kb, about 4.3 Kb to about 5.8 Kb, about 4.4 Kb to about 5.8 Kb, about 4.5 Kb to about 5.8 Kb, about 4.6 Kb to about 5.8 Kb, about 4.7 Kb to about 5.8 Kb, about 4.8 Kb to about 5.8 Kb, about 4.9 Kb to about 5.8 Kb, about 5.0 Kb to about 5.8 Kb, about 5.1 Kb to about 5.8 Kb, about 5.2 Kb to about 5.8 Kb, about 5.3 Kb to about 5.8 Kb, about 5.4 Kb to about 5.8 Kb, about 5.5 Kb to about 5.8 Kb, about 5.6 Kb to about 5.8 Kb, about 5.7 Kb to about 5.8 Kb, about 3 Kb to about 5.6 Kb, about 3.1 Kb to about 5.6 Kb, about 3.2 Kb to about 5.6 Kb, about 3.3 Kb to about 5.6 Kb, about 3.4 Kb to about 5.6 Kb, about 3.5 Kb to about 5.6 Kb, about 3.6 Kb to about 5.6 Kb, about 3.7 Kb to about 5.6 Kb, about 3.8 Kb to about 5.6 Kb, about 3.9 Kb to about 5.6 Kb, about 4.0 Kb to about 5.6 Kb, about 4.1 Kb to about 5.6 Kb, about 4.2 Kb to about 5.6 Kb, about 4.3 Kb to about 5.6 Kb, about 4.4 Kb to about 5.6 Kb, about 4.5 Kb to about 5.6 Kb, about 4.6 Kb to about 5.6 Kb, about 4.7 Kb to about 5.6 Kb, about 4.8 Kb to about 5.6 Kb, about 4.9 Kb to about 5.6 Kb, about 5.0 Kb to about 5.6 Kb, about 5.1 Kb to about 5.6 Kb, about 5.2 Kb to about 5.6 Kb, about 5.3 Kb to about 5.6 Kb, about 5.4 Kb to about 5.6 Kb, about 5.5 Kb to about 5.6 Kb, about 3 Kb to about 5.4 Kb, about 3.1 Kb to about 5.4 Kb, about 3.2 Kb to about 5.4 Kb, about 3.3 Kb to about 5.4 Kb, about 3.4 Kb to about 5.4 Kb, about 3.5 Kb to about 5.4 Kb, about 3.6 Kb to about 5.4 Kb, about 3.7 Kb to about 5.4 Kb, about 3.8 Kb to about 5.4 Kb, about 3.9 Kb to about 5.4 Kb, about 4.0 Kb to about 5.4 Kb, about 4.1 Kb to about 5.4 Kb, about 4.2 Kb to about 5.4 Kb, about 4.3 Kb to about 5.4 Kb, about 4.4 Kb to about 5.4 Kb, about 4.5 Kb to about 5.4 43 13002505v1Docket No.: 2017359-0091 Kb, about 4.6 Kb to about 5.4 Kb, about 4.7 Kb to about 5.4 Kb, about 4.8 Kb to about 5.4 Kb, about 4.9 Kb to about 5.4 Kb, about 5.0 Kb to about 5.4 Kb, about 5.1 Kb to about 5.4 Kb, about 5.2 Kb to about 5.4 Kb, about 5.3 Kb to about 5.4 Kb, about 3 Kb to about 5.2 Kb, about 3.1 Kb to about 5.2 Kb, about 3.2 Kb to about 5.2 Kb, about 3.3 Kb to about 5.2 Kb, about 3.4 Kb to about 5.2 Kb, about 3.5 Kb to about 5.2 Kb, about 3.6 Kb to about 5.2 Kb, about 3.7 Kb to about 5.2 Kb, about 3.8 Kb to about 5.2 Kb, about 3.9 Kb to about 5.2 Kb, about 4.0 Kb to about 5.2 Kb, about 4.1 Kb to about 5.2 Kb, about 4.2 Kb to about 5.2 Kb, about 4.3 Kb to about 5.2 Kb, about 4.4 Kb to about 5.2 Kb, about 4.5 Kb to about 5.2 Kb, about 4.6 Kb to about 5.2 Kb, about 4.7 Kb to about 5.2 Kb, about 4.8 Kb to about 5.2 Kb, about 4.9 Kb to about 5.2 Kb, about 5.0 Kb to about 5.2 Kb, about 5.1 Kb to about 5.2 Kb, about 3 Kb to about 5.0 Kb, about 3.1 Kb to about 5.0 Kb, about 3.2 Kb to about 5.0 Kb, about 3.3 Kb to about 5.0 Kb, about 3.4 Kb to about 5.0 Kb, about 3.5 Kb to about 5.0 Kb, about 3.6 Kb to about 5.0 Kb, about 3.7 Kb to about 5.0 Kb, about 3.8 Kb to about 5.0 Kb, about 3.9 Kb to about 5.0 Kb, about 4.0 Kb to about 5.0 Kb, about 4.1 Kb to about 5.0 Kb, about 4.2 Kb to about 5.0 Kb, about 4.3 Kb to about 5.0 Kb, about 4.4 Kb to about 5.0 Kb, about 4.5 Kb to about 5.0 Kb, about 4.6 Kb to about 5.0 Kb, about 4.7 Kb to about 5.0 Kb, about 4.8 Kb to about 5.0 Kb, about 4.9 Kb to about 5.0 Kb, about 3 Kb to about 4.8 Kb, about 3.1 Kb to about 4.8 Kb, about 3.2 Kb to about 4.8 Kb, about 3.3 Kb to about 4.8 Kb, about 3.4 Kb to about 4.8 Kb, about 3.5 Kb to about 4.8 Kb, about 3.6 Kb to about 4.8 Kb, about 3.7 Kb to about 4.8 Kb, about 3.8 Kb to about 4.8 Kb, about 3.9 Kb to about 4.8 Kb, about 4.0 Kb to about 4.8 Kb, about 4.1 Kb to about 4.8 Kb, about 4.2 Kb to about 4.8 Kb, about 4.3 Kb to about 4.8 Kb, about 4.4 Kb to about 4.8 Kb, about 4.5 Kb to about 4.8 Kb, about 4.6 Kb to about 4.8 Kb, about 4.7 Kb to about 4.8 Kb, about 3 Kb to about 4.6 Kb, about 3.1 Kb to about 4.6 Kb, about 3.2 Kb to about 4.6 Kb, about 3.3 Kb to about 4.6 Kb, about 3.4 Kb to about 4.6 Kb, about 3.5 Kb to about 4.6 Kb, about 3.6 Kb to about 4.6 Kb, about 3.7 Kb to about 4.6 Kb, about 3.8 Kb to about 4.6 Kb, about 3.9 Kb to about 4.6 Kb, about 4.0 Kb to about 4.6 Kb, about 4.1 Kb to about 4.6 Kb, about 4.2 Kb to about 4.6 Kb, about 4.3 Kb to about 4.6 Kb, about 4.4 Kb to about 4.6 Kb, about 4.5 Kb to about 4.6 Kb, about 3 Kb to about 4.4 Kb, about 3.1 Kb to about 4.4 Kb, about 3.2 Kb to about 4.4 Kb, about 3.3 Kb to about 4.4 Kb, about 3.4 Kb to about 4.4 Kb, about 3.5 Kb to about 4.4 Kb, about 3.6 Kb to about 4.4 Kb, about 3.7 Kb to about 4.4 Kb, about 3.8 Kb to about 4.4 Kb, about 3.9 Kb to about 4.4 Kb, about 4.0 Kb to about 4.4 Kb, about 4.1 Kb to about 4.4 Kb, about 4.2 Kb to about 4.4 Kb, about 4.3 Kb to about 4.4 Kb, 44 13002505v1Docket No.: 2017359-0091 about 3 Kb to about 4.2 Kb, about 3.1 Kb to about 4.2 Kb, about 3.2 Kb to about 4.2 Kb, about 3.3 Kb to about 4.2 Kb, about 3.4 Kb to about 4.2 Kb, about 3.5 Kb to about 4.2 Kb, about 3.6 Kb to about 4.2 Kb, about 3.7 Kb to about 4.2 Kb, about 3.8 Kb to about 4.2 Kb, about 3.9 Kb to about 4.2 Kb, about 4.0 Kb to about 4.2 Kb, about 4.1 Kb to about 4.2 Kb, about 3 Kb to about 4.0 Kb, about 3.1 Kb to about 4.0 Kb, about 3.2 Kb to about 4.0 Kb, about 3.3 Kb to about 4.0 Kb, about 3.4 Kb to about 4.0 Kb, about 3.5 Kb to about 4.0 Kb, about 3.6 Kb to about 4.0 Kb, about 3.7 Kb to about 4.0 Kb, about 3.8 Kb to about 4.0 Kb, about 3.9 Kb to about 4.0 Kb, about 3 Kb to about 3.8 Kb, about 3.1 Kb to about 3.8 Kb, about 3.2 Kb to about 3.8 Kb, about 3.3 Kb to about 3.8 Kb, about 3.4 Kb to about 3.8 Kb, about 3.5 Kb to about 3.8 Kb, about 3.6 Kb to about 3.8 Kb, about 3.7 Kb to about 3.8 Kb, about 3 Kb to about 3.6 Kb, about 3.1 Kb to about 3.6 Kb, about 3.2 Kb to about 3.6 Kb, about 3.3 Kb to about 3.6 Kb, about 3.4 Kb to about 3.6 Kb, about 3.5 Kb to about 3.6 Kb, about 3 Kb to about 3.4 Kb, about 3.1 Kb to about 3.4 Kb, about 3.2 Kb to about 3.4 Kb, about 3.3 Kb to about 3.4 Kb, about 3 Kb to about 3.2 Kb, or about 3.1 Kb to about 3.2 Kb.

[0125] In some embodiments, a transgene construct of the present disclosure comprises single-stranded DNA. In some embodiments, a transgene construct of the present disclosure comprises double-stranded DNA. In some embodiments, a transgene construct of the present disclosure is linear. In some embodiments, a transgene construct of the present disclosure is a circularized plasmid.

[0126] Methods for cloning and propagating constructs (e.g., polynucleotide constructs) are known in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., which is incorporated in its entirety herein by reference). A. Expression Cassette 1. Inverted Terminal Repeat Sequences (ITRs)

[0127] Expression cassette sequences of a transgene construct described herein may comprise cis-acting 5ˈ and 3ˈ ITR sequences (See, e.g., B. J. Carter, in “Handbook of Parvoviruses,” ed., P. Tijsser, CRC Press, pp.155168 (1990), which is incorporated in its entirety herein by reference). In some embodiments, ITR sequences are about 145 nt in length. For example, wild type Adeno-Associated Virus 2 (AAV2) ITRs are generally about 145 nt in 45 13002505v1Docket No.: 2017359-0091 length. In some embodiments, substantially the entire sequences encoding ITRs are present in a transgene construct disclosed herein, although some degree of minor modification of these sequences is permissible. The ability to modify ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al. “Molecular Cloning. A Laboratory Manual,” 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520532 (1996), each of which is incorporated in its entirety herein by reference). An example of such a molecule employed in the present disclosure is a “cis-acting” construct comprising a heterologous nucleic acid comprising a transgene encoding a therapeutic polypeptide, in which such a transgene and its associated regulatory elements are flanked by 5ˈ or “left” and 3ˈ or “right” AAV ITR sequences. 5ˈ and left designations refer to a position of an ITR sequence relative to an entire construct, read left to right, in a sense direction. For example, in some embodiments, a 5ˈ or left ITR is an ITR that is closest to a promoter (as opposed to a polyadenylation sequence) for a given construct, when a construct is depicted in a sense orientation, linearly. 3ˈ and right designations refer to a position of an ITR sequence relative to an entire construct, read left to right, in a sense direction. For example, in some embodiments, a 3ˈ or right ITR is an ITR that is closest to a polyadenylation sequence (as opposed to a promoter sequence) for a given construct, when a construct is depicted in a sense orientation, linearly. ITRs as provided herein are described in 5ˈ to 3ˈ order in accordance with a sense strand. Accordingly, one of skill in the art will appreciate that a 5ˈ or “left” orientation ITR can also be depicted as a 3ˈ or “right” ITR when converting from sense to antisense direction. Further, it is well within the ability of one of skill in the art to transform a given sense ITR sequence (e.g., a 5ˈ / left AAV ITR) into an antisense sequence (e.g., 3ˈ / right ITR sequence). Accordingly, based upon known AAV ITRs one of skill in the art would understand, in looking at sequences disclosed herein, whether an ITR was in a sense or antisense orientation and whether it would go on a “left” or “right” side of a construct, whether or not it is explicitly labeled as such. In some embodiments, a given ITR sequence for use as either a 5ˈ / left or 3ˈ / right ITR, or an antisense version thereof can be modified.

[0128] ITR sequences may be obtained from any known virus. In some embodiments, an ITR is or comprises 145 nucleotides. In some embodiments an ITR is a wild-type AAV2 ITR. In some embodiments an ITR is derived from a wild-type AAV2 ITR and includes one or more modifications, e.g., truncations, deletions, substitutions or insertions as is known in the art. In 46 13002505v1Docket No.: 2017359-0091 some embodiments, an ITR comprises fewer than 145 nucleotides, e.g., 119, 127, 130, 134 or 141 nucleotides. For example, in some embodiments, an ITR comprises 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 ,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143144, or 145 nucleotides.

[0129] In some embodiments, an ITR comprises (a) a dependoparvovirus ITR (b) an AAV ITR, optionally an AAV2 ITR, (c) a bocaparvovirus ITR, (d) a protoparvovirus ITR, (e) a tetraparvovirus ITR, copiparvovirus ITR, or (f) an erythroparvovirus ITR. In some embodiments, an ITR is a terminal palindrome with Rep binding elements and terminal resolution site (trs) that is structurally similar to the wild-type ITR. In some embodiments, an ITR, is from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, an ITR has the AAV2 RBE and trs. In some embodiments, an ITR is a chimera of different AAVs. In some embodiments, an ITR and a Rep protein are from AAV5. In some embodiments, an ITR is synthetic and is comprised of RBE motifs and a terminal resolution site (trs), e.g., GGTTGG, AGTTGG, AGTTGA, or RRTTRR. A typical T-shaped structure of a terminal palindrome consisting of B / B’ and C / C’ stems may also be synthetically modified with substitutions and insertions that maintain the overall secondary structure based on folding prediction (available at URL (http) of unafold.rna.albany.edu / ?q=mfold / DNA-Folding-Form). The stability of the ITR secondary structure is designated by the Gibbs free energy, delta G, with lower values, i.e., more negative, indicating greater stability. The full-length, 145nt ITR has a computed ΔG = -69.91 kcal / mol. The B and C stems: GCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCG (SEQ ID NO: 1) have ΔG = -22.44 kcal / mol. Substitutions and insertions that result in a structure with ΔG = -15 kcal / mol to -30 kcal / mol are functionally equivalent and not distinct from the wild-type dependoparvovirus ITRs.

[0130] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a 5ˈ ITR having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2. In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a 3ˈ ITR having a nucleotide sequence at least 80%, at least 85%, at least 47 13002505v1Docket No.: 2017359-0091 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3. In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a 5ˈ ITR having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2, and a 3ˈ ITR having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3. TABLE 1: Exemplary Transgene Construct ITR Sequences ITR Sequence Nucleotide Sequence ˈ C G G G2. Transgene

[0131] Among other things, the present disclosure provides a transgene construct (e.g., polynucleotide transgene construct) comprising an expression cassette, wherein the expression cassette comprises a heterologous transgene that encodes a therapeutic polypeptide. In some embodiments, the expression cassette comprises one or more elements that promotes the expression of a therapeutic polypeptide encoded by the heterologous transgene, when the construct is introduced (e.g., transduced via a virion) into a cell.

[0132] In some embodiments, a therapeutic polypeptide is a protein channel, cell surface protein, receptor, toxin, hormone, enzyme, cytokine, antibody or fragment thereof. In some embodiments, a heterologous transgene in a construct disclosed herein encodes any therapeutic polypeptide of which expression in a cell is desired, including, but not limited protein channels, 48 13002505v1Docket No.: 2017359-0091 cell surface proteins, receptors, hormones, enzymes, cytokines, antibodies, or functional fragments of any of the above.

[0133] In some embodiments, a heterologous transgene encodes a therapeutic polypeptide that is lacking or non-functional in a subject having a disease, including but not limited to any of the diseases described herein. In some embodiments, a disease is a genetic disease.

[0134] In some embodiments, a heterologous transgene as described herein encodes a therapeutic polypeptide for use in methods of preventing or treating one or more genetic deficiencies or dysfunctions in a mammal, such as for example, a polypeptide deficiency or polypeptide excess in a mammal, and particularly for preventing, treating or reducing the severity or extent of deficiency in a human manifesting one or more of the disorders linked to a deficiency in such polypeptides in cells and tissues. In some embodiments, a method involves administration of a transgene that encodes one or more therapeutic polypeptides, peptides siRNAs, microRNAs, antisense nucleotides, etc. packaged in a virion described herein, preferably in a pharmaceutically acceptable composition, to a subject in an amount and for a period of time sufficient to prevent or treat the deficiency or disorder in a subject suffering from such a disorder.

[0135] Thus, in some embodiments, heterologous transgenes of constructs of the present disclosure can encode one or more therapeutic polypeptides, proteins, or peptides, which are useful for the treatment or prevention of a disease in a mammalian subject (e.g., a human subject).

[0136] Exemplary transgenes for use in constructs and methods as disclosed herein include but are not limited to, polynucleotides encoding: cystic fibrosis transmembrane conductance regulator (CFTR), CNTF, BDNF, CSF, EGF, FGF, G-SCF, GM-CSF, gonadotropin, IFN, IFG-1, M-CSF, NGF, PDGF, PEDF, TGF, VEGF, TGF-B2, TNF, prolactin, somatotropin, XIAP1, IL- 1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL- 10, IL- 10(187A), viral IL- 10, IL- 11, IL- 12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, VEGF, FGF, SDF-1, connexin 40, connexin 43, SCN4a, HIFia, SERCa2a, ADCYl, ADCY6, mammalian β globin (e.g., HBA1, HBA2, HBB, HBG1, HBG2, HBD, HBE1, and / or HBZ), alpha-hemoglobin stabilizing protein (AHSP), B- cell lymphoma / leukemia 11A (BCL11A), Kruppel-like factor 1 (KLF1), CCR5, 49 13002505v1Docket No.: 2017359-0091 CXCR4, PPP1R12C (AAVS1), hypoxanthine phosphoribosyltransferase (HPRT), albumin, Factor VIII, Factor IX, Leucine-rich repeat kinase 2 (LRRK2), Huntingtin (HTT), rhodopsin (RHO), F8 or a fragment thereof (e.g., fragment encoding B-domain deleted polypeptide (e.g., VIII SQ, p-VIII)), surfactant protein B (SFTPB), T-cell receptor alpha (TRAC), T-cell receptor beta (TRBC), programmed cell death 1 (PD1), Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4), human leukocyte antigen (HLA) A, HLA B, HLA C, HLA-DPA, HLA-DQ, HLA-DRA, LMP7, Transporter associated with Antigen Processing (TAP) 1, TAP2, tapasin (TAPBP), class II major histocompatibility complex transactivator (CUT A), dystrophin (DMD), glucocorticoid receptor (GR), IL2RG, RFX5, FAD2, FAD3, ZP15, KASII, MDH, or EPSPS.

[0137] In some embodiments, a heterologous transgene for use in a construct disclosed herein can be incorporated into a virion capsid, wherein the virion can be used to restore the expression of genes that are reduced in expression, silenced, or otherwise dysfunctional in a subject. (i) Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)

[0138] In some embodiments, a dysfunctional gene in a subject is CFTR. In some embodiments, one or more CFTR allele in a subject comprises a mutation selected from ΔF508, R553X, R74W, R668C, S977F, L997F, K1060T, A1067T, R1070Q, R1066H, T3381, R334W, G85E, A46D, I336K, H1054D, M1V, E92K, V520F, H1085R, R560T, L927P, R560S, N1303K, M1101K, L1077P, R1066M, R1066C, L1065P, Y569D, A561E, A559T, S492F, L467P, R347P, S341P, I507del, G1061R, G542X, W1282X, and 2184InsA.

[0139] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising a CFTR transgene. In some embodiments, a CFTR transgene encodes a CFTR polypeptide, or functional fragment thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 2.

[0140] In some embodiments, a CFTR transgene encodes a CFTR polypeptide, or functional fragment thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 4. 50 13002505v1Docket No.: 2017359-0091

[0141] In some embodiments, a CFTR transgene encodes a CFTR polypeptide, or functional fragment thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 5.

[0142] In some embodiments, a CFTR transgene encodes a CFTR polypeptide, or functional fragment thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 6.

[0143] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising a polynucleotide having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7.

[0144] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide sequence that is human codon-optimized. In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide sequence that is CpG depleted. In some embodiments, an expression cassette of a construct of the present disclosure comprises a polynucleotide sequence that is human codon- optimized and CpG depleted.

[0145] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 8.

[0146] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 9. 51 13002505v1Docket No.: 2017359-0091

[0147] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 3. TABLE 2: Exemplary CFTR Amino Acid Sequences CFTR Sequence Amino Acid Sequence (SEQ ID NO) D F V G A E Q T I E L L AI R L T I R S I G Q L L52 13002505v1Docket No.: 2017359-0091 CFTR Sequence Amino Acid Sequence (SEQ ID NO) S D F V G A E Q T I E L L AI R M A G E I Q W R L K D F V G A E13002505v1Docket No.: 2017359-0091 CFTR Sequence Amino Acid Sequence (SEQ ID NO) Q T I E L D L AI R M L A G E I Q W R L Q KTABLE 3: Exemplary CFTR Nucleotide Sequences CFTR Sequence Nucleotide Sequence A A C A T G A T13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) C T C G G G T A T A G A G C A C T T G T T T13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) G T G A G T A C A A T G T T T G T A T T G T T T A T G T13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) A T A T C A A A C G C C C G C C T T A T G T G13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) G A A G G A A C C A C A A G T C T A T G13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) C A G G T G C G T T A A A A C G C C13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) C G C C T T A T G T G G A A A G G A A C C A13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) C A A G T C T A T G C A G G T G C G T13002505v1Docket No.: 2017359-0091 CFTR Sequence Nucleotide Sequence (SEQ ID NO) T A(ii) Other Transgenes

[0148] In some embodiments, a dysfunctional gene in a subject is a tumor suppressor that has been silenced in a subject having cancer. In some embodiments, a dysfunctional gene in a subject is an oncogene that is aberrantly expressed in a subject having a cancer. Exemplary genes associated with cancer (oncogenes and tumor suppressors) include, but are not limited to: AARS, ABCB 1, ABCC4, ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXAS, ANXA7, AP2Ml, APC, ARHGAPS, ARHGEFS, ARID4A, ASNS, ATF4, ATM, ATPSB, ATPSO, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1, CCND2, CCND3, CCNE1, CCTS, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2LS, CDK10, CDK4, CDK5, CDK9, CDKL1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLK3, CLNS1A, CLTC, COL1A1, COL6A3, COX6C, COX7A2, CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1, CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL1, DVL3, E2F1, E2F3, E2F5, EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK, FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS, FOSL1, FOSL2, FOXG1A, FOXO1A, FRAP1, FRZB, FTL, FZD2, FZDS, FZD9, G22P1, GAS6, GCNSL2, GDF1S, GNA13, GNAS, GNB2, GNB2Ll, GPR39, GRB2, GSK3A, GSPT1, GTF21, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPAS, HSPA8, HSPB1, HSPH1, HYAL1, HYOU1, ICAM1, ID1, ID2, IDUA, IER3, IFITM1, IGF1R, IGF2R, IGFBP3, IGFBP4, IGFBPS, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4, JAK1, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, 62 13002505v1Docket No.: 2017359-0091 KITLG, KLK10, KPNA2, KRAS2, KRT18, KRT2A, KRT9, LAMB1, LAMP2, LCK, LCN2, LEP, LITAF, LRPAP1, LTF, LYN, LZTR1, MADH1, MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPRE1, MARS, MAS1, MCC, MCM2, MCM4, MDM2, MDM4, MET, MGST1, MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCLI, MYCN, MYD88, MYL9, MYLK, NEO1, NF1, NF2, NFKB I, NFKB2, NFSF7, NID, NINJ1, NMBR, NME1, NME2, NME3, NOTCH 1, NOTCH2, NOTCH4, NPM1, NQO1, NRlD1, NR2Fl, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4, PABPC1, PCNA, PCTK1, PCTK2, PCTK3, PDGFA, PDGFB, PDGFRA, PDPK1, PEAl5, PFDN4, PFDN5, PGAM1, PHB, PIK3CA, PIK3CB, PIK3CG, PIM1, PKM2, PKMYT1, PLK2, PPARD, PPARG, PPIH, PPP1CA, PPP2RSA, PRDX2, PRDX4, PRKAR1A, PRKCBP1, PRNP, PRSS15, PSMA1, PTCH, PTEN, PTGS1, PTMA, PTN, PTPRN, RABSA, RAC1, RADSO, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRF1, RB1, RBBP4, RBL2, REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6KB 1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA, SIVA TP53, SKI, SKIL, SLC16A1, SLC1A4, SLC20Al, SMO, SMPD1, SNAI2, SND1, SNRPB2, SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2, STAT3, STAT5B, STC1, TAF1, TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFB1, TGFBR1, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1, TK1, TLE1, TNF, TNFRSF10A, TNFRSF10B, TNFRSF1A, TNFRSF1B, TNFRSF6, TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP5313, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYR03, UBC, UBE2L6, UCHL1, USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2, WNT2B, WNT3, WNTSA, WT1, XRCC 1, YES 1, YWHAB, YWHAZ, ZAP70, and ZNF9. 3. Transgene Promoter Sequences

[0149] In some embodiments, a heterologous transgene is operably linked to a promoter (e.g., a transgene promoter). In some embodiments, a transgene promoter is an inducible promoter, a constitutive promoter, a mammalian cell promoter, a viral promoter, a chimeric promoter, an engineered promoter, a tissue-specific promoter, or any other type of promoter known in the art. 63 13002505v1Docket No.: 2017359-0091

[0150] In some embodiments, a heterologous transgene is operably linked to a chicken β- actin promoter. In some embodiments, a heterologous transgene is operably linked to a promoter derived from a wild-type chicken β-actin promoter. In some embodiments, a heterologous transgene is operably linked to a promoter having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 10.

[0151] In some embodiments, a heterologous transgene is operably linked to a tissue- specific promoter. In some embodiments, a heterologous transgene is operably linked to a lung- specific promoter.

[0152] In some embodiments, a promoter is an RNA polymerase II promoter, such as a mammalian RNA polymerase II promoter. In some embodiments, a promoter is an RNA polymerase III promoter, including, but not limited to, a HI promoter, a human U6 promoter, a mouse U6 promoter, or a swine U6 promoter.

[0153] In some embodiments, a promoter can be a transgene promoter that, in its endogenous context, is associated with a gene in the CRISPR / Cas system. For example, in some embodiments, a promoter can be a Cas gene promoter. In some embodiments, a transgene promoter can be a Cas9 promoter.

[0154] A variety of promoters is known in the art, any of which can be used herein. Non- limiting examples of promoters that can be used herein include promoters for: human elongation factor 1α-subunit (EF1a) (Liu et al. (2007) Exp. Mol. Med.39(2): 170-175; Accession No. J04617.1; Gill et al., Gene Ther.8(20):1539-1546, 2001; Xu et al., Human Gene Ther.12(5):563- 573, 2001; Xu et al., Gene Ther.8:1323-1332; Ikeda et al., Gene Ther.9:932-938, 2002; Gilham et al., J. Gene Med.12(2):129-136, 2010, each of which is incorporated in its entirety herein by reference), cytomegalovirus (Xu et al., Human Gene Ther.12(5):563-573, 2001; Xu et al., Gene Ther.8:1323-1332; Gray et al., Human Gene Ther.22:1143-1153, 2011, each of which is incorporated in its entirety herein by reference), human immediate-early cytomegalovirus (CMV) (US Patent No.5,168,062, Liu et al. (2007) Exp. Mol. Med.39(2): 170-175; Accession No. X17403.1 or KY490085.1, each of which is incorporated in its entirety herein by reference), human ubiquitin C (UBC) (Gill et al., Gene Ther.8(20):1539-1546, 2001; Qin et al., PLoS One 64 13002505v1Docket No.: 2017359-0091 5(5):e10611, 2010, each of which is incorporated in its entirety herein by reference), mouse phosphoglycerate kinase 1, polyoma adenovirus, simian virus 40 (SV40), β-globin, β-actin, α- fetoprotein, γ-globin, β-interferon, γ-glutamyl transferase, mouse mammary tumor virus (MMTV), Rous sarcoma virus, rat insulin, glyceraldehyde-3-phosphate dehydrogenase, metallothionein II (MT II), amylase, cathepsin, MI muscarinic receptor, retroviral LTR (e.g., human T-cell leukemia virus HTLV, each of which is incorporated in its entirety herein by reference), AAV ITR, interleukin-2, collagenase, platelet-derived growth factor, adenovirus 5 E2, stromelysin, murine MX gene, glucose regulated proteins (GRP78 and GRP94), α-2- macroglobulin, vimentin, MHC class I gene H-2κ b, HSP70, proliferin, tumor necrosis factor, thyroid stimulating hormone α gene, immunoglobulin light chain, T-cell receptor, HLA DQα and DQβ, interleukin-2 receptor, MHC class II, MHC class II HLA-DRα, muscle creatine kinase, prealbumin (transthyretin), elastase I, albumin gene, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), H2B (TH2B) histone, rat growth hormone, human serum amyloid (SAA), troponin I (TN I), duchenne muscular dystrophy, human immunodeficiency virus, Gibbon Ape Leukemia Virus (GALV) promoters, promoter of HNRPA2B1-CBX1 (UCOE) (Powell and Gray (2015) Discov. Med.19(102): 49-57; Antoniou et al., Human Gene Ther.24(4):363-374, 2013), β-glucuronidase (GUSB) (Husain et al., Gene Ther.16:927-932, 2009), chicken β-actin (CBA) (Liu et al. (2007) Exp. Mol. Med.39(2): 170-175; Stone et al. (2005) Mol. Ther.11(6): 843-848; Klein et al., Exp. Neurol.176(1):66-74, 2002; Ohlfest et al., Blood 105:2691-2698, 2005; Gray et al., Human Gene Ther.22:1143-1153, 2011, each of which is incorporated in its entirety herein by reference), a human β-actin promoter (HBA) (Accession No. Y00474.1), murine myosin VIIA (musMyo7) (Boeda et al. (2001) Hum. Mol. Genet.10(15): 1581-1589; Accession No. AF384559.1, each of which is incorporated in its entirety herein by reference), human myosin VIIA (hsMyo7) (Boeda et al. (2001) Hum. Mol. Genet.10(15): 1581-1589; Accession No. NG_009086.1, each of which is incorporated in its entirety herein by reference), murine poly(ADP-ribose) polymerase 2 (musPARP2) (Ame et al. (2001) J. Biol. Chem.276(14): 11092- 11099; Accession No. AF191547.1, each of which is incorporated in its entirety herein by reference), human poly(ADP-ribose) polymerase 2 (hsPARP2) (Ame et al. (2001) J. Biol. Chem. 276(14): 11092-11099; Accession No. X16612.1 or AF479321.1, each of which is incorporated in its entirety herein by reference), acetylcholine receptor epsilon-subunit (AChε) (Duclert et al., (1993) PNAS 90(7): 3043-3047; Accession No. S58221.1 or CR933736.12, each of which is 65 13002505v1Docket No.: 2017359-0091 incorporated in its entirety herein by reference), Rous sarcoma virus (RSV) (Liu et al. (2007) Exp. Mol. Med.39(2): 170-175; Accession No. M77786.1, each of which is incorporated in its entirety herein by reference), (GFAP) (Liu et al. (2007) Exp. Mol. Med.39(2): 170-175; Stone et al. (2005) Mol. Ther.11(6): 843-848; Accession No. NG_008401.1 or M67446.1, each of which is incorporated in its entirety herein by reference), hAAT (Van Linthout et al., Human Gene Ther. 13(7):829-840, 2002; Cunningham et al., Mol. Ther.16(6):1081-1088, 2008, each of which is incorporated in its entirety herein by reference), and a CBA hybrid (CBh) (Gray et al. (2011) Hum. Gen. Therapy 22: 1143-1153; Accession No. KF926476.1 or KC152483.1, each of which is incorporated in its entirety herein by reference). Additional examples of promoters are known in the art. See, e.g., Lodish, Molecular Cell Biology, Freeman and Company, New York 2007. The contents of each of these references are incorporated by reference in its entirety.

[0155] In some embodiments, a promoter is a CMV immediate early promoter.

[0156] In some embodiments, a promoter is a CAG promoter or a CAG / CBA promoter.

[0157] The term “constitutive” promoter refers to a nucleotide sequence that, when operably linked with a gene (e.g., a transgene) encoding a polypeptide (e.g., a therapeutic polypeptide), actively and continuously promotes gene expression.

[0158] Examples of constitutive promoters include, without limitation, a retroviral Rous sarcoma virus (RSV) LTR promoter, a cytomegalovirus (CMV) promoter (see, e.g., Boshart et al. Cell 41:521-530, 1985, which is incorporated in its entirety herein by reference), an SV40 promoter, a dihydrofolate reductase promoter, a beta-actin promoter, a phosphoglycerol kinase (PGK) promoter, and an EF1-alpha promoter (Invitrogen).

[0159] In some embodiments, a promoter is an inducible promoter. In some embodiments, an inducible promoter allows regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or presence of a specific physiological state, e.g., acute phase, a particular functional or biological state of a cell, e.g., a particular differentiation state of a cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech, and Ariad. Additional examples of inducible promoters are known in the art. 66 13002505v1Docket No.: 2017359-0091

[0160] Examples of inducible transgene promoters regulated by exogenously supplied compounds include a zinc-inducible sheep metallothionine (MT) promoter, a dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, a T7 polymerase promoter system (WO 98 / 10088, which is incorporated in its entirety herein by reference); an ecdysone insect promoter (No et al. Proc. Natl. Acad. Sci. U.S.A.93:3346-3351, 1996, which is incorporated in its entirety herein by reference), a tetracycline-repressible system (Gossen et al. Proc. Natl. Acad. Sci. U.S.A.89:5547-5551, 1992, which is incorporated in its entirety herein by reference), a tetracycline-inducible system (Gossen et al. Science 268:1766-1769, 1995, see also Harvey et al. Curr. Opin. Chem. Biol.2:512-518, 1998, each of which is incorporated in its entirety herein by reference), an RU486-inducible system (Wang et al. Nat. Biotech.15:239-243, 1997; and Wang et al. Gene Ther.4:432-441, 1997, each of which is incorporated in its entirety herein by reference), and a rapamycin-inducible system (Magari et al. J. Clin. Invest.100:2865- 2872, 1997, which is incorporated in its entirety herein by reference).

[0161] In some embodiments, regulatory sequences impart tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue-specific manner.

[0162] The term “tissue-specific” promoter refers to a promoter that is active only in certain specific cell types and / or tissues (e.g., transcription of a specific gene occurs only within cells expressing transcription regulatory and / or control proteins that bind to the tissue-specific promoter).

[0163] In some embodiments, a provided transgene construct of the present disclosure comprises a promoter sequence selected from a CBA, a CAG, a CMV, or a CB7 promoter. TABLE 4: Exemplary Construct Promoter Sequences Promoter Nucleotide Sequence G T13002505v1Docket No.: 2017359-0091 Promoter Nucleotide Sequence (SEQ ID NO) G C T4. Polyadenylation Signal

[0164] In some embodiments, a transgene construct disclosed herein comprises an expression cassette comprising a polyadenylation signal. In some embodiments, a polyadenylation signal is operably linked to the 3ˈ end of a transgene. In some embodiments, a polyadenylation signal is situated downstream of a 3' untranslated region (UTR), e.g., adjacent to a 3' UTR.

[0165] As used herein, the term “polyadenylation signal”, or “poly(A) signal” refers to a sequence that signals the introduction of an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3' end of an RNA polynucleotide. Polyadenylation signals may be immediately 3ˈ to a transgene sequence or follow a 3ˈ UTR.

[0166] In some embodiments, a polyadenylation signal of the present disclosure, signals the introduction of about 10 to about 150, about 20 to about 150, about 30 to about 150, about 40 to about 150, about 50 to about 150, about 60 to about 150, about 70 to about 150, about 80 to about 150, about 90 to about 150, about 100 to about 150, about 110 to about 150, about 120 to about 150, about 130 to about 150, about 140 to about 150, about 10 to about 140, about 20 to about 140, about 30 to about 140, about 40 to about 140, about 50 to about 140, about 60 to about 140, about 70 to about 140, about 80 to about 140, about 90 to about 140, about 100 to about 140, about 110 to about 140, about 120 to about 140, about 130 to about 140, about 10 to about 130, about 20 to about 130, about 30 to about 130, about 40 to about 130, about 50 to about 130, about 60 to about 130, about 70 to about 130, about 80 to about 130, about 90 to about 130, about 100 to about 130, about 110 to about 130, about 120 to about 130, about 10 to about 120, about 20 to about 120, about 30 to about 120, about 40 to about 120, about 50 to about 120, about 60 to about 120, about 70 to about 120, about 80 to about 120, about 90 to 68 13002505v1Docket No.: 2017359-0091 about 120, about 100 to about 120, about 110 to about 120, about 10 to about 110, about 20 to about 110, about 30 to about 110, about 40 to about 110, about 50 to about 110, about 60 to about 110, about 70 to about 110, about 80 to about 110, about 90 to about 110, about 100 to about 110, about 10 to about 100, about 20 to about 100, about 30 to about 100, about 40 to about 100, about 50 to about 100, about 60 to about 100, about 70 to about 100, about 80 to about 100, about 90 to about 100, about 10 to about 90, about 20 to about 90, about 30 to about 90, about 40 to about 90, about 50 to about 90, about 60 to about 90, about 70 to about 90, about 80 to about 90, about 10 to about 80, about 20 to about 80, about 30 to about 80, about 40 to about 80, about 50 to about 80, about 60 to about 80, about 70 to about 80, about 10 to about 70, about 20 to about 70, about 30 to about 70, about 40 to about 70, about 50 to about 70, about 60 to about 70, about 10 to about 60, about 20 to about 60, about 30 to about 60, about 40 to about 60, about 50 to about 60, about 10 to about 50, about 20 to about 50, about 30 to about 50, about 40 to about 50, about 10 to about 40, about 20 to about 40, about 30 to about 40, about 10 to about 30, about 20 to about 30, or about 10 to about 20 A nucleotides to the 3' end of an RNA polynucleotide.

[0167] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising a polyadenylation signal having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 12. TABLE 5: Exemplary Polyadenylation Signal Sequences Polyadenylation Nucleotide Sequence C T69 13002505v1Docket No.: 2017359-0091 5. Enhancers

[0168] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising an enhancer sequence. In some embodiments, an enhancer is a nucleotide sequence that can increase a level of transcription of a nucleic acid encoding a polypeptide of interest (e.g., a transgene). In some embodiments, enhancer sequences (50-1500 base pairs in length) generally increase a level of transcription by providing additional binding sites for transcription-associated proteins (e.g., transcription factors). In some embodiments, an enhancer sequence is found within an intronic sequence. Unlike promoter sequences, enhancer sequences can act at much larger distances away from a transcription start site (e.g., as compared to a promoter). Non-limiting examples of enhancers include, but are not limited to, a CMV enhancer, an RSV enhancer, and a SV40 enhancer. An example of a CMV enhancer is described in, e.g., Boshart et al., Cell 41(2):521-530, 1985, which is incorporated in its entirety herein by reference.

[0169] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising a CMV enhancer. In some embodiments, a transgene construct of the present disclosure comprises an expression cassette comprising an enhancer having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 14. TABLE 6: Exemplary Construct Enhancer Sequences Enhancer Nucleotide Sequence C T T T G0 13002505v1Docket No.: 2017359-0091 Enhancer Nucleotide Sequence (SEQ ID NO) C A G C A6. Additional Sequences

[0170] In some embodiments, a transgene construct described herein comprises an expression cassette that can further include one or more control sequence, e.g., a control sequence selected from the group of a transcription initiation sequence, a transcription termination sequence, a promoter sequence, an enhancer sequence, an RNA splicing sequence, locus control region, a polyadenylation (polyA) sequence, a Kozak consensus sequence, and / or additional untranslated regions which may house pre- or post-transcriptional regulatory and / or control elements. In some embodiments, a promoter can be a native promoter, a constitutive promoter, an inducible promoter, and / or a tissue-specific promoter.

[0171] In some embodiments, transgene constructs of the present disclosure may comprise an expression cassette incorporating a T2A element or sequence. In some embodiments, transgene constructs of the present disclosure may include expression cassettes having one or more cloning sites. In some such embodiments, cloning sites may not be fully removed prior to manufacturing for administration to a subject. (i) Untranslated Regions (UTRs)

[0172] In some embodiments, a transgene construct described herein can include an expression cassette having one or more untranslated regions. In some embodiments, an 71 13002505v1Docket No.: 2017359-0091 expression cassette can include a 5ˈ UTR and / or a 3ˈ UTR sequence. In some embodiments, if more than one UTR is present, UTRs may come from a single gene or more than one gene.

[0173] A UTR of a gene is transcribed but not translated. In some embodiments, a 5ˈ UTR sequence starts at a transcription start site and continues to a translation initiation codon sequence but does not include that translation initiation codon sequence. In some embodiments, a 3ˈ UTR starts immediately following a stop codon and continues until a transcriptional termination signal. In some embodiments, a UTR may modulate the stability of nucleic acid molecules and translation. In some embodiments, regulatory features of a UTR can be incorporated into a construct, composition, kit, or method as described herein to, e.g., enhance stability of a protein.

[0174] For example, in some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a 5ˈ UTR sequence. Non-limiting examples of 5ˈ UTR sequences including those from the following genes: albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, and Factor VIII, can be used to enhance expression of a nucleic acid molecule, such as an mRNA. In some embodiments, 5ˈ UTR sequences have also been known, e.g., to form secondary structures that are involved in elongation factor binding.

[0175] Among other things, the present example recognizes that selection of a 5ˈ UTR sequence can improve production of a therapeutic polypeptide encoded by a heterologous transgene. Among other things, the present example recognizes that selection of a 5ˈ UTR sequence can reduce toxicity of a polypeptide encoded by a transgene. In some embodiments, a 5ˈ UTR is a stretch of nucleotides between an expression control sequence and a transgene coding sequence (referred to herein as “a nucleotide spacer sequence”).

[0176] In some embodiments, a nucleotide spacer sequence has a length of about 1 nucleotide. In some embodiments, a nucleotide spacer sequence has a length of about 5 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 10 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 20 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 30 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 40 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 50 72 13002505v1Docket No.: 2017359-0091 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 60 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 70 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 80 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 90 nucleotides. In some embodiments, a nucleotide spacer sequence has a length of about 100 nucleotides.

[0177] In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 100 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 75 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 10 to about 100 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 50 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 60 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 30 to about 60 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 80 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 55 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 10 to about 70 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 90 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 65 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 45 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 20 to about 80 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 1 to about 75 nucleotides. In some embodiments, a nucleotide spacer sequence has a length from about 40 to about 80 nucleotides.

[0178] In some embodiments, an expression cassette of a transgene construct of the present disclosure does not comprise a nucleotide spacer sequence.

[0179] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a 3ˈ UTR. 3ˈ UTRs are known to have stretches of adenosines and uridines embedded in them. These AU-rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, AU-rich elements (AREs) can be separated into three classes (Chen et al., Mol. Cell. Biol.15:5777-5788, 73 13002505v1Docket No.: 2017359-0091 1995; Chen et al., Mol. Cell Biol.15:2010-2018, 1995, each of which is incorporated in its entirety herein by reference): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. For example, c-Myc and MyoD mRNAs contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A) (U / A) nonamers. GM-CSF and TNF- alpha mRNAs are examples that contain class II AREs. Class III AREs are less well defined. These U-rich regions do not contain an AUUUA motif. Two well-studied examples of this class are c-Jun and myogenin mRNAs.

[0180] Most proteins binding to AREs are known to destabilize a messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase stability of mRNA. HuR binds to AREs of all three classes. Engineering HuR specific binding sites into a 3’ UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of a message in vivo.

[0181] In some embodiments, introduction, removal, or modification of 3ˈ UTR AREs can be used to modulate stability of an mRNA encoding a protein. In some embodiments, AREs can be removed or mutated to increase intracellular stability and thus increase translation and production of a protein. (ii) Kozak Consensus Sequence

[0182] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises one or more Kozak consensus sequences. In some embodiments, 5ˈ UTRs include a sequence that plays a role in translation initiation. For example, in some embodiments, 5ˈ UTRs include signatures like Kozak sequences, which are commonly known to be involved in a process by which a ribosome initiates translation of many genes. Kozak sequences generally have a consensus sequence CCR(A / G)CCATGG, where R is a purine (A or G) three bases upstream of a translation initiation codon sequence (ATG), which is followed by another “G”. In some embodiments, Kozak sequences may be included in synthetic or additional sequence elements, such as cloning sites.

[0183] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a Kozak sequence having a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at 74 13002505v1Docket No.: 2017359-0091 least 98%, at least 99%, or 100% identical to the sequence GGCCGCCACC (SEQ ID NO: 16) or GGCCGCCACCATGC (SEQ ID NO: 17). (iii) 5ˈ Cap Sequence

[0184] As described herein, an expression cassette of a transgene construct of the present disclosure can comprise a sequence that signals the introduction of a 5ˈ cap to an mRNA transcript of the transgene. As used herein, a 5ˈ cap (also termed an RNA cap, an RNA 7- methylguanosine cap or an RNA m.sup.7G cap) is a modified guanine nucleotide that has been added to a “front” or 5ˈ end of a eukaryotic messenger RNA shortly after a start of transcription. In some embodiments, a 5ˈ cap consists of a terminal group which is linked to a first transcribed nucleotide. Its presence is critical for recognition by a ribosome and protection from RNases. Cap addition is coupled to transcription, and occurs co-transcriptionally, such that each influences the other. Shortly after start of transcription, a 5ˈ end of an mRNA being synthesized is bound by a cap-synthesizing complex associated with RNA polymerase. This enzymatic complex catalyzes chemical reactions that are required for mRNA capping. Synthesis proceeds as a multi-step biochemical reaction. A capping moiety can be modified to modulate functionality of mRNA such as its stability or efficiency of translation. (iv) Reporter Sequence

[0185] In some embodiments, an expression cassette of a transgene construct provided herein can include a polynucleotide sequence encoding a reporter polypeptide (e.g., a reporter sequence). For example, in some embodiments, a reporter sequence may encode a FLAG polypeptide, an eGFP polypeptide, an mScarlet polypeptide, a luciferase polypeptide, or any variant thereof. In some embodiments, a reporter polypeptide is visibly detectable without intervention. In some embodiments, a reporter polypeptide may be detected using a combination of fluorescent, histochemical, and / or transcript or protein analyses. In some embodiments, reporter polypeptides can be used to verify tissue-specific targeting capabilities and tissue- specific promoter regulatory activity of any constructs described herein. 7. Exemplary Expression Cassettes

[0186] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette having a polynucleotide sequence at least 80%, at least 85%, at least 90%, 75 13002505v1Docket No.: 2017359-0091 at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 7.

[0187] In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises a polynucleotide sequence that is human codon-optimized. In some embodiments, an expression cassette of a transgene construct of the present disclosure comprises polynucleotide sequence that is CpG depleted. In some embodiments, an expression cassette of a construct of the present disclosure comprises a polynucleotide sequence that is human codon- optimized and CpG depleted. TABLE 7: Exemplary Transgene Construct Expression Cassettes Expression Cassette Nucleotide Sequence (SEQ ID NO) C G C C A A T G C G A G G C T T C13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G T T T C T T T A C T T G C T T T C A G A C T A13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) A G C A G A G C A C T T A G C C G C C T G G G C A C C T13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G A T C C C G C C A A T G C G A G G C T T C13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G T T T C T T T A C T T G C T T T C A G A C T A13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) A G C A G A G C A C T T A G C C G C C T G G G C A C C T13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G A T C C C G C C A A T G C G A G G C T T C13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G T T T C T T T A C T T G C T T T C A G A C T A13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) A G C A G A G C A C T T A G C C G C C T G G G C A C C T13002505v1Docket No.: 2017359-0091 Expression Cassette Nucleotide Sequence (SEQ ID NO) G C A T C CB. Polynucleotide Backbone

[0188] In some embodiments, a transgene construct of the present disclosure comprises a polynucleotide backbone. In some embodiments, a polynucleotide backbone comprises one or more elements that promote the replication of the transgene construct, incorporation of the transgene construct into a virion capsid, expression of the transgene in a cell, or a combination thereof. 1. Transgene Construct Origin of replication (ori)

[0189] In some embodiments, a transgene construct of the present disclosure comprises an AAV Rep protein-dependent origin of replication (ori). In some embodiments, an ori comprises one or more nucleotide substitutions that slow(s) replication of the transgene construct in Escherichia coli.

[0190] In some embodiments, a transgene construct of the present disclosure comprises an origin of replication having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 21.

[0191] In some embodiments, a transgene construct of the present disclosure comprises an origin of replication having an amino acid sequence at least 80%, at least 85%, at least 90%, 85 13002505v1Docket No.: 2017359-0091 at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 22. TABLE 8: Exemplary Construct Origin of Replication Sequences Ori Nucleotide Sequence (SEQ ID NO) G A C A T T T G A C A T T T A C G C13002505v1Docket No.: 2017359-0091 Ori Nucleotide Sequence (SEQ ID NO) C G C C2. Transgene Construct Selection Marker

[0192] In some embodiments, a transgene construct of the present disclosure comprises one or more selection markers. In some embodiments, the expression of a polypeptide encoded by one or more selection markers permits the identification and / or enrichment of cells containing the transgene construct.

[0193] In some embodiments, a selection marker encodes a polypeptide that confers antibiotic resistance to a cell. In some embodiments, a selection marker encodes a polypeptide that confers kanamycin resistance, ampicillin resistance, neomycin resistance, G418 resistance, or puromycin resistance.

[0194] In some embodiments, a transgene construct of the present disclosure comprises a kanamycin resistance gene. In some embodiments, a transgene construct of the present disclosure comprises a kanamycin resistance gene having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 24.

[0195] In some embodiments, a kanamycin resistance gene is operably linked to a promoter. In some embodiments, a transgene construct of the present disclosure comprises a promoter having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 25. 87 13002505v1Docket No.: 2017359-0091

[0196] In some embodiments, a selection marker encodes a colored, fluorescent, or luminescent polypeptide (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase). In some embodiments, a selection marker encodes a polypeptide which mediates cellular metabolism resulting in enhanced cell growth rates and / or gene amplification (e.g., dihydrofolate reductase). TABLE 9: Exemplary Construct Selection Marker Sequences Selection Marker Nucleotide Sequence Sequence A G A C A T A G A A G T A G G T G G88 13002505v1Docket No.: 2017359-0091 Selection Marker Nucleotide Sequence Sequence C C G A G T A T A G G G A C G C13002505v1Docket No.: 2017359-0091 Selection Marker Nucleotide Sequence Sequence3. Transgene Construct Terminator Sequences

[0197] In some embodiments, a transgene construct of the present disclosure comprises one or more terminator sequences.

[0198] In some embodiments, a transgene construct of the present disclosure comprises one or more transcriptional terminator sequence. In some embodiments, a transcriptional terminator sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 30.

[0199] In some embodiments, a transcriptional terminator sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 31.

[0200] In some embodiments, a transcriptional terminator sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 32.

[0201] In some embodiments, a transcriptional terminator sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 33. 90 13002505v1Docket No.: 2017359-0091 TABLE 10: Exemplary Transgene Construct Terminator Sequences Terminator Nucleotide Sequence SequenceC. An Exemplary Transgene Construct

[0202] In some embodiments, a transgene construct of the present disclosure comprises an expression cassette. In some embodiments, an expression cassette comprises a 5ˈ inverted terminal repeat (ITR), a heterologous transgene, and a 3ˈ ITR. In some embodiments, an expression cassette comprises an AAV25ˈ ITR, a heterologous transgene encoding CFTR, and an AAV23ˈ ITR. In some embodiments, an expression cassette comprises: (i) a 5ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2; (ii) a heterologous transgene encoding CFTR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9; and (iii) a 3ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3. 91 13002505v1Docket No.: 2017359-0091

[0203] In some embodiments, an expression cassette comprises: (i) a 5ˈ ITR; (ii) an enhancer; (iii) a promoter; (iv) a Kozak sequence; (v) a heterologous transgene; (vi) a polyadenylation sequence; and (vii) a 3ˈ ITR. In some embodiments, an expression cassette comprises: (i) an AAV25ˈ ITR; (ii) a CMV enhancer; (iii) a CBA promoter; (iv) a Kozak sequence; (v) a heterologous transgene encoding CFTR; (vi) a polyadenylation signal sequence; and (vii) an AAV23ˈ ITR. In some embodiments, an expression cassette comprises: (i) a 5ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2; (ii) an enhancer having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 14; (iii) a promoter having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 10; (iv) a Kozak sequence having a polynucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 16; (v) a heterologous transgene encoding CFTR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9; (vi) a polyadenylation signal having a polynucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 12; and 92 13002505v1Docket No.: 2017359-0091 (vii) a 3ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3.

[0204] In some embodiments, a transgene construct of the present disclosure comprises: 1) an expression cassette comprising: (i) a 5ˈ ITR, (ii) an enhancer, (iii) a promoter, (iv) a Kozak sequence, (v) a heterologous transgene, (vi) a polyadenylation signal sequence, and (vii) a 3ˈ ITR; and 2) a polynucleotide backbone comprising: (i) an origin of replication (ori), (ii) a promoter, (iii) a gene encoding a selection marker, wherein the gene is operably linked to the promoter, and (iv) one or more termination sequences.

[0205] In some embodiments, a transgene construct of the present disclosure comprises: 1) an expression cassette comprising: (i) an AAV25ˈ ITR, (ii) a CMV enhancer, (iii) a CBA promoter, (iv) a Kozak sequence, (v) a heterologous transgene encoding CFTR, (vi) a polyadenylation signal sequence, and (vii) an AAV23ˈ ITR; and 2) a polynucleotide backbone comprising: (i) a Rep polypeptide-dependent ori, (ii) a promoter; (iii) a kanamycin resistance gene, wherein the kanamycin resistance gene is operably linked to the promoter; and (iv) one or more termination sequences.

[0206] In some embodiments, a transgene construct of the present disclosure comprises: 1) an expression cassette comprising: (i) a 5ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 2, (ii) an enhancer having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 14, 93 13002505v1Docket No.: 2017359-0091 (iii) a promoter having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 10, (iv) a Kozak sequence having a polynucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 16, (v) a heterologous transgene encoding CFTR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9, (vi) a polyadenylation signal having a polynucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 12, and (vii) a 3ˈ ITR having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 3; and 2) a polynucleotide backbone comprising: (i) an ori having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 21 or SEQ ID NO: 22, (ii) a promoter having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at 94 13002505v1Docket No.: 2017359-0091 least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 25, (iii) a kanamycin resistance gene having a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 24; and (iv) one or more termination sequences comprising a polynucleotide sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or a combination thereof.

[0207] In some embodiments, a transgene construct of the present disclosure comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 11.

[0208] In some embodiments, a transgene construct of the present disclosure comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 34.

[0209] In some embodiments, a transgene construct of the present disclosure comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 35.

[0210] In some embodiments, a transgene construct of the present disclosure comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 36. 95 13002505v1Docket No.: 2017359-0091 TABLE 11: Exemplary Transgene Construct (Full-Length Sequence) Transgene Nucleotide Sequence Construct G G T A T T C T T G C G C A G A T G C A G T G A A T C13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct G G T G G C C G G T G A T T C A A A T G G C T A A T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct G C G C C G A G G A C T A C A T T T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct T G T C A T T C A G T G G A A A C A T G C C T99 13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct A G G T A T T C T T G C G C A G A T G C A G T G A A T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct C G G T G G C C G G T G A T T C A A A T G G C T A A13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct T G C G C C G A G G A C T A C A T T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct T T G T C A T T C A G T G G A A A C A T G C C T103 13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct A G G T A T T C T T G C G C A G A T G C A G T G A A T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct C G G T G G C C C G G T G A T T C A A A T G G C T A A13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct T G C G C C G A G G A C T A C A T T13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct T T G T C A T T C A G T G G A A A C A T G C C T107 13002505v1Docket No.: 2017359-0091 Transgene Nucleotide Sequence Construct AII. PARVOVIRUS

[0211] Among other things, the present disclosure recognizes that a virion comprising a transgene construct described herein, is particularly advantageous as a vehicle for gene therapy. For example, in some embodiments, the present disclosure describes virions, populations of virions, pharmaceutical compositions, and host cells comprising: (i) a transgene construct as described herein; and (ii) a parvovirus capsid comprising, a) a VP1 capsid polypeptide, functional fragment thereof, or variant thereof, b) a VP2 capsid polypeptide, functional fragment thereof, or variant thereof, c) a VP3 capsid polypeptide, functional fragment thereof, or variant thereof, or d) any combination thereof. In some embodiments, a parvovirus capsid may be a bocaparvovirus capsid, protoparvovirus capsid, erythroparvovirus capsid, tetraparvovirus capsid, copiparvovirus capsid, or other parvovirus capsid.

[0212] Without wishing to be bound by any particular theory, parvoviruses offer a variety of advantages compared to AAV. First, due to a larger virion genome size, a parvovirus (having a ~5.3 kb genome size compared to a ~4.7 kb genome size of AAV) can package a nucleic acid at least 0.6 kb greater than AAV, thereby allowing delivery of a therapeutic gene(s) whose size exceeds the capacity of AAV. A larger virion genome size also allows delivery of one or more therapeutic transgenes together with genomic safe harbor (GSH) sequences that accommodate site-specific recombination of one or more transgenes at a desired genomic location. Such site- specific recombination allows integration of one or more transgenes at an inert location in the genome, as opposed to random integration that could disrupt an essential gene and its expression.

[0213] Second, parvoviruses are not as prevalent as AAV. Thus, administration of a virion comprising a parvovirus VP1 capsid polypeptide, VP2 capsid polypeptide, VP3 capsid polypeptide, or combination thereof, would not trigger an extensive anti-viral immune reaction that precludes efficient gene delivery. That is, in some embodiments, no prescreening of a subject for anti-parvovirus antibodies is required prior to administering (e.g., systemically) 108 13002505v1Docket No.: 2017359-0091 compositions (e.g., pharmaceutical compositions), preparations, constructs, virions, population of virions described herein. Accordingly, a virion comprising a parvovirus VP1 capsid polypeptide, a parvovirus VP2 capsid polypeptide, a parvovirus VP3 capsid polypeptide, or a combination thereof can achieve gene delivery with efficiency unparalleled to AAV.

[0214] Third, parvoviruses have extraordinary tropism for specific tissues as described herein.

[0215] In some embodiments the present disclosure provides a virion comprising a) a parvovirus VP1 capsid polypeptide, functional fragment thereof, or variant thereof, b) a parvovirus VP2 capsid polypeptide, functional fragment thereof, or variant thereof, c) a parvovirus VP3 capsid polypeptide, functional fragment thereof, or variant thereof, or d) any combination thereof. In some embodiments, wherein the VP1 capsid polypeptide, functional fragment thereof, or variant thereof; the VP2 capsid polypeptide, functional fragment thereof, or variant thereof; or the VP3 capsid polypeptide, functional fragment thereof, or variant thereof, is derived from a bocaparvovirus, protoparvovirus, erthythroparvovirus, tetraparvovirus, copiparvovirus, or other parvovirus. A. Bocaparvovirus

[0216] Bocaparvovirus is a genus of viruses in the Parvovirus family (Cotmore et al., 2019, the disclosure of which is hereby incorporated by reference in its entirety). Humans, cattle, and dogs serve as natural hosts. Diseases associated with this genus include, in humans, acute respiratory illness, and in cattle, diarrhea and mild respiratory symptoms. Bocaviruses were first described in animals in the early 1960s. Marmots have also been identified as hosts of bocaparvoviruses (Ao et al., 2017, the disclosure of which is hereby incorporated by reference in its entirety).

[0217] In some embodiments, bocaparvoviruses exhibit characteristics as described in U.S. Pat. No. US 9,828,587 B2, the contents of which is hereby incorporated by reference in its entirety.

[0218] Bocaparvoviruses generally infect gastrointestinal and respiratory tracts. Some may cross a placenta and cause congenital infection of a fetus. Canine minute virus, first isolated in 1967 and associated with disease in 1970, causes respiratory disease with breathing difficulty 109 13002505v1Docket No.: 2017359-0091 and enteritis with severe diarrhoea, spontaneous abortion of fetuses, and death of newborn puppies. Human bocaviruses were first isolated in 2005 in Sweden (Allander et al., 2005, the disclosure of which is hereby incorporated by reference in its entirety). Bovine bocaviruses utilize endocytosis in clathrin-coated vesicles to enter cells; they are dependent upon acidification, and appear to be associated with actin and microtubule dependency (Dudleenamjil et al., 2010, the disclosure of which is hereby incorporated by reference in its entirety).

[0219] Bocaparvoviruses have a linear, ssDNA genome of about 5.5kb in size. Negative strands are predominantly encapsidated. Open reading frames (ORFs) for both structural and non-structural proteins are located on a same DNA strand. A bocaparvovirus genome is replicated through a rolling-hairpin mechanism.

[0220] Bocaparvoviruses comprise two open reading frames—ORF1 and 2 in their genomes. ORF1 encodes a nonstructural protein (NS1) that is involved in viral genome replication. ORF2 encodes two capsid proteins—VP1 capsid polypeptide and VP2 capsid polypeptide. Like other parvoviruses, a VP1 unique region contains a phospholipase A(2) (PLA2) motif with a conserved Histidine–Aspartic acid-XXY motif in the catalytic center (Qu et al., 2008, see also, e.g., ictv.global / report / chapter / parvoviridae / parvoviridae, viralzone.expasy.org / 567?outline=all_by_species, the contents of which is hereby incorporated by reference in its entirety).

[0221] Bocaparvoviruses encode a protein called NP1 that is not present in parvoviruses from other genera. For example, in Canine minute virus NP1 has been shown to be important for an early step in viral replication and is also required for read through of an internal polyadenylation site that is important for expression of capsid polypeptides (Shukhu et al., 2012, the contents of which is hereby incorporated by reference in its entirety).

[0222] Unique among parvoviruses, genomes of bocaparvoviruses contain a third open reading frame between non-structural and structural coding regions (Manteufel et al., 2008, the entire content of which is incorporated herein by reference). This gene encodes a highly phosphorylated nonstructural protein (NP1).

[0223] Bocaparvovirus virions have an icosahedral and round structure with T=1 symmetry. A bocaparvovirus capsid is non-enveloped, and composed of 60 copies of up to six types of capsid polypeptides (called VP1 through VP6) which share a common C-terminal 110 13002505v1Docket No.: 2017359-0091 region. The structure of a virus-like particles composed only of VP2 capsid polypeptide was determined by cryogenic electron microscopy and image reconstruction (Gurda et al., 2010 the contents of which is hereby incorporated by reference in its entirety). Bocaparvovirus virions have a diameter of about 21-22 nm (see also, viralzone.expasy.org / 567?outline=all_by_species, the contents of which is hereby incorporated by reference in its entirety).

[0224] In some embodiments, a bocaparvovirus is of a species selected from Carnivore bocaparvovirus 1, Carnivore bocaparvovirus 2, Carnivore bocaparvovirus 3, Carnivore bocaparvovirus 4, Carnivore bocaparvovirus 5, Carnivore bocaparvovirus 6, Chiropteran bocaparvovirus 1, Chiropteran bocaparvovirus 2, Chiropteran bocaparvovirus 3, Chiropteran bocaparvovirus 4, Chiropteran bocaparvovirus 5, Lagomorph bocaparvovirus 1, Pinniped bocaparvovirus 1, Pinniped bocaparvovirus 2, Primate bocaparvovirus 1, Primate bocaparvovirus 2, Primate bocaparvovirus 3, Rodent bocaparvovirus 1, Rodent bocaparvovirus 2, Ungulate bocaparvovirus 1, Ungulate bocaparvovirus 2, Ungulate bocaparvovirus 3, Ungulate bocaparvovirus 4, Ungulate bocaparvovirus 5, Ungulate bocaparvovirus 6, Ungulate bocaparvovirus 7, Ungulate bocaparvovirus 8, Ungulate bocaparvovirus 9. In some embodiments, a bocaparvovirus is a canine bocaparvovirus (CBV). In some embodiments, a bocaparvovirus is a bovine parvovirus (BPV). In some embodiments, a bocaparvovirus is a human bocavirus 1 (HBoV1).

[0225] Among other things, in some embodiments, the present disclosure recognizes that one or more characteristic sequence elements of a bocaparvovirus VP1, VP2, and / or VP3 capsid polypeptide surprisingly affects virion internalization into a host cell. Among other things, in some embodiments, the present disclosure recognizes that one or more characteristic sequence elements of a bocaparvovirus VP1, VP2, and / or VP3 capsid polypeptide surprisingly affects virion transit into a nucleus of a cell. Among other things, the present disclosure recognizes that one or more characteristic sequence elements of a bocaparvovirus VP1, VP2, and / or VP3 capsid polypeptide surprisingly affects productive virus infection.

[0226] Among other things, the present disclosure provides a virion comprising: (i) a transgene construct as described herein; and (ii) a bocavirus capsid comprising a) one or more VP1 capsid polypeptides, functional fragments, or variants thereof, b) one or more VP2 capsid polypeptides, functional fragments, or variants thereof, c) one or more VP3 capsid polypeptides, 111 13002505v1Docket No.: 2017359-0091 functional fragments, or variants thereof, or d) any combination thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising a) one or more VP1 capsid polypeptides, functional fragments, or variants thereof, b) one or more VP2 capsid polypeptides, functional fragments, or variants thereof, c) one or more VP3 capsid polypeptides, functional fragments, or variants thereof, or d) any combination thereof.

[0227] In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising one or more VP1 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising one or more VP2 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising one or more VP3 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising a) one or more VP1 capsid polypeptides, functional fragments, or variants thereof, and b) one or more VP2 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising a) one or more VP1 capsid polypeptides, functional fragments, or variants thereof, and b) one or more VP3 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising a) one or more VP2 capsid polypeptides, functional fragments, or variants thereof, and b) one or more VP3 capsid polypeptides, functional fragments, or variants thereof. In some embodiments, a virion of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) a human bocavirus capsid comprising a) one or more VP1 capsid polypeptides, functional fragments, or variants thereof, b) one or more VP2 capsid polypeptides, functional fragments, or variants thereof, and c) one or more VP3 capsid polypeptides, functional fragments, or variants thereof. 112 13002505v1Docket No.: 2017359-0091

[0228] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising one or more capsid polypeptides, functional fragments, or variants thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 12.

[0229] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising one or more VP1 capsid polypeptides, functional fragments, or variants thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 37.

[0230] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising one or more VP2 capsid polypeptides, functional fragments, or variants thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41.

[0231] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising one or more VP3 capsid polypeptide, functional fragments, or variants thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 43 or SEQ ID NO: 44.

[0232] In some embodiments, a functional fragment of a VP3 capsid polypeptide comprising an N-terminal truncation of about 12 to about 20 amino acids (e.g., about 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, a human bocavirus capsid comprises one or more functional fragments of a VP3 capsid polypeptide comprising an N- terminal truncation of about 16 amino acids. Without wishing to be bound by any particular theory, a virion having a greater proportion of N-terminally truncated VP3 capsid polypeptide 113 13002505v1Docket No.: 2017359-0091 relative to full-length VP3 capsid polypeptide is associated with having a greater propensity to fully encapsidate a transgene construct. In some embodiments, a ratio of N-terminally truncated VP3 capsid polypeptide relative to full-length VP3 capsid polypeptide of greater than about 3.0, greater than about 3.1, greater than about 3.2, greater than about 3.3, greater than about 3.4, greater than about 3.5, greater than about 3.6, greater than about 3.7, greater than about 3.8, greater than about 3.9, greater than about 4.0, greater than about 4.1, greater than about 4.2, greater than about 4.5, greater than about 4.6, greater than about 4.7, greater than about 4.8, greater than about 4.9, greater than about 5.0, greater than about 5.1, greater than about 5.2, greater than about 5.3, or greater than about 5.4 is associated with having a greater propensity to fully encapsidate a transgene construct. In some embodiments, a ratio of N-terminally truncated VP3 capsid polypeptide relative to full-length VP3 capsid polypeptide of greater than or equal to about 3.3 is associated with having a greater propensity to fully encapsidate a transgene construct.

[0233] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising a) a VP1 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 37 and b) a VP2 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41.

[0234] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising a) a VP1 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 37 and b) a VP3 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at 114 13002505v1Docket No.: 2017359-0091 least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 43 or SEQ ID NO: 44.

[0235] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising a) a VP2 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41 and a VP3 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 43 or SEQ ID NO: 44.

[0236] In some embodiments, a virion of the present disclosure comprises (i) a transgene construct as described herein, and (ii) a human bocavirus capsid comprising a) a VP1 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 37, b) a VP2 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41 and c) a VP3 capsid polypeptide, functional fragment, or variant thereof, comprising an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 43or SEQ ID NO: 44. TABLE 12: Exemplary Human Bocavirus Capsid Polypeptides Human Bocavirus Amino Acid Sequence D I13002505v1Docket No.: 2017359-0091 Human Bocavirus Amino Acid Sequence Capsid Polypeptide W P E Y G L K G H D I K Q P E Y G L K G D I K Q P E Y G L K13002505v1Docket No.: 2017359-0091 Human Bocavirus Amino Acid Sequence Capsid Polypeptide G D C Y E L G K T V C Y E L G K T V K Q P E Y G L K13002505v1Docket No.: 2017359-0091 Human Bocavirus Amino Acid Sequence Capsid Polypeptide G K Q P E Y G L K G H W P E Y G L K G H118 13002505v1Docket No.: 2017359-0091 B. Genotypic Variants of Virions

[0237] A species of virus comprises clusters of genetic variants (Van Regenmortel MHV (2000) Virus Taxonomy-Seventh Report of the International Committee on Taxonomy of Viruses). Genetic variants may comprise mutations (that encompasses point mutations and insertions-deletions of different lengths), hypermutations, several types of recombination, and genome segment reassortments. Mutation is observed in all viruses, with no known exceptions (Domingo (2019) Virus as Populations 2020:35-71). Recombination is also widespread, and occurs in both DNA viruses and RNA viruses. Genome segment reassortment, a type of variation close to chromosomal exchanges in sexual reproduction, is an adaptive asset of segmented viral genomes, as continuously evidenced by ongoing evolution of the influenza viruses. The three modes of virus genome variation are compatible, and reassortant- recombinant-mutant genomes are continuously arising in present-day viruses.

[0238] Accordingly, a genetic variant of a virion described herein may comprise a polypeptide described herein or those belonging to a virus or virion described herein (e.g., a VP1 capsid polypeptide, a VP2 capsid polypeptide, a VP3 capsid polypeptide, an NS1 polypeptide, etc.) with an amino acid sequence that is at least, about, or no more than 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to an amino acid sequence of the exemplary sequences presented herein or an amino acid sequence of the polypeptide of exemplary viruses referenced herein. C. Capsid Modifications

[0239] Among other things, the present disclosure describes insertion of one or more capsid modifications into one or more residues of a parvovirus VP1, VP2, and / or VP3 capsid polypeptide as described herein. In some embodiments, a capsid modification comprises insertion of one or more heterologous peptides into one or more residues of a parvovirus VP1, VP2, and / or VP3 capsid polypeptide as described herein. In some embodiments, a capsid modification comprises one or more single point mutations (singletons) resulting in one or more amino acid changes (e.g., mutations) in one or more residues of a parvovirus VP1, VP2, and / or 119 13002505v1Docket No.: 2017359-0091 VP3 capsid polypeptide as described herein. In some embodiments, a parvovirus VP1, VP2, and / or VP3 capsid polypeptide comprising one or more capsid modifications is referred to as a parvovirus variant VP1, VP2, and / or VP3 capsid polypeptide. In some embodiments, a parvovirus variant VP1, VP2, and / or VP3 capsid polypeptide comprises one or more modifications, relative to a parvovirus reference VP1, VP2, and / or VP3 capsid polypeptide.

[0240] Among other things, the present disclosure describes insertion of one or more heterologous peptides into one or more residues of a parvovirus VP1, VP2, and / or VP3 capsid polypeptide as described herein. In some embodiments, a heterologous peptide comprises or is a heterologous targeting peptide.

[0241] In some embodiments, insertion of one or more heterologous peptides is at one or more residues of a parvovirus VP1 capsid polypeptide that map(s) onto a structural overlay of one or more residues within a variable region (e.g., VR (e.g., VR-IV, VR-V, VR-VIII)) of a parvovirus VP1 capsid polypeptide (e.g., AAV capsid, e.g., AAV2 capsid, e.g., AAV5 capsid, e.g., AAV8 capsid, e.g., AAV9 capsid, or any variant thereof). For example, one or more residues of a human bocavirus (HBoV1) VP1 capsid polypeptide can be mapped onto a structural overlay of one or more residues within a VR-II of an AAV2 capsid. It is an insight of the present disclosure that, in some embodiments, such structural overlay shows that a region comprising residues 805-825 of a human bocavirus (HBoV1) VP1 capsid polypeptide corresponds to VR-II of an AAV2 capsid. It is also an insight of the present disclosure that, in some embodiments, such structural overlay shows that a region comprising residues 1201-1248 of a human bocavirus (HBoV1) VP1 capsid polypeptide corresponds to VR-IV of an AAV2 capsid. It is also an insight of the present disclosure that, in some embodiments, such structural overlay shows that a region comprising residues 1543-1578 of a human bocavirus (HBoV1) VP1 capsid polypeptide corresponds to VR-VIII of an AAV2 capsid. Similar corresponding regions of other parvoviruses can also be determined from structural overlays as described herein.

[0242] In some embodiments, insertion of one or more heterologous peptides is at one or more residues corresponding to one or more residues within a variable region (e.g., VR (e.g., VR-IV, VR-V, VR-VIII)) of a parvovirus VP1 capsid polypeptide. AAV VRs differ between serotypes and are responsible for serotype-specific variations in antibody and receptor binding (see Tseng and Agbandje-McKenna, 2014, the entire contents of which are hereby incorporated 120 13002505v1Docket No.: 2017359-0091 by reference herein). In some embodiments, one or more heterologous peptides increases cell specificity and / or viral transduction efficiency and / or increases virion performance of a parvovirus VP1 capsid polypeptide.

[0243] Adenovirus capsid modifications are described by Buning and Srivastava, 2019, the entire contents of which are hereby incorporated by reference herein. It is an insight of the present disclosure that, in some embodiments, one or more modifications introduced into one or more residues of an AAV capsid can be introduced into one or more corresponding residues of a parvovirus VP1 capsid polypeptide as described herein. In some embodiments, one or more modifications described by Buning and Srivastava, 2019 are introduced into one or more residues of a parvovirus VP1 capsid polypeptide as described herein.

[0244] Among other things, the present disclosure describes insertion of one or more heterologous peptides into one or more residues along a 3-fold axis of symmetry of a parvovirus capsid polypeptide. Residues in regions along a 3-fold axis of symmetry of a capsid can be responsible for serotype-specific variations in antibody and / or receptor binding (see, Callaway et al., 2017, the entire contents of which are hereby incorporated by reference herein).

[0245] It is also an insight of the present disclosure that one or more modifications at one or more residues along a 3-fold axis of symmetry of a parvovirus capsid polypeptide can help re- direct or expand tropism (e.g., cell surface targeting) of viral-based gene therapies described herein.

[0246] Adenovirus capsid modifications are described by Buning and Srivastava, 2019, the entire contents of which are hereby incorporated by reference herein. It is an insight of the present disclosure that, in some embodiments, one or more modifications introduced in a variable region of an AAV capsid can be introduced into one or more residues along a 3-fold axis of symmetry of a parvovirus VP1 capsid polypeptide as described herein. In some embodiments, one or more modifications described by Buning and Srivastava, 2019 are introduced into corresponding residues (e.g., along a 3-fold axis of symmetry) of a parvovirus VP1 capsid polypeptide. In some embodiments, one or more modifications are introduced into one or more residues along a 3-fold axis of symmetry of a parvovirus VP1 capsid polypeptide. In some embodiments, a capsid modification is a peptide insertion. In some embodiments a capsid modification is a peptide insertion into one or more residues of a parvovirus VP1 capsid 121 13002505v1Docket No.: 2017359-0091 polypeptide that corresponds to one or more residues described by Buning and Srivastava, 2019. In some embodiments, one or more heterologous peptides is inserted into one or more residues along a 3-fold axis of symmetry of a common VP3 region of a parvovirus VP1 capsid polypeptide. In some embodiments, one or more heterologous peptides is inserted into one or more residues along a 3-fold axis of symmetry of a common VP2 region of a parvovirus VP1 capsid polypeptide.

[0247] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirusVP1 capsid polypeptide corresponding to residue 587 of a common VP3 region of AAV2. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirusVP1 capsid polypeptide corresponding to residue 588 of a common VP3 Region of AAV2. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residues other than 587 or 588 of a common VP3 region of AAV2. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 453 of a common VP3 region of AAV2. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 585 of a common VP3 Region of AAV2. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 520 of a common VP3 Region of AAV2. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 584 of a common VP3 Region of AAV2.

[0248] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirusVP1 capsid polypeptide corresponding to a common VP3 region of AAV1. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 590 of a common VP3 Region of AAV1.

[0249] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV3. For example, in some embodiments, a heterologous peptide is inserted into one or more 122 13002505v1Docket No.: 2017359-0091 residues of a parvovirus VP1 capsid polypeptide corresponding to residue 586 of a common VP3 Region of AAV3.

[0250] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV4. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 586 of a common VP3 Region of AAV4.

[0251] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV5. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 575 of a common VP3 Region of AAV5.

[0252] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV6. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 585 of a common VP3 Region of AAV6. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 585 in combination with mutation of a tyrosine to phenylalanine at residues 705 and 731 and mutation of threonine to valine at residue 492 of a common VP3 Region of AAV6. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 585 in combination with mutation of a tyrosine to phenylalanine at residues 705 and 731 and mutation of threonine to valine at residue 492 and mutation of lysine to glutamic acid at residue 531 of a common VP3 Region of AAV6.

[0253] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV8. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 585 of a common VP3 Region of AAV8. In some embodiments, a heterologous peptide is inserted into one or more 123 13002505v1Docket No.: 2017359-0091 residues of a parvovirus VP1 capsid polypeptide corresponding to residue 590 of a common VP3 Region of AAV8.

[0254] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV9. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 588 of a common VP3 Region of AAV9. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 589 of a common VP3 Region of AAV9.

[0255] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV9P1.

[0256] In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to a common VP3 Region of AAV-PHP.B. For example, in some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 588 of a common VP3 Region of AAV-PHP.B. In some embodiments, a heterologous peptide is inserted into one or more residues of a parvovirus VP1 capsid polypeptide corresponding to residue 589 of a common VP3 Region of AAV-PHP.B.

[0257] Among other things, in some embodiments, the present disclosure describes compositions, preparations, constructs, virions, population of virions, and host cells comprising a VP1 capsid coding sequence that encodes a parvovirus VP1 capsid polypeptide further comprise an insertion of one or more heterologous peptides as described by Borner et al., 2020, the contents of which are hereby incorporated by reference in its entirety. In some embodiments, a heterologous peptide comprises a length of from 10 amino acids to 20 amino acids. In some embodiments, an insertion of one or more heterologous peptides is at one or more residues along a 3-fold axis of symmetry of a VP1 capsid polypeptide. In some embodiments, a parvovirus VP1 capsid polypeptide confers increased infectivity compared to the infectivity by a reference virion comprising the corresponding parvovirus reference VP1 capsid polypeptide. In some 124 13002505v1Docket No.: 2017359-0091 embodiments, a heterologous peptide alters cell specificity and / or viral transduction efficiency. In some embodiments the heterologous peptide increases virion performance.

[0258] TABLE 13 lists exemplary heterologous peptide sequences that can be inserted into one or more residues of a parvovirus VP1 capsid polypeptide described herein. TABLE 13: Exemplary Heterologous Peptide Sequence Insertions Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:13002505v1Docket No.: 2017359-0091 Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:126 13002505v1Docket No.: 2017359-0091 Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:127 13002505v1Docket No.: 2017359-0091 Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:128 13002505v1Docket No.: 2017359-0091 Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:129 13002505v1Docket No.: 2017359-0091 Exemplary Sequence Name Amino Acid Sequence SEQ ID NO:

[0259] In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises one or more amino acid modifications (e.g., mutations) in one or more residues of a parvovirus reference VP1 capsid polypeptide. In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises a single point mutation (singleton), relative to a parvovirus reference VP1 capsid polypeptide as described by Fakhiri et al., 2020, the contents of which is hereby incorporated by reference in its entirety.

[0260] In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises a threonine to serine mutation at a residue corresponding to residue 590 of a HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39), relative to a parvovirus reference VP1 capsid polypeptide. In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises an aspartic acid to asparagine mutation at a residue corresponding to residue 86 of a HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39), relative to a parvovirus reference VP1 capsid polypeptide. In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises a serine to asparagine mutation at a residue corresponding to residue 474 of a HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39), relative to a parvovirus reference VP1 capsid polypeptide. In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises an alanine to threonine mutation at a residue corresponding to residue 149 of a HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39), relative to a parvovirus reference VP1 capsid polypeptide. In some embodiments, a parvovirus variant VP1 capsid polypeptide comprises a threonine to serine mutation at a residue corresponding to residue 590, an aspartic acid to asparagine mutation at a 130 13002505v1Docket No.: 2017359-0091 residue corresponding to residue 86, a serine to asparagine mutation at a residue corresponding to residue 474, an alanine to threonine mutation at a residue corresponding to residue 149, or any combination thereof, of a HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39), relative to a parvovirus reference VP1 capsid polypeptide.

[0261] In some embodiments, a singleton affects transduction, capsid assembly, and / or immunoreactivity of a parvovirus variant VP1 capsid polypeptide, relative to a parvovirus reference VP1 capsid polypeptide described herein. For example, it is an insight of the present disclosure that de novo sequence diversity is common at certain nucleotide positions within a HBoV VP1 capsid polypeptide (e.g., at position 590). In some embodiments, a VP1 capsid modification comprises a mutation of a surface exposed tyrosine at residue 590 of a HBoV VP1 capsid polypeptide as described in Fakhiri et al., 2020, the contents of which is hereby incorporated by reference herein in its entirety. It is an insight of the present disclosure that mutation of a tyrosine introduced into residue 590 of a HBoV VP1 capsid polypeptide can be introduced into a corresponding to residue in other parvovirus species described herein.

[0262] Among other things, it is an insight of the present disclosure that the gorilla bocavirus (GBoV) described by Kapoor et al. is genetically most closely related to HBoV. Additionally, a HBoV Variable Region (e.g., VR-VIIIB) is most homologous to GBoV. In some embodiments, a capsid modification made in a HBoV VP1 capsid polypeptide, as described in Fakhiri et al., 2020, is made in a GBoV VP1 capsid polypeptide. In some embodiments, a GBoV variant VP1 capsid polypeptide comprises a threonine to serine mutation at a residue corresponding to residue 590 of a reference HBoV (SEQ ID NO: 39). In some embodiments, a GBoV variant VP1 capsid polypeptide comprises an aspartic acid to asparagine mutation at a residue corresponding to residue 86 of HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39). In some embodiments, a GBoV variant VP1 capsid polypeptide comprises a serine to asparagine mutation at a residue corresponding to residue 474 of a reference HBoV (SEQ ID NO: 39). In some embodiments, a GBoV variant VP1 capsid polypeptide comprises an alanine to threonine mutation at a residue corresponding to residue 149 of HBoV reference VP1 capsid polypeptide (SEQ ID NO: 39). 131 13002505v1Docket No.: 2017359-0091 III. PHARMACEUTICAL COMPOSITIONS AND KITS

[0263] Pharmaceutical compositions of the present disclosure may comprise a transgene construct as described herein and one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. For example, in some embodiments, pharmaceutical compositions of the present disclosure may comprise virions comprising a transgene construct as described herein and one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. In some embodiments, pharmaceutical compositions of the present disclosure may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose, or dextrans; mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.

[0264] In some embodiments, pharmaceutical compositions of the present disclosure comprise a pharmaceutically acceptable carrier (e.g., phosphate buffered saline, saline, or bacteriostatic water). Upon formulation, pharmaceutical compositions of the present disclosure can be administered in a manner compatible with a dosage formulation and in such amount as is therapeutically effective.

[0265] The present disclosure also provides kits including any virion, population of virions, pharmaceutical compositions, or cells as described herein. In some embodiments, a kit can include a solid composition (e.g., a lyophilized composition including at least one virion, population of virions, pharmaceutical composition, or cell as described herein) and a liquid for solubilizing the composition.

[0266] In some embodiments, a kit of the present disclosure can include a pre-loaded syringe including a virion, population of virions, pharmaceutical composition, or cell as described herein.

[0267] In some embodiments, a kit of the present disclosure can include a vial comprising a virion, population of virions, pharmaceutical composition, or cell as described herein (e.g., formulated as an aqueous composition, e.g., an aqueous pharmaceutical composition). 132 13002505v1Docket No.: 2017359-0091

[0268] In some embodiments, a kit of the present disclosure can include instructions for performing any methods described herein. IV. CELLS A. Host Cells

[0269] As used herein, a “host cell” may refer to a cell that has been transfected with an exogenous DNA sequence. In some embodiments, a host cell includes progeny of an original cell that has been transfected. It is understood that, in some embodiments, progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.

[0270] In some embodiments, the present disclosure provides a cell comprising a transgene construct described herein, and one or more additional constructs. In some embodiments, a cell is an insect cell (e.g., an Sf9 cell). In some embodiments, a cell is a mammalian cell. In some embodiments, a cell is a human cell. In some embodiments, a cell is a human cell line (e.g., HEK293T cells, etc.). In some embodiments, a cell is a lung cell (e.g., a lung fibroblast cell). In some embodiments, a transgene construct and one or more additional constructs can be introduced into any cell. Non-limiting examples of certain constructs and methods for introducing constructs into cells are described herein.

[0271] In some embodiments, a cell is in vitro. In some embodiments, a cell is in vivo or ex vivo. For example, in some embodiments, a cell is present in a mammal. In some embodiments, a cell (e.g., a mammalian cell) is an autologous cell obtained, e.g., from a subject (e.g., a mammal) and cultured ex vivo.

[0272] In some embodiments, cells provided by the present disclosure are transfected host cells. In some embodiments, transfection is used to refer to uptake of exogenous DNA by a cell, and a cell has been “transfected” when exogenous DNA has been introduced inside a cell membrane. A number of transfection techniques are described in Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; and Chu et al. (1981) Gene 13:197, each of which is incorporated in its entirety herein by reference. 133 13002505v1Docket No.: 2017359-0091 Such techniques can be used to introduce one or more exogenous nucleic acids, such as a transgene construct and / or one or more additional constructs into suitable host cells.

[0273] In some embodiments, a host cell of the present disclosure comprises a transgene construct as described herein. 1. Additional Constructs

[0274] In some embodiments, a host cell of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) one or more additional constructs comprising an expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides.

[0275] In some embodiments, an expression cassette of one or more additional constructs encodes one or more human bocavirus protein, fragment thereof, or variant thereof. In some embodiments, an expression cassette of one or more additional constructs encodes one or more human bocavirus proteins, fragments thereof, or variants thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 12.

[0276] In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene encoding: a) a human bocavirus VP1 polypeptide, fragment thereof, or a variant thereof; b) a human bocavirus VP2 polypeptide, fragment thereof, or variant thereof; c) a human bocavirus VP3 polypeptide, fragment thereof, or variant thereof; or d) any combination thereof.

[0277] In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene encoding: a) a human bocavirus VP2 polypeptide, fragment thereof, or variant thereof; and b) a human bocavirus VP3 polypeptide, fragment thereof, or variant thereof. In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene encoding: a) a human bocavirus VP2 polypeptide, fragment thereof, or variant thereof comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ 134 13002505v1Docket No.: 2017359-0091 ID NO: 40; and b) a human bocavirus VP3 polypeptide, fragment thereof, or variant thereof comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 43.

[0278] In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene comprising a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 125. In some embodiments, an expression cassette of one or more additional constructs comprises a transgene comprising a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 126.

[0279] In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene encoding: a) a human bocavirus VP1 polypeptide, fragment thereof, or variant thereof; b) a human bocavirus VP2 polypeptide, fragment thereof, or variant thereof; and c) a human bocavirus VP3 polypeptide, fragment thereof, or variant thereof. In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene encoding: a) a human bocavirus VP1 polypeptide, fragment thereof, or variant thereof comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 37; b) a human bocavirus VP2 polypeptide, fragment thereof, or variant thereof comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 41; and c) a human bocavirus VP3 polypeptide, fragment thereof, or variant thereof comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 44. 135 13002505v1Docket No.: 2017359-0091

[0280] In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene comprising a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 127. In some embodiments, an expression cassette of one or more additional constructs comprises a heterologous transgene comprising a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 128. In some embodiments, an expression cassette of one or more additional constructs comprises a transgene comprising a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 129.

[0281] In some embodiments, an expression cassette of one or more additional constructs further comprises an enhancer. In some embodiments, an enhancer comprises a CMV enhancer. In some embodiments, a CMV enhancer comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 15 or SEQ ID NO: 130.

[0282] In some embodiments, an expression cassette of one or more additional constructs further comprises a promoter. In some embodiments, a promoter is operably linked to the 5ˈ end of a heterologous transgene. In some embodiments, a promoter comprises a CMV promoter. In some embodiments, a CMV promoter comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 11.

[0283] In some embodiments, an expression cassette of one or more additional constructs further comprises an SV40 intron. In some embodiments, an SV40 intron comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 131. 136 13002505v1Docket No.: 2017359-0091

[0284] In some embodiments, an expression cassette of one or more additional constructs further comprises a polyadenylation signal sequence. In some embodiments, a polyadenylation signal sequence is operably linked to the 3ˈ end of a heterologous transgene. In some embodiments, a polyadenylation signal sequence comprises a bovine growth hormone (bGH) polyadenylation signal sequence. In some embodiments, a bGH polyadenylation signal sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 13.

[0285] In some embodiments, one or more additional constructs further encodes one or more helper polypeptide. In some embodiments, one or more helper polypeptide is an adenovirus helper polypeptide. In some embodiments, one or more helper polypeptide is an adenovirus 5 (Ad5) helper polypeptide. In some embodiments, one or more helper polypeptide comprises: (i) an Ad5 E4 ORF 1 polypeptide; (ii) an Ad5 E4 ORF 2 polypeptide; (iii) an Ad5 E4 ORF 3 polypeptide; (iv) an Ad5 E4 ORF 4 polypeptide; (v) an Ad5 E4 ORF 5 polypeptide; (vi) an Ad5 E4 ORF 6 / 7 polypeptide; (vii) an Ad5 E435kDa polypeptide; (viii) an Ad5 E2A polypeptide; (ix) an Ad5 L4100 kDa polypeptide; (x) an Ad5 L433 kDa polypeptide; (xi) an Ad5 L422 kDa polypeptide; or (xii) any combination thereof.

[0286] In some embodiments, one or more additional constructs further encodes: 137 13002505v1Docket No.: 2017359-0091 (i) an Ad5 E4 ORF 1 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 132; (ii) an Ad5 E4 ORF 2 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 133; (iii) an Ad5 E4 ORF 3 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 134; (iv) an Ad5 E4 ORF 4 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 135; (v) an Ad5 E4 ORF 6 / 7 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 136; (vi) an Ad5 E435kDa polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 137; (vii) an Ad5 E2A polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 138; 138 13002505v1Docket No.: 2017359-0091 (viii) an Ad5 L4100 kDa polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 139; (ix) an Ad5 L433 kDa polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 140; (x) an Ad5 L422 kDa polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 141; or (xi) any combination thereof.

[0287] In some embodiments, one or more additional constructs further comprises: (i) an Ad5 E4 ORF 1 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 142; (ii) an Ad5 E4 ORF 2 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 143; (iii) an Ad5 E4 ORF 3 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 144; (iv) an Ad5 E4 ORF 4 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 139 13002505v1Docket No.: 2017359-0091 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 145; (v) an Ad5 E4 ORF 6 / 7 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 146; (vi) an Ad5 E435kDa polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 147; (vii) an Ad5 E2A polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 148; (viii) an Ad5 L4100 kDa polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 149; (ix) an Ad5 L433 kDa polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 150; (x) an Ad5 L422 kDa polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:151; or (xii) any combination thereof.

[0288] In some embodiments, one or more additional constructs further encodes one or more replication (Rep) polypeptide. In some embodiments, one or more Rep polypeptide is an 140 13002505v1Docket No.: 2017359-0091 adeno-associated virus (AAV) Rep polypeptide. In some embodiments, one or more Rep polypeptide is an AAV2 Rep polypeptide. In some embodiments, one or more Rep polypeptide comprises: (i) an AAV2 Rep 68 polypeptide; (ii) an AAV2 Rep 78 polypeptide; (iii) an AAV2 Rep 40 polypeptide; (iv) an AAV2 Rep 52 polypeptide; or (v) any combination thereof.

[0289] In some embodiments, one or more additional constructs further encodes: (i) an AAV2 Rep 68 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 152 or SEQ ID NO: 156; (ii) an AAV2 Rep 78 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 153; (iii) an AAV2 Rep 40 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 154 or SEQ ID NO: 157; (iv) an AAV2 Rep 52 polypeptide comprising an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 155; or (xii) any combination thereof.

[0290] In some embodiments, one or more additional constructs further comprises: 141 13002505v1Docket No.: 2017359-0091 (i) an AAV2 Rep 68 polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 158 or SEQ ID NO: 162; (ii) an AAV2 Rep 78 polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 164, or SEQ ID NO: 165; (iii) an AAV2 Rep 40 polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 160 or SEQ ID NO: 166; (iv) an AAV2 Rep 52 polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 162, SEQ ID NO: 167, SEQ ID NO: 168, or SEQ ID NO: 169; (v) an AAV2 p5 polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 170; (v) an AAV2 P19 polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 171; or (vi) any combination thereof.

[0291] In some embodiments, one or more additional constructs further comprises an origin of replication sequence. In some embodiments, an origin of replication sequence comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at 142 13002505v1Docket No.: 2017359-0091 least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 23.

[0292] In some embodiments, one or more additional constructs further comprises a selection marker. In some embodiments, a selection marker is an antibiotic selection marker. In some embodiments, a selection marker is an ampicillin resistance gene. In some embodiments, an ampicillin resistance gene comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 27. In some embodiments, a selection marker is a neomycin / kanamycin resistance gene. In some embodiments, a neomycin / kanamycin in resistance gene comprises a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 28.

[0293] In some embodiments an ampicillin resistance gene is operably linked to a promoter. In some embodiments, an ampicillin resistance gene is operably linked to a promoter having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 26. In some embodiments a neomycin / kanamycin resistance gene is operably linked to a promoter. In some embodiments, a neomycin / kanamycin resistance gene is operably linked to a promoter having a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 29.

[0294] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 172.

[0295] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at 143 13002505v1Docket No.: 2017359-0091 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 173.

[0296] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 174.

[0297] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 175.

[0298] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 176.

[0299] In some embodiments, one or more additional constructs comprise a polynucleotide sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 177. TABLE 14: Exemplary Construct Human Bocavirus Capsid Protein Nucleotide Sequences Human Bocavirus Nucleotide Sequence C G G T C C A144 13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide T C C A C T T G A A G G G A A G G G A C13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide A G C G T C T T A C G C T A G G C A C T A C13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide A G C G T C T T A C G C T A G G C A C T A13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide A A T A T C C T C G G A C C T A G G C A C A C A A A13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide A T A T C C T C G G A C C T A G G C A C A C A149 13002505v1Docket No.: 2017359-0091 TABLE 15: Additional Construct Nucleotide Sequences Expression Cassette Nucleotide Sequence (SEQ ID NO) G ATABLE 16: Exemplary Construct Helper Polypeptide Sequences Human Bocavirus Amino Acid Sequence Ca sid Pol e tide A E V M L Y P P13002505v1Docket No.: 2017359-0091 Human Bocavirus Amino Acid Sequence Capsid Polypeptide T E T P I L K A V A A S S I A F E E M Y A A L G A T PI151 13002505v1Docket No.: 2017359-0091 Human Bocavirus Amino Acid Sequence Capsid Polypeptide P I L P RTABLE 17: Exemplary Construct Helper Nucleotide Sequences Human Bocavirus Nucleotide Sequence Ca sid Pol e tide G T G A T T T G C G C C C13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide T C T T G A G G C G C A T G G T T T C G A A G A C153 13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide G A T G G T T T C G A A G A G C G C G G G C13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide A G C T A A T C C C C C C G A C C A13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide G A C G G C G T G C T T C T C G G G A G156 13002505v1Docket No.: 2017359-0091 Human Bocavirus Nucleotide Sequence Capsid Polypeptide C A C T C G C G C C A C T C G157 13002505v1Docket No.: 2017359-0091 TABLE 18: Exemplary Construct Rep Polypeptide Sequences Additional Amino Acid Sequence Construct S W E I S A V N S S W E I S A V N S S W E I S A V N S158 13002505v1Docket No.: 2017359-0091 Additional Amino Acid Sequence Construct V L Y G L Y G L Y G G CTABLE 19: Exemplary Construct Rep Nucleotide Sequences Additional Nucleotide Sequence C C A C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G A C A A A C G C G G T T C G G T C G C C G C C A T C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G C C A C G A C A A A C G C G G T T C G G T C A G T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C A A C C T C C A C G A C A A A C G C G G T T C G G T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C G C C G C C A T C C A C G A C A A A C G C G G T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C G G T C G C C G C C A T C C A C G A C A A A C G C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G T T C G G T C A G T C G C C A T C C A C G A C A A A C G C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G G T T C G G T C A G T C A A C C T A G C T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C C G G G T A A T G G T A G C T C C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A A T T T T T A G C T C C G G G T A A T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A G C T C C G G G T A A T T A G C T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C C G A A T T T T A G C T C C G A A T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T TTABLE 20: Exemplary Additional Construct (Full-Length Sequence) Additional Nucleotide Sequence Construct G G G A A C A T A A G C C G T G C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T G C C T T G T T A A A G C G C C T A A A G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G C A A T G T C G C G A C G A T C A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T A T C G A G A G A C T C T C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C A C C G T A G T A C T G A G C G A T G C A G A C T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T C G T C C G T A C C C A G G C T G T T G A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G C G G C C G A C A C G T G T G G G A C G T A A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G G A A T A A T G G T G C G C T T T A G T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C T C T T T C C T A A G A A G T T A A G179 13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G G G A A C A T A A G C C G T G C G T G C C T G180 13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G T A C T C G T A T T A A A G G C A A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T G T C G C G A C G A A T T A G C C C A G G C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G T G T C C C T A G A T T C T C C A C C T T C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T G T A G G A G C T C T G A T T G A C G G G G T A T G T T G C T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C C C G A G T C A C A C C T A A C C G T C G T T C T T G T C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C C C C C G C A C A A C A C A C G C T T A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T A A G A T C T G A T G T A A T A A A A C T G C G G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T T C C G C C A A A C T G A G A T T G C A A A C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A G A G G T C G A A C A G T A T G A G C A A T A C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T A C G G C A A T G T G A T G T C T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G C C C C A C G C T G A T T C A A G G T G C A A A A C G C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G T T C G G T C G C C G C C A T C G A T A C T G C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C T G T C T G A G A T T G C A A A C A G A G G T C G A A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C A G T A T G A G C A A T A C T A C G G C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A A T G T G A T G T C T T G C C C C A C G C T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G A T T C A A G G T G C A A A A C G C G G T T C G G T C G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C C G C C A T T A C T A A C G C G C G T C A G A T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G C A A A C A G A G G T C G A A C A G T A T G A G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C A A T A C T A C G G C A A T G T G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A T G T C T T G C C C C A C G C T G A T T C A A G G T G C A A A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A C G C G G T T C G G T C A G T C G C C A T T A C T A A13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C G C G C G T C A G A T T G C A A A C A G A G G13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct T C G A A C A G T A T G A G C A A T A C T A C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G G C A A T G T G A T G T C T T G C C C C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A C G C T G A T T C A A G G T G C A A A A C G C G G T T C13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G G T C A G T C A A C C T A T T G G T G A T T A A T206 13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct A G A T T G C A A A C A G A G G T C G A A C A G T A T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G A G C A A T A C T A C G G C A A T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G T G G C G A C G C G C G G C G G T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct G A G G C T C A A T T T T C T C C G A C G T T T13002505v1Docket No.: 2017359-0091 Additional Nucleotide Sequence Construct C A A G A G A C T A C G A C T

[0300] In some embodiments, a host cell of the present disclosure comprising: (i) a transgene construct as described herein, and (ii) one or more additional constructs, produces a virion comprising the transgene construct encapsidated by a recombinant parvovirus capsid. In some embodiments, a host cell of the present disclosure comprising: (i) a transgene construct as described herein, and (ii) one or more additional constructs, produces a virion comprising the transgene construct encapsidated by a human bocavirus capsid. In some embodiments, a host cell of the present disclosure comprising: (i) a transgene construct as described herein, and (ii) 211 13002505v1Docket No.: 2017359-0091 one or more additional constructs, produces a virion comprising the transgene construct encapsidated by a human bocavirus capsid comprising a) a VP1 capsid polypeptide, fragment thereof, or variant thereof, b) a VP2 capsid polypeptide, fragment thereof, or variant thereof, c) a VP3 capsid polypeptide, fragment thereof, or variant thereof, or d) any combination thereof.

[0301] In some embodiments, a host cell of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) one or more recombinant parvovirus capsid polypeptides. In some embodiments, a host cell of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) one or more human bocavirus capsid polypeptides. In some embodiments, a host cell of the present disclosure comprises: (i) a transgene construct as described herein; and (ii) one or more human bocavirus capsid polypeptides, fragments thereof, or variants thereof, having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence listed in TABLE 12. V. METHODS

[0302] Among other things, the present disclosure provides methods. In some embodiments, a method comprises producing a virion described herein. In some embodiments, a method comprises purifying a virion described herein. In some embodiments, a method comprises characterizing a virion described herein. In some embodiments, a method comprises manufacturing a virion described herein.

[0303] In some embodiments, a method comprises introducing a composition as described herein into a cell of a subject. For example, provided herein are methods that in some embodiments include administering to a cell of a subject (e.g., an animal, e.g., a mammal, e.g., a primate, e.g., a human) a therapeutically effective amount of a virion, a population of virions, a pharmaceutical composition, or a cell of the present disclosure. A. Methods of Manufacture

[0304] Among other things, the present disclosure provides methods of manufacturing a virion described herein. 212 13002505v1Docket No.: 2017359-0091

[0305] In some embodiments, a virion is prepared using a standard transfection method comprising transfecting three plasmids into a cell culture, wherein the three plasmids include (i) a plasmid comprising Rep and capsid genes, (ii) a plasmid comprising helper genes, and (iii) a plasmid comprising a transgene encoding a therapeutic polypeptide. In some embodiments, virions are subsequently harvested from cell supernatants by centrifugation. In some embodiments, virions are harvested from cell lysates. In some embodiments, lysed cells are treated with protease. In some embodiments, virions are purified by CsCl gradient ultracentrifugation. In some embodiments, virions are purified by iodixanol density gradient ultracentrifugation. In some embodiments, purified virions are concentrated. In some embodiments, virions are buffer-exchanged. In some embodiments, chromatography (e.g., affinity chromatography, ion exchange chromatography, or reverse phase chromatography), may be used to purify a virion or population of virions.

[0306] In some embodiments a virion or population of virions of the present disclosure are formulated for delivery into a subject.

[0307] In some embodiments, the present disclosure provides, among other things, a method of making parvovirus-related compositions, preparations, constructs, virions, populations of virions, etc. In some embodiments, such methods include use of host cells.

[0308] In some embodiments, a host cell is a mammalian cell. In some embodiments, a mammalian cell is a human cell. In some embodiments, a mammalian cell is a HEK293T cell. In some embodiments, a mammalian cell is a K562 cell. In some embodiments, a mammalian cell is a lung cell. For example, in some embodiments, such methods include use of an exemplary transgene construct described herein (e.g., SEQ ID NO: 34, e.g., SEQ ID NO: 35, e.g., SEQ ID NO: 36) for production of compositions, preparations, constructs, virions, populations of virions, etc. in mammalian cells (e.g., HEK293T cells). For example, in some embodiments, such methods include use of an exemplary additional construct described herein (e.g., SED ID NO: 172, e.g., SED ID NO: 173, e.g., SED ID NO: 174, e.g., SED ID NO: 175, e.g., SED ID NO: 176, e.g., SED ID NO: 177) for production of compositions, preparations, constructs, virions, populations of virions, etc. in mammalian cells (e.g., HEK293T cells). 213 13002505v1Docket No.: 2017359-0091

[0309] In some embodiments, a virion may also be produced using, for example, a method described by Grieger et al (2016) Mol Ther 24: 287–297, the contents of which are incorporated by reference herein in its entirety).

[0310] In some embodiments, a host cell is an insect cell. In some embodiments, an insect cell is derived from a species of lepidoptera, e.g., Spodoptera frugiperda, Spodoptera littoralis, Spodoptera exigua, or Trichoplusiani. In some embodiments, an insect cell is an Sf9 cell. For example, in some embodiments, such methods include use of an exemplary transgene construct described herein (e.g., SEQ ID NO: 34, e.g., SEQ ID NO: 35, e.g., SEQ ID NO: 36) for production of compositions, preparations, constructs, virions, populations of virions, etc. in insect cells (e.g., Sf9 cells). For example, in some embodiments, such methods include use of an exemplary additional construct described herein (e.g., SED ID NO: 172, e.g., SED ID NO: 173, e.g., SED ID NO: 174, e.g., SED ID NO: 175, e.g., SED ID NO: 176, e.g., SED ID NO: 177) for production of compositions, preparations, constructs, virions, populations of virions, etc. in insect cells (e.g., Sf9 cells).

[0311] In some embodiments, a construct is a baculoviral construct, a viral construct, or a plasmid. In some embodiments, a construct is a baculoviral construct. In some embodiments, subclones of lepidopteran cell lines that demonstrate enhanced virion yield on a per cell or per volume basis are used. In some embodiments, modified lepidopteran cell lines with an integrated copy of NS1, Rep, VP, and / or construct genome, singly or in combinations, are used. The insect cell line, in some embodiments, is “cured” of endogenous or contaminating or adventitious insect viruses such as the Spodoptera rhabdovirus.

[0312] In some embodiments, the present disclosure provides a system in which (i) a heterologous transgene flanked by ITRs, (ii) one or more Rep genes, and (iii) one or more parvovirus capsid genes are introduced into insect host cells by infection with insect virus (e.g., baculovirus)-based constructs.

[0313] In some embodiments, provided herein are methods of producing a virion or a population of virions described herein. A number of constructs described herein may be consolidated by incorporating the structural and / or nonstructural genes into one or more constructs. In some embodiments, one or more parvovirus genomic sequences may also be integrated into a baculovirus genome to contain structural and / or nonstructural genes. In some 214 13002505v1Docket No.: 2017359-0091 embodiments, one or more parvovirus genomic sequences may also be integrated into a mammalian genome to contain structural and / or nonstructural genes. In some embodiments, one or more parvovirus structural genes may include one or more VP capsid polypeptide genes.

[0314] In some embodiments, provided herein are methods of producing a virion comprising a) a parvovirus VP1 capsid polypeptide, functional fragment thereof, or variant thereof; b) a parvovirus VP2 capsid polypeptide, functional fragment thereof, or variant thereof; c) a parvovirus VP3 capsid polypeptide, functional fragment thereof, or variant thereof; or d) any combination thereof. In some embodiments, provided herein are methods of producing a virion comprising a) a human bocavirus VP1 capsid polypeptide, functional fragment thereof, or variant thereof; b) a human bocavirus VP2 capsid polypeptide, functional fragment thereof, or variant thereof; c) a human bocavirus VP3 capsid polypeptide, functional fragment thereof, or variant thereof; or d) any combination thereof. B. Methods of Treatment

[0315] Among other things, in some embodiments, the present disclosure provides methods of using a composition, preparation, constructs, virion, population of virions, or host cell described herein to prevent or treat a disease or disorder. In some embodiments, provided herein are methods of preventing or treating a disease using a virion or pharmaceutical compositions described herein. In some embodiments, a virion disclosed herein delivers a transgene encoding a therapeutic polypeptide to a subject in need thereof. In some embodiments, expression of a virion-delivered transgene is transiently (e.g., a nucleic acid transduced by a virion is eventually lost after a certain period of expression). In some embodiments, a nucleic acid transduced by a virion stably integrates into the genome of transduced cells.

[0316] In some embodiments, provided herein are methods of preventing or treating a disease, comprising administering to a subject in need thereof an effective amount of a virion, population of virions, or pharmaceutical composition of the present disclosure. In some embodiments, provided herein are methods of preventing or treating a disease, comprising administering to a subject in need thereof an effective amount of a virion described herein comprising a transgene encoding a therapeutic polypeptide that increases or restores expression of a gene whose endogenous expression is aberrantly lower than expression in a healthy subject. 215 13002505v1Docket No.: 2017359-0091

[0317] In some embodiments, provided herein are methods of preventing or treating a disease, comprising: (a) obtaining a plurality of cells from a subject, (b) transducing the cells with a virion, population of virions, or pharmaceutical composition described herein, optionally selecting or screening for transduced cells, and (c) administering an effective amount of transduced cells to a subject. In some embodiments, transduced cells are autologous to a subject. In some embodiments, cells are autologous to a subject. In some embodiments, cells are allogeneic to a subject. Without wishing to be bound by any particular theory, there are advantages of preparing transduced cells in vitro or ex vivo. First, existence and location of a transgene in a target cell genome can be verified before administering them to a subject, thereby avoiding interfering with cell functions or off target effects and improving safety. Second, transduced cells can be administered to a subject in need thereof without a virion. This can eliminate any concern for triggering immune response or inducing neutralizing antibodies that may inactivate a virion. In some embodiments, transduced cells can be safely re-dosed or a dose can be titrated without any adverse effect.

[0318] Among other things, in some embodiments, provided herein are methods of preventing or treating a disease comprising standard of care measures used for gene therapies. In some embodiments, a virion or population of virions, a pharmaceutical composition, or transduced cells described herein can induce an immune response in a subject. In some embodiments, provided herein are methods of preventing or treating a disease, comprising, among other things, co-administering to a subject (1) an immune suppressant and / or a prophylactic and (2) a virion or population of virions, a pharmaceutical composition, or transduced cells described herein to mitigate an immune response.

[0319] In some embodiments, an immune suppressant and / or a prophylactic is administered to a subject prior to administering to a subject a virion or population of virions, a pharmaceutical composition, or transduced cells. In some embodiments, an immune suppressant and / or a prophylactic is administered to a subject after administering to a subject a virion or population of virions, a pharmaceutical composition, or transduced cells. In some embodiments, an immune suppressant and / or a prophylactic is administered to a subject at the same time as administering to a subject a virion or population of virions, a pharmaceutical composition, or transduced cells. 216 13002505v1Docket No.: 2017359-0091

[0320] In some embodiments, a method of preventing or treating a disease in a subject using a virion or population of virions, a pharmaceutical composition, or transduced cells described herein may result in improvement in a disease in the subject for at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 80 days, at least 85 days, at least 100 days, at least 105 days, at least 110 days, at least 115 days, at least 120 days, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months. In some embodiments, disease improvement may be assessed using any standard metrics for determining improvement in a disease described herein.

[0321] In some embodiments, the present disclosure provides a method of preventing or treating a CFTR deficiency or CFTR insufficiency in a subject. In some embodiments, a method comprises administering a virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells comprising a CFTR-encoding transgene described herein, to a subject in need thereof. In some embodiments, virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells is / are delivered to the lungs of a subject in need thereof via intranasal or intrapulmonary administration. In some embodiments, a virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells increase(s) expression of CFTR when administered to a subject in need thereof.

[0322] In some embodiments, the present disclosure provides a method of preventing or treating cystic fibrosis in a subject. In some embodiments, a method comprises administering a virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells comprising a CFTR-encoding transgene described herein, to a subject having cystic fibrosis. In some embodiments, virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells is / are delivered to the lungs of a subject in need thereof via intranasal or intrapulmonary administration. In some embodiments, a virion, population of virions, preparation, composition, pharmaceutical composition, or transduced cells increase(s) expression of CFTR when administered to a subject having cystic fibrosis. 217 13002505v1Docket No.: 2017359-0091

[0323] In some embodiments, virions described herein are naturally liver “de-targeted”. In some embodiments, virions described herein have low seroprevalence and immunotoxicity (e.g., as compared to AAV virions used in standard gene therapy). C. Methods of Delivering a Transgene to a Genomic Safe Harbor (GSH)

[0324] Among other things, in some embodiments, the present disclosure provides for a method of delivering a transgene encoding a therapeutic polypeptide to a genomic safe harbor (GSH).

[0325] Genomic safe harbors (GSH) are intragenic, intergenic, or extragenic regions of the human and model species genomes that are able to accommodate the predictable expression of newly integrated DNA without significant adverse effects on the host cell or organism. GSHs may comprise intronic or exonic gene sequences as well as intergenic or extragenic sequences. While not being limited to theory, a useful safe harbor should permit sufficient transgene expression to yield desired levels of the transgene-encoded protein or non-coding RNA. A GSH also should not predispose cells to malignant transformation, nor interfere with progenitor cell differentiation, nor significantly alter normal cellular functions. What distinguishes a GSH from a fortuitous good integration event is the predictability of outcome, which is based on prior knowledge and validation of a GSH.

[0326] Without wishing to be bound by any particular theory, the larger genome size of a virion described herein allows delivery of a transgene encoding a therapeutic polypeptide together with GSH sequences, which is otherwise not possible with virions having a limited genome size, e.g., AAV. In some embodiments, virions of the present disclosure facilitate delivery of a larger transgene (e.g., as compared to AAV) and facilitate safe delivery of the transgene by allowing codelivery of one or more GSH sequences that ensure predictable expression of the transgene without adverse effects on host cells. In some embodiments, exemplary GSHs that are targeted for transgene incorporation include (i) the adeno-associated virus site 1 (AAVS1), a naturally occurring, non-germline, site of integration of AAV virus DNA on chromosome 19; (ii) chemokine (C-C motif) receptor 5 (CCR5) gene, a chemokine receptor gene known as an HIV-1 coreceptor; (iii) human ortholog of the mouse Rosa26 locus, a locus extensively validated in the murine setting for the insertion of ubiquitously expressed transgenes; (iii) a T cell receptor locus (TCR), such as TCR alpha or TCR beta, and (iv) albumin in murine 218 13002505v1Docket No.: 2017359-0091 cells (see, e.g., U.S. Pat. Nos.7,951,925; 8,771,985; 8,110,379; and 7,951,925; U.S. Patent Publication Nos.2010 / 0218264; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983; 2013 / 0177960; 2015 / 0056705 and 2015 / 0159172; all of which are incorporated by reference). In some embodiments, GSHs may include Kif6, Pax5, collagen, HTRP, HI 1 (a thymidine kinase encoding nucleic acid at HI 1 locus), beta-2 microglobulin, GAPDH, TCR, RUNX1, KLHL7, NUPL2 or an intergenic region thereof, mir684, KCNH2, GPNMB, MIR4540, MIR4475, MIR4476, PRL32P21, LOC105376031, LOC105376032, LOC105376030, MELK, EBLN3P, ZCCHC7, RNF38, or loci meeting the criteria of a genome safe harbor as described herein (see e.g., WO 2019 / 169233 A1, WO 2017 / 079673 A1; incorporated by reference). GSHs described herein provide a non-limiting representation of GSHs that can be used with virions described herein.

[0327] In some embodiments, a GSH allows safe and targeted gene delivery that has limited off-target activity and minimal risk of genotoxicity, or causing insertional oncogenesis upon integration of foreign DNA, while being accessible to highly specific nucleases with minimal off-target activity.

[0328] In some embodiments, a GSH has any one or more of the following properties: (i) outside a gene transcription unit; (ii) located between 5-50 kilobases (kb) away from the 5' end of any gene; (iii) located between 5-300 kb away from cancer-related genes; (iv) located 5-300 kb away from any identified microRNA; and (v) outside ultra-conserved regions and long noncoding RNAs. In some embodiments, a GSH locus has any or more of the following properties: (i) outside a gene transcription unit; (ii) located >50 kilobases (kb) from the 5' end of any gene; (iii) located >300 kb from cancer-related genes; (iv) located >300 kb from any identified microRNA; and (v) outside ultra-conserved regions and long noncoding RNAs. In studies of lentiviral construct integrations in transduced induced pluripotent stem cells, analysis of over 5,000 integration sites revealed that -17% of integrations occurred in safe harbors. Virions that integrated into these safe harbors were able to express therapeutic levels of β-globin from their transgene without perturbing endogenous gene expression.

[0329] In some embodiments, a GSH is AAVS1. AAVS1 was identified as the adeno- associated virus common integration site on chromosome 19 and is located in chromosome 19 (position l9ql3.42) and was primarily identified as a repeatedly recovered site of integration of 219 13002505v1Docket No.: 2017359-0091 wild-type AAV in the genome of cultured human cell lines that have been infected with AAV in vitro. Integration in the AAVS1 locus interrupts the gene phosphatase 1 regulatory subunit 12C (PPP1R12C; also known as MBS85), which encodes a protein with a function that is not clearly delineated. The organismal consequences of disrupting one or both alleles of PPP1R12C are currently unknown. No gross abnormalities or differentiation deficits were observed in human and mouse pluripotent stem cells harboring transgenes targeted in AAVS1. Originally, AAV DNA integration into AAVS1 site was Rep-dependent, however, there are commercially available CRISPR / Cas9 reagents available for targeting which preserved the functionality of the targeted allele and maintained the expression of PPP1R12C at levels that are comparable to those in non- targeted cells. AAVS1 was also assessed using ZFN-mediated recombination into iPSCs or CD34+ cells.

[0330] As originally characterized, the AAVS1 locus is >4kb and is identified as chromosome 19 nucleotides 55,113,873-55,117,983 (human genome assembly GRCh38 / hg38) and overlaps with exon 1 of the PPP1R12C gene that encodes protein phosphatase 1 regulatory subunit 12C. This >4kb region is extremely G+C nucleotide content rich and is a gene-rich region of particularly gene-rich chromosome 19 (see FIG.1A of Sadelain et al, Nature Revs Cancer, 2012; 12; 51-58), and some integrated promoters can indeed activate or cis-activate neighboring genes, the consequence of which in different tissues is presently unknown. PPP1R12C exon 15’untranslated region contains a functional AAV origin of DNA synthesis indicated within a known sequence (Urcelay et al.1995).

[0331] AAVS1 GSH was identified by characterizing an AAV provirus structure in latently infected human cell lines with recombinant bacteriophage genomic libraries generated from latently infected clonal cell lines (Detroit 6 clone 7374 IIID5) (Kotin and Berns 1989), Kotin et al, isolated non-viral, cellular DNA flanking the provirus and used a subset of “left” and “right” flanking DNA fragments as probes to screen panels of independently derived latently infected clonal cell lines. In approximately 70% of the clonal isolates, AAV DNA was detected with the cell-specific probe (Kotin et al.1991; Kotin et al.1990). Sequence analysis of the pre- integration site identified near homology to a portion of the AAV inverted terminal repeat (Kotin, Linden, and Beerns 1992). Although lacking the characteristic interrupted palindrome, the 220 13002505v1Docket No.: 2017359-0091 AAVS1 locus retained the Rep binding elements and terminal resolution sites homologous to the AAV ITR (FIG.1A).

[0332] Selection of the exonic integration site is non-obvious, and perhaps counter- intuitive, since insertion and expression of foreign DNA likely disrupts expression of endogenous genes. Apparently, insertion of a AAV genome into this locus does not adversely affect cell viability or iPSC differentiation (DeKelver et al.2010; Wang et al.2012; Zou et al. 2011). AAVS1 locus is within the 5’ UTR of the highly conserved PPP1R12C gene. The Rep- dependent minimal origin of DNA synthesis is conserved in a 5’ UTR of a human, chimpanzee, and gorilla PPP1R12C gene. However, commercially available CRISPR / Cas9 reagents used for integrating DNA into AAVS1 target PPP1R12C intron 1 rather than an exon.

[0333] In some embodiments, a GSH is any one of Kif6, Pax5, collagen, HTRP, HI 1, beta-2 microglobulin, GAPDH, TCR, RUNX1, KLHL7, an intergenic region of NUPL2, mir684, KCNH2, GPNMB, MIR4540, MIR4475, MIR4476, PRL32P21, LOC105376031, LOC105376032, LOC105376030, MELK, EBLN3P, ZCCHC7, and RNF38.

[0334] In some embodiments, a GSH is a Pax 5 gene (also known as Paired Box 5, or "B-cell lineage specific activator protein," or BSAP). In humans PAX5 is located on chromosome 9 at 9p 13.2 and has orthologues across many vertebrate species, including, human, chimp, macaque, mouse, rat, dog, horse, cow, pig, opossum, platypus, chicken, lizard, xenopus, C . elegans, drosophila and zebrafish. PAX5 gene is located at Chromosome 9: 36,833,275-37,034,185 reverse strand (GRCh38:CM00067l.2) or 36,833,272-37,034,182 in GRCh37 coordinates.

[0335] Additional exemplary GSHs are listed in TABLE 21 and TABLE 22. TABLE 21: Exemplary GSH loci in Homo Sapiens (see, e.g., WO 2019 / 169232; herein incorporated by reference in its entirety) Gene Chromosomal location Accession number / location221 13002505v1Docket No.: 2017359-0091 MIR4475 GRCh38.p7 NC_000009.12 (36823539..36823599, (GCF_000001405.33) complement)222 13002505v1Docket No.: 2017359-0091 TABLE 22: Exemplary GSH loci (see, e.g., WO 2019 / 169232; herein incorporated by reference in its entirety) Intergenic Loci Taxonomic Brief Description Species Chromosomal location223 13002505v1Docket No.: 2017359-0091 D. Methods of Integration into a Target Genome

[0336] Among other things, in some embodiments, the present disclosure provides for a method of integration of a transgene encoding a therapeutic polypeptide into a target genome.

[0337] In some embodiments, integration into a target genome may be driven by cellular processes, such as homologous recombination or non-homologous end-joining (NHEJ). In some embodiments, integration may also be initiated and / or facilitated by an exogenously introduced nuclease. In some embodiments, a transgene within a virion described herein is integrated to a specific locus within the genome, e.g., a GSH. In some embodiments, a GSH is any locus that permits sufficient transgene expression to yield desired levels of the transgene-encoded protein or non-coding RNA. A GSH also should not predispose cells to malignant transformation nor significantly alter normal cellular functions. Site-specific integration to a GSH may be mediated by a nucleic acid homologous to a GSH that is placed 5ˈ and 3 ˈ to a nucleic acid to be integrated. Such homologous donor sequences may provide a template for homology-dependent repair that allows integration at the desired locus.

[0338] In some embodiments, a virion described herein comprises a nucleic acid comprising a nucleic acid sequence that is at least about 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to a nucleic acid sequence of a genomic safe harbor (GSH) of a target cell. In some embodiments, a nucleic acid that is at least about 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to a GSH is placed 5ˈ and 3 ˈ (homology arms) to a nucleic acid to be integrated, thereby allowing insertion (of a nucleic acid located between homology arms) to a specific locus in a target genome by homologous recombination. In some embodiments, a nucleic acid to be integrated is any one of a nucleic acids operably linked to a promoter described herein. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, 224 13002505v1Docket No.: 2017359-0091 Pax5, an intergenic region of NUPL2, collagen, HTRP, HI 1 (a thymidine kinase encoding nucleic acid at HI 1 locus), beta-2 microglobulin, GAPDH, TCR, RUNX1, KLHL7, mir684, KCNH2, GPNMB, MIR4540, MIR4475, MIR4476, PRL32P21, LOC105376031, LOC105376032, LOC105376030, MELK, EBLN3P, ZCCHC7, or RNF38. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, Pax5, or an intergenic region of NUPL2.

[0339] In some embodiments, a transgene of a virion described herein is integrated into a genome of a target cell upon transduction. In some embodiments, a nucleic acid is integrated into a GSH or EVE. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, Pax5, an intergenic region of NUPL2, collagen, HTRP, HI 1 (a thymidine kinase encoding nucleic acid at HI 1 locus), beta-2 microglobulin, GAPDH, TCR, RUNX1, KLHL7, mir684, KCNH2, GPNMB, MIR4540, MIR4475, MIR4476, PRL32P21, LOC105376031, LOC105376032, LOC105376030, MELK, EBLN3P, ZCCHC7, or RNF38. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, Pax5, or an intergenic region of NUPL2. In some embodiments, a transgene is integrated into a target genome by homologous recombination followed by a DNA break formation induced by an exogenously-introduced nuclease. In some embodiments, a nuclease is TALEN, ZFN, a meganuclease, a megaTAL, or a CRISPR endonuclease (e.g., a Cas9 endonuclease or a variant thereof). In some embodiments, a CRISPR endonuclease is in a complex with a guide RNA.

[0340] In some embodiments, provided herein are methods of integrating a transgene encoding a therapeutic polypeptide into a GSH in a cell, comprising: (a) transducing the cell with one or more virions described herein comprising a heterologous nucleic acid flanked at the 5’ end and 3’ end by a donor nucleic acid sequence that is at least about 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to the target GSH nucleic acid; or (b) transducing the cell with one or more virions described herein comprising (i) a heterologous nucleic acid flanked at the 5ˈ end and 3ˈ end by a donor nucleic acid sequence that is at least about 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 225 13002505v1Docket No.: 2017359-0091 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to a target GSH nucleic acid, and (ii) a nucleic acid encoding a nuclease (e.g., Cas9 or a variant thereof, ZFN, TALEN) and / or a guide RNA, wherein a nuclease or a nuclease / gRNA complex makes a DNA break at a GSH, which is repaired using a donor nucleic acid, thereby integrating a heterologous nucleic acid at a GSH. In some embodiments, (i) the heterologous nucleic acid flanked by a donor nucleic acid that is at least about 30%, 35%, 40%, 45%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to a target GSH nucleic acid and (ii) a nucleic acid encoding a nuclease and / or the gRNA are transduced in separate virions. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, Pax5, an intergenic region of NUPL2, collagen, HTRP, HI 1 (a thymidine kinase encoding nucleic acid at HI 1 locus), beta-2 microglobulin, GAPDH, TCR, RUNX1, KLHL7, mir684, KCNH2, GPNMB, MIR4540, MIR4475, MIR4476, PRL32P21, LOC105376031, LOC105376032, LOC105376030, MELK, EBLN3P, ZCCHC7, or RNF38. In some embodiments, a GSH is AAVS1, ROSA26, CCR5, Kif6, Pax5, or an intergenic region of NUPL2.

[0341] For integration of a nucleic acid located between the 5ˈ and 3ˈ homology arms, the 5ˈ and 3ˈ homology arms should be long enough for targeting to a GSH and allow (e.g., guide) integration into the genome by homologous recombination. To increase the likelihood of integration at a precise location and enhance the probability of homologous recombination, the 5ˈ and 3ˈ homology arms may include a sufficient number of nucleic acids. In some embodiments, the 5ˈ and 3ˈ homology arms may include at least 10 base pairs but no more than 5,000 base pairs, at least 50 base pairs but no more than 5,000 base pairs, at least 100 base pairs but no more than 5,000 base pairs, at least 200 base pairs but no more than 5,000 base pairs, at least 250 base pairs but no more than 5,000 base pairs, or at least 300 base pairs but no more than 5,000 base pairs. In some embodiments, the 5ˈ and 3ˈ homology arms include about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 226 13002505v1Docket No.: 2017359-0091 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500 base pairs. Detailed information regarding the length of homology arms and recombination frequency is art-known, see e.g., Zhang et al. "Efficient precise knock in with a double cut HDR donor after CRISPR / Cas9-mediated double-stranded DNA cleavage." Genome biology 18.1 (2017): 35, which is incorporated herein in its entirety by reference.

[0342] 5ˈ and 3ˈ homology arms may be any sequence that is homologous with a GSH target sequence in a genome of a host cell. In some embodiments, 5' and 3' homology arms may be homologous to portions of a GSH described herein. Furthermore, 5' and 3' homology arms may be non-coding or coding nucleotide sequences.

[0343] In some embodiments, 5' and / or 3' homology arms may be homologous to a sequence immediately upstream and / or downstream of the integration or DNA cleavage site on the chromosome. Alternatively, 5' and / or 3' homology arms can be homologous to a sequence that is distant from the integration or DNA cleavage site, such as at least 1, 2, 5, 10, 15, 20, 25, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more base pairs away from the integration or DNA cleavage site, or partially or completely overlapping with a DNA cleavage site (e.g., can be a DNA break induced by an exogenously- introduced nuclease). In some embodiments, a 3' homology arm of the nucleotide sequence is proximal to an ITR. VI. ADMINISTRATION

[0344] The present disclosure provides, among other things, therapeutic delivery systems for preventing or treating a disease or disorder. In some embodiments, the present disclosure provides a composition, preparation, construct, virion, population of virions, or host cell comprising a transgene construct encoding a therapeutic polypeptide. 227 13002505v1Docket No.: 2017359-0091 A. Routes of Administration

[0345] In some embodiments, the present disclosure provides various routes of and formulations for administration. In some embodiments, the present disclosure provides pharmaceutical forms suitable for injectable use including sterile aqueous solutions or dispersions; and sterile powders for extemporaneous preparation of sterile aqueous solutions or dispersions. In some embodiments, dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils.

[0346] In some embodiments, a pharmaceutical composition, preparation, construct, virion, population of virions, or host cell of the present disclosure contain a preservative to prevent growth of microorganisms (e.g., bacteria and fungi). In some embodiments, a form of administration is sterile and fluid to the extent that easy syringability exists. In some embodiments, a pharmaceutical composition or preparation of the present disclosure is stable under the conditions for manufacture and storage. In some embodiments, a pharmaceutical composition or preparation of the present disclosure comprises a pharmaceutically acceptable carrier. In some embodiments, a carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils. In some embodiments, proper fluidity may be maintained, for example, by use of a coating, such as lecithin, by maintenance of the required particle size in the case of dispersion and by use of surfactants. In some embodiments, a pharmaceutical composition or preparation of the present disclosure may include one or more antibacterial and / or antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In some embodiments, a pharmaceutical composition or preparation of the present disclosure comprises one or more isotonic agents, for example, sugars or sodium chloride.

[0347] In some embodiments, a pharmaceutical composition or preparation of the present disclosure may have prolonged absorption. In some embodiments, a pharmaceutical composition or preparation of the present disclosure comprises one or more agents delaying absorption, for example, aluminum monostearate or gelatin. In some embodiments, a pharmaceutical composition or preparation of the present disclosure may be suitably buffered. In some embodiments, a pharmaceutical composition or preparation of the present disclosure may 228 13002505v1Docket No.: 2017359-0091 be rendered isotonic with sufficient saline or glucose. In some embodiments, a pharmaceutical composition or preparation of the present disclosure may be suitable for intravenous, intramuscular, subcutaneous, and / or intraperitoneal administration. In some embodiments, a dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at a proposed site of infusion, (see for example, “Remington’s Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580, which is incorporated in its enti...

Claims

1. Docket No.: 2017359-0091 CLAIMS WHAT IS CLAIMED IS 1. A construct comprising an expression cassette, wherein the expression cassette comprises: (i) a 5ˈ inverted terminal repeat (ITR); (ii) a heterologous transgene encoding cystic fibrosis transmembrane conductance regulator (CFTR); and (iii) a 3ˈ ITR.

2. The construct of claim 1, wherein the 5ˈ ITR and / or the 3ˈ ITR is a dependoparvovirus ITR, a bocaparvovirus ITR, a protoparvovirus ITR, a tetraparvovirus ITR, an erythroparvovirus ITR, or a copiparvovirus ITR.

3. The construct of any one of claims 1 to 2, wherein the 5ˈ ITR and the 3ˈ ITR are dependoparvovirus ITRs.

4. The construct of any one of claims 1 to 3, wherein the 5ˈ ITR and the 3ˈ ITR are adeno- associated virus (AAV) ITRs.

5. The construct of any one of claims 1 to 4, wherein the 5ˈ ITR and the 3ˈ ITR are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 ITRs.

6. The construct of any one of claims 1 to 5, wherein the 5ˈ ITR and the 3ˈ ITR are AAV2 ITRs.

7. The construct of any one of claims 1 to 6, wherein the 5ˈ ITR comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

2. 280 13002505v1 Docket No.: 2017359-0091 8. The construct of any one of claims 1 to 7, wherein the 3ˈ ITR comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

3.

9. The construct of any one of claims 1 to 8, wherein the CFTR encoded by the heterologous transgene comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO:

6.

10. The construct of any one of claims 1 to 9, wherein the heterologous transgene comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO:

9.

11. The construct of any one of claims 1 to 10, wherein the heterologous transgene is operably linked at its 5ˈ end to a promoter.

12. The construct of claim 11, wherein the promoter comprises a chicken β-actin (CBA) promoter, a cytomegalovirus (CMV) promoter, a CAG promoter, or a CB7 promoter.

13. The construct of claim 11 or 12, wherein the promoter comprises a CBA promoter.

14. The construct of any one of claims 11 to 13, wherein the promoter comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

10.

15. The construct of claim 11, wherein the promoter is a tissue-specific promoter. 281 13002505v1 Docket No.: 2017359-0091 16. The construct of claim 11 or 15, wherein the promoter is a lung-specific promoter.

17. The construct of any one of claims 1 to 16, wherein the heterologous transgene is operably linked at its 3ˈ end to a polyadenylation signal.

18. The construct of claim 17, wherein the polyadenylation signal comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

12.

19. The construct of any one of claims 1 to 18, wherein the expression cassette further comprises an enhancer.

20. The construct of claim 19, wherein the enhancer comprises a CMV enhancer.

21. The construct of any one of claims 1 to 20, wherein the expression cassette further comprises one or more transcription regulatory elements.

22. The construct of claim 21, wherein the one or more transcription regulatory elements comprise an enhancer, a transcription termination sequence, a 5ˈ untranslated region (UTR), a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof.

23. The construct of any one of claims 1 to 22, wherein the expression cassette further comprises a Kozak sequence.

24. The construct of any one of claims 1 to 23, further comprising a Rep polypeptide-dependent origin of replication (ori). 282 13002505v1 Docket No.: 2017359-0091 25. The construct of claim 24, wherein the ori comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 21 or SEQ ID NO:

22.

26. The construct of any one of claims 1 to 25, further comprising a selection marker.

27. The construct of claim 26, wherein the selection marker is a kanamycin-resistance selection marker.

28. A construct comprising an expression cassette, wherein the expression cassette comprises: (i) a 5ˈ AAV2 ITR; (ii) a promoter; (iii) a heterologous transgene comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9; (iv) a polyadenylation signal; and (v) a 3ˈ AAV2 ITR.

29. The construct of claim 28, wherein the heterologous transgene comprises a polynucleotide having a sequence at least 90% identical to a sequence according to SEQ ID NO:

7.

30. The construct of claim 28 or 29, wherein the heterologous transgene comprises a polynucleotide having a sequence at least 90% identical to a sequence according to SEQ ID NO: 8, or SEQ ID NO: 9, and wherein the heterologous transgene is CpG depleted.

31. The construct of any one of claims 1 to 27, where the expression cassette is CpG depleted. 283 13002505v1 Docket No.: 2017359-0091 32. The construct of claim 31, wherein the expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

18.

33. The construct of claim 31 or 32, comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

34.

34. The construct of claim 31, wherein the expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

19.

35. The construct of claim 31 or 34, comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

35.

36. The construct of claim 31, wherein the expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

20.

37. The construct of claim 31 or 36, comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

36.

38. The construct of any one of claims 1 to 37, wherein the construct is single-stranded DNA. 284 13002505v1 Docket No.: 2017359-0091 39. The construct of any one of claims 1 to 37, wherein the construct is double-stranded DNA.

40. The construct of any one of claims 1 to 39, wherein the construct is linear.

41. The construct of any one of claims 1 to 39, wherein the construct is a circularized plasmid.

42. A virion comprising: (i) a construct of any one of claims 1 to 41; and (ii) one or more recombinant parvovirus capsid polypeptides.

43. The virion of claim 42, wherein the one or more recombinant parvovirus capsid polypeptides comprise a bocaparvovirus capsid polypeptide, a protoparvovirus capsid polypeptide, an erythroparvovirus capsid polypeptide, a tetraparvovirus capsid polypeptide, or a copiparvovirus capsid polypeptide.

44. The virion of claim 42 or 43, wherein the one or more recombinant parvovirus capsid polypeptides comprise a human bocavirus capsid polypeptide.

45. The virion of claim 44, wherein the human bocavirus capsid polypeptide comprises a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

37.

46. The virion of claim 44 or 45, wherein the human bocavirus capsid polypeptide comprises a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:40 or SEQ ID NO:

41. 285 13002505v1 Docket No.: 2017359-0091 47. The virion of any one of claims 44 to 46, wherein the human bocavirus capsid polypeptide comprises a VP3, fragment thereof, or variant thereof, capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 43 or SEQ ID NO:

44.

48. The virion of any one of claims 44 to 47, comprising: (i) a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 37; (ii) a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41; and (iii) a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: SEQ ID NO: 43 or SEQ ID NO:

44.

49. A population of virions of any one of claims 42 to 48.

50. A pharmaceutical composition comprising one or more virion of any one of claims 42 to 48, and a pharmaceutically acceptable carrier.

51. A pharmaceutical composition comprising a population of virions of claim 49, and a pharmaceutically acceptable carrier.

52. A cell comprising: (i) a construct of any one of claims 1 to 41; and (ii) one or more recombinant parvovirus capsid polypeptides. 286 13002505v1 Docket No.: 2017359-0091 53. The cell of claim 52, wherein the one or more recombinant parvovirus capsid polypeptides comprise a bocaparvovirus capsid polypeptide, a protoparvovirus capsid polypeptide, an erythroparvovirus capsid polypeptide, a tetraparvovirus capsid polypeptide, or a copiparvovirus capsid polypeptide.

54. The cell of claim 52 or 53, wherein the one or more recombinant parvovirus capsid polypeptides comprise a human bocavirus capsid polypeptide.

55. The cell of claim 54, wherein the human bocavirus capsid polypeptide comprises a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

37.

56. The cell of claim 54 or 55, wherein the human bocavirus capsid polypeptide comprises a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 40 or SEQ ID NO:

41.

57. The cell of any one of claims 54 to 56, wherein the human bocavirus capsid polypeptide comprises a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 43 or SEQ ID NO:

44.

58. The cell of any one of claims 54 to 57, comprising: (i) a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, 287 13002505v1 Docket No.: 2017359-0091 at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 37; (ii) a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 40 or SEQ ID NO: 41; and (iii) a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 43 or SEQ ID NO:

44.

59. A cell comprising: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising: (a) a second expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) one or more helper sequences; and (iii) a third construct comprising: (a) a third expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) a polynucleotide encoding one or more Rep polypeptides.

60. The cell of claim 59, wherein the heterologous transgene of the second expression cassette encodes one or more bocaparvovirus capsid polypeptides, protoparvovirus capsid polypeptides, erythroparvovirus capsid polypeptides, tetraparvovirus capsid polypeptides, or copiparvovirus capsid polypeptides.

61. The cell of claim 59 or 60, wherein the heterologous transgene of the second expression cassette encodes one or more human bocavirus capsid polypeptides. 288 13002505v1 Docket No.: 2017359-0091 62. The cell of claim 61, wherein the heterologous transgene of the second expression cassette encodes a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

40.

63. The cell of claim 61 or 62, wherein the heterologous transgene of the second expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

125.

64. The cell of any one of claims 61 to 63, wherein the heterologous transgene of the second expression cassette encodes a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

43.

65. The cell of any one of claims 61 to 64, wherein the heterologous transgene of the second expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

126.

66. The cell of any one of claims 61 to 65, wherein the heterologous transgene of the second expression cassette encodes: (i) a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 40; and (ii) a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, 289 13002505v1 Docket No.: 2017359-0091 at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 43, wherein the second expression cassette comprises one or more alternative start codons.

67. The cell of any one of claims 61 to 66, wherein the second expression cassette comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 125; and (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

126.

68. The cell of any one of claims 59 to 67, wherein the heterologous transgene of the second expression cassette is operably linked to a promoter.

69. The cell of claim 68, wherein the promoter comprises a CMV promoter, a CBA promoter, a CAG promoter, or a CB7 promoter.

70. The cell of claim 68 or 69, wherein the promoter comprises a CMV promoter.

71. The cell of any one of claims 68 to 69, wherein the promoter comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

11.

72. The cell of claim 68, wherein the promoter is a tissue-specific promoter.

73. The cell of claim 72, wherein the promoter is a lung-specific promoter. 290 13002505v1 Docket No.: 2017359-0091 74. The cell of any one of claims 59 to 71, wherein the second expression cassette further comprises an enhancer.

75. The cell of claim 74, wherein the enhancer comprises a CMV enhancer.

76. The cell of any one of claims 59 to 75, wherein the second expression cassette further comprises an SV40 intron.

77. The cell of any one of claims 59 to 76, wherein the second expression cassette further comprises one or more transcription regulatory elements.

78. The cell of claim 77, wherein the one or more transcription regulatory elements comprise an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof.

79. The cell of any one of claims 59 to 78, wherein the heterologous transgene of the second expression cassette is operably linked at its 3ˈ end to a polyadenylation signal.

80. The cell of claim 79, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal.

81. The cell of any one of claims 59 to 80, wherein the one or more helper sequences of the second construct comprise one or more adenovirus helper sequences.

82. The cell of any one of claims 59 to 81, wherein the one or more helper sequences of the second construct comprise one or more adenovirus 5 (Ad5) helper sequences.

83. The cell of claim 82, wherein the one or more Ad5 helper sequences comprise: (i) an Ad5 E2A sequence; (ii) an Ad5 E4 ORF1 sequence; (iii) an Ad5 E4 ORF2 sequence; 291 13002505v1 Docket No.: 2017359-0091 (iv) an Ad5 E4 ORF3 sequence; (v) an Ad5 E4 ORF6 sequence; (vi) an Ad5 E4 ORF6 / 7 sequence; or (vii) a combination thereof.

84. The cell of any one of claims 59 to 83, wherein the second construct further comprises a nucleotide sequence encoding a selection marker.

85. The cell of claim 84, wherein the selection marker of the second construct is a neomycin / kanamycin resistance selection marker.

86. A cell comprising: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising, (a) a second expression cassette, wherein the second expression cassette comprises, 1) a promoter, 2) one or more alternative start codons, 3) a heterologous transgene comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 125; and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 126, and 4) a polyadenylation signal, and (b) one or more helper sequences comprising, 1) an Ad5 E2A sequence, 292 13002505v1 Docket No.: 2017359-0091 2) an Ad5 E4 ORF1 sequence, 3) an Ad5 E4 ORF2 sequence, 4) an Ad5 E4 ORF3 sequence, 5) an Ad5 E4 ORF6 sequence, 6) an Ad5 E4 ORF6 / 7 sequence, or 7) a combination thereof; and (iii) a third construct comprising: (a) a third expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) a polynucleotide encoding one or more Rep polypeptides.

87. The cell of claim 86, wherein the second construct comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

173.

88. The cell of any one of claims 59 to 87, wherein the second construct is single-stranded DNA.

89. The cell of any one of claims 59 to 87, wherein the second construct is double-stranded DNA.

90. The cell of any one of claims 59 to 89, wherein the second construct is linear.

91. The cell of any one of claims 59 to 89, wherein the second construct is a circularized plasmid.

92. The cell of any one of claims 59 to 91, wherein the heterologous transgene of the third expression cassette encodes one or more bocaparvovirus capsid polypeptides, protoparvovirus capsid polypeptides, erythroparvovirus capsid polypeptides, tetraparvovirus capsid polypeptides, or copiparvovirus capsid polypeptides. 293 13002505v1 Docket No.: 2017359-0091 93. The cell of any one of claims 59 to 92, wherein the heterologous transgene of the third expression cassette encodes one or more human bocavirus capsid polypeptides.

94. The cell of claim 93, wherein the heterologous transgene of the third expression cassette encodes a VP1 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

37.

95. The cell of claim 93 or 94, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

127.

96. The cell of any one of claims 93 to 95, wherein the heterologous transgene of the third expression cassette encodes a VP2 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

41.

97. The cell of any one of claims 93 to 96, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

128.

98. The cell of any one of claims 93 to 97, wherein the heterologous transgene of the third expression cassette encodes a VP3 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

44. 294 13002505v1 Docket No.: 2017359-0091 99. The cell of any one of claims 93 to 98, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

129.

100. The cell of any one of claims 93 to 99, wherein the heterologous transgene of the third expression cassette encodes: (i) a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 47; (i) a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 41; and (ii) a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

44.

101. The cell of any one of claims 59 to 100, wherein the third expression cassette comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 127; (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 128, and (iii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

129. 295 13002505v1 Docket No.: 2017359-0091 102. The cell of any one of claims 59 to 101, wherein the heterologous transgene of the third expression cassette is operably linked to a promoter.

103. The cell of claim 102, wherein the promoter comprises a CMV promoter, a CBA promoter, a CAG promoter, or a CB7 promoter.

104. The cell of claim 102 or 103, wherein the promoter comprises a CMV promoter.

105. The cell of any one of claims 102 to 103, wherein the promoter comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

11.

106. The cell of claim 102, wherein the promoter is a tissue-specific promoter.

107. The cell of claim 102 or 106, wherein the promoter is a lung-specific promoter.

108. The cell of any one of claims 59 to 107, wherein the third expression cassette further comprises an enhancer.

109. The cell of claim 108, wherein the enhancer comprises a CMV enhancer.

110. The cell of any one of claims 59 to 109, wherein the third expression cassette further comprises an SV40 intron.

111. The cell of any one of claims 59 to 110, wherein the third expression cassette further comprises a Kozak sequence.

112. The cell of any one of claims 59 to 111, wherein the third expression cassette further comprises one or more transcription regulatory elements. 296 13002505v1 Docket No.: 2017359-0091 113. The cell of claim 112, wherein the one or more transcription regulatory elements comprise an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof.

114. The cell of any one of claims 59 to 113, wherein the heterologous transgene of the third expression cassette is operably linked at its 3ˈ end to a polyadenylation signal.

115. The cell of claim 114, wherein the polyadenylation signal is a bovine growth hormone polyadenylation signal.

116. The cell of any one of claims 59 to 115, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep polypeptide.

117. The cell of any one of claims 59 to 116, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 78 polypeptide.

118. The cell of any one of claims 59 to 117, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 78 protein comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

153.

119. The cell of any one of claims 59 to 118, wherein the polynucleotide encoding one or more Rep polypeptides comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

159.

120. The cell of any one of claims 117 to 119, wherein the polynucleotide encoding one or more Rep polypeptides is operably linked to an AAV2 promoter. 297 13002505v1 Docket No.: 2017359-0091 121. The cell of claim 120, wherein the AAV2 promoter is an AAV2 p5 promoter.

122. The cell of any one of claims 59 to 121, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 52 polypeptide.

123. The cell of any one of claims 59 to 122, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 52 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

155.

124. The cell of any one of claims 59 to 123, wherein the polynucleotide encoding one or more Rep polypeptides comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

161.

125. The cell of any one of claims 122 to 124 wherein the polynucleotide encoding one or more Rep polypeptides is operably linked to an AAV2 promoter.

126. The cell of claim 125, wherein the AAV2 promoter is an AAV2 p19 promoter.

127. The cell of any one of claims 59 to 126, wherein the polynucleotide encoding one or more Rep polypeptides encodes: (i) an AAV2 Rep 78 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 153; and (ii) an AAV2 Rep 52 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at 298 13002505v1 Docket No.: 2017359-0091 least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

155.

128. The cell of any one of claims 59 to 127, wherein the polynucleotide encoding one or more Rep polypeptides comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 159; and (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

161.

129. The cell of any one of claims 59 to 128, wherein the third construct further comprises a polynucleotide encoding a selection marker.

130. The cell of claim 129, wherein the selection marker of the third construct is a neomycin / kanamycin resistance selection marker.

131. A cell comprising: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising, (a) a second expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) one or more helper sequences; and (iii) a third construct comprising: (a) a third expression cassette, wherein the third expression cassette comprises, 1) a promoter, 299 13002505v1 Docket No.: 2017359-0091 2) a heterologous transgene comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 127; a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 128, and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 129, and 3) a polyadenylation signal, and (b) a polynucleotide encoding one or more Rep polypeptides, comprising, 1) one or more AAV2 promoters, 2) one or more alternative start codons, and 3) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 159; and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

161.

132. The cell of claim 131, wherein the third construct comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

174. 300 13002505v1 Docket No.: 2017359-0091 133. The cell of any one of claims 59 to 132, wherein the third construct is single-stranded DNA.

134. The cell of any one of claims 59 to 132, wherein the third construct is double-stranded DNA.

135. The cell of any one of claims 59 to 134, wherein the third construct is linear.

136. The cell of any one of claims 59 to 134, wherein the third construct is a circularized plasmid.

137. A method of producing a virion comprising contacting a cell with: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising: (a) a second expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) one or more helper sequences; and (iii) a third construct comprising: (a) a third expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) a polynucleotide encoding one or more Rep polypeptides.

138. The method of claim 137, wherein the heterologous transgene of the second expression cassette encodes one or more bocaparvovirus capsid polypeptides, protoparvovirus capsid polypeptides, erythroparvovirus capsid polypeptides, tetraparvovirus capsid polypeptides, or copiparvovirus capsid polypeptides.

139. The method of claim 137 or 138, wherein the heterologous transgene of the second expression cassette encodes one or more human bocavirus capsid polypeptides. 301 13002505v1 Docket No.: 2017359-0091 140. The method of claim 139, wherein the heterologous transgene of the second expression cassette encodes a VP2 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

40.

141. The method of claim 140, wherein the heterologous transgene of the second expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

125.

142. The method of claim 139, wherein the heterologous transgene of the second expression cassette encodes a VP3 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

43.

143. The method of claim 139 or 142, wherein the heterologous transgene of the second expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

126.

144. The method of any one of claims 139 to 143, wherein the heterologous transgene of the second expression cassette encodes: (i) a VP2 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 40; and (ii) a VP3 capsid polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 302 13002505v1 Docket No.: 2017359-0091 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

43.

145. The method of any one of claims 139 to 144, wherein the second expression cassette comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 125; and (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

126.

146. The method of any one of claims 137 to 145, wherein the heterologous transgene of the second expression cassette is operably linked to a promoter.

147. The method of claim 146, wherein the promoter comprises a CMV promoter, a CBA promoter, a CAG promoter, or a CB7 promoter.

148. The method of claim 146 or 147, wherein the promoter comprises a CMV promoter.

149. The method of claim 146 or 147, wherein the promoter comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

11.

150. The method of any one of claims 137 to 149, wherein the second expression cassette further comprises an enhancer.

151. The method of claim 150, wherein the enhancer comprises a CMV enhancer. 303 13002505v1 Docket No.: 2017359-0091 152. The method of any one of claims 137 to 151, wherein the second expression cassette further comprises an SV40 intron.

153. The method of any one of claims 137 to 152, wherein the second expression cassette further comprises one or more transcription regulatory elements.

154. The method of claim 153, wherein the one or more transcription regulatory elements comprise an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof.

155. The method of any one of claims 137 to 154, wherein the heterologous transgene of the second expression cassette is operably linked at its 3ˈ end to a polyadenylation signal.

156. The method of claim 155, wherein the polyadenylation sequence is a bovine growth hormone polyadenylation signal.

157. The method of any one of claims 137 to 156, wherein the one or more helper sequences of the second construct comprise one or more adenovirus helper sequences.

158. The method of any one of claims 137 to 157, wherein the one or more helper sequences of the second construct comprise one or more adenovirus 5 (Ad5) helper sequences.

159. The method of claim 158, wherein the one or more Ad5 helper sequences comprise: (i) an Ad5 E2A sequence; (ii) an Ad5 E4 ORF1 sequence; (iii) an Ad5 E4 ORF2 sequence; (iv) an Ad5 E4 ORF3 sequence; (v) an Ad5 E4 ORF6 sequence; (vi) an Ad5 E4 ORF6 / 7 sequence; or (vii) a combination thereof. 304 13002505v1 Docket No.: 2017359-0091 160. The method of any one of claims 137 to 159, wherein the second construct further comprises a polynucleotide sequence encoding a selection marker.

161. The method of claim 160, wherein the selection marker of the second construct is a neomycin / kanamycin resistance selection marker.

162. A method of producing a virion comprising contacting a cell with: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising, (a) a second expression cassette, wherein the second expression cassette comprises, 1) a promoter, 2) one or more alternative start codons, 3) a heterologous transgene comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 125; and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 126, and 4) a polyadenylation signal, and (b) one or more helper sequences comprising, 1) an Ad5 E2A sequence, 2) an Ad5 E4 ORF1 sequence, 3) an Ad5 E4 ORF2 sequence, 4) an Ad5 E4 ORF3 sequence, 5) an Ad5 E4 ORF6 sequence, 305 13002505v1 Docket No.: 2017359-0091 6) an Ad5 E4 ORF6 / 7 sequence, or 7) a combination thereof; and (iii) a third construct comprising: (a) a third expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and (b) a polynucleotide encoding one or more Rep polypeptides.

163. The method of claim 162, wherein the second construct comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

173.

164. The method of any one of claims 137 to 163, wherein the second construct is single- stranded DNA.

165. The method of any one of claims 137 to 163, wherein the second construct is double- stranded DNA.

166. The method of any one of claims 137 to 165, wherein the second construct is linear.

167. The method of any one of claims 137 to 165, wherein the second construct is a circularized plasmid.

168. The method of any one of claims 137 to 167, wherein the heterologous transgene of the third expression cassette encodes one or more bocaparvovirus capsid polypeptides, protoparvovirus capsid polypeptides, erythroparvovirus capsid polypeptides, tetraparvovirus capsid polypeptides, or copiparvovirus capsid polypeptides.

169. The method of any one of claims 137 to 168, wherein the heterologous transgene of the third expression cassette encodes one or more human bocavirus capsid polypeptides. 306 13002505v1 Docket No.: 2017359-0091 170. The method of claim 169, wherein the heterologous transgene of the third expression cassette encodes a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

37.

171. The method of claim 169 or 170, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

127.

172. The method of any one of claims 169 to 171, wherein the heterologous transgene of the third expression cassette encodes a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

41.

173. The method of any one of claims 169 to 172, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

128.

174. The method of any one of claims 169 to 173, wherein the heterologous transgene of the third expression cassette encodes a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

44. 307 13002505v1 Docket No.: 2017359-0091 175. The method of claim 174, wherein the heterologous transgene of the third expression cassette comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

129.

176. The method of any one of claims 169 to 175, wherein the heterologous transgene of the third expression cassette encodes: (i) a VP1 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 37; (i) a VP2 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 41; and (ii) a VP3 capsid polypeptide, fragment thereof, or variant thereof, comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

44.

177. The method of any one of claims 137 to 176, wherein the third expression cassette comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 127; (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 128, and 308 13002505v1 Docket No.: 2017359-0091 (iii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

129.

178. The method of any one of claims 137 to 177, wherein the heterologous transgene of the third expression cassette is operably linked to a promoter.

179. The method of claim 178, wherein the promoter comprises a CMV promoter, a CBA promoter, a CAG promoter, or a CB7 promoter.

180. The method of claim 178 or 179, wherein the promoter comprises a CMV promoter.

181. The method of any one of claims 178 or 179, wherein the promoter comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

11.

182. The method of claim 178, wherein the promoter is a tissue-specific promoter.

183. The method of claim 178 or 182, wherein the promoter is a lung-specific promoter.

184. The method of any one of claims 137 to 181, wherein the third expression cassette further comprises an enhancer.

185. The method of claim 184, wherein the enhancer comprises a CMV enhancer.

186. The method of any one of claims 137 to 185, wherein the third expression cassette further comprises an SV40 intron. 309 13002505v1 Docket No.: 2017359-0091 187. The method of any one of claims 137 to 186, wherein the third expression cassette further comprises a Kozak sequence.

188. The method of any one of claims 137 to 187, wherein the third expression cassette further comprises one or more transcription regulatory elements.

189. The method of claim 188, wherein the one or more transcription regulatory elements comprise an enhancer, a transcription termination sequence, a 5ˈ UTR, a 3ˈ UTR, a proximal promoter element, a locus control region, or a combination thereof.

190. The method of any one of claims 137 to 189, wherein the heterologous transgene of the third expression cassette is operably linked at its 3ˈ end to a polyadenylation signal.

191. The method of claim 190, wherein the polyadenylation sequence is a bovine growth hormone polyadenylation signal.

192. The method of any one of claims 137 to 191, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep polypeptide.

193. The method of any one of claims 137 to 192, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 78 polypeptide.

194. The method of any one of claims 137 to 193, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 78 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

153.

195. The method of any one of claims 137 to 194, wherein the polynucleotide encoding one or more Rep polypeptides comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 310 13002505v1 Docket No.: 2017359-0091 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

159.

196. The method of any one of claims 137 to 195, wherein the polynucleotide encoding one or more Rep polypeptides is operably linked to an AAV2 promoter.

197. The method of claim 196, wherein the AAV2 promoter is an AAV2 p5 promoter.

198. The method of any one of claims 137 to 197, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 52 polypeptide.

199. The method of any one of claims 137 to 198, wherein the polynucleotide encoding one or more Rep polypeptides encodes an AAV2 Rep 52 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

155.

200. The method of any one of claims 137 to 199, wherein the polynucleotide encoding one or more Rep polypeptides comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

161.

201. The method of any one of claims 198 to 200 wherein the polynucleotide encoding one or more Rep polypeptides is operably linked to an AAV2 promoter.

202. The method of claim 201, wherein the AAV2 promoter is an AAV2 p19 promoter.

203. The method of any one of claims 137 to 202, wherein the polynucleotide encoding one or more Rep polypeptides encodes: 311 13002505v1 Docket No.: 2017359-0091 (i) an AAV2 Rep 78 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 153; and (ii) an AAV2 Rep 52 polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

155.

204. The method of any one of claims 137 to 203, wherein the polynucleotide encoding one or more Rep polypeptides comprises: (i) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 159; and (ii) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

161.

205. The method of any one of claims 137 to 204, wherein the third construct further comprises a polynucleotide encoding a selection marker.

206. The method of claim 205, wherein the selection marker of the third construct is a neomycin / kanamycin resistance selection marker.

207. A method of producing a virion comprising contacting a cell with: (i) a construct of any one of claims 1 to 41; (ii) a second construct comprising: (a) a second expression cassette comprising a heterologous transgene encoding one or more recombinant parvovirus capsid polypeptides; and 312 13002505v1 Docket No.: 2017359-0091 (b) one or more helper sequences; and (iii) a third construct comprising: (a) a third expression cassette, wherein the third expression cassette comprises, 1) a promoter, 2) a heterologous transgene comprising a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 127; a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 128, and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO: 129, and 3) a polyadenylation signal, and (b) a polynucleotide encoding one or more Rep polypeptides, comprising, 1) one or more AAV2 promoters, 2) one or more alternative start codons, and 3) a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO: 159; and a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a sequence according to SEQ ID NO:

161.

208. The method of claim 207, wherein the third construct comprises a polynucleotide having a sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, 313 13002505v1 Docket No.: 2017359-0091 at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence according to SEQ ID NO:

174.

209. The method of any one of claims 137 to 208, wherein the third construct is single- stranded DNA.

210. The method of any one of claims 137 to 208, wherein the third construct is double- stranded DNA.

211. The method of any one of claims 137 to 210, wherein the third construct is linear.

212. The method of any one of claims 137 to 210, wherein the third construct is a circularized plasmid.

213. A method of preventing a CFTR deficiency or treating a subject having a CFTR deficiency or reduced expression of CFTR, comprising administering to the subject an effective amount of a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51.

214. The method of claim 213, wherein the effective amount of the virion, the population of virions, or the pharmaceutical composition is administered to the subject via inhalation or injection.

215. The method of claim 214, wherein inhalation comprises delivery of the effective amount of the virion, the population of virions, or the pharmaceutical composition in the form of an aerosol from a nebulizer or a pressurized container comprising a propellant.

216. The method of claim 215, wherein the propellant is carbon dioxide. 314 13002505v1 Docket No.: 2017359-0091 217. The method of claim 214, wherein injection comprises delivery of the effective amount of the virion, the population of virions, or the pharmaceutical composition via intravenous, subcutaneous, intramuscular, intradermal, or intraperitoneal injection.

218. A method of preventing a CFTR deficiency or treating a subject having a CFTR deficiency or reduced expression of CFTR, comprising: (i) obtaining a plurality of cells; (ii) transducing the plurality of cells with a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51 to produce transduced cells; and (iii) administering an effective amount of the transduced cells to the subject.

219. A method of characterizing a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51.

220. A method of manufacturing an intermediate of a virion of any one of claims 42 to 48, a population of virions of claim 49, a pharmaceutical composition of claim 50 or 51, or a cell of any one of claims 52 to 136.

221. The method of claim 220, wherein the intermediate can be stored or shipped.

222. A method of providing a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51, comprising assessing one or more characteristics of the virion, the population of virions, or the pharmaceutical composition and establishing one or more characteristics of the virion, the population of virions, or the pharmaceutical composition as compared to a reference sample.

223. A system comprising a cell of any one of claims 52 to 136. 315 13002505v1 Docket No.: 2017359-0091 224. A method comprising contacting a cell with a construct of any one of claims 1 to 41, a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51.

225. A virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51 for use in the prevention or treatment of a disease or disorder.

226. Use of a construct of any one of claims 1 to 41, for the manufacture of a medicament to prevent or treat a disease or disorder in a subject.

227. Use of a virion of any one of claims 42 to 48, for the manufacture of a medicament to prevent or treat a disease or disorder in a subject.

228. Use of a population of virions of claim 49, for the manufacture of a medicament to prevent or treat a disease or disorder in a subject.

229. A kit comprising a construct of any one of claims 1 to 41, a virion of any one of claims 42 to 48, a population of virions of claim 49, a pharmaceutical composition of claim 50 or 51, or a cell of any one of claims 52 to 136.

230. A method of restoring chloride current across a cell comprising contacting the cell with a construct of any one of claims 1 to 41, a virion of any one of claims 42 to 48, a population of virions of claim 49, or a pharmaceutical composition of claim 50 or 51.

231. The method of claim 230, wherein the chloride current is restored to a therapeutically relevant level. 316 13002505v1

Images