Constructs for improved AAV production
Stable integration of adenovirus late stage gene products like L4 in AAV production systems addresses inefficiencies in current methods, improving yield and consistency of rAAV production.
Patent Information
- Application Number
- PCT/US2025/048293
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-08-21
- Filing Date
- 2025-09-26
- Publication Date
- 2026-04-02
AI Technical Summary
Current methods for recombinant AAV production are inefficient, leading to low yield, high impurity, and variable product quality, with transient transfection systems resulting in heterogeneous populations and high production costs.
Stable integration of adenovirus late stage gene products, such as L4, into cells along with other necessary components for AAV production, using inducible promoters and recombinase systems to control expression and enhance rAAV production efficiency.
Increased production of packaged rAAV virions and improved product consistency, reducing toxicity to host cells and lowering production costs while enhancing scalability and reproducibility.
Smart Images

Figure US2025048293_02042026_PF_FP_ABST
Abstract
Description
CONSTRUCTS FOR IMPROVED AAV PRODUCTION CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 700,438, filed September 27, 2024, U.S. Provisional Application No. 63 / 770,966, filed March 12, 2025, and U.S. Provisional Application No. 63 / 868,268, filed August 21, 2025, each entitled “CONSTRUCTS FOR IMPROVED AAV PRODUCTION” the contents of which are incorporated by reference in their entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The content of the electronic sequence listing (324632001240seqlist.xml; Size: 1,337,517 bytes; and Date of Creation: September 24, 2025) is herein incorporated by reference in its entirety. INTRODUCTION
[0003] Adeno-associated virus (AAV) belongs to the Parvoviridae family and Dependovirus genus, of which some members require co-infection with a helper virus such as adenovirus to promote replication. AAV establishes a latent infection in the absence of a helper virus. AAV virions are composed of a 25 nm icosahedral capsid encompassing a 4.7 kb single-stranded DNA genome with two open reading frames: rep and cap. The non-structural rep gene encodes four AAV Rep proteins that are regulatory proteins essential for viral replication, whereas cap encodes three structural AAV Capsid proteins (Virion proteins 1-3 “VP1–VP3”) that assemble into a 60-mer capsid shell. This viral capsid mediates the ability of AAV vectors to overcome many of the biological barriers of viral transduction, including cell surface receptor binding, endocytosis, intracellular trafficking, and unpackaging in the nucleus.
[0004] There is a need in the art for better methods of recombinant AAV (rAAV) production that enhance AAV packaging efficiency to provide for delivery of a payload of interest by a rAAV virion to a cell. SUMMARY
[0005] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production are provided. In provided aspects, among the provided embodiments are polynucleotides, vectors, and systems of vectors or polynucleotides, and cells including the same, that include a polynucleotide that includes a coding sequence for a late gene (e.g., L4). In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to express one or more adenovirus late stage gene products. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells,and methods may be used to produce rAAV. Expression of one or more adenovirus late stage gene products may increase production of rAAV over polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods lacking expression of one or more adenovirus late stage gene products. BRIEF DESCRIPTION OF THE DRAWINGS
[0006] FIG. 1A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product (e.g., L4-22K and / or L4-33K proteins). In FIG.1A, Construct 4 includes a late stage gene product coding sequence, which is added to a “v1.3” system comprised of Constructs 1-3. In FIG. 1A, the constructs are in an “off” (i.e., uninduced) state. Construct 1 (also referred to as a helper construct) encodes adenovirus helper proteins (e.g., E2A IRES E4) operably linked to a doxycycline inducible promoter, such that a first triggering agent (e.g., tetracycline) may induce expression. To prevent leaky or unwanted expression of the helper proteins, a self-excisable element comprising a coding sequence of a recombinase (e.g., cre) is located upstream of the helper protein coding sequence. The coding sequence of the recombinase is downstream of the doxycycline inducible promoter. The boundaries of the self-excisable element are defined by recombination sites (e.g., lox sites; arrowheads in construct 1 of FIG. 1A) to excise the cre recombinase coding sequence. The cre recombinase includes an estrogen responsive element, which allows translocation of the cre recombinase with the addition of a second triggering agent (e.g., tamoxifen). As illustrated, Construct 1 further includes a VA-RNA coding sequence operably linked to a constitutive promoter (e.g., U6). The constitutive promoter is split into two parts, interrupted by an excisable element including a selectable marker gene (e.g., puromycin resistance) under the control of a constitutive promoter (e.g., CMV in Construct 1). In the presence of the second triggering agent, the cre recombinase excises the excisable element (e.g., the selectable marker gene encoding puromycin resistance) to rejoin the U6 promoter, thus allowing expression of the VA-RNA. Construct 2 (also referred to as a Rep / Cap construct) encodes AAV Rep and Cap proteins. The Rep coding sequence is under control of the native p5 and p19 promoters and is further interrupted by an intron comprising a 5’ splice site, a first recombination site, a first 3’ splice acceptor site, a BFP coding sequence, a second recombination site, and a second 3’ splice acceptor site. The Rep coding sequence further includes a heterologous (e.g., bovine growth hormone) polyA signal sequence and may include one or more enhancers. The AAV Cap coding sequence is operably linked to a tetracycline inducible promoter (e.g., p3) and a heterologous SV40 polyA signal sequence. Optionally, the Cap coding sequence is operably linked to one or more enhancers. The coding sequences for Cap and Rep proteins are separated by a transcription blocking element (TBE). Construct 2 further includes a first half of a split selectable marker (e.g., blasticidin) under the control of a constitutive (p4) promoter. In the absence of the first triggering agent (doxycycline), the Cap protein is not expressed. In the absence of the second triggering agent (tamoxifen), the Rep coding sequence generates a fusion protein between a first portion of the Repprotein and the BFP marker. In the presence of the first and second triggering agents, the Cap protein is expressed, as recombination within the excisable element removes the BFP marker and first 3’ splice acceptor site, thus allowing splicing between the 5’ splice site and the second 3' splice site and expression of the Rep protein. Construct 3 (also referred to as a payload construct) includes a sequence encoding a gene of interest flanked by inverted terminal repeats (ITRs) and a second half of a split selectable marker (e.g., blasticidin) under the control of a constitutive promoter (e.g., EF1alpha). When a cell comprises both Constructs 2 and 3, the two halves of the split blasticidin are expressed, thus allowing for selection for cells using blasticidin when Constructs 2 and 3 are integrated. In addition to the v1.3 system as described above, FIG. 1A illustrates a Construct 4 expressing an L4 construct. The L4 coding sequence is operably linked to an inducible promoter (e.g., tetracycline) and further comprises a selectable marker (e.g., hygromycin) under control of a constitutive promoter (e.g., EF1alpha). Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed.
[0007] FIG.1B. A v1.3 system plus the L4 construct in its “on” (i.e., induced) state. In FIG. 1B, the first triggering agent (doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase to translocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron (Construct 2), the self-excisable element (e.g., cre) in Construct 1 and the puromycin-containing excisable element in Construct 1. Absent the excisable elements, the Rep proteins and VA-RNA are expressed. Thus, rAAV can be produced by the cells comprising the v1.3 system and L4 construct.
[0008] FIG. 2A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product (e.g., L4-22K and / or L4-33K proteins). In FIG.2A, Construct 4 includes a late stage gene product coding sequence. In FIG. 2A, the constructs are in an “off” (i.e., uninduced) state. Construct 1 (also referred to as a helper construct) encodes adenovirus helper proteins (e.g., E2A IRES E4) operably linked to a doxycycline inducible promoter, such that a first triggering agent (e.g., tetracycline) may induce expression. To prevent leaky or unwanted expression of the helper proteins, a self-excisable element comprising a coding sequence of a cre recombinase is located upstream of the helper protein coding sequence. The coding sequence of the recombinase is downstream of the doxycycline inducible promoter. The boundaries of the self-excisable element are defined by recombination sites (lox sites; arrowheads in construct 1 of FIG. 2A) to excise the cre recombinase coding sequence. The cre recombinase includes an estrogen responsive element, which allows translocation of the cre recombinase with the addition of a second triggering agent (e.g., tamoxifen). As illustrated, Construct 1 further includes a VA-RNA coding sequence operably linked to a U6 constitutive promoter. The constitutive promoter is split into two parts, interrupted by an excisable element including a selectable marker gene (e.g., puromycin resistance) under the control of a constitutive promoter (e.g., CMV in Construct 1). In the presence of the second triggering agent, thecre recombinase excises the excisable element to rejoin the U6 promoter, thus allowing expression of the VA-RNA. Construct 2 (also referred to as a Rep / Cap construct) includes a polynucleotide for expression of Rep proteins and Cap proteins, wherein the coding sequences and promoters for the Rep proteins are separated from the coding sequence and promoter for the Cap proteins by a transcription blocking element (TBE) is depicted. An intron is inserted in the coding sequence for large Rep proteins, upstream of the small Rep coding sequence. A Conditional by Deletion (CODE) module is included in the intron. The CODE module includes a BFP marker sequence comprising a stop codon and lox sites that flank the BFP marker sequence comprising the stop codon. The stop codon in the CODE module results in truncated large Rep proteins that are non-functional, and therefore also non-toxic in their truncated forms, and prevents the expression of small Rep proteins. A heterologous promoter is inserted to drive expression of small Rep proteins but is notoperably linked to the small Rep coding sequence until the CODE module is excised following recombination of the lox sites. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably linked to the large Rep coding sequence and the TATA box of the P19 promoter is mutated. An exemplary bovine growth hormone (bGH) polyadenylation signal sequence (PolyA) and an exemplary enhancer are located downstream of the sequence encoding the Rep proteins. The TBE separates the Rep coding sequence from the Cap coding sequence. Expression of Cap is under the control of an inducible promoter (e.g., Tet-on promoter) and includes a polyadenylation signal sequence (PolyA) downstream of the sequence encoding the Cap proteins (Capsid). An exemplary polyadenylation signal sequence is an SV40 polyadenylation sequence. The polynucleotide also includes a selectable marker (e.g., antibiotic resistance gene) expressed under the control of a constitutive promoter (e.g., EF-1alpha attenuated promoter). In this example, the EF-1alpha promoter includes a mutated TATA box which reduces its activity resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic) and for preventing cellular toxicity due to leaky Rep protein expression. Construct 3 (also referred to as a payload construct) includes a sequence encoding a gene of interest flanked by inverted terminal repeats (ITRs) and a second half of a split selectable marker (blasticidin) under the control of a constitutive promoter (EF1alpha). When a cell comprises both Constructs 2 and 3, the two halves of the split blasticidin are expressed, thus allowing for selection for cells using blasticidin when Constructs 2 and 3 are integrated. In addition to the v1.4 system as described above, FIG.2A illustrates a Construct 4 expressing an L4 construct. The L4 coding sequence is operably linked to an inducible promoter (e.g., tetracycline) and further comprises a selectable marker (e.g., hygromycin) under control of a constitutive promoter (e.g., EF1alpha). Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed.
[0009] FIG. 2B. The system of FIG. 2A in its “on” (i.e., induced) state for rAAV production. In FIG. 2B, the first triggering agent (e.g., doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase totranslocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron (Construct 2), the self-excisable element (e.g., cre) in Construct 1 and the puromycin-containing excisable element in Construct 1. Absent the excisable elements, the Rep proteins and VA-RNA are expressed.
[0010] FIG. 3A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product (e.g., L4-22K and / or L4-33K proteins). In FIG.3A, Construct 4 includes a late stage gene product coding sequence. In FIG. 3A, the constructs are in an “off” (i.e., uninduced) state. Construct 1 (also referred to as a helper construct) encodes adenovirus helper proteins (e.g., E2A IRES E4) operably linked to a doxycycline inducible promoter, such that a first triggering agent (e.g., tetracycline) may induce expression. To prevent leaky or unwanted expression of the helper proteins, a self-excisable element comprising a coding sequence of a cre recombinase is located upstream of the helper protein coding sequence. The coding sequence of the recombinase is downstream of the doxycycline inducible promoter. The boundaries of the self-excisable element are defined by recombination sites (e.g., lox sites; arrowhead in construct 1 of FIG.3A) to excise the cre recombinase coding sequence. The cre recombinase includes an estrogen responsive element, which allows translocation of the cre recombinase with the addition of a second triggering agent (e.g., tamoxifen). As illustrated, Construct 1 further includes a VA-RNA coding sequence operably linked to a constitutive promoter (e.g., U6). The constitutive promoter is split into two part, interrupted by an excisable element including a selectable marker gene (e.g., puromycin resistance) under the control of a constitutive promoter (e.g., CMV in Construct 1). In the presence of the second triggering agent, the cre recombinase excises the excisable element to rejoin the U6 promoter, thus allowing expression of the VA-RNA. Construct 2 (also referred to as a Rep / Cap construct) includes a polynucleotide for expression of Rep proteins and Cap proteins, wherein the coding sequences and promoters for the Rep proteins are separated from the coding sequence and promoter for the Cap proteins by a transcription blocking element (TBE) as depicted. An intron is inserted in the coding sequence for large Rep proteins, upstream of the small Rep coding sequence. A Conditional by Deletion (CODE) module is included in the intron. The CODE module includes a BFP marker sequence comprising a stop codon and lox sites that flank the BFP marker sequence comprising the stop codon. The stop codon in the CODE module results in truncated large Rep proteins that are non-functional, and therefore also non-toxic in their truncated forms, and prevents the expression of small Rep proteins. A heterologous promoter is inserted to drive expression of small Rep proteins but is notoperably linked to the small Rep coding sequence until the CODE module is excised following recombination of the lox sites. The schematic further depicts that the P5 promoter is replaced with a heterologous promoter that is operably linked to the large Rep coding sequence and the TATA box of the P19 promoter is mutated. An exemplary bovine growth hormone (bGH) polyadenylation signal sequence (PolyA) and an exemplary enhancer are located downstream of the sequence encoding the Rep proteins. To limit leaky or unwanted expression of Rep proteins, a self- cleaving ribozyme is located between the Rep coding sequence and the bGH polyA signal sequence.The ribozyme facilitates degradation of Rep-encoding mRNA. The ribozyme is also flanked by recombination sites to allow excision by a recombinase. The TBE separates the Rep coding sequence from the Cap coding sequence. Expression of Cap is under the control of an inducible promoter (e.g., Tet-on promoter) and includes a polyadenylation signal sequence (PolyA) downstream of the sequence encoding the Cap proteins (Capsid). An exemplary polyadenylation signal sequence is an SV40 polyadenylation sequence. The polynucleotide also includes a selectable marker (e.g., antibiotic resistance gene) expressed under the control of a constitutive promoter (e.g., EF-1alpha attenuated promoter). In this example, the EF-1alpha promoter includes a mutated TATA box which reduces its activity resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic and for preventing cellular toxicity due to leaky Rep protein expression). Construct 3 (also referred to as a payload construct) includes a sequence encoding a gene of interest flanked by inverted terminal repeats (ITRs) and a second half of a split selectable marker (blasticidin) under the control of a constitutive promoter (EF1alpha). When a cell comprises both Constructs 2 and 3, the two halves of the split blasticidin are expressed, thus allowing for selection for cells using blasticidin when Constructs 2 and 3 are integrated. In addition to the v1.4.1 system as described above, FIG.3A illustrates a Construct 4 expressing an L4 construct. The L4 coding sequence is operably linked to an inducible (e.g., tetracycline) promoter and further comprises a selectable marker (e.g., hygromycin) under control of a constitutive promoter (e.g., EF1alpha). Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed.
[0011] FIG. 3B. The system of FIG. 3B in its “on” (i.e., induced) state for rAAV production. In FIG. 3B, the first triggering agent (e.g., doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase to translocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron in Construct 2, the ribozyme in Construct 2, the self-excisable element in Construct 1 (e.g., cre) and the puromycin-containing excisable element in Construct 1. Absent the excisable elements, the Rep proteins and VA-RNA are expressed.
[0012] FIG 4. An illustration of integration of an L4 construct at a Rogi-1 locus using a CRISPR- Cas9 system. The sequence for a CRISPR gRNA targeting a Rogi-1 safe harbor locus is shown with a vertical bar ‘|’ showing where the Cas9 nuclease cuts and the “TGG” PAM motif recognized by the Cas9 (SEQ ID NO: 266). The sequence of the Cas9 guide RNA sequence is set forth in SEQ ID NO: 407. The L4 construct comprises an insert flanked by left and right homology arms to allow insertion of the insert. The L4 insert comprises an L4 coding sequence and a marker gene. The L4 coding sequence is operably linked to an inducible promoter (Tet-on-3G) and an SV40 polyA signal sequence. The marker gene is operably linked to a constitutive promoter (EF1alpha) and a synthetic polyA signal sequence. In the illustrated inserts, a first insert comprises an antibiotic (e.g., hygromycin) resistancegene to allow for selection via antibiotics in media. The second illustrated insert comprises a fluorescent protein (e.g., eGFP), which can be used to identify and / or sort cells that have integrated the insert.
[0013] FIG 5. An exemplary multi-construct system, where Rep coding sequences and Cap coding sequences are present on independent constructs and multiple split selectable markers are used for selection. A first triggering agent is used for inducible promoters, including to induce expression of recombinase (e.g., cre) and L4 proteins. A second triggering agent is used to translocate the recombinase to the nucleus, where excision of excisable elements flanked by recombination sites then occurs. After the first and second triggering agents are added, the components for rAAV production are expressed by the cells. These components include AAV helper proteins (e.g., E2A and E4), non-coding transcripts for adenovirus replication (e.g., VA-RNA), AAV Rep proteins, AAV Cap proteins, and / or L4 proteins (e.g., L4-22K and / or L4-33K).
[0014] FIG. 6A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product (e.g., L4-22K and / or L4-33K proteins). In FIG. 6A, the L4 construct (i.e., Construct 4) includes a late stage gene product coding sequence, which is added to a system comprised of three constructs: 1) Construct 1: helper construct, 2) Construct 2: Rep / Cap construct, and 3) Construct 3: payload construct. In FIG. 6A, the constructs are in an “off” (i.e., uninduced) state. The helper construct encodes adenovirus helper proteins (e.g., E2A and E4) downstream of an inducible (e.g., doxycycline) promoter, such that a first triggering agent induces expression. To prevent leaky or unwanted expression of the helper proteins, a self-excisable element comprising a coding sequence of a recombinase (e.g., cre) is located upstream of the helper protein coding sequence. The coding sequence of the recombinase is downstream of the doxycycline inducible promoter. The boundaries of the self-excisable element are defined by recombination sites (e.g., lox sites; arrowheads in construct 1 of FIG. 6A) to excise the cre recombinase coding sequence. The cre recombinase includes an estrogen responsive element, which allows translocation of the cre recombinase with the addition of a second triggering agent (e.g., tamoxifen). Upon excision of the self- excisable element, the sequence encoding the helper proteins becomes operably linked to the inducible promoter. As illustrated, Construct 1 further includes a VA-RNA coding sequence operably linked to a constitutive promoter (e.g., U6). The constitutive promoter is split into two parts, interrupted by an excisable element including a selectable marker gene (e.g., puromycin resistance) under the control of a constitutive promoter (e.g., CMV promoter). In the presence of the second triggering agent, the cre recombinase excises the excisable element to rejoin the two parts of the U6 promoter, thus allowing expression of the VA-RNA. Construct 2 (also referred to as a Rep / Cap construct) encodes AAV Rep and Cap proteins. The Rep coding sequence is under control of the native p5 and p19 promoters and is further interrupted by an intron comprising a 5’ splice site, a first recombination site, a first 3’ splice acceptor site, a BFP coding sequence, a second recombination site, and a second 3’ acceptor splice site. The Rep coding sequence further includes a heterologous (e.g., bovine growth hormone) polyA signal sequence. The Rep coding sequence may include one or more enhancers downstream of the poly signalsequence. The AAV Cap coding sequence is operably linked to a tetracycline inducible promoter (e.g., p3) and a heterologous SV40 polyA signal sequence. The coding sequences for Cap and Rep proteins are separated by a transcription blocking element (TBE). Construct 2 further includes a first half of a split selectable marker (e.g., blasticidin) under the control of a constitutive (e.g., p4, such as an EF1alpha or mutant EF1alpha) promoter. In the absence of the first triggering agent (e.g., doxycycline), the Cap protein is not expressed. In the absence of the second triggering agent (e.g., tamoxifen), the Rep coding sequence generates a fusion protein between a first portion of the Rep protein and the BFP marker. In the presence of the first and second triggering agents, the Cap and Rep proteins are expressed, as recombination within the excisable element removes the BFP marker and first 3’ splice acceptor site, thus allowing splicing between the 5’ splice site and the second 3' splice site and expression of the Rep protein. Construct 3 (also referred to as a payload construct) includes a sequence encoding a gene of interest flanked by inverted terminal repeats (ITRs) and a second half of a split selectable marker (e.g., blasticidin) under the control of a constitutive promoter (e.g., EF-1alpha). When a cell comprises both Rep / Cap construct and the payload construct, the two halves of the split selectable marker are expressed, thus allowing for selection of cells using said selection marker when both constructs are integrated. Further, the system includes an L4 construct expressing L4 proteins (e.g., L4-22K and / or L4-33K proteins). The L4 coding sequence is operably linked to an inducible promoter and further comprises a selectable marker under control of a constitutive promoter. Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed.
[0015] FIG.6B. An exemplary system comprising the L4 construct in its “on” (i.e., induced) state (“off”, uninduced state is depicted in FIG.6A). In FIG.6B, the first triggering agent (e.g., doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase to translocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron (Construct 2), the self-excisable element in Construct 1 (e.g., cre) and the puromycin- containing excisable element in Construct 1. Absent the excisable elements, the helper proteins, the Rep proteins and VA-RNA are expressed. Thus, rAAV can be produced by the cells comprising the four- construct system.
[0016] FIG. 7A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product (e.g., L4-22K and / or L4-33K proteins). In FIG.7A, Construct 4 includes a late stage gene product coding sequence. In FIG. 7A, the constructs are in an “off” (i.e., uninduced) state. The constructs comprise components as described above in FIG.2A, but differ in that there is no enhancer downstream of the Cap coding sequence in Construct 2. The Rep coding sequence may include one or more enhancers.. The L4 coding sequence is operably linked to an inducible promoter and further comprises a selectable marker under control of a constitutive promoter. Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed in FIG.7A.
[0017] FIG. 7B. The system of FIG. 7A in its “on” (i.e., induced) state for rAAV production. In FIG. 7B, the first triggering agent (e.g., doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase to translocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron (Construct 2), the self-excisable element in Construct 1 (e.g., cre) and the puromycin-containing excisable element in Construct 1. Absent the excisable elements, the Rep proteins and VA-RNA are expressed.
[0018] FIG. 8A. An exemplary system of polynucleotides for the production of rAAV virions including using a late stage gene product. In FIG. 8A, Construct 4 includes a late stage gene product coding sequence. In FIG. 8A, the constructs are in an “off” (i.e., uninduced) state. The constructs comprise components as described above in FIG. 3A (e.g., a Rep / Cap construct, a Helper construct, and a payload construct), but differ in that there is no enhancer downstream of the Cap coding sequence in Construct 2. The Rep coding sequence may include one or more enhancers. The L4 coding sequence is operably linked to an inducible promoter and further comprises a selectable marker under control of a constitutive promoter. Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K proteins) are not expressed.
[0019] FIG. 8B. The system of FIG. 8A in its “on” (i.e., induced) state for rAAV production. In FIG. 8B, the first triggering agent (e.g., doxycycline) allows expression of the cre recombinase, L4 proteins, and Cap proteins. The second triggering agent (e.g., tamoxifen) allows the cre recombinase to translocate to the nucleus, where the cre recombinase excises the various excisable elements flanked by recombination sites—the BFP marker protein from the Rep intron in Construct 2, the ribozyme in Construct 2, the self-excisable element in Construct 1 (e.g., cre) and the puromycin-containing excisable element on Construct 1. Absent the excisable elements, the Rep proteins and VA-RNA are expressed.
[0020] FIG.9A shows the measured titer levels for rAAVs produced from cell lines expressing an L4 construct and v1.4.1 system constructs (e.g., system of polynucleotides) or from control cell lines expressing only v1.4.1 system and no L4 construct. Cells stably expressed the L4 construct and v1.4.1 system constructs (See, e.g., FIGS. 14A-14B). In the presence of a first triggering agent (e.g., doxycycline), the Tet-inducible promoters were activated, and transcription of the inducible recombinase and Cap proteins (AAV9 Cap (Cap9)) was induced. In the presence of a second triggering agent (e.g., tamoxifen), the Cre-ERT2 translocated to the nucleus and induced recombination of the lox sites flanking each of the excisable elements. Following recombination induced by the first and second triggering agents, the excisable elements stably integrated in the cells were excised, thereby enabling the expression of the full-length AAV Rep proteins, the AAV helper proteins (e.g., E2A and E4), and VA-RNA. Together, expression of the AAV Cap proteins, AAV Rep proteins, AAV helper proteins, and VA-RNA induced rAAV production and encapsidation of the payload. Titer levels of the payload (vg) and the capsid (vp) per milliliter (mL) were determined using droplet digital PCR and ELISA.
[0021] FIG. 9B shows the titer for rAAVs produced from different clones expressing AAV9 L4 stable cell lines (e.g., cells stably expressed an L4 construct, a helper construct, a Rep / Cap construct (AAV9 Cap (Cap9)), and a payload construct). These AAV9 stable cell lines expressed constructs of system v1.4.1 as described in FIG.9A.
[0022] FIG. 10 shows the titer for rAAVs produced from cell lines expressing different versions of vectors for rAAV production from systems: v1.0, v1.2, v1.3, v1.4, or v1.4.1. Both AAV5 and AAV9 stable cell lines were tested. Mammalian cells were stably transfected with either an inducible rAAV system encoding AAV5 Cap (Cap5) or an inducible rAAV system encoding AAV9 Cap (Cap9). AAV5 stable cell lines expressed a helper construct, a Rep / Cap construct, and a payload construct (v1.0, v1.2, v1.3, or v1.4). AAV9 stable cell lines expressed an L4 construct, a helper construct, a Rep / Cap construct, and a payload construct (of system v1.4.1). The AAV9 L4 stable cell line expressed v1.4.1. Titer levels of the payload (vg) and the capsid (vp) per milliliter (mL) were determined using droplet digital PCR and ELISA.
[0023] FIG. 11 shows the titer for rAAVs produced from cell lines stably expressing vectors for rAAV production or rAAV produced from cell lines that were transiently transfected. AAV9 stable cell lines expressed an L4 construct, a helper construct, a Rep / Cap construct, and a payload construct (stable cell lines expressed constructs of v1.4.1). Cells stably expressed the L4 construct and v1.4.1 system constructs (see, e.g., FIGS 14A-14B), which in the presence of a first triggering agent (e.g., doxycycline), the Tet-inducible promoters were activated, and transcription of the inducible recombinase and Cap proteins (AAV9 Cap (Cap9)) was induced. In the presence of a second triggering agent (e.g., tamoxifen), the Cre-ERT2 translocated to the nucleus and induced recombination of the lox sites flanking each of the excisable elements. Following recombination induced by the first and second triggering agents, the excisable elements stably integrated in the cells were excised, thereby enabling the expression of the full-length AAV Rep proteins, the AAV helper proteins (e.g., E2A and E4), and VA-RNA. Together, expression of the AAV Cap proteins, AAV Rep proteins, AAV helper proteins, and VA-RNA induced rAAV production and encapsidation of the payload. Titer levels of the payload (vg) per milliliter (mL) were determined using droplet digital PCR and the capsid (vp) per milliliter (mL) were determined using ELISA.
[0024] FIG.12 shows the titer levels produced from rAAV production runs of different scale. Cell lines stably expressed vectors for rAAV production of AAV with serotype AAV5 or AAV9. The AAV5 stable cell lines expressed a helper construct, a Rep / Cap construct, and a payload construct of systems v1.3, v1.4, or v1.4.1. The AAV9 stable cell lines expressed an L4 construct, a helper construct, a Rep / Cap construct, and a payload construct (constructs of system v1.4.1). Titer levels of the payload (vg) per milliliter (mL) were determined using droplet digital PCR (left bar of the two bars per production run). Titer levels of capsid (vp) per milliliter (mL) were determined using ELISA (right bar of the two bars per production run). Titer production was measured from rAAV production runs usingbioreactors (BRX) or shake flasks (SF). The exemplary payload (GOI; gene of interest) progranulin (PGRN) was used.
[0025] FIGS.13A-13B show an exemplary schematic of constructs of a v1.4 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced (FIG. 13A, v1.4 uninduced). The induced constructs, once the first triggering agent and the second triggering agent are added, are shown in FIG. 13B, v1.4 induced. rAAV is produced after induction by the first triggering agent and the second triggering agent. Construct 1: helper construct; Construct 2: Rep / Cap construct; Construct 3: payload construct; Construct 4: L4 construct.
[0026] FIGS. 14A-14B show an exemplary schematic of constructs of a v1.4.1 system for inducibly producing rAAV. In absence of the first triggering agent and the second triggering agent, the system is in an off state, in which rAAV is not produced (FIG. 14A, v1.4.1 uninduced). The induced constructs, once the first triggering agent and the second triggering agent are added, are shown in FIG. 14B, v1.4.1 induced. rAAV is produced after induction by the first triggering agent and the second triggering agent. Construct 1: helper construct; Construct 2: Rep / Cap construct; Construct 3: payload construct; Construct 4: L4 construct.
[0027] FIG. 15 depicts plots indicating the percent cell viability of P1 cells (left), P1 cells containing knock-in of an L4 construct (P1 L4; middle), or P2 cells (right) with either 4 or 7 KOs, as compared to control P2 cells (P2 clone A or B), for 7 days following induction of recombinant AAV (rAAV) production.
[0028] FIG. 16 depicts plots indicating the percent cell viability of engineered P2 cell lines containing 1, 7, or 8 KOs, as compared to control P2 cells (P2 clone A or B) without addition of chemical pan-caspase zVAD.fmk (left) or with addition of zVAD.fmk (right) following induction of rAAV production.
[0029] FIG. 17A depicts plots showing the rAAV titer from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KOs, 7 KOs, or 8 KOs with or without addition of chemical pan-caspase zVAD.fmk 4 or 6 days following induction.
[0030] FIG. 17B depicts plots showing levels of human genomic DNA encapsidated in rAAVs, as measured by copies of Alu, from different engineered P2 cell lines derived from two clones (A; left or B; right) containing no KOs (WT), 1 KO, 7 KOs, or 8 KOs with or without addition of chemical pan- caspase zVAD.fmk 4 or 6 days following induction.
[0031] FIG. 18A depicts plots showing percent cell viability (top), total AAV titer (middle), and level of human genomic DNA encapsidated in rAAVs (bottom) in either wild-type (WT) cells or an engineered cell line containing 7 KOs derived from two different clones of P2 cells.
[0032] FIG. 18B depicts plots showing percent cell viability (top), total AAV titer (middle), and level of human genomic DNA encapsidated in rAAVs (bottom) in either wild-type (WT) cells, cellsnucleofected with ribonucleic proteins (RNPs) containing a scrambled gRNA, or engineered cell line containing either: (a) a CASP3 single KO, (b) a IFNAR1 single KO, or (c) a BAX BAK1 double KO. DETAILED DESCRIPTION
[0033] Polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods for improving recombinant adeno-associated virus (rAAV) production are provided. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to express one or more adenovirus late stage gene products. In certain aspects, these polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods may be used to produce rAAV. Expression of one or more adenovirus late stage gene products may increase production of rAAV over polynucleotides, vectors, systems of vectors or polynucleotides, cells, and methods lacking expression of one or more adenovirus late stage gene products.
[0034] The gene therapy industry is an ever-growing therapeutic approach, and AAV is the dominant delivery vehicle. Yet, current approaches to rAAV manufacturing are inefficient. Many existing methods rely on transient expression systems, and in particular on triple transient transfection of a helper plasmid construct, a Rep / Cap construct, and a construct encoding a gene of interest (“payload”). The most widely used method for producing rAAV virions is based on the helper-virus- free transient transfection of multiple plasmids, typically a triple transfection, into adherent cell lines. Often transient transfections result in mixed populations of transfected cells where only some of the cells are actually transfected with all plasmid constructs. The system can result in a heterogenous viral product and / or result in a product that is severely limited due to low yield, high impurity, lack of consistent scalability and reproducibility, and unsustainable production costs. Moreover, these problems can lead to requiring high doses of rAAV for therapeutic applications, which can lead to toxic therapies.
[0035] Although there is ongoing investment to increase production capacity, current AAV manufacturing processes are inefficient and expensive. In addition, they result in variable product quality, with low levels of encapsidation of a payload, such as a therapeutic payload. Therefore, there is a need for new and improved methods to overcome these challenges while balancing the need for robust expression of the AAV proteins required for rAAV production with the toxicity of these proteins to the host production cell.
[0036] The provided embodiments address these problems. The provided embodiments provide a system in which cells are transfected with an adenovirus late stage gene product for improved AAV production. In particular embodiments, the late stage gene product is stably integrated into cells along with other necessary components for AAV production, such as coding sequences for Rep, Cap and helper proteins. Expression of one or more adenovirus late stage gene products is useful in increasing packaged virions during the production of recombinant AAV. Expression of one or more adenoviruslate stage gene products is useful in increasing both total virions and packaged virions during the production of recombinant AAV.
[0037] In particular embodiments, the late stage gene product is L4. It is surprisingly found herein L4 is an important viral helper factor for efficient capsid mRNA production in a number of AAV serotypes. The improvement in percentage of filled capsids was seen for AAV serotypes beyond AA5, including AAV9. As a result, integration of this helper factor enabled high-titer production of multiple AAV serotypes. In some embodiments, it is believed that the helper protein may be required to boost splicing of capsid mRNA, particular for non-AAV5 serotypes. In such aspects, L4 is a helper gene that is transcribed and spliced to one or more isoforms, which generate an L4-22K and L4-33K protein that then can act as a splicing factor to activate splicing of mRNAs that contain weak 3’ splice acceptor sites. Results herein demonstrate substantial improvement in titer when L4 is expressed in AAV production cell lines compared to when it is absent, across different serotypes including AAV9. Strikingly, results herein show an improvement in titer with greater than 800-fold improvement of viral genomes and greater than 100-fold improvement in viral particles. Further embodiments demonstrate the stable integration of L4 in cell lines that allow for efficient and consistent L4 expression, including in an inducible manner, in connection with AAV production systems.
[0038] In some aspects, the constructs provided herein are for regulated expression of one or both of L4-22K and L4-33K proteins for use in adeno-associated virus production. Results herein demonstrate that the expression of one or both of L4-22K and L4-33K proteins in the cell line used for rAAV production improves rAAV production. In some embodiments, the L4-22K and L4-33K proteins further increase AAV Rep protein and AAV Cap protein expression. In some embodiments, L4-22K and L4-33K protein expression increases titer levels as compared to conditions without L4-22K and L4-33K protein expression. In some embodiments, L4-22K and L4-33K protein expression increases encapsidation percent as compared to conditions without L4-22K and L4-33K protein expression. In some embodiments, L4-22K and L4-33K protein expression increases rAAV production as compared to conditions without L4-22K and L4-33K protein expression. In some embodiments, L4-22K and L4- 33K protein expression increases vg / ml and vp / ml as compared to conditions without L4-22K and L4- 33K protein expression. In some embodiments, L4-22K and L4-33K protein expression increases production of infectious virus particles as compared to conditions without L4-22K and L4-33K protein expression.
[0039] In some aspects, L4-22K and L4-33K protein expression improves rAAV production in all serotypes. In some embodiments, L4-22K and L4-33K proteins are expressed in serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV.rh46. In some embodiments, L4-22K and L4-33K proteins are expressed in AAV9. The described embodiments provide for systems that allow for a swappable capsid in for production methods that can be used to for any of a variety of AAV serotypes.
[0040] In provided embodiments as described, the system also allows for stable integration of all genetic elements required for AAV production into host cells. As described, this can be achieved by using cell selections (e.g., antibiotic selection) for stable cell clones from polyclonal pools, allowing generation of a monoclonal cell line for each gene of interest (payload) system that expresses all plasmids for AAV production, such as following single cell seeding, outgrowth and expansion and screening for high expressing clones. Moreover, exquisite control of viral gene expression also is achieved using various inducible systems. This means that toxic elements can be kept fully silenced (e.g., not transcribed) until induced when there is peak cell density and fitness. In the uninduced or off state, viral genes that normally can be toxic to host cells, such as E2A and E4 helper proteins, Rep proteins and Cap proteins, are not expressed. However, in the induced state, the viral genes (e.g., expressing E2A and E4 helper proteins, Rep proteins, and Cap proteins) are allowed to be expressed resulting in highly efficient virion production. Among provided aspects, the system allows high titer production of as much as 1.5e12vg / L or more including a titer of greater than 1.5e13vg / L or greater than 1.5e14vg / L. For example, in provided aspects, the system allows high titer production of as much as 1.5e14vg / L or more including a titer of greater than 2e14vg / L, greater than 3e14vg / L, greater than 4e14vg / L, greater than 5e14vg / L and higher. In provided aspects, the system also allows an increase in filled capsids, with a packaging efficiency of greater than 15%, greater than 20%, greater than 25%, greater than 30%, greater than 35%, greater than 40%, greater than 50%, greater than 60%, greater than 70% or more, even pre-purification. In some embodiments, such packaging efficiency (e.g., with as much as 70% packaging efficiency) can be achieved while maintaining the high Vg titers. As a result, the provided systems allow for manufacturing processes to produce rAAV more efficiently, in a shorter amount of time, more consistently and with a high robustness of titer and packaging, thereby allowing for decreased dose (e.g., rAAV dose), decreased cost (e.g., decreased cost in production and manufacturing of rAAV), lower toxicity / adverse effects, and / or consistent patient dosing. Compared to methods using transient transfection, the systems allow for as much as multiple-fold improvements in manufacturing productivity as determined by increased yield (e.g., titer (vg / mL) from cell lysates), increased quality (e.g., percent packaging efficiency pre-purification), and increased performance (e.g., high-yield payload expression of transduced cells). For example, the increased yield can be greater than 10-fold, greater than 20-fold, greater than 30-fold or more final product per production volume. The improvements can be seen across AAV serotypes, including AAV9, AAV5, AAV2, and other serotypes as described herein.
[0041] Before the present polynucleotides, vectors, systems, cells, and methods are described, it is to be understood that this invention is not limited to particular methods or components described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0042] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction.
[0044] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method may be carried out in the order of events recited or in any other order which is logically possible.
[0045] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells, and reference to "the vector" includes reference to one or more vectors and equivalents thereof, such as viral vectors, plasmids, constructs, and the like, known to those skilled in the art, and so forth.
[0046] It must be noted that as used herein and in the appended claims, references to numerical order—e.g., “first,” “second,” “third,” etc.—may be used for convenience to differentiate between similar components or features. Such reference is for purpose of distinguishing the components being referred to. Unless mandated by the text or context, such references to order should not be considered to force order on any such component. It also is understood that reference to such distinguishing terms is non-limiting and does not mean that such a number of components is necessarily present or present in any particular order.
[0047] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates ofpublication provided may be different from the actual publication dates which may need to be independently confirmed. I. DEFINITIONS
[0048] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which the invention pertains.
[0049] The term "about", particularly in reference to a given quantity, is meant to encompass deviations of up to plus or minus five percent.
[0050] "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The components of the AAV DNA genome consists of two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). Rep gene encodes multiple distinct proteins including Rep78, Rep68, Rep52, and Rep40. These proteins are also referred to herein as Rep proteins or Rep and may encompass one or more of Rep78, Rep68, Rep52, and Rep40 and functional variants thereof and homologs thereof. Rep78 and Rep68 and functional variants thereof and homologs thereof are referred to herein as large Rep. Rep52 and Rep40 and functional variants thereof and homologs thereof are referred to herein as small Rep. Rep proteins from an AAV of a particular serotype may also be referred to as Rep1, Rep2, etc. where the Rep protein is derived from an AAV1 or an AAV2 serotype, respectively. Cap gene encodes capsid proteins VP1, VP2, and VP3 required for production of rAAV capsids. These proteins are also referred to herein as Cap proteins or Cap and may encompass one or more of VP1, VP2, and VP3 and functional variants thereof and homologs thereof. Cap proteins from an AAV of a particular serotype may also be referred to as Cap1, Cap2, Cap4, etc. where the Rep protein is derived from an AAV1, an AAV2, or an AAV5 serotype, respectively. In addition to Rep and Cap, AAV requires a helper plasmid containing genes from a helper virus such as adenovirus, including E1a, E1b, E4, E2a, and VA genes for AAV replication.
[0051] "Recombinant virus" is meant to describe a virus that has been genetically altered, e.g., by the addition or insertion of a heterologous nucleic acid construct into the virus.
[0052] The abbreviation "rAAV" refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector"). The term “AAV” includes any AAV serotype as well as AAV vectors based on the combination of different serotypes (also referred to as "hybrid AAV vectors" or "pseudotype AAV vectors"). AAV serotype may be AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV-10), AAV type 11 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, AAV-7m8, AAV-6.2, AAV-Dj, AAV-DJ / 8, AAV2-retro, AAV2-QuadYF and AAV2.7m8, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV-PHP.eB, AAV-PHP.eS, evolved capsids that are less immunogenic to mice and humans, and variants thereof and combinationsthereof. “Primate AAV” refers to AAV isolated from a primate, “non-primate AAV” refers to AAV isolated from a non-primate mammal, “bovine AAV” refers to AAV isolated from a bovine mammal (e.g., a cow), etc. An "rAAV vector" comprises a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a polynucleotide sequence of interest for introducing into a target cell. In general, the heterologous polynucleotide is flanked by at least one, and usually by two AAV inverted terminal repeat sequences (ITRs). The heterologous polynucleotide can also be referred to as a polynucleotide payload. The term rAAV vector encompasses both rAAV virions and rAAV vector plasmids.
[0053] An "AAV virus" or "AAV viral particle" or "rAAV vector particle" or “rAAV particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector". Thus, production of a rAAV particle necessarily includes production of a rAAV vector, as such a vector contained within an rAAV particle.
[0054] "Packaging" refers to a series of intracellular events that result in the assembly, encapsidation, and production of an AAV particle.
[0055] AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and capsid proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."
[0056] By "AAV Rep coding region" or “sequence encoding one or more Rep proteins” or “Rep encoding sequence” and grammatical equivalents thereof is meant the art-recognized region of the AAV genome which encodes the replication proteins of the virus which are required to replicate the viral genome and / or a payload flanked by ITRs. The rep coding region, as used herein, may be derived from any viral serotype, such as those described above. The region need not include all of the wild-type genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the rep genes provide for expression Rep proteins. Rep coding sequences are further described below.
[0057] By "AAV cap coding region" or “sequence encoding one or more cap proteins,” or “Cap encoding sequence” and grammatical equivalents thereof it is meant the art-recognized region of the AAV genome which encodes the coat proteins of the virus which are required for the capsid that viral genome or a payload is packaged into by the Rep proteins. For a further description of the cap coding region, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol.158, 97-129; Kotin, R. M. (1994) Human Gene Therapy 5, 793-801. The AAV cap coding region, as used herein, may be derived from any AAV serotype, as described above. The region need not include all of the wild-type cap genes but may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the genes provide for sufficient packaging functions. Cap coding sequences are further described below.
[0058] By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art- recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the viral genome. The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin, R. M. (1994) Human Gene Therapy 5, 793-801; Berns, K. I. "Parvoviridae and their Replication" in Fundamental Virology, 2d ed., (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 ITRs sequence. As used herein, an "AAV ITR" need not have a wild-type nucleotide sequence, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides. The AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV- 1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, etc. Furthermore, 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate. The ITRs may be single stranded (ssITRs) or self-complementary (scITRs).
[0059] A "helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the American Type Culture Collection (ATCC). Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.
[0060] "Helper virus function(s)" refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, "helper virus function" may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.
[0061] An "infectious" virus or viral particle is one that comprises a polynucleotide component which it is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an “infectious” virus or viral particle is one that may access a target cell, may infect a target cell, and may express a heterologous nucleic acid in a target cell. Thus, “infectivity” refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity may refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles may be expressed as the number of viral genome (vg) copies. The ability of a viral particle to express a heterologous nucleic acid in a cell may be referred to as “transduction.” The ability of a viral particle to express a heterologous nucleic acid in a cell may be assayed using a number of techniques, including assessment of a marker gene, such as agreen fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA). Viral infectivity may be expressed as the ratio of infectious viral particles to total viral particles. Methods of determining the ratio of infectious viral particle to total viral particle are known in the art. See, e.g., Grainger et al. (2005) Mol. Ther. 11:S337 (describing a TCID50 infectious titer assay); and Zolotukhin et al. (1999) Gene Ther.6:973.
[0062] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
[0063] As used herein, the term “polynucleotide construct” refers to a DNA segment of any size that includes one or more sequences encoding an RNA or protein and at least one promoter for driving expression from the one or more sequences. A polynucleotide construct may be a circular DNA or a linear DNA. A polynucleotide construct may be single stranded or double stranded. As used herein, the term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which may transfer gene sequences into and between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. The use of the term "vector" throughout this specification encompasses plasmid or viral vectors, which permit the desired components to be transferred to the host cell via transfection or infection. For example, an adeno- associated viral (AAV) vector is a plasmid comprising a recombinant AAV genome. In some embodiments, useful vectors are contemplated to be those vectors in which the nucleic acid segment to be transcribed is positioned under the transcriptional control of a promoter. A vector may be linear or circular, single stranded or double stranded, DNA or RNA. In certain aspects, the vector may be circular, double stranded DNA.
[0064] As used herein, the term “vector system” refers to two or more vectors that are used together, e.g., by simultaneous or sequential introduction into a cell, to provide at least two different components into the cell. The two different components may then work together in the cell.
[0065] A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. The term percent “sequence identity,” in the context oftwo or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent “sequence identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
[0066] For sequence comparison, typically one sequence acts as a reference sequence (also called the subject sequence) to which test sequences (also called query sequences) are compared. The percent sequence identity is defined as a test sequence’s percent identity to a reference sequence. For example, when stated “Sequence A having a sequence identity of 50% to Sequence B,” Sequence A is the test sequence and Sequence B is the reference sequence. When using a sequence comparison algorithm, test and reference sequences are input into a computer program, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve the maximum alignment, based on the designated program parameters, introducing gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) relative to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from the aligned sequence is as follows:
[0067] [(Number of Identical Positions) / (Total Number of Positions in the Test Sequence)] × 100%.
[0068] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm for sequence alignment, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm uses a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence) to search against, or in some cases, a database of multiple reference sequences to search against. The BLAST algorithm performs sequence alignment by finding high-scoring alignment regions between the test and the reference sequences by scoring alignment of short regions of the test sequence (termed “words”) to the reference sequence. The scoring of each alignment is determined by the BLAST algorithm and takes factors into account, such as the number of aligned positions, as well as whether introduction of gaps between the test and the reference sequences would improve the alignment. The alignment scores for nucleic acids can be scored by set match / mismatch scores. For protein sequences, the alignment scores can be scored using a substitution matrix to evaluate the significance of the sequence alignment, for example, the similarity between aligned amino acids based on their evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, the public default values of April 6, 2023 are used when usingthe BLASTN and BLASTP algorithms. The BLASTN and BLASTP algorithms then output a “Percent Identity” output value and a “Query Coverage” output value. The overall percent sequence identity as used herein can then be calculated from the BLASTN or BLASTP output values as follows:
[0069] Percent Sequence Identity = (“Percent Identity” output value) × (“Query Coverage” output value).
[0070] The following non-limiting examples illustrate the calculation of percent identity between two nucleic acids sequences. The percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in the test sequence)] × 100%. Percent identity is calculated to compare test sequence 1: AAAAAGGGGG (length = 10 nucleotides; SEQ ID NO: 367) to reference sequence 2: AAAAAAAAAA (length = 10 nucleotides; SEQ ID NO: 368). The percent identity between test sequence 1 and reference sequence 2 would be [(5) / (10)] ×100% = 50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated to compare test sequence 3: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides; SEQ ID NO: 369) to reference sequence 4: GGGGGGGGGG (length = 10 nucleotides; SEQ ID NO: 370). The percent identity between test sequence 3 and reference sequence 4 would be [(10) / (20)] ×100% = 50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated to compare test sequence 5: GGGGGGGGGG (length = 10 nucleotides; SEQ ID NO: 370) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides; SEQ ID NO: 369). The percent identity between test sequence 5 and reference sequence 6 would be [(10) / (10)] ×100% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.
[0071] The following non-limiting examples illustrate the calculation of percent identity between two protein sequences. The percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in the test sequence)] × 100%. Percent identity is calculated to compare test sequence 7: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 371) to reference sequence 8: YYYYYYYYYY (length = 10 amino acids; SEQ ID NO: 372). The percent identity between test sequence 7 and reference sequence 8 would be [(5) / (10)] ×100% = 50%. Test sequence 7 has 50% sequence identity to reference sequence 8. In another example, percent identity is calculated to compare test sequence 9: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids; SEQ ID NO: 373) to reference sequence 10: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 371). The percent identity between test sequence 9 and reference sequence 10 would be [(10) / (20)] ×100% = 50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated to compare test sequence 11: FFFFFYYYYY (length = 10 amino acids; SEQ ID NO: 371) to reference sequence 12: LLLLLFFFFFYYYYYLLLLL (length = 20 amino acids; SEQ ID NO: 373). The percent identity between test sequence 11 and reference sequence 12 would be [(10) / (10)] ×100% = 100%. Test sequence 11 has 100% sequence identity to reference sequence 12.
[0072] For purposes herein, reference to a polynucleotide sequence (e.g., a DNA sequence or an RNA sequence) also encompasses the reverse complement of the polynucleotide sequence. Forexample, a sequence of AAAAAGGGGG ( SEQ ID NO: 367) also encompasses a sequence of CCCCCTTTTT ( SEQ ID NO: 374).
[0073] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
[0074] The term "host cell" denotes, for example, microorganisms, yeast cells, insect cells, and mammalian cells, that may be, or have been, used as recipients of an AAV vector system as described herein, or other transfer DNA. The term includes the progeny of the original cell which has been transfected. Thus, a "host cell" as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.
[0075] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes may occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
[0076] The term "cell culture," refers to cells grown adherent or in suspension, bioreactors, roller bottles, hyperstacks, microspheres, macrospheres, flasks and the like, as well as the components of the supernatant or suspension itself, including but not limited to rAAV particles, cells, cell debris, cellular contaminants, colloidal particles, biomolecules, host cell proteins, nucleic acids, and lipids, and flocculants. Large scale approaches, such as bioreactors, including suspension cultures and adherent cells growing attached to microcarriers or macrocarriers in stirred bioreactors, are also encompassed by the term "cell culture." Cell culture procedures for both large and small-scale production of proteins are encompassed by the present disclosure.
[0077] The encapsidation ratio of a population of rAAV virions may be measured as the ratio of rAAV viral particle (VP) to viral genome (VG). The rAAV viral particle includes empty capsids, partially full capsids (e.g., comprising a partial viral genome), and full capsids (e.g., comprising a full viral genome).
[0078] The F:E ratio of a population of rAAV virions may be measured as the ratio of rAAV full capsids to empty capsids. The rAAV full capsid particle includes partially full capsids (e.g., comprising a partial viral genome) and full capsids (e.g., comprising a full viral genome). The empty capsids lack a viral genome.
[0079] The potency or infectivity of a population of rAAV virions may be measured as the percentage of target cells infected by the rAAV virions at a multiplicity of infection (MOI; viral genomes / target cell). Exemplary MOI values are 1 × 101, 1 × 102, 2 × 103, 5 × 104, or 1 × 105vg / target cell. An MOI may be a value chosen from the range of 1 × 101to 1 × 105vg / target cell.
[0080] The term “auxotrophic” or “auxotrophic selection marker” as used herein refers to the usage of a medium lacking a supplement, such as a medium lacking an essential nutrient such as the purine precursors hypoxanthine and thymidine (HT), or the like, for selection of a functional enzyme which allows for growth in the medium lacking the essential nutrient, e.g., a functional dihydrofolate reductase or the like.
[0081] The terms “tetracycline” is used generically herein to refer to all antibiotics that are structurally and functionally related to tetracycline, including tetracycline, doxycycline, demeclocycline, minocycline, sarecycline, oxytetracycline, omadacycline, or eravacycline.
[0082] The terms “constitutive” or “constitutive expression” are used interchangeably herein. They refer to genes that are transcribed in an ongoing manner. Such gene are driven by a constitutive promoter. In some embodiments, the terms refer to the expression of a therapeutic payload or a nucleic acid sequence that is not conditioned on addition of an expression triggering agent to the cell culture medium. A constitutive promoter is capable of directing continuous gene expression in a cell. Constitutive promoters regulate expression of basal genes, like housekeeping genes. In contrast, an inducible promoter directs gene expression in the presence of particular transcription activator(s) or absence of a transcription repressor(s). Thus, an inducible promoter can be controlled by controlling the level of the transcription activator(s) or transcription repressor(s).
[0083] As used herein, the term “polynucleotide payload” refers to a polynucleotide sequence that is packaged into a rAAV virion for delivery by the rAAV virion into a cell. A polynucleotide payload is flanked by AAV inverted terminal repeats (ITRs). Upon delivery to a cell, the polynucleotide payload may be available to the cell as a DNA (e.g., a homology region for homology-directed repair), transcribed into an RNA (e.g., a guide RNA (gRNA), a tRNA, a suppressor tRNA, a siRNA, a miRNA, an mRNA, a shRNA, a circular RNA, an antisense oligonucleotide (ASO)), or transcribed and translated into a polypeptide (e.g., an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, or a DNAzyme.
[0084] "Recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
[0085] A "control element" or "control sequence" is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certainconditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter. A promoter is usually upstream of a gene whose expression is controlled by the promoter.
[0086] "Operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.
[0087] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous payload is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous payload is a payload not normally encoded by a naturally-occurring, wild-type AAV. As another example, a large Rep coding sequence operatively linked to a heterologous promoter refers to a large Rep coding sequence operatively linked to a non-native promoter.
[0088] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell. For example, a gene integrated into the nuclear genome of the cell and is available to perform its function during extended culture of the cell in vitro. A gene integrated into the nuclear genome of the cell is inheritable by progeny of the cell.
[0089] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a payload to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a payload to a mammalian subject (which may be referred to as "transgenes" to be delivered to a recipient cell), include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.
[0090] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment may be measured on an absolute basis, such as weight per volume of solution, or it may be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some cases purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.
[0091] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. The term “treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and / or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom(s) but has not yet been diagnosed as having it; (b) inhibiting the disease and / or symptom(s), i.e., arresting development of a disease and / or the associated symptoms; or (c) relieving the disease and the associated symptom(s), i.e., causing regression of the disease and / or symptom(s). Those in need of treatment may include those already afflicted (e.g., those with a neurological disorder) as well as those in which prevention is desired (e.g., those with increased susceptibility to a neurological disorder; those suspected of having a neurological disorder; those having one or more risk factors for a neurological disorder, etc.).
[0092] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, is sufficient, in combination with another agent, or alone in one or more doses, to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.
[0093] The terms “individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses, camels, etc.); mammalian farm animals (e.g., sheep, goats, cows, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some cases, the individual is a human.
[0094] The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson Crick base pairing.
[0095] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule may have two homologous regions which are capable of hybridizing to each other. Thus, the term "homologous region" includes nucleic acid segments with complementary sequences. Homologous regions may vary in length, but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).
[0096] As used herein, the terms "complementary" or "complementarity" refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands may base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when a uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. "Complementarity" may exist between two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be "complementary" and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary" or "100% complementary" if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered "perfectly complementary" or "100% complementary" even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other. "Less than perfect" complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.
[0097] As used herein, the term “recombination site” denotes a region of a nucleic acid molecule comprising a binding site or sequence-specific motif recognized by a site-specific recombinase that binds at the target site and catalyzes recombination of specific sequences of DNA at the target site. Site- specific recombinases catalyze recombination between two such target sites. The relative orientation of the target sites determines the outcome of recombination. For example, translocation occurs if therecombination sites are on separate DNA molecules. DNA between two recombination sites oriented in the same direction on the same DNA molecule will be excised as a circular loop of DNA. DNA between two recombination sites that are orientated in the opposite direction on the same DNA molecule will be inverted.
[0098] As used herein, the term “enhancer” refers to a non-translated nucleic acid sequence that is contiguous with the coding sequence (in cis) and functions to increase expression of the transcript and / or protein from the coding sequence. Enhancers can include transcriptional enhancers or translational enhancers. Transcriptional enhancers are DNA sequences and influence the rate at which a nearby gene is transcribed into messenger RNA (mRNA) and, ultimately, translated into a functional protein. A translational enhancer is a specific sequence or structural element in messenger RNA (mRNA) that plays a role in regulating the process of translation. Translational enhancers can be involved in modulating the efficiency or specificity of translation.
[0099] The terms "antibody" and “immunoglobulin” include antibodies or immunoglobulins of any isotype, fragments of antibodies which retain specific binding to antigen, including, but not limited to, Fab, Fv, scFv, and Fc fragments, chimeric antibodies, humanized antibodies, single-chain antibodies, including antibodies comprising only heavy chains (e.g. VHH camelid antibodies), bispecific antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non- antibody protein.
[0100] The term “ribozyme” refers to catalytically active nucleic acid molecules, including DNA, RNA, and combinations thereof. Ribozymes are capable of catalyzing cleavage, splicing, ligation, and other reactions. Certain ribozymes are trans-acting, such that they catalyze a reaction on the same molecule or cis-acting, such that they catalyze a reaction on a different molecule.
[0101] The term “cis-acting” refers to a regulatory element or sequence located on the same polynucleotide as a coding sequence it regulates. These elements function locally to regulate the expression of nearby coding sequences. Non-limiting examples of cis-acting elements or factors include promoters, enhancers, and silencers. Some factors encode a functional nucleotide sequence, such as a DNAzyme or ribozyme.
[0102] The term “leaky expression” refers to gene expression, when the gene is not supposed to be expressed—such expression can include transcription of the gene and / or translation of the gene. As a non-limiting example, gene expression of a gene that is operably linked to an inducible promoter absent an inducing or triggering agent is leaky expression. An additional non-limiting example of leaky expression includes expression of a gene in the presence of silencing agent or inhibitor. II. POLYNUCLEOTIDES AND POLYNUCLEOTIDE SYSTEMS
[0103] Various embodiments are directed to one or more polynucleotides, where each polynucleotide comprises a sequence encoding a component for rAAV production. A collection of polynucleotides may be considered a “polynucleotide system,” “a polynucleotide set,” and / or “a set ofpolynucleotides.” The polynucleotides described herein contain expression cassettes containing coding sequences for a component for rAAV production as well as necessary regulatory sequences for transcription, such as a promoter, enhancer and / or polyA sequence.
[0104] A polynucleotide system for producing rAAV may include a polynucleotide (e.g., third polynucleotide) comprising a sequence encoding one or more AAV helper proteins; a polynucleotide (e.g., second polynucleotide) comprising a sequence encoding AAV Rep and / or Cap proteins; a polynucleotide (e.g., first polynucleotide) comprising a polynucleotide payload flanked by AAV inverted terminal repeats (ITRs), and a polynucleotide encoding an AAV late stage gene, such as L4. A. Polynucleotides for Adenovirus Late Stage Gene Expression
[0105] A polynucleotide is provided that includes a first promoter operably linked to a sequence encoding a late stage gene. In embodiments, a sequence of a promoter operably linked to the sequence encoding a late stage gene is also called a late-stage gene cassette. In some embodiments, the late-stage gene cassette comprises an L4 coding sequence and a first promoter. In some embodiments, the first promoter is heterologous to the late stage gene. In some embodiments, the first promoter is an inducible promoter and heterologous to the late stage gene. In some embodiments, the first promoter is a constitutive promoter and heterologous to the late stage gene. In some embodiments, the promoter operably linked to the late stage gene sequence has higher promoter activity as compared to its native promoter.
[0106] The late stage gene may be one or more of L1-L5. In some instances, the late stage gene is L4. In some instances, the L4 gene encodes two proteins: a 22K protein and a 33K protein. The L4 gene encoded by the construct is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the 22K protein (i.e., L4-22K) and the other mature mRNA encodes the 33K protein (i.e., L4-33K). In some embodiments, the L4 gene encodes only a 22K protein. In certain embodiments, the L4 gene encodes only a 33K protein. Additional details regarding adenovirus late stage gene products can be found in Adsero A, et al. A Novel Role for the Adenovirus L4 Region 22K and 33K Proteins in Adeno-Associated Virus Production. Hum Gene Ther. 2024 Jan;35(1-2):59-69; the disclosure of which is hereby incorporated by reference in its entirety.
[0107] During adenoviral infection, adenovirus L422K / 33K proteins are initially expressed at low levels under the control of the L4 internal promoter (L4P) but are expressed at much higher levels from the adenovirus Major Late Promoter (MLP) later in infection. Provided herein are constructs for regulated expression of adenovirus L4 22K / 33K proteins using heterologous promoters. In some embodiments, the L4 22K / 33K proteins further increase Rep and Cap protein expression. In some embodiments, L4 22K / 33K protein expression during rAAV production increases titer levels as compared to conditions for rAAV production without L4 22K / 33K protein expression. In some embodiments, L422K / 33K protein expression during rAAV production increases encapsidation percentas compared to conditions for rAAV production without L4 22K / 33K protein expression. In some embodiments, L422K / 33K protein expression during rAAV production increases rAAV production as compared to conditions for rAAV production without L4 22K / 33K protein expression. In some embodiments, L422K / 33K protein expression during rAAV production increases vg / ml and vp / ml as compared to conditions for rAAV production without L4 22K / 33K protein expression. In some embodiments, L4 22K / 33K protein expression during rAAV production increases production of infectious virus particles as compared to conditions for rAAV production without L422K / 33K protein expression.
[0108] In some embodiments, L422K / 33K protein expression improves rAAV production in all serotypes. In some embodiments, L422K / 33K proteins are expressed in rAAV production of serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV.rh46. In some embodiments, L4 22K / 33K proteins are expressed in AAV9. In some embodiments, L4 22K / 33K proteins are expressed in AAV2.
[0109] In some embodiments, the polynucleotide encodes a late stage protein comprising an L4- 22K protein comprising an amino acid sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 277. In some embodiments, the polynucleotide encodes a late stage protein comprising an L4-22K protein comprising an amino acid sequence of SEQ ID NO: 277.
[0110] In some embodiments, the polynucleotide encoding an L4-22K protein comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 270. In some embodiments, the polynucleotide encoding an L4- 22K protein comprises a sequence of SEQ ID NO: 270.
[0111] In some embodiments, the polynucleotide encoding an L4-33K protein comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 273. In some embodiments, the polynucleotide encoding an L4- 33K protein a sequence of SEQ ID NO: 273.
[0112] In some embodiments, the polynucleotide encodes an L4-33K protein comprising an amino acid sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 278. In some embodiments, the polynucleotide encodes an L4-33K protein comprising an amino acid sequence of SEQ ID NO: 278.
[0113] In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the wildtype L4 adenovirus gene. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene encodes 22K protein and 33K protein. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene that encodes 22K protein and 33K protein comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 271. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene that encodes 22K protein and 33K protein comprises a sequence of SEQ ID NO: 271.
[0114] In many embodiments, a polynucleotide (e.g., late-stage gene cassette) includes an upstream promoter (e.g., a first promoter) that is upstream (e.g., 5’) of and operably linked to a sequence encoding L4 gene products (e.g., 22K protein and / or 33K protein). In this example, the promoter can be one or more of native, heterologous, inducible, and constitutive, as described herein.
[0115] In some embodiments, the promoter is an inducible promoter. The inducible promoters may be a promoter that is induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.
[0116] In some embodiments, the inducible promoter is a tetracycline-inducible promoter. In some embodiments, a tetracycline inducible promoter comprises a plurality of tetracycline (Tet) operator elements capable of binding to an activator in the presence of a triggering agent, e.g., doxycycline or tetracycline. In some embodiments, the inducible promoter is a tetracycline response element (TRE, also called TRE3G) promoter that comprises a plurality of tetracycline (Tet) operator elements (tetO) capable of binding to an activator in the presence of a triggering agent. In certain aspects, TRE comprises seven repeats of a 19-base pair tet operator sequence located upstream of a minimal promoter. In certain aspects, TRE comprises seven repeats of a 19-base pair tet operator sequence located upstream of a minimal CMV promoter. In some embodiments, the 19-base pair tet operator sequence is a sequence of SEQ ID NO: 343. A tetO concacatemer of seven repeats of SEQ ID NO: 343 is set forth in SEQ ID NO: 341. In some embodiments, the minimal CMV promoter sequence is a sequence of SEQ ID NO: 342. In some embodiments, the inducible promoter (e.g., TRE3G promoter) comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 262. In some embodiments, the inducible promoter (e.g., TRE3G promoter) comprises SEQ ID NO: 262. In certain aspects, the triggering agent is doxycycline. In certain aspects, the activator is Tet- on 3G. In some embodiments, the activator sequence is set forth in SEQ ID NO: 265. To induce expression of the late viral gene, such as L422K / 33K, a first triggering agent (e.g., doxycycline) is added to the cell culture. In some embodiments, the activator binds to the inducible promoter in the presence of a first triggering agent to trigger or induce activation of the promoter. Doxycycline willbind to the activator (e.g., Tet-on 3G protein) and this will promote binding of the activator (e.g., Tet- on 3G) to the tet operator elements in the TRE promoter (also referred to as doxycycline-inducible promoter). This will trigger (e.g., induce) the activation of the promoter. In some embodiments, transcription of the L4 coding sequence is activated from the first promoter upon binding of an activator (e.g., Tet-on3G).
[0117] In other embodiments, the inducible promoter is an ecdysone-inducible promoter. In some embodiments, the inducible promoter is a cumate-inducible promoter. Additional details regarding inducible promoters are described elsewhere herein.
[0118] In some embodiments, the late-stage gene cassette includes a polyadenylation (polyA) signal sequence and / or an enhancer element operably linked to the adenovirus late stage gene. In many instances, the polyA signal sequence and / or enhancer element is a native sequence. In other embodiments, the polyA signal sequence and / or enhancer element is heterologous to the adenovirus late stage gene. Such heterologous polyA signal sequences and enhancer element are described elsewhere herein. In some embodiments, the polyA signal is an SV40 polyA. In some embodiments, the polyA signal comprises sequence set forth in SEQ ID NO: 274.
[0119] In some embodiments, the late-stage gene expression cassette contains the sequence encoding the L4 gene products operably linked to an inducible promoter and a polyA. In some embodiments, the late-stage gene expression cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 377. In some embodiments, the late stage gene cassette comprises a sequence of SEQ ID NO: 377.
[0120] In some embodiments, the L4 construct further comprises a selection cassette. In some embodiments, the selection cassette is used to select cells with the integrate L4 construct. In some embodiments, the selection cassette comprises a selection gene (also called selectable marker) and a promoter (e.g., a second promoter). In such embodiments, the polynucleotide includes both the selection cassette containing the selectable marker and its operably linked promoter, and the late-stage gene expression cassette containing the sequence encoding the L4 gene products operably linked to its promoter (e.g., inducible promoter). In provided embodiments, the selectable marker is a marker that can be used for selection of cells that have integrated the polynucleotide. Accordingly, the selectable marker facilitates selection of cells that have integrated the late-stage gene expression cassette, such as a cassette including the late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein).
[0121] In some embodiments, the selection cassette comprises a constitutive promoter and a selection gene. In some embodiments, the selection gene comprises an antibiotic resistance gene. In some embodiments, the antibiotic resistance protein is selected from a hygromycin resistance protein, a puromycin resistance protein, and an ampicillin resistance protein. Also illustrated in this example isa sequence encoding a hygromycin resistance protein, although this sequence can encode for any relevant selectable marker. In some embodiments, hygromycin is encoded by SEQ ID NO: 276.
[0122] Further, in some embodiments, the selectable marker is a split selectable marker. A split selectable marker comprises one of the two halves of a selectable marker. When polynucleotides (e.g., constructs or selection cassettes) comprising split selectable markers are introduced in cells and both halves of the split selectable marker are expressed, the selectable marker is expressed. In some embodiments, the polynucleotide comprises a first part of the selectable marker sequence fused to a first reassembly module and wherein another polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module. In some embodiments, the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C- intein) or leucine zippers.
[0123] In some embodiments, the selectable marker is the split selectable marker that is a split antibiotic resistance protein and the polynucleotide comprises a sequence of a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein. In some embodiments, the selectable marker is the split selectable marker that is a split antibiotic resistance protein and the polynucleotide comprises a sequence of a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein. In some embodiments, the selectable marker is a first part of a split blasticidin resistance gene intein. In some embodiments, the selectable marker is a first part of a split hygromycin resistance gene intein. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the mammalian cell selection element is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is DHFR.
[0124] The sequence encoding the antibiotic resistance protein is operably linked to a promoter (e.g., second promoter) in the selection cassette. In some embodiments, the promoter (e.g., second promoter) of the selection cassette is a constitutive promoter. As illustrated, the sequence encoding a hygromycin resistance protein is operably linked to a promoter (e.g., constitutive promoter) to allow for selection of a cell that includes the polynucleotide. Any of a variety of constitutive promoters are known and can be used. Typically, the constitutive promoter of the selection cassette is a promoter that drives strong expression in mammalian cells. Non-limiting examples of constitutive promoters that can be included in the selection cassette to drive expression of the selectable marker include a CMV promoter, EF1a promoter, SV40 promoter, PGK1 promoter, UbC promoter, beta actin promoter, or CAG promoter. In some embodiments, the second promoter is an EF1alpha promoter. In some embodiments, the EF1alpha promoter comprises the sequence set forth in SEQ ID NO: 406 or SEQ ID NO:264.
[0125] In some embodiments, the selection cassette may further include on or more other regulatory components to control expression of the selectable marker, such as an enhancer or a polyAsequence. In some embodiments, the polyA signal is an SV40 polyA. In some embodiments, the polyA signal comprises sequence set forth in SEQ ID NO: 375. Other examples of heterologous polyA signal sequences are described elsewhere herein.
[0126] In some embodiments, the selection cassette contains a sequence encoding a selectable marker such as an antibiotic resistance protein operably linked to a constitutive promoter and a polyA. In some embodiments, the selection cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 376. In some embodiments, the selection cassette comprises a sequence of SEQ ID NO: 376.
[0127] In some embodiments, an exemplary polynucleotide for late stage gene expression comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 251. In some embodiments, an exemplary polynucleotide for late stage gene expression comprises a sequence of SEQ ID NO: 251.
[0128] In some embodiments, an exemplary polynucleotide for late stage gene expression comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 255. In some embodiments, an exemplary polynucleotide for late stage gene expression comprises a sequence of SEQ ID NO: 255.
[0129] In some embodiments, while the selectable marker and its operably linked promoter are illustrated downstream of (e.g., 3’ of) the sequence encoding the L4 gene products, these sequences may be upstream of and / or antiparallel (e.g., on the other strand) of the sequence encoding the L4 gene products.
[0130] In some embodiments, the L4 constructs encoded by the polynucleotides are delivered to cells for rAAV production. The L4 constructs encoded by the polynucleotides are delivered to cells prior to beginning rAAV production. In some embodiments, the delivery comprises integrating the polynucleotide construct in the genome of the cell. In some embodiments, the polynucleotide includes the L4 coding sequence (e.g., encoding L422K / 33K, or an expression cassette comprising the same operably linked to a promoter (e.g., inducible promoter), and also includes integration sequences to facilitate integration into a host cell genome. Thus, in provided embodiments, the polynucleotide or vector comprising the polynucleotide may include features or components to assist in integration of the construct. Various such components are known in the art and include enzyme-based methods, such as the use of a nuclease, an integrase, a transposase, and / or any other relevant enzyme; mechanical based systems, such as biolistics; vector-based, such as viral-based and / or bacterial based (e.g., using Agrobacterium spp.). In some instances, the integration may utilize innate mechanisms, such as DNA repair pathways (e.g., non-homologous end joining, double strand break repair, etc.). Some instances utilize homology-based integration (e.g., long terminal repeats, inverted terminal repeats, etc.). Someinstances, include features that are specific to exogenously added transposases, including (but not limited to) PiggyBac sites along with the PiggyBac, Tol2, Sleeping Beauty, Mariner, Minos, Hermes, Frog Prince, any other applicable transposon system, and combinations thereof.
[0131] In some embodiments, the integration method comprises a transposon system or a targeted integration via homology.
[0132] In some embodiments, the polynucleotide further comprises a sequence for integration into the genome of a cells. In some embodiments, the sequence comprises a 5’ sequence and a 3’ sequence. In some embodiments, the integration is by transposon system integration, wherein the sequence for integration comprises a transposon 5’ inverted terminal repeat and a transposon 3’ inverted terminal repeat that are able to be recognized by a transposase. In some embodiments, the polynucleotide comprises a 5’ inverted terminal repeat (ITR) upstream of the late-stage gene cassette and a 3’ ITR downstream of the late-stage gene cassette, wherein the 5’ ITR and 3’ ITR are for integration of the late-stage gene cassette into the genome of a cell by a transposon system. In some embodiments, the transposon system is a Piggybac system. Examples of 5’ and 3’ homology arms includes sequences SEQ ID NO: 351 and SEQ ID NO: 352, respectively.
[0133] In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 249. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence of SEQ ID NO: 249. In such embodiments, delivery is carried out also with a transposase plasmid for transposase integration. In provided embodiments, the integration results in the insert L4 construct set forth in SEQ ID NO: 251 being integrated into the genome of the cell.
[0134] In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 248. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence of SEQ ID NO: 248. In such embodiments, delivery is carried out also with a transposase plasmid for transposase integration. In provided embodiments, the integration results in the insert L4 construct set forth in SEQ ID NO: 251 being integrated into the genome of the cell.
[0135] In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in thegenome of the cell comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 254. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence of SEQ ID NO: 254. In such embodiments delivery is carried out also with a transposase plasmid for transposase integration. In provided embodiments, the integration results in the insert L4 construct set forth in SEQ ID NO: 255 being integrated into the genome of the cell.
[0136] In some embodiments, the integration is by homology directed repair (HDR) into a target loci. In some embodiments, the sequence for integration comprises 5’ (or left) and 3’ (or right) homology arms that are each independently complementary to a sequence of the target loci flanking the site of integration. In some embodiments, the polynucleotide comprises a 5’ homology arm upstream of the late-stage gene cassette and a 3’ homology arm downstream of the late-stage gene cassette. In some embodiments, the 5’ and 3’ homology arms are for targeted knock-in of the late-stage gene cassette by homology directed repair (HDR) into a target loci and are each independently complementary to a sequence of the target loci flanking a site of integration. In some embodiments, the target loci is a safe harbor locus. In some embodiments, the safe harbor locus is one in which genetic material can be inserted without disrupting the normal function of the host cell. Non-limiting examples of safe harbor loci include sites like AAVS1, CCR5, Rogi-1 and Rogi-2. In some embodiments, the safe harbor locus is Rogi-1. Examples of 5’ (left) and 3’ (right) homology arms includes sequences SEQ ID NO: 252 and SEQ ID NO: 253, respectively. In such embodiments, the polynucleotide is the donor template for HDR with an endonuclease (e.g., Cas protein) and, in some cases also a guide RNA (gRNA) to direct the Cas protein to the site of cleavage. The 5’ and 3’ homology arms are sequences are designed to be homologous or complementary to the regions flanking the cleavage site to allow the repair machinery to accurately align the donor template with the genomic DNA during the repair process.
[0137] In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) for integrating the polynucleotide construct in the genome of the cell comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 250. In some embodiments, the polynucleotide encoding a late stage gene comprising L4 gene (e.g., which encodes 22K protein and / or 33K protein) comprises a sequence of SEQ ID NO: 250. In such embodiments, the polynucleotide serves as the donor template for HDR, utilizing a CRISPR-Cas system paired with a gRNA to achieve targeted insertion at the exemplary Rogi-1 safe harbor locus. In provided embodiments, the integration results in the insert L4 construct set forth in SEQ ID NO: 251 being integrated into the genome of the cell.
[0138] Exemplary components of an L4 construct are found in Table 1 below. Table 1 lists the components and corresponding SEQ ID NOs for an exemplary L4 construct(e.g., Construct 4). In some embodiments, the L4 construct comprises an L4 expression cassette that comprises an L4 coding sequence operably linked to an inducible promoter (e.g., tetracycline) and further comprises a selection cassette that comprises a selectable marker (e.g., hygromycin) operably linked to a constitutive promoter (e.g., EF1-alpha promoter non-attenuated). Transcription from the inducible promoter is activated in the presence of a first triggering agent (e.g., doxycycline). Absent the first triggering agent, the L4 proteins (e.g., L4-22K and / or L4-33K) are not expressed. The L4 coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two mRNA transcripts, that respectively encode 1) 22K protein (i.e., L4-22K) and 2) 33K protein (i.e., L4-33K).
[0139] Another exemplary L4 construct that includes a selection cassette with a split hygromycin in place of the hygromycin resistance gene is set forth in SEQ ID NO: 255.
[0140] Exemplary L4 constructs encoding L4 proteins (e.g., L4-22K, L4-33K) for integration into the genome and the selection marker used to select cells with integrated L4 constructs are found in Table 2.B. Polynucleotides Encoding AAV Rep Proteins and / or AAV Cap proteins
[0141] In some embodiments, provided polynucleotides and systems include a polynucleotide encoding a Rep protein and / or Cap protein. 1. Polynucleotide Encoding AAV Rep Proteins
[0142] In some embodiments, a polynucleotide (e.g., first polynucleotide) is provided encoding a Rep protein. In some embodiments, the Rep protein includes AAV Rep proteins. In some embodiments, the polynucleotide comprises a Rep open reading frame. In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small Rep coding sequence. The Rep protein can include large and small Rep proteins. The large Rep coding sequence partially overlaps with the small Rep coding sequence such that the small Rep coding sequence is common within a portion of the large Rep coding sequence. The large Rep coding sequence encodes two large Rep proteins, Rep78 and Rep68. The large Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the large Rep protein, Rep78 and the other mature mRNA encodes the large Rep protein, Rep68. The small Rep coding sequenceencodes two small Rep proteins, Rep52 and Rep40. The small Rep coding sequence is transcribed into a precursor mRNA that is alternatively spliced to produce two types of mature mRNA, where one mature mRNA encodes the small Rep protein, Rep52 and the other mature mRNA encodes the small Rep protein, Rep40.
[0143] In some embodiments, the polynucleotide comprises an AAV Rep expression cassette. In some embodiments, the AAV Rep expression cassette comprises a promoter and a Rep open reading frame. In some embodiments, the first polynucleotide comprises from 5’ to 3’, the promoter and the Rep open reading frame. The Rep open reading frame encodes four nonstructural proteins, Rep 78, Rep 68, Rep52, and Rep 40. Transcription of the sequence encoding the large Rep proteins, Rep 78 and Rep 68, is driven by the native p5 promoter. Alternative splicing generates separate transcripts for Rep78 and Rep 68. Transcription of the sequence encoding the small Rep proteins, Rep 52 and Rep 40, is driven by the native p19 promoter. Alternative splicing generates separate transcripts for Rep52 and Rep 40.
[0144] In some embodiments, the Rep open reading frame comprises a large Rep coding sequence and a small coding sequence. In some embodiments, the large Rep coding sequence is operably linked to a first promoter. In some embodiments, the large Rep coding sequence comprises a small Rep coding sequence. In some embodiments, the large Rep coding sequence comprises a p19 promoter upstream of the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the p19 promoter.
[0145] In some embodiments, the large Rep coding sequence encodes one or more large Rep proteins and the small Rep coding sequence encodes one or more small Rep proteins. In some embodiments, the Rep open reading frame comprises the coding sequences for Rep78, Rep68, Rep52, and Rep 40. In some such embodiments, the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40. In some embodiments, the Rep open reading frame does not include the Rep40 coding sequence. In some such embodiments, the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep 52. In some such embodiments, transcripts for Rep68 and Rep40 are not expressed.
[0146] In some embodiments, the AAV Rep expression cassette comprises one or more promoters for driving transcription of the large and small Rep coding sequences encoded in the Rep open reading frame. In some embodiments, transcription of the gene or sequence encoding an AAV Rep protein is driven by native AAV promoters. In some embodiments, the one or more promoters comprise a p5 native AAV promoter and a p19 native AAV promoter. In various embodiments, the Rep coding sequences are operably linked to an endogenous P5 promoter. In various embodiments, the Rep coding sequences are operably linked to an endogenous P19 promoter. In some embodiments, the one or more promoters comprise heterologous promoters. Heterologous promoters can include constitutive, inducible, and / or any other type of heterologous promoter. Inducible promoters can be induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced inresponse to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.
[0147] In some embodiments, the Rep coding sequences are operably linked to an inducible promoter. In some embodiments, the inducible promoter comprises a tetracycline-inducible promoter, a cumate-inducible promoter, or a cumate-inducible promoter. In some embodiments, the Rep coding sequences are operably linked to a constitutive promoter. In some embodiments, the constitutive promoter is EF1alpha promoter or human cytomegalovirus promoter.
[0148] A polynucleotide is provided that includes a first promoter operably linked to a large Rep coding sequence. In some embodiments, the first promoter is heterologous to the large Rep coding sequence. The large Rep coding sequence includes a small Rep coding sequence. In some embodiments, a promoter is operably linked to the small Rep coding sequence. In some embodiments, the promoter operably linked to the small Rep coding sequence has higher promoter activity as compared to the first promoter. In some embodiments, the large Rep coding sequence includes an intron and a small Rep coding sequence. In some embodiments, the intron includes a second promoter operably linked to the small Rep coding sequence. In some embodiments, the second promoter has higher promoter activity as compared to the first promoter. In some embodiments, the second promoter is heterologous to the small Rep coding sequence and the second promoter has higher promoter activity as compared to the first promoter.
[0149] In certain aspects, the large Rep coding sequence comprises (i) a functional p19 promoter operably linked to the small Rep coding sequence and (ii) the intron comprising the second promoter. In this aspect, the polynucleotide expresses two small Rep coding transcripts, one expressed under the control of the p19 promoter and the other expressed under the control of the second promoter. Alternatively spliced transcripts encode the two small Rep proteins, Rep58 and Rep 40. . In certain aspects, the intron and hence the second promoter is located downstream of the p19 promoter and upstream of the transcription start site of the small Rep coding sequence.
[0150] In certain aspects, the intron is a synthetic intron comprising a 5’ splice donor site, the second promoter sequence, and a 3’ splice acceptor site, wherein the splice donor and acceptor sites are compatible with a cell used for expressing the Rep proteins. The intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce the large Rep proteins, Rep78 and Rep68. In some embodiments, the intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce only the large Rep protein, Rep78. In some embodiments, the intron is positioned to allow for generation of mRNAs lacking the intron which can then be translated to produce only the large Rep proteins, Rep68.In certain aspects, the first promoter operably linked to the large Rep coding sequence is the native p5 promoter and the expression from the large Rep coding sequence is controlled by the p5 promoter.
[0151] In other aspects, the p19 promoter is mutated to substantially reduce promoter activity. In some embodiments, the TATA box of the p19 promoter is mutated. In certain aspects, the mutated p19 promoter results in a reduction of expression of the small Rep to a level that is at least 30% less, at least 40% less, at least 50% less, at least 60% less, at least 70% less, at least 80% less, at least 90% less, or is undetectable as compared to the expression level of the small Rep under the control of the native p19 promoter. In some aspects, the polynucleotide lacks a functional p19 promoter.
[0152] In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the native p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0153] In certain aspects, the p5 promoter present upstream of the AAV large Rep coding sequence is mutated to substantially reduce promoter activity. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the mutated p5 promoter and both the first promoter and the p5 promoter control expression from the large Rep coding sequence. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0154] In other aspects, the polynucleotide lacks a functional p5 promoter. In certain aspects, the first promoter operably linked to the large Rep coding sequence is a not a p5 promoter and the polynucleotide includes the first promoter and lacks a p5 promoter for controlling expression from the large Rep coding sequence. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is removed. In certain aspects, the p5 promoter present upstream of the AAV Rep coding sequence is replaced with the first promoter. In certain aspects, the first promoter is heterologous to the large Rep coding sequence.
[0155] In certain aspects, one or both of the first and second promoters for driving the expression of the large Rep proteins and small Rep proteins, respectively, are independently selected from constitutive promoters and / or inducible promoters. In certain aspects, the first promoter and the second promoter may be independently selected from the following promoters: ubiquitin C (UBC) promoter, Rous sarcoma virus long terminal repeat (RSV) promoter, chicken beta actin promoter, cytomegalovirus (CMV) promoter, CMV enhancer / chicken beta actin (CAG) promoter, ribosomal protein L13a (RPL13a) promoter, elongation factor 1-alpha (EF1α or EF1alpha) promoter, simian virus 40 (SV40) early promoter, phosphoglycerate kinase (PGK) promoter, hypoxanthine-guanine phosphoribosyltransferase (Hprt) promoter, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter, albumin promoter (ALB), muscle creatine kinase (MSC) promoter, sialophorin promoter (CD43), histone H4 promoter, prostaglandin synthase 2 (PGS2) promoter, activated leukocyte cell adhesion molecule (ALCAM) promoter, fragile X mental retardation 1 (FMR1) promoter, CD68 promoter keratin 14 (K14) promoter, Thy1 promoter, pax6 paired box (P2) promoter, elongation factor 2 (EF2) promoter, platelet-derived growth factor beta (PDGF-B) promoter, vascular endothelial growthfactor receptor 2 (Flk-1) promoter, glucocorticoid receptor promoter (GRP), Lck promoter, myosin light chain 2 (MLC-2) promoter, chromobox homolog 3 (Cbx3) promoter, Nanog promoter, pancreatic and duodenal homeobox 1 (PDX1) promoter, neuron-specific enolase (NSE) promoter, CCAAT / enhancer binding protein alpha (C / EBPα) promoter, Vav1 promoter, Rosa26 promoter, peroxisome proliferator- activated receptor gamma coactivator 1-alpha (hPGC1α) promoter, cytokeratin 19 (Ck19) promoter, myeloperoxidase (MPO) promoter, fatty acid binding protein 4 (FABP4) promoter, TATA box promoter, endothelial nitric oxide synthase (eNOS) promoter, vivmentin promoter, glial fibrillary acidic protein (GFAP) promoter, calcium / calmodulin-dependent protein kinase II alpha (CaMKIIα) promoter, γ-actin promoter, plasminogen activator inhibitor-1 (PAI-1) promoter, and stromal cell-derived factor 1 (SDF-1) promoter. In certain aspects, the first promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the first promoter is a chicken beta actin promoter and the second promoter is a cytomegalovirus (CMV) promoter; (iii) the first promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the second promoter is a RSV promoter; (iv) the first promoter is a chicken beta actin promoter and the second promoter is a RSV promoter, or (v) the first promoter is a herpes simplex virus (HSV) thymidine kinase (TK) HSVtk promoter and the second promoter is a murine leukemia virus-derived (MND) promoter.
[0156] In some embodiments, the first promoter is a UBC promoter and the second promoter is a CAG promoter.
[0157] In some embodiments, the first promoter and the second promoter comprise a nucleotide sequence independently selected from any one of SEQ ID NOs: 113, 269, 275, 295, 297, 301, 302, 309, 339, 394, 395, 396, and 397, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the first promoter comprises the nucleotide sequence of SEQ ID NO: 297 or SEQ ID NO: 269, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the second promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 302, 309, 396, and 397 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
[0158] In certain aspects, the polynucleotide includes an excisable element that controls expression of large and small Rep proteins. In some embodiments, the excisable element is positioned in the small Rep coding sequence since the small Rep coding sequence is common with the large Rep coding sequence such that expression of both small and large Rep proteins can be controlled. The excisable element includes a sequence comprising a stop codon which prevents translation of the full-length Rep proteins, resulting in expression of truncated Rep proteins that are non-functional and lack toxicity associated with the full-length Rep proteins. The excisable element includes a first recombination site and a second recombination site flanking the sequence comprising the stop codon. The first recombination site and the second recombination site are oriented in the same direction andrecombination between the first and second recombination sites by an inducible recombinase results in excision of the sequence comprising the stop codon allowing expression of full-length large Rep proteins and full-length small Rep proteins. In some embodiments, the excisable element is positioned upstream of the small Rep coding sequence. In some such embodiments, the stop codon in the excisable element results in truncated transcripts for large Rep proteins and transcripts for the small Rep proteins are not expressed. Following the excision of the sequence comprising the stop codon, full length large Rep proteins and small Rep proteins are expressed. In some embodiments, the excisable element is positioned upstream of the small Rep coding sequence. In some such embodiments, the stop codon in the excisable element results in truncated transcripts for large Rep proteins and transcripts for the small Rep proteins are not expressed. Following the excision of the sequence comprising the stop codon, full length large Rep proteins and small Rep proteins are expressed.
[0159] In certain embodiments, the Rep open reading frame comprises, from 5’ to 3’: the large Rep coding sequence, an intron, and the small Rep coding sequence. In some embodiments, the intron comprises a promoter and an excisable element. In some embodiments, the excisable element comprises a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element prevents the expression of transcripts for small Rep proteins and results in truncated transcripts for large Rep protein.
[0160] In some embodiments, the intron is a synthetic intron comprising from 5’ to 3’: (i) a 5’ splice donor site, (ii) the promoter, (iii) the excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iv) a second 3’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. In some such embodiments, the promoter located in the intron is operably linked to the small Rep coding sequence. Following excision of the coding sequence comprising a stop signaling sequence, full length large Rep proteins and small Rep proteins are expressed.
[0161] In certain embodiments, the Rep open reading frame comprises from 5’ to 3’: the large Rep coding sequence, the p19 promoter, a first part of the small Rep coding sequence, an intron, and a second part of the small Rep coding sequence. In some such embodiments, the first part and the second part of the small Rep coding sequence form the small Rep coding sequence. In some embodiments, the small Rep coding sequence is operably linked to the p19 promoter. In some embodiments, the intron comprises an excisable element comprising a coding sequence comprising a stop signaling sequence flanked by recombination sites. In some embodiments, the flanking recombination sites are oriented in the same direction. The stop signaling sequence in the excisable element results in truncated transcripts for large and small Rep proteins.
[0162] In some embodiments, the intron is synthetic intron comprising, from 5’ to 3’: (i) a 5’ splice donor site, (ii) the excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and (iii) a second 3’ acceptor site. In some such embodiments, the splice donor site and the first and second splice acceptor sites are compatible with a cell used for expressing Rep proteins. Upon exposure to a recombinase, the first 3’ splice acceptor site and the coding sequence comprising a stop signaling sequence are excised following a recombination event between the recombination sites of the excisable element. Following excision of the coding sequence comprising a stop signaling sequence, full length large and small Rep proteins are expressed.
[0163] In certain aspects, the large Rep coding sequence encodes transcripts that includes the intron. When expressed in a suitable cell, the intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68. In certain aspects, the large Rep coding sequence also includes the excisable element. When present in a suitable cell that also includes a recombinase (e.g., an inducible recombinase) that recombines the first and second recombination sites, the excisable element is removed and the large Rep coding sequence is transcribed into transcripts that include the intron, which intron is excised to generate processed transcripts that can be translated into Rep78 and Rep68.
[0164] In certain aspects, the open reading frame of sequence encoding the small Rep proteins is present within the large Rep coding sequence and the second promoter drives the expression of transcripts that are translated into Rep52 and Rep40. In certain embodiments, the second promoter is located within an intron.
[0165] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins is operably linked to one or more promoters, such as a AAV Rep expression cassette, comprises: (i) a first part of an AAV Rep proteins coding sequence, (ii) an excisable element comprising a first recombination site, a coding sequence encoding a stop signaling sequence, a second recombination site, wherein the first and second recombination sites flank the coding sequence encoding a stop signaling sequence and wherein the first recombination site and the second recombination site are oriented in the same direction, and (iii) a second part of the AAV Rep proteins coding sequence.
[0166] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins operably linked to one or more promoters comprises from 5' to 3': one or more promoters operably linked to a first sequence comprising a first part of an AAV Rep coding sequence, a 5' splice site, a first part of an intron, a first recombination site, a first 3' splice site, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3' splice site, and a second sequence comprising a second part of the AAV Rep coding sequence, allowing expression of AAV Rep proteins. In certain embodiments, the first recombination site, the first 3' splice site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element. In certain embodiments, the first recombination site and the second recombination site are oriented in the same direction. In certain embodiments, the one or more promoters are not operably linked to the second sequence comprising the second part of the AAV Repcoding sequence. In certain embodiments, the first and second recombination sites are recombined by the inducible recombinase in the presence of a first triggering agent and a second triggering agent resulting in excision of the excisable element. In certain embodiments, the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence, allowing expression of AAV Rep proteins.
[0167] In the exemplary embodiments, prior to the cell being contacted with the first triggering agent and the second triggering agent, the Rep coding sequence is interrupted by an excisable element. Addition of both the first triggering agent and the second triggering agent are required for excision of the excisable element. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the p19 promoter. In some embodiments, the excisable element is inserted at CAG-G, CAG-A, AAG-G, AAG-A, wherein the dash (-) indicates the point of insertion of the excisable element, in the Rep coding sequence, and the excisable element is inserted downstream of the p19 promoter and upstream of the p40 promoter.
[0168] In certain embodiments, the excisable element comprises, from 5’ to 3’, a first spacer segment, a second spacer segment, and a third spacer segment.
[0169] In particular embodiments, the first spacer segment comprises a 5’ splice donor site (5’SS) 5’ to the first spacer element. In some embodiments, the first spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 15.
[0170] In some embodiments, the second spacer segment comprises a polynucleotide encoding a detectable protein marker flanked by lox sites. In certain embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a green or blue fluorescent protein (GFP of BFP). In specific embodiments, the GFP is EGFP. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). Screening for the fluorescent marker can be used to confirm integration of the construct into the cell genome and can subsequently be used to confirm excision of the intervening spacer segment. In some embodiments, the second spacer segment further comprises a polyA signal sequence. In certain embodiments, the poly A signal sequence comprises a rabbit beta globin (RBG) polyA signal sequence. In some embodiments, the second spacer segment further comprises a first 3’ splice acceptor site (3’SS) between the first lox site and the polynucleotide encoding the protein marker.
[0171] In some embodiments, the second spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 16.
[0172] In some embodiments, the third spacer segment further comprises a second 3’ splice acceptor site (3’SS). In particular embodiments, the second 3’ splice acceptor site is positioned 3’ to the second lox site.
[0173] In some embodiments, the third spacer segment comprises a nucleic acid sequence having at least 80% identity to SEQ ID NO: 17.
[0174] In some embodiments, the coding sequence encoding the stop signaling sequence of the polynucleotide comprising a sequence encoding AAV Rep proteins encodes for from 5' to 3': an exon and the stop signaling sequence. In some embodiments, the coding sequence encoding the stop signaling sequence of the polynucleotide comprising a sequence encoding AAV Rep proteins further comprises a sequence encoding a protein marker. In certain embodiments, the sequence encoding the protein marker is in-frame with the stop signaling sequence.
[0175] In certain aspects, the small Rep coding sequence may include a first spacer segment and a second spacer segment flanking the excisable element, wherein the first spacer segment comprises a 5’ splice donor site (5’SS) at the 5’ end of the first spacer segment followed by a first intron and the second spacer segment comprises a second intron followed by a first 3’ end of the second spacer segment, wherein the excisable element comprises from 5’ end to 3’ end: the first recombination site, a second 3’ splice acceptor site (3’SS), the stop signaling sequence (e.g., a stop codon), and the second recombination site.
[0176] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5’ splice donor site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombination site, the first 3’ splice acceptor site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in the same direction, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins.
[0177] In certain aspects, the excisable element is flanked by a split intron to prevent read-through from the stop signaling sequence. For example, the polynucleotide construct comprises from 5’ to 3’: one or more native AAV Rep promoters operably linked to a first part of an AAV Rep coding sequence, a 5’ splice donor site (SS), a first part of an intron, a first recombination site, a first 3’ SS, a coding sequence comprising a stop signaling sequence, a second recombination site, a second part of the intron, a second 3’ SS, and a second part of the AAV Rep coding sequence, wherein the first recombinationsite, the first 3’ splice acceptor site, the coding sequence comprising the stop signaling sequence, and the second recombination site form an excisable element, wherein the first recombination site and the second recombination site are oriented in opposite directions, and wherein the one or more promoters are not operably linked to the second part of the AAV Rep coding sequence. The first and second recombination sites are recombined by an inducible recombinase resulting in excision of the excisable element which results in a polynucleotide in which the first part of the AAV Rep coding sequence and the first part of the intron are joined to the second part of the intron and the second part of the AAV Rep coding sequence to form a complete AAV Rep coding sequence comprising the intron. Upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce AAV Rep proteins: Rep78, Rep68, Rep52, and Rep40. In some embodiments, upon transcription, the intron is spliced out by the endogenous cellular machinery to generate a mature mRNA which is translated to produce only AAV Rep proteins: Rep78 and Rep52.
[0178] In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise Lox sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences
[0179] In some embodiments, the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein.
[0180] In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP-ERT2 fusion protein.
[0181] In some embodiments, the coding sequence encoding the stop signaling sequence comprised in the excisable element encodes, from 5' to 3', an exon and the stop signaling sequence. In some embodiments, the coding sequence comprises a sequence encoding a protein marker. In certain embodiments, the sequence encoding the protein marker is in-frame with the stop signaling sequence.
[0182] In certain aspects, the excisable element includes a sequence encoding a marker protein (e.g., a detectable marker) in frame with the stop codon such that the marker protein is expressed when the excisable element is present. In some embodiments, the coding sequence comprising a stop signaling sequence is a detectable marker. For example, detectable markers contemplated herein includeluminescent markers, fluorescent markers, or radiolabels. Fluorescent markers include, but are not limited to, EGFP, GFP, BFP, RFP, or any combination thereof.
[0183] In some embodiments, the coding sequence comprising a stop signaling sequences is a detectable protein marker. In some embodiments, the detectable protein marker is a luminescent marker, a radiolabel, or a fluorescent marker. In some embodiments, the detectable protein marker is a fluorescent protein. In particular embodiments, the fluorescent protein is a blue fluorescent protein (BFP). In some embodiments, the detectable marker comprises the nucleotide sequence of SEQ ID NO: SEQ ID NO: 287, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
[0184] In certain aspects, the 5’ splice donor site is a rabbit beta globin 5’ donor splice site. In certain aspects, both of the first and second 3’ splice acceptor sites are rabbit beta globin 3’ splice acceptor sites.
[0185] In certain aspects, the vector may include an excisable element as described in US20220145328A1, e.g., paragraphs 10, 30, and 31, which are incorporated herein by reference.
[0186] In some embodiments, the excisable element comprises the nucleotide sequence of SEQ ID NO: 292 or 307, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0187] In some embodiments, a polynucleotide comprising an AAV Rep expression cassette sequence further comprises a sequence encoding a cis-acting ribozyme. Such ribozyme coding sequences include any as described in Section II.G. In certain instances, the ribozyme catalyzes a reaction on the mRNA encoding the large and / or small Rep proteins to lead to degradation and / or silencing of the large and / or small Rep proteins. Such activity can limit cellular toxicity caused by leaky large and / or small Rep protein expression.
[0188] In some embodiments, the sequence encoding a ribozyme is located downstream (e.g., 3’ of) a sequence encoding the Rep proteins and upstream of (e.g., 5’ of) a polyA signal sequence. In some embodiments, the sequence encoding the ribozyme is located upstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the small Rep coding sequence. In some embodiments, the sequence encoding the ribozyme is located downstream of the large Rep coding sequence and the small Rep coding sequence.
[0189] In some embodiments, the ribozyme is a self-cleaving ribozyme—in such embodiments, the ribozyme in the mRNA cleaves itself from the mRNA molecule, thus separating the polyA sequence from the coding sequence. By performing this reaction, the mRNA molecule is no longer functional and subject to degradation, leading to silencing of the encoded protein. In some embodiments, the ribozyme mediates degradation of an RNA encoding the ribozyme. In some instances, the self-cleaving ribozyme is part of a Ribo-off system.
[0190] In some instances, the encoded ribozyme is a Hammerhead ribozyme. In their natural state, Hammerhead ribozymes are class of ribozymes that perform self-cleavage reactions and do not catalyzemultiple reactions or turnovers. In certain embodiments the encoded ribozyme is selected from one or more of a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1- hammerhead.
[0191] In various embodiments, the ribozyme comprises the nucleotide sequence of SEQ ID NO: 268, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments, the sequence encoding a ribozyme comprises SEQ ID NO: 268.
[0192] In some embodiments, the sequence encoding a ribozyme is flanked by recombination sites to allow for inducible excision of the sequence encoding a ribozyme. In certain embodiments, the sequence encoding a ribozyme is flanked by recombination sites that are oriented in the same direction and wherein recombination between the recombination sites flanking the sequence encoding a ribozyme by an inducible recombinase results in excision of the sequence encoding the ribozyme. In certain instances, the recombination sites flanking the sequence encoding a ribozyme comprise Lox sequences (or Lox sites). Lox sequences are part of a Cre-Lox recombination system that allows for recombination between Lox sites using a Cre recombinase. In various embodiments, a Cre recombinase can be added exogenously. In certain embodiments, a Cre recombinase is expressed within the cell. In certain instances, the Cre recombinase is inducible (e.g., operably linked to an inducible promoter).
[0193] In some embodiments, the AAV Rep expression cassette further comprises an excisable element, downstream of the Rep open reading frame and upstream of the polyA signal sequence, comprising a sequence encoding a ribozyme flanked by recombination sites. In some such embodiments, the ribozyme mediates degradation of an RNA encoding the ribozyme. In some embodiments, the sequence encoding the ribozyme is excised following a recombination event between the recombination sites flanking the sequence encoding the ribozyme
[0194] In some embodiments, the AAV Rep expression cassette comprises, from 5’ to 3’, a promoter, a Rep open reading frame, an excisable element comprising a sequence encoding a ribozyme flanked by recombination sites, and a polyadenylation (polyA) signal sequence. In some embodiments, an mRNA transcript encoding a Rep protein comprises a sequence encoding a ribozyme. In some such embodiments, the ribozyme mediates degradation of the mRNA transcript encoding a Rep protein. In some embodiments, the mRNA transcript encodes Rep 78, Rep 68, Rep 52, or Rep40. Upon exposure to a recombinase, a recombination event between the flanking recombination sites results in the excision of the sequence encoding the ribozyme. Following excision of the sequence encoding the ribozyme, a stable mRNA transcript encoding a Rep protein is produced, thus allowing Rep protein expression.
[0195] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise Lox sites. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP, LoxN, Lox2272, or Lox511 sequences. In some embodiments the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences. Insome embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences.
[0196] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise flippase recognition target (FRT) sites. In some embodiments, the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise flippase recognition target (FRT) sites. In some such embodiments, the recombinase is a flippase (FRP) recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a FRP recombinase fused to the ligand binding domain of an estrogen receptor. In some embodiments, the inducible recombinase is a FRP-ERT2 fusion protein.
[0197] In some embodiments, the recombination sites flanking the sequence encoding the ribozyme and the recombination sites flanking the coding sequence comprising the stop signaling sequence are different. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxP sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxN sequences. In some embodiments, the recombination sites flanking the sequence encoding the ribozyme comprise LoxN sequences and the recombination sites flanking the coding sequence comprising the stop signaling sequence comprise LoxP sequences.
[0198] In certain aspects, the polynucleotide includes a tag encoding sequence present in frame with the large Rep coding sequence and the small Rep coding sequence such that the large Rep and the small Rep each are expressed as a fusion protein comprising the tag. Any suitable tag may be used. In certain aspects, the tag is a purification tag and / or a detectable tag. In certain aspects, the tag may be a poly-Histidine tag, a Flag tag, a MYC tag, a GST tag, a MBP tag, a strep tag, etc.
[0199] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a polynucleotide or vector not having the first promoter. In certain aspects, the vector is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the large Rep transcripts from a polynucleotide or vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a polynucleotide or vector not having the first promoter. In certain aspects, the polynucleotide or vector is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the large Rep proteins from a polynucleotide or vector having a p5 promoter for driving large Rep expression. In certain aspects, the first promoter is weaker than the p5 promoter. In certain aspects, the first promoter is stronger than the p5 promoter but weaker than the second promoter driving expression of the small Rep proteins.
[0200] In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a polynucleotide or vector not having the second promoter. In certain aspects, the polynucleotide or vector is configured to provide for an expression of the small Rep transcripts at a level that is higher than the expression of the small Rep transcripts from a polynucleotide or vector having a p19 promoter. In certain aspects, the second promoter is stronger than the p19 promoter. In certain aspects, the second promoter is weaker than the p19 promoter. In certain aspects, the second promoter is weaker than the p19 promoter and stronger than the first promoter driving expression of the large Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a polynucleotide or vector not having the second promoter. In certain aspects, the polynucleotide or vector is configured to provide for an expression of the small Rep proteins at a level that is higher than the expression of the small Rep proteins from a polynucleotide or vector having a p19 promoter. In certain aspects, the second promoter is stronger than the p19 promoter. In certain aspects, the second promoter is weaker than the p19 promoter. In certain aspects, the second promoter is weaker than the p19 promoter and stronger than the first promoter driving expression of the large Rep proteins.
[0201] In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep transcripts at a level that is lower than the expression level of the small Rep transcripts. In certain aspects, the polynucleotide is configured to provide for an expression of the large Rep proteins at a level that is lower than the expression level of the small Rep proteins. In certain aspects, the first promoter is weaker than the second promoter.
[0202] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts using the polynucleotide or vector is higher than the ratio of the small Rep transcripts to large Rep transcripts ratio produced using a polynucleotide or vector that includes a p5 promoter instead of the first promoter for driving large Rep transcripts expression and includes a p19 promoter instead of the second promoter for driving small Rep transcripts expression. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins using the polynucleotide or vector is higher than the ratio of the small Rep proteins to large Rep proteins ratio produced using a vector that includes a p5 promoter instead of the first promoter for driving large Rep proteins expression and includes a p19 promoter instead of the second promoter for driving small Rep proteins expression.
[0203] In certain aspects, a ratio of the expression level of the small Rep transcripts to the expression level of the large Rep transcripts ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1; 6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50:1; 100:1; 300:1; 500:1; 1000:1; 3000:1; 5000:1; or 10,000:1. In certain aspects, a ratio of the expression level of the small Rep proteins to the expression level of the large Rep proteins ranges from 1.5:1 to 10,000:1, including 1.5:1; 1.8:1; 2:1; 2.3:1; 2.5:1; 2.8:1; 3:1; 3.5:1; 4:1; 4.5:1; 5:1; 5.5:1; 6:1;6.5:1; 7:1; 7.5:1; 8:1; 8.5:1; 9:1; 9.5:1; 10:1; 50:1; 100:1; 300:1; 500:1; 1000:1; 3000:1; 5000:1; or 10,000:1.
[0204] In many embodiments, the polynucleotide includes an upstream heterologous promoter (e.g., a first promoter) that replaces the native p5 (“P5”) promoter for AAV large Rep. In this example, the native p19 (“P19”) promoter is mutated to reduce expression of the small Rep (e.g., comprises a TATA box mutation). In some embodiments, the p19 promoter is mutated to substantially reduce promoter activity. In some embodiments, the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native p19 promoter activity. The open reading frame (ORF) of the large Rep partially overlap with the ORF for the small Rep since large and small Rep genes share the same ORF in the 3’-end. In some embodiments, the first (e.g., upstream) half of a Rep coding sequence refers to the portion of the large Rep coding sequence that encodes the large Rep sequences that does not overlap with the small Rep coding sequence. In some embodiments, the second (e.g, downstream) half of a Rep coding sequence refers to the small Rep coding sequence which also includes the ORF that is part of the 3’end of the large Rep coding sequence. In some embodiments, an intron that is inserted in between the upstream half and downstream half of a Rep coding sequence and upstream of the small Rep coding sequence. However, in certain aspects, the intron may be positioned further downstream within the small Rep coding sequence with respect to the transcription start site for the small Rep, closer to the start site. In certain aspects, the intron may be positioned further upstream with respect to the transcription start site for the small Rep, closer to the p19 promoter. (e.g., within 10 nucleotides (nt), within 25 nt, within 50 nt, within 100 nt, within 250 nt, or within 500 nt). By placing the split intron and excisable element configuration proximally to the native p19 promoter, or heterologous promoter, minimizes the transcript length, and potentially the associated polypeptide, which may further minimize the likelihood of a functional polypeptide. The intron may include a multiple cloning site to facilitate introduction of the second promoter for driving expression of the small Rep. The second promoter may be heterologous to the small Rep coding sequence. The polynucleotide construct also may include an optional ORF encoding a tag that is in-frame with the large Rep and small Rep ORFs which results in production of tagged large and small Rep proteins. The p19 (“P19”) promoter may not include any mutations that decrease promoter activity. Additionally, the 5’ splice donor site and 3’splice sites should be in an intron-exon context, such as one or more of: CAG-G, CAG-A, AAG-G, or AAG-A, where the hyphen denotes site of insertion.
[0205] In some embodiments, a polynucleotide for expression of AAV large Rep transcripts and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts is provided. In some embodiments, an intron is inserted upstream of the small Rep coding sequence, which is within the coding sequence for large Rep. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter that is operably connected to the large Repcoding sequence and the TATA box of the p19 (“P19”) promoter is mutated to decrease promoter activity.
[0206] In some embodiments, a polynucleotide comprises an internal heterologous promoter (e.g., a second promoter) introduced into the intron for driving transcription from the small Rep coding sequence. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the p19 (“P19”) promoter is not modified to decrease promoter activity.
[0207] In some embodiments, a polynucleotide for expression of AAV large Rep and small Rep transcripts and subsequent expression of AAV large Rep proteins and small Rep proteins from these transcripts is provided. In some embodiments, an intron is inserted upstream of the small Rep coding sequence and in the coding sequence for large Rep. A heterologous promoter (e.g., a second promoter) inserted into the intron and operably connected to the small Rep coding sequence. In some embodiments, the p5 (“P5”) promoter is replaced with a heterologous promoter (e.g., a first promoter) that is operably connected to the large Rep coding sequence and the TATA box of the P19 promoter is mutated to decrease promoter activity.
[0208] Such polynucleotides may produce three types of transcripts. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron. Upon splicing out of the intron, large Rep proteins are translated from the processed transcripts. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is translated into small Rep proteins. Transcript 3 is produced under the control of the p19 promoter and is similar to Transcript 2.
[0209] In some embodiments, a polynucleotide comprises an excisable element inserted at a position that encodes a sequence common to large and small Rep proteins. The excisable element includes a stop codon flanked by recombination sites. Presence of this excisable element prevents expression of both full-length large Rep proteins and full-length small Rep proteins. In the presence of a recombinase, the recombination sites are joined and the stop codon is removed, allowing for expression of full-length large Rep proteins and full-length small Rep proteins.
[0210] Such polynucleotides are capable of producing three types of transcripts. Transcript 1 is produced under the control of the upstream heterologous promoter (e.g., first promoter) and initially includes the intron and is not translated into large Rep proteins due the presence of the stop codon in the excisable element. Transcript 2 is produced under the control of the internal heterologous promoter (e.g., second promoter) and is not translated into small Rep proteins due the presence of the stop codon in the excisable element. Transcript 3 is produced under the control of the p19 promoter and initially includes the intron and is not translated due the presence of the stop codon in the excisable element.
[0211] In some embodiments, the AAV Rep expression cassette further comprises a polyadenylation (polyA) signal sequence downstream of the Rep open reading frame. In some embodiments, the AAV Rep expression cassette further comprises an enhancer downstream of thepolyA signal sequence. In some embodiments, the AAV Rep expression cassette comprises a first promoter, the Rep open reading frame, a polyA signal sequence, and an enhancer.
[0212] In certain embodiments, the AAV Rep expression cassette comprises an AAV Rep coding sequence operably linked to native Rep promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence. In certain embodiments the AAV Rep expression cassette comprises an AAV Rep coding sequence operably linked to heterologous promoters, a PolyA signal sequence, and an enhancer downstream of the PolyA signal sequence
[0213] A suitable polyA signal sequence may be a signal sequence that increases the length of polyA added to Rep mRNAs and / or the amount of Rep mRNAs with a long polyA as compared to a coding sequence not including the PolyA signal sequence. In certain cases, the polyA signal sequence may be an AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a native AAV Rep polyA signal sequence. In certain cases, the polyA signal sequence may be a polyA signal sequence that is stronger than AAV Rep polyA signal sequence. A PolyA signal sequence that is stronger than AAV Rep PolyA signal sequence provides for an expression level of the Rep proteins that is higher than the expression level of the Rep proteins using the AAV Rep PolyA signal sequence, e.g., at least 5%, 10%, 20%, 30%, 40%, 50% higher, or more. Polyadenylation (polyA) signal sequences generally include a short sequence that triggers polyadenylation of an mRNA. In certain instances, RNA stability, expression, and / or function can be enhanced with additional sequences surrounding a shorter sequence. Various PolyA signal sequences can be used for the coding sequences of various embodiments. In certain embodiments, a polyA signal sequence that is stronger than AAV Rep polyA signal sequence may be bGH-polyA signal sequence or a SV40 polyA signal sequence as described herein. Additional suitable polyA signal sequences are described elsewhere herein.
[0214] In some embodiments, the polyA signal sequence is a native AAV Rep polyA signal sequence. In some embodiments, the polyA signal sequence is a heterologous polyA signal sequence. In some embodiments, the heterologous polyA signal sequence is selected from the group consisting of: a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin-1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence. In some embodiments, the heterologous polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs:214-222, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the heterologous polyA signal sequence is a bGH polyA signal sequence. In some embodiments, the heterologous polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 214, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.
[0215] A suitable enhancer may be a translational enhancer and / or a transcriptional enhancer. The enhancer increases the expression of the Rep proteins as compared to expression from a polynucleotide lacking the enhancer. In some embodiments, the enhancer comprises one or more sequences selected from the group consisting of SEQ ID NOs: 113, 103-107, and 108-212. In some embodiments, the enhancer comprises one or more of a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of one or more of SEQ ID NOs: 103-105, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing. In some embodiments, the enhancer is a double enhancer comprising a Simian virus 40 (SV40) and a CMV enhancer. In some embodiments, the double enhancer comprises the nucleotide sequence of SEQ ID NO: 106, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. In some embodiments, the enhancer is a triple enhancer comprising a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), and a CMV promoter / enhancer. In some embodiments, the enhancer comprises the nucleotide sequence of SEQ ID NO: 107, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof. Additional suitable enhancers are described elsewhere herein.
[0216] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins further comprises a sequence encoding AAV Cap proteins. AAV Cap proteins are described in the following section.
[0217] The Rep sequence can encode Rep from any desired AAV serotype. In some embodiments, the encoded Rep protein is drawn from the same serotype as the Cap protein. In some embodiments, the encoded Rep protein is drawn from a different serotype from the Cap protein. In particular embodiments, the encoded Rep protein includes, but is not limited to, a Rep protein from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof.
[0218] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV- 11 genome is provided in Virology, 330(2): 375-383 (2004).
[0219] In some embodiments, the Rep polypeptide is a wildtype Rep polypeptide. In other embodiments, the Rep polypeptide is a synthetic or mutant Rep polypeptide. In many embodiments, the Rep polypeptide is selected from any naturally occurring serotype or variant. Exemplary and non- limiting wild type Rep polypeptides include one or more of SEQ ID NOS: 5-14. The table below (e.g., Table 3) provides a summary of which polypeptide sequences (SEQ ID NOS: 5-14) in the sequence listing arise from which AAV serotype and is not limiting on the scope of the present disclosure:
[0220] In particular embodiments, the encoded Rep proteins, are large and small Rep proteins from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10 and AAV-11, or chimeric combinations thereof. In particular embodiments, the encoded Rep proteins are large Rep proteins and small Rep proteins from AAV serotype 2.
[0221] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins comprises a sequencing having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to one or more of SEQ ID NOS: 1-4. In certain embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins has sequence of any one of SEQ ID NOS: 1-4.
[0222] In some embodiments, the Rep expression cassette contains the sequence encoding the Rep proteins operably linked to a promoter and a polyA, such as any as described. In some embodiments, the Rep expression cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 291. In some embodiments, the late stage gene cassette comprises a sequence of SEQ ID NO: 291.
[0223] In some embodiments, the Rep expression cassette contains the sequence encoding the Rep proteins operably linked to a promoter, a polyA and an enhancer, such as any as described. In some embodiments, the Rep expression cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 349. In some embodiments, the late stage gene cassette comprises a sequence of SEQ ID NO: 349.
[0224] In some embodiments, the Rep expression cassette contains the sequence encoding the Rep proteins operably linked to a promoter, a polyA and an enhancer, such as any as described. In some embodiments, the Rep expression cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 388. In some embodiments, the late stage gene cassette comprises a sequence of SEQ ID NO: 388.
[0225] In some embodiments, the Rep expression cassette contains the sequence encoding the Rep proteins operably linked to a promoter, a polyA, an enhancer and a ribozyme coding sequence, such as any as described. In some embodiments, the Rep expression cassette comprises a sequence with a sequence identity of at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to SEQ ID NO: 308. In some embodiments, the late stage gene cassette comprises a sequence of SEQ ID NO: 308. 2. Polynucleotide Encoding Cap Proteins
[0226] In some embodiments, a polynucleotide comprises a sequence encoding AAV Cap proteins. In some instances, the polynucleotide comprising a sequence encoding AAV Cap proteins is located on a plasmid, vector, or construct by itself. In some embodiments, the polynucleotide includes a CAP expression cassette that comprises a Cap open reading frame sequence encoding AAV Cap proteins operably linked to a promoter.
[0227] In some embodiments, transcription of the sequence encoding the AAV Cap proteins on the polynucleotide comprising a sequence encoding AAV Cap proteins is driven by a native AAV Cap proteins promoter. In certain embodiments, the native AAV Cap proteins promoter is a P40 native AAV promoter. In some embodiments, the sequence encoding AAV Cap proteins is operably linked to a promoter. As described in relation to other sequences and polynucleotides, the operably linked promoter can be selected from a native promoter, a heterologous promoter, an inducible promoter, and / or a constitutive promoter. In some instances, the sequence encoding AAV Cap proteins is operably linked to an inducible promoter.
[0228] In some instances, the polynucleotide comprising a sequence encoding AAV Cap proteins is comprised on a polynucleotide comprising a sequence encoding AAV Rep proteins (e.g., such as described in the previous section. In some embodiments, the Rep coding sequence is 5’ to the Cap coding sequence. In certain embodiments, the Cap coding sequence is operably linked to an endogenous P40 promoter. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence. In some embodiments, the Cap coding sequence is operably linked to a heterologous promoter.
[0229] In other aspects, the AAV Cap coding sequence may be operably linked to a promoter, e.g., a constitutive promoter. In certain aspects, the promoter may be a native promoter. In certain aspects,the native promoter may be p40. In certain aspects, the p40 promoter may be present in the large Rep coding sequence that is common with the small Rep coding sequence.
[0230] In some embodiments, the AAV Cap coding sequence may be operably linked to an inducible promoter. The inducible promoter may be a promoter that is induced in response to exogenous or endogenous signals. For example, an inducible promoter may be induced in response to the production of a particular compound (e.g., protein, carbohydrate, lipid, etc.) within a cell or it may be induced by the addition of a triggering agent or inducer added exogenously, such as tetracycline, doxycycline, etc.
[0231] In some embodiments, the inducible promoter comprises a tetracycline-responsive promoter element (TRE). In some embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In some embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, transcription from the inducible promoter is activated by binding of an activator. Activators are known in the art. In some embodiments, the activator is reverse tetracycline-controlled transactivator (rtTA) comprising a Tet Repressor binding protein (TetR) fused to a VP16 transactivation domain. In some embodiments, the activator is selected from rtTa variants: rtTA, S2, M2, 2s-S1, 2s-M2, V1, rtTa3, V10, and V16. See, e.g., Das AT, Tenenbaum L, Berkhout B. Tet-On Systems For Doxycycline-inducible Gene Expression. Curr Gene Ther. 2016;16(3):156-67. doi: 10.2174 / 1566523216666160524144041.
[0232] In some embodiments, the activator binds the promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the activator comprises the sequence set forth in SEQ ID NO: 350 or SEQ ID NO: 265. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline. In some embodiments, the first triggering agent is doxycycline. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 262, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity of any of the foregoing. In some embodiments the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 262.
[0233] The Cap sequence can encode Cap proteins from any desired AAV serotype. Such Cap proteins may include one or more of VP1, VP2, and VP3. In some embodiments, the encoded Cap protein is drawn from the same serotype as the Rep protein. In some embodiments, the encoded Cap protein is drawn from a different serotype from the Rep protein. In particular embodiments, the encoded Cap protein includes, but is not limited to, a Cap protein from AAV serotypes AAV-1, AAV-2, AAV- 3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10 and AAV-11, or chimeric combinations thereof.
[0234] In some aspects, the capsid is a capsid selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80,AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68 (described in WO2020 / 033842, incorporated herein by reference in its entirety). The hu68 capsid is described in WO 2018 / 160582, incorporated herein by reference in its entirety. In some aspects, the capsid is an AAV5 capsid. In some aspects, the capsid is an AAV1 capsid. In some aspects, the capsid is an AAV2 capsid. In some aspects, the capsid is an AAV3 capsid. In some aspects, the capsid is an AAV4 capsid. In some aspects, the capsid is an AAV6 capsid. In some aspects, the capsid is an AAV7 capsid. In some aspects, the capsid is an AAV8 capsid. In some aspects, the capsid is an AAV9 capsid.
[0235] In some aspects, the capsid is a derivative, modification, or pseudotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV 13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 or AAVhu68.
[0236] In some aspects, capsid protein is a chimera of capsid proteins from two or more serotype selected from AAV1, AAV2, rAAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16 (described in WO2020 / 033842, incorporated herein by reference in its entirety). In certain embodiments, the capsid is an rh32.33 capsid, described in US Pat. No.8,999,678, incorporated herein by reference in its entirety.
[0237] The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV- 2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol, 45: 555-564 (1983); the complete genome of AAV- 3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8); the AAV-9 genome is provided in Gao et al. Virol, 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol Ther, 13(1): 67-76 (2006); and the AAV- 11 genome is provided in Virology, 330(2): 375-383 (2004).
[0238] In some embodiments, the Cap polypeptide is a wildtype Cap polypeptide. In other embodiments, the Cap polypeptide is a synthetic or mutant Cap polypeptide. In many embodiments, the Cap polypeptide is selected from any naturally occurring serotype or variant. Exemplary and non- limiting, naturally occurring Cap polypeptides can be selected from one or more of SEQ ID NOS: 18- 33. The table below (e.g., Table 4) provides a summary of which polypeptide sequences (SEQ ID NOS: 18-33) correlate to which AAV serotypes in the sequence listing arise from which AAV serotype and is not limiting on the scope of the present disclosure:
[0239] In some embodiments, the polynucleotide comprises a sequence encoding a AAV Cap protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOS: 18-33. In certain embodiments, the polynucleotide comprises a sequence encoding an AAV Cap protein that has the sequence of any one of SEQ ID NOS: 18-33.
[0240] In some embodiments, the Cap open reading frame comprises the nucleotide sequence of any of one of SEQ ID NOs: 279, 295 or 385, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0241] In some embodiments, the Cap open reading frame comprises a sequence encoding AAV9 Cap protein comprising a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 295. In certain embodiments, the Cap open reading frame comprises a sequence encoding AAV9 Cap protein comprising the sequence of SEQ ID NO: 295.
[0242] In some embodiments, the Cap open reading frame comprises a sequence encoding AAV5 Cap proteins comprising a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity toSEQ ID NO: 279. In certain embodiments, the Cap open reading frame comprises a sequence encoding AAV5 Cap protein comprising the sequence of SEQ ID NO: 279.
[0243] In some embodiments, the Cap open reading frame comprises a sequence encoding AAV2 Cap proteins comprising a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 385. In certain embodiments, the Cap open reading frame comprises a sequence encoding AAV5 Cap protein comprising the sequence of SEQ ID NO: 385.
[0244] Various embodiments may include one or more of an enhancer and a polyA signal sequence. Such polyA signal sequences can be heterologous to the AAV Cap protein. In some instances, the polyA signal sequence encodes a stronger polyA signal than a native AAV Cap polyadenylation signal sequence and is 3' of the sequence encoding AAV Cap proteins. Enhancers can include one or more of enhancers described herein, including translational and / or transcriptional enhancers. Such enhancers can be 3’ and / or 5’ of the sequence encoding the AAV Cap proteins, depending on effect or purpose of the enhancer. In some instances, the polynucleotide comprises multiple enhancers, as described herein.
[0245] In certain aspects, the Cap coding sequence may be operably linked to a polyadenylation (polyA) signal sequence. The polyA signal sequence may be a polyA signal sequence functional in the cells used for producing the rAAV. In some instances, the polyA signal sequence may be a bovine Growth Hormone polyA (bGH-PolyA) signal sequence or a SV40 polyA signal sequence.
[0246] The bGH-PolyA signal sequence may include a nucleotide sequence that has at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity or 100% sequence identity to nucleotide sequence of SEQ ID NO: 214.
[0247] In certain cases, the SV40 polyA signal sequence may include a nucleotide sequence having at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity or 100% sequence identity to SEQ ID NO: 46 or SEQ ID NO: 217.
[0248] In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of any one of SEQ ID NOs: 281, 296, 386, 401, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 68 or SEQ ID NO: 69, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
[0249] In some embodiments, the AAV2 Cap expression cassette encodes AAV2 Cap and comprises the nucleotide sequence of SEQ ID NO: 386, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 386.
[0250] In some embodiments, the AAV5 Cap expression cassette encodes AAV5 Cap and comprises the nucleotide sequence of SEQ ID NO: 281, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 281.
[0251] In some embodiments, the AAV9 Cap expression cassette encodes AAV9 Cap and comprises the nucleotide sequence of SEQ ID NO: 296, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 296.
[0252] In some embodiments, the AAV9 Cap expression cassette encodes AAV9 Cap and comprises the nucleotide sequence of SEQ ID NO: 401, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 401.
[0253] In some embodiments, the polynucleotide comprising a sequence encoding AAV Rep proteins and the polynucleotide comprising a sequence encoding AAV Cap proteins are the same polynucleotide. For example, a polynucleotide construct comprises the sequence encoding AAV Rep proteins and the sequence encoding AAV Cap proteins. In various instances, the sequence encoding the AAV Rep proteins is 5’ of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins is downstream of the sequence encoding the AAV Cap proteins. In some instances, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are antiparallel to each other (e.g., on different coding strands).
[0254] In various embodiments, the sequence encoding the AAV Rep proteins and the sequence encoding the AAV Cap proteins are separated by an intervening sequence. In certain embodiments, the intervening sequence is a transcription blocking element (TBE). In some such embodiments, the promoter of the Cap expression cassette is adjacent to the promoter of the Rep expression cassette. In some embodiments, the TBE blocks cross-promotion of transcription between the promoter of the AAV Rep expression cassette and the promoter of the Cap expression cassette such that the promoter of the AAV Rep expression cassette cannot effect transcription of the Cap coding sequence and the promoter of the AAV Cap expression cassette cannot effect transcription of the Rep coding sequence.
[0255] In certain embodiments, the TBE comprises a nucleotide sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 34. 3. Selectable marker
[0256] In certain aspects, the polynucleotide comprising an AAV Cap and / or AAV Rep expression cassette also includes a coding sequence for a selectable marker, e.g. a selection cassette. In someembodiments, the polynucleotide comprises: i) an AAV Cap expression cassette, ii) an AAV Rep expression cassette, and iii) a selection cassette.
[0257] The coding sequence for the selectable marker may be operatively linked to a constitutive promoter. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR).
[0258] In some embodiments, the polynucleotide comprising an AAV Cap and / or AAV Rep expression cassette further comprises a selection cassette. In some embodiments, the selection cassette comprises, from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a selectable marker. In some embodiments, the selection cassette is located downstream of the AAV Cap expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Cap expression cassette. In some embodiments, the selection cassette is located downstream of the AAV Rep expression cassette. In some embodiments, the selection cassette is in the same orientation as the AAV Rep expression cassette.
[0259] In some embodiments, the constitutive promoter is an EF1α promoter. In some embodiments, the EF1α promoter has a TATA box mutation. A TATA box mutation reduces the activity of the EF1α promoter resulting in decreased expression of the selectable marker. This promoter is useful for increasing copy number of the polynucleotide when present in a cell that is cultured under a selection pressure (e.g., antibiotic and for preventing cellular toxicity due to leaky Rep protein expression). In some embodiments, the constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327.
[0260] In some embodiments, the selectable marker is an antibiotic resistance gene. In some embodiments, the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene. In some embodiments, the resistance gene is a blasticidin resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a resistance gene. In some embodiments, the selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.
[0261] In some embodiments, the selectable marker comprises the nucleotide sequence of SEQ ID NO: 282, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 282.
[0262] In some embodiments, the selection cassette comprises a 3’ UTR downstream of the selectable marker. In some embodiments, the 3’ UTR comprises the nucleotide sequence of SEQ ID NO: 380, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 380.
[0263] In some embodiments, the selection cassette comprises a polyA sequence downstream of the selectable marker. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 3381, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 381.
[0264] In some embodiments, the selection cassette comprises the nucleotide sequence of SEQ ID NO: 383, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 383. 4. Exemplary Rep / Cap Constructs
[0265] In some embodiments, the polynucleotide comprises the nucleotide sequence of any of SEQ ID NOs: 384, 387, 390, 393, 398, 399 or 402, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the polynucleotide comprises the nucleotide sequence of any of SEQ ID NOs: 384, 387, 390, 393, 398, 399, or 402.
[0266] The polynucleotide described herein may be used in a vector. The vector comprising the polynucleotide may be used in conjunction with one or more additional vectors for producing rAAV. Such vector systems are provided in Section IV.
[0267] Various instances may be directed to variations on one or more protein encoding sequences to enhance expression, to limit unwanted expression, and / or any other desirable characteristic, including ribozymes, enhancers, heterologous promoters, heterologous polyA signal sequences, etc.
[0268] FIGS.1A-1B and FIGS.6A-6B illustrate a system of polynucleotides referred to as a v1.3 system and comprising a Tet-On promoter and a heterologous polyA signal sequence operably linked to the sequence encoding AAV Cap proteins. Additionally, the sequence encoding AAV Rep proteins is operably linked to a heterologous polyA signal sequence and an enhancer. In an off-state (FIG.1A or FIG. 6A), Cap expression is suppressed, while Rep expression is suppressed due to the presence of the excisable element. In an on-state (FIG. 1B or FIG. 6B) from introduction of first and second triggering agents (e.g., doxycycline and tamoxifen), Cap is expressed, and a cre recombinase (encoded in the helper construct) translocates to the nucleus, allowing recombination within the intron within the Rep coding sequence. The Rep mRNA is stabilized and / or possesses enhanced expression due to a heterologous polyA signal sequence and the enhancer.
[0269] An exemplary Rep / Cap construct of a v1.3 system with serotype AAV9 (e.g., CAP AAV9) is listed in Table 7 below. Table 7 describes exemplary components of the v1.3 system Rep and Cap expression cassettes (e.g., Rep / Cap construct), which encode AAV Rep and Cap proteins. An exemplaryRep expression cassette of the v1.3 system comprises a Rep coding sequence with native promoters, introns, an excisable element (i.e., CODE (excisable element) SEQ ID NO: 292), and a heterologous polyA signal (e.g., bovine growth hormone) sequence. In some embodiments, the Rep expression cassette includes one or more enhancers. In some embodiments, the enhancer sequence downstream of the Rep coding sequence is a triple enhancer (SEQ ID NO: 107) as shown in Table 7. In some embodiments, an exemplary v.1.3 Rep / Cap construct has all the same elements listed in Table 7, except for the triple enhancer sequence which is replaced with the sequence of a double enhancer (SEQ ID NO: 106). In some embodiments, the Rep expression cassette and a Cap expression cassette is separated by a transcriptional blocking element (TBE). An exemplary Cap expression cassette comprises an inducible promoter, an intron, Cap coding sequence, and a heterologous polyA signal (e.g., SV40) sequence. In some embodiments, the Cap coding sequence is operably linked to one or more enhancers. In some embodiments, the Rep / Cap construct further includes a selection cassette. In this exemplary construct, expression of a split selectable marker is driven by constitutive promoter and allows for selection of cells with the integrated Rep / Cap construct. A first triggering agent (e.g., tetracycline) and a second triggering agent (e.g., tamoxifen) are added to trigger excision of the excisable element in the Rep expression cassette. The first triggering agent also induces expression of the inducible promoter (e.g., expressing Cap protein). The exemplary Rep and Cap expression cassettes are designed to encode the expression cassettes in opposing directions. In some embodiments, the Rep expression cassette is oriented in the forward (e.g., “F”) direction and the Cap expression cassette is oriented in the reverse (e.g., “R”) direction. In some embodiments, the Rep expression cassette is oriented in the reverse (e.g., “R”) direction and the Cap expression cassette is oriented in the forward (e.g., “F”) direction. In some embodiments, the Rep / Cap construct comprises a Rep expression cassette (SEQ ID NO: 291), a Cap expression cassette (SEQ ID NO: 296) and a selection cassette. In some embodiments, the Rep expression cassette comprises a heterologous polyA sequence and enhancer sequence downstream of the Rep coding sequence to enhance Rep protein expression. In some embodiments, the Cap expression cassette comprises an inducible promoter operably linked to an AAV9 Cap coding sequence.
[0270] An exemplary Rep / Cap construct of a v1.3 system with serotype AAV5 (e.g., CAP AAV5) is listed in Table 8 below. Table 8 describes an exemplary Cap expression cassette encoding Cap proteins of AAV5 serotype. In some embodiments, the Cap expression cassette (e.g., Cap AAV5) listed in Table 8 is expressed in place of the Cap AAV9 expression cassette listed in Table 7. The Cap sequence can encode Cap proteins from any desired AAV serotype, and Cap proteins may include one or more of VP1, VP2, and VP3. In some embodiments, the encoded Cap protein is drawn from the same serotype as the Rep protein. In some embodiments, the encoded Cap protein is drawn from a different serotype than the Rep protein. In some embodiments, the encoded Cap protein is a Cap protein from AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV- 10, or AAV-11, or chimeric combinations thereof.
[0271] FIGS. 13A-13B illustrate a v1.4 polynucleotide system in accordance with various embodiments. In the v1.4 system, the Rep / Cap construct is similar to v1.3, with the exception that the sequence encoding Rep proteins is operably linked to heterologous promoters. With the inclusion of heterologous promoters, Rep expression may be increased relative to expression from native promoters. In certain instances, the selection of the heterologous promoters (p1 and p2) may be used to modulate relative levels of large Rep and small Rep.
[0272] An exemplary Rep / Cap construct of v1.4 system is shown in Table 9 below and an exemplary insert sequence is found in SEQ ID NO: 387 (v1.4 AAV5 Cap). Table 9 describes exemplary components of the v1.4 system Rep and Cap expression cassettes (e.g., Rep / Cap construct), which encode AAV Rep and Cap proteins. An exemplary Rep expression cassette of the v1.4 system comprises similar Rep and Cap expression cassettes to v1.3, however the sequence encoding Rep proteins is operably linked to heterologous promoters in v1.4 Rep expression cassette. The inclusion of heterologous promoters increases Rep expression relative to expression levels achieved with nativepromoters. In some embodiments, the selection of the heterologous promoters may be used to modulate relative levels of large Rep and small Rep proteins. As in v1.3, the exemplary Rep and Cap expression cassettes are designed to encode the expression cassettes in opposing directions. In some embodiments, the enhancer sequence downstream of the Rep coding sequence is a triple enhancer (SEQ ID NO: 107) as shown in Table 9. In some embodiments, an exemplary v.1.4 Rep / Cap construct has all the same elements listed in Table 9, except for the triple enhancer sequence which is replaced with the sequence of a double enhancer (SEQ ID NO: 106). In some embodiments, the Rep expression cassette is oriented in the forward (e.g., “F”) direction and the Cap expression cassette is oriented in the reverse (e.g., “R”) direction. In some embodiments, the Rep expression cassette is oriented in the reverse (e.g., “R”) direction and the Cap expression cassette is oriented in the forward (e.g., “F”) direction.
[0273] FIGS.14A-14B illustrate a system including a ribozyme operably linked to the Rep coding sequence and is referred to as a v1.4.1 system. In its off-state (FIG.14A; e.g., uninduced; prior to the addition of triggering agents), the ribozyme is flanked by recombination sites (e.g., Lox sites). Unwanted or leaky transcription of the Rep coding sequence generates an mRNA comprising the ribozyme. The ribozyme facilitates degradation of the mRNA and suppresses the unwanted Rep expression. In the on-state (FIG.14B), translocation of a cre recombinase (encoded in the helper construct) by introduction of the second triggering agent (e.g., tamoxifen) excises the ribozyme, thus allowing Rep expression.
[0274] An exemplary v1.4.1 Rep / Cap construct has all the same elements listed in Table 9 for an exemplary v1.4 Rep / Cap construct and further includes a ribozyme sequence flanked by Loxrecombination sites that is inserted after the small Rep coding sequence and before the polyA. An exemplary addition of a ribozyme component for a Rep / Cap construct of v1.4.1 system is shown below in Table 10. The ribozyme facilitates degradation of the mRNA and suppresses leaky Rep expression (e.g., prior to induced expression of Rep). In some embodiments, an exemplary v1.4.1 Rep / Cap construct has a triple enhancer sequence (SEQ ID NO: 107) as shown in Table 9. In some embodiments, an exemplary v.1.4.1 Rep / Cap construct comprises all the same elements listed in Table 9, except for the triple enhancer sequence which was replaced with the sequence of a double enhancer (SEQ ID NO: 106).
[0275] In some embodiments, the Rep / Cap polynucleotide encodes a polynucleotide of v1.4.1. In some embodiments, the v1.4.1 Rep / Cap polynucleotide comprises heterologous promoters and a ribozyme Rep / Cap construct. In some embodiments, the uninduced heterologous promoters and a ribozyme Rep / Cap construct comprises a sequence of SEQ ID NO: 344. In some embodiments, the induced heterologous promoters and a ribozyme Rep / Cap construct comprises a sequence of SEQ ID NO: 345. In some embodiments, the full construct (e.g., plasmid) comprising heterologous promoters and a ribozyme Rep / Cap construct comprises a sequence of SEQ ID NO: 346.
[0276] Exemplary full-length Rep / Cap constructs are included in Table 11 below. Table 11 summarizes Rep / Cap construct SEQ ID NOS for polynucleotides of system version 1.3, v1.4, and v1.4.1 for both AAV5 and AAV9 serotypes.C. Polynucleotide Encoding Adenoviral Helper Proteins
[0277] In some embodiments, a polynucleotide comprises a sequence encoding one or more adenoviral helper proteins. In some embodiments, polynucleotide comprises an AAV helper expression cassette comprising a sequence encoding one or more helper proteins operably linked to a promoter. In some embodiments, the AAV helper expression cassette is a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins.
[0278] In some embodiments, the polynucleotide, in some instances referred to as a second polynucleotide, further comprises a second expression cassette, e.g., an activator expression cassette, comprising a second constitutive promoter operably linked to a nucleotide sequence encoding an activator. In some embodiments, the polynucleotide further comprises a third expression cassette, e.g., a VA-RNA expression cassette, comprising a first part of a third constitutive promoter, a third excisable element, a second part of a third constitutive promoter and a sequence encoding VA RNA.
[0279] In some embodiments, the first expression cassette further comprises an inducible promoter. In some embodiments, the first expression cassette comprises, from 5’ to 3’: a) an inducible promoter, b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and c) a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.
[0280] In some embodiments, the inducible promoter of the polynucleotide comprising a sequence encoding one or more AAV helper proteins is the same as the inducible promoter of the polynucleotide comprising a sequence encoding AAV Cap proteins. In some embodiments, the inducible promoter of the helper expression cassette is the same as the inducible promoter of the AAV Cap expression cassette. In some embodiments, the inducible promoter that is operably linked to the recombinase is the same as the inducible promoter that is operably linked to the Cap open reading frame.
[0281] In some embodiments, transcription from the inducible promoter is activated by the binding of an activator. In some embodiments, the activator activates transcription from the inducible promoter operably linked to the recombinase and the inducible promoter operably linked to the Cap open reading frame. In some embodiments, the activator binds the inducible promoter in the presence of a first triggering agent. In some embodiments, the activator is Tet-On3G. In some embodiments, the inducible promoter is activated in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline or tetracycline.
[0282] In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre-ERT2 fusion protein. Insome embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is tamoxifen.
[0283] In some embodiments, in the off state, such as depicted in Construct 1 FIG. 6A, 7A and 8A, the self-excising element, comprising the sequence encoding the recombinase (e.g., a Cre recombinase), of the first expression cassette prevents operable linkage of the inducible promoter to the sequence encoding the one or more AAV helper proteins. In the on state, such as depicted in Construct 1 FIG. 6B, 7B and 8B, in the presence of a first triggering agent, e.g., doxycycline, expression of the recombinase is activated by binding of the first triggering agent to an activator. In the presence of a second triggering agent, e.g., tamoxifen, the inducible recombinase translocates to the nucleus and the self-excising element is excised by the recombinase, thereby resulting in operable linkage of the inducible promoter to the one or more AAV helper proteins and allowing the expression of the one or more AAV helper proteins. Self-excision of the sequence encoding the Cre recombinase limits the duration of Cre expression in the cells thus limiting Cre related toxicity and promiscuous recombination events. In some embodiments, the activator, such as TetON3G, is expressed from a second expression cassette and can only bind to an inducible promoter, e.g.,a tet-inducible promoter, in the presence of a triggering agent, such as doxycycline. In some embodiments, such as depicted in Construct 1 of FIG. 6B, 7B and 8B, when expression of the recombinase is activated, e.g., in the presence of a first triggering agent, and the inducible recombinase translocates to the nucleus, e.g., in the presence of a second triggering agent, the third excisable element is excised, thereby reconstituting the constitutive promoter by operably linking the first part with the second part of the constitutive promoter, which results in expression of the VA RNA.
[0284] In certain embodiments, this helper construct comprises: an inducible promoter operably linked to a self-excising element; the self-excising element comprising a third recombination site and a fourth recombination site flanking a sequence encoding an inducible recombinase; a constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins. In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins constitutively expresses the activator and the activator is unable to activate the first inducible promoter or the second inducible promoter in absence of a first triggering agent. In some embodiments, in absence of activation of the first inducible promoter and the second inducible promoter, detectable levels of the Rep proteins from the polynucleotide comprising a sequence encoding AAV Rep proteins or if present the Cap proteins, the Cap proteins from the polynucleotide comprising a sequence encoding AAV Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins are not expressed, and wherein the inducible recombinase is activated in the presence of a second triggering agent. In some embodiments, a polynucleotide comprising a sequence encoding adenovirus helper proteins is comprised within a construct, where theconstruct further comprises a polynucleotide comprising a sequence encoding VA-RNA as described herein.
[0285] In some embodiments, the polynucleotide comprising the sequence encoding one or more adenoviral helper proteins comprises: (i) a first sequence comprising from 5' to 3': a second inducible promoter operably linked to a sequence encoding an inducible recombinase; a self-excising element comprising a third recombination site, the sequence encoding the inducible recombinase, and a fourth recombination site; and a sequence encoding one or more adenoviral helper proteins, wherein the second inducible promoter is not operably linked to the sequence encoding the one or more adenoviral helper proteins; (ii) a second sequence comprising a first constitutive promoter operably linked to a sequence encoding an activator. In some embodiments, the third recombination site and the fourth recombination site are oriented in the same direction. In some embodiments, the cell constitutively expresses the activator, and the activator is unable to activate the second inducible promoter in absence of a first triggering agent. In some embodiments, in the presence of the first triggering agent, the activator activates the second inducible promoter resulting in expression of the inducible recombinase, and the inducible recombinase is expressed. In some embodiments, in the presence of a second triggering agent, the inducible recombinase translocates to a nucleus of the cell and causes recombination between the third recombination site and the fourth recombination site resulting in excision of the self-excising element, thereby operably linking the second inducible promoter to the sequence encoding the one or more adenoviral helper proteins and allowing expression of the one or more adenoviral helper proteins.
[0286] In some embodiments, the one or more adenoviral helper proteins comprise one or more of adenovirus E1A protein, E1B protein, E2A protein, and E4 protein. In certain embodiments, the one or more adenoviral helper proteins comprises E2A protein and E4 protein.
[0287] In some embodiments, the polynucleotide comprising the sequence encoding for one or more AAV helper proteins comprises a bicistronic open reading frame encoding two AAV helper proteins. In some embodiments, the sequence encoding one or more helper proteins comprises the nucleotide sequence of SEQ ID NO: 326.
[0288] In some embodiments, the one or more adenoviral helper proteins are separated by a bicistronic open reading frame. In certain embodiments, the bicistronic open reading frame comprises an internal ribosome entry site (IRES) or a peptide 2A (P2A) sequence.
[0289] In some embodiments, the sequence encoding the one or more AAV helper proteins is a bistronic open reading frame encoding at least two AAV helper proteins. In some embodiments, the one or more helper proteins comprise E2A and E4. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 319 and SEQ ID NO: 321, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 319 and SEQ ID NO: 321. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 324, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 324.
[0290] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker. In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by an IRES. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 323, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the IRES comprises that nucleotide sequence of SEQ ID NO: 323.
[0291] In some embodiments, the sequence coding for E2A and the sequence coding for E4 are separated by a cleavable linker. In some embodiments, the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A. In some embodiments, the 2A peptide is P2A, T2A, F2A, or E2A.
[0292] In some embodiments, the second inducible promoter operably linked to the self-excising element in the polynucleotide is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter.
[0293] In some embodiments, the first inducible promoter and the second inducible promoter are the same. In some embodiments, the first inducible promoter and the second inducible promoter are a tetracycline-inducible promoter. In some embodiments, the inducible promoter of the polynucleotide encoding Adenoviral Helper proteins is the same as the inducible promoter of the polynucleotide encoding Rep and Cap proteins, such as described in Section II.B and / or the inducible promoter encoding the adenovirus late stage gene (e.g., L4) as described in Section I.A.
[0294] In certain embodiments, the tetracycline-inducible promoter comprises a tetracycline- responsive promoter element (TRE). In certain embodiments, the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter. In certain embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, the tetO sequence concatamers comprises the sequence of SEQ ID NO: 341. In certain embodiments, the minimal promoter is a human cytomegalovirus promoter. In some embodiments, the minimal promoter comprises the nucleotide sequence of SEQ ID NO: 342.
[0295] In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 262 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the inducible promoter comprises the nucleotide sequence of SEQ ID NO: 262.
[0296] In some embodiments, the first constitutive promoter is EF-1alpha promoter or human cytomegalovirus promoter.
[0297] In some embodiments, the activator is reverse tetracycline-controlled transactivator (rTA) comprising a Tet Repressor binding protein (TetR) fused to a VP16 transactivation domain.
[0298] In some embodiments, the inducible promoter is activated in the presence of a triggering agent, e.g., a first triggering agent. For instance, as shown in FIG. 6A, 7A, 8A 13A, and 14A, in the absence of a triggering agent, the inducible promoter is not activated, thereby resulting in a lack of expression of helper proteins E2A and E4 from the helper construct (e.g., Construct 1), whereas in the presence of a triggering agent there is activation of the inducible promoter, thereby resulting in expression of helper proteins E2A and E4 from the helper construct (e.g., Construct 1, as shown in FIGS.6B, 7B, 8B, 13B, or 14B.
[0299] In some embodiments, a triggering agent for inducing the tetracycline-inducible promoter is tetracycline. In other embodiments, a triggering agent for inducing the tetracycline-inducible promoter is doxycycline.
[0300] In some embodiments, the inducible recombinase is fused to an estrogen response element (ER) and translocates to the nucleus in the presence of tamoxifen. As used herein, an estrogen response element can refer to an estrogen receptor.
[0301] In embodiments as described, the self-excising element includes recombination sites, e.g., a third recombination site and a fourth recombination site, flanking a sequence encoding an inducible recombinase. In some embodiments, the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the flanking recombination sites, e.g., third recombination site and the fourth recombination site. In some embodiments, the inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following the recombination event between the third recombination site and the fourth recombination site, as depicted in FIG.6B, 7B, 8B, 13B, or 14B.
[0302] In some embodiments, the recombinase is a Cre recombinase or a flippase (FLP) recombinase.
[0303] In some embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and the polynucleotide comprising a sequence encoding helper proteins are lox sites and the inducible recombinase is a Cre recombinase. In some embodiments, the flanking recombination sites, e.g., third recombination and fourth recombination sites, comprise Lox sequences, and the recombinase is a Cre recombinase. In some embodiments, the recombinase is an inducible recombinase. In some embodiments, the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain. In some embodiments, the inducible recombinase is a Cre- ERT2 fusion protein. In some embodiments, the inducible recombinase translocates to the nucleus in the presence of a second triggering agent. In some embodiments, the second triggering agent is an estrogen receptor ligand. In some embodiments, the second triggering agent is a selective estrogen receptor modulator (SERM). In some embodiments, the second triggering agent is tamoxifen.
[0304] In some embodiments, the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 317, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, therecombination event between the flanking recombination sites, e.g., third recombination site and the fourth recombination site, is induced in the presence of the first and second triggering agents. In some embodiments, the first triggering agent is doxycycline and the second triggering agent is tamoxifen.
[0305] In other embodiments, the recombination sites in the polynucleotide comprising a sequence encoding AAV Rep proteins and the polynucleotide comprising a sequence encoding helper proteins are flippase recognition target (FRT) sites and the inducible recombinase is a flippase (Flp) recombinase. In some embodiments, the flanking recombination sites, e.g., third recombination and fourth recombination sites, comprise FRT sequences. In some embodiments, the recombinase is a Flp recombinase. In some embodiments, the fifth recombination and sixth recombination sites comprise FRT sequences,and the recombinase is a Flp recombinase.
[0306] In some embodiments, presence of the triggering agent activates the activator for activation of the first inducible promoter to express AAV Cap proteins from the polynucleotide encoding the AAV Cap proteins.
[0307] In some embodiments, presence of the triggering agent activates the activator for activation of the second inducible promoter to express the Rep proteins of the polynucleotide comprising a sequence encoding AAV Rep proteins; if present, the Cap proteins, the inducible recombinase, and the one or more adenoviral helper proteins.
[0308] In some embodiments, upon expression of the inducible recombinase, recombination between the first recombination site and the second recombination site in the polynucleotide comprising a sequence encoding AAV Rep proteins results in excision of the excisable element, and the first part of the AAV Rep proteins coding sequence and the second part of the AAV Rep proteins coding sequence are joined to form a complete AAV Rep proteins coding sequence, wherein the one or more promoters are operably linked to the complete AAV Rep coding sequence to allow expression of an AAV Rep protein of the polynucleotide comprising a sequence encoding AAV Rep proteins and, if present, the Cap Proteins; and recombination between the third recombination site and the fourth recombination site in a polynucleotide comprising a sequence encoding VA-RNA (as described herein) results in excision of the self-excising element comprising the sequence encoding the inducible recombinase, wherein the inducible promoter becomes operably linked to the sequence encoding the one or more adenoviral helper proteins to allow expression of the one or more adenoviral helper proteins.
[0309] In some embodiments, the polynucleotide further comprises a selectable marker operably linked to a third promoter.
[0310] In some embodiments, the AAV helper expression cassette, e.g., first expression cassette, comprises the nucleotide sequence of SEQ ID NO: 363, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the AAV helper expression cassette, e.g., first expression cassette, comprises the nucleotide sequence of SEQ ID NO: 363.
[0311] In some embodiments, the polynucleotide encoding the helper proteins, e.g., second polynucleotide, further comprises an activator expression cassette, e.g., second expression cassette, comprising a constitutive promoter, e.g., second constitutive promoter, operably linked to a nucleotide sequence encoding an activator.
[0312] In some embodiments, the activator is Tet-on3G. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 350 or SEQ ID NO: 265 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the activator comprises the nucleotide sequence of SEQ ID NO: 350 or SEQ ID NO: 265.
[0313] In some embodiments, the activator expression cassette, e.g., second expression cassette, is in an opposite orientation relative to the AAV helper expression cassette, e.g., first expression cassette. In some embodiments, the AAV helper expression cassette, e.g, first expression cassette, is oriented 3’ to 5’ and the activator expression cassette, e.g., second expression cassette, is oriented 5’ to 3’, or the AAV helper expression cassette, e.g., first expression cassette, is oriented 5’ to 3’ and the activator expression cassette, e.g., second expression cassette, is oriented 3’ to 5’. In some embodiments, the AAV helper expression cassette, e.g., first expression cassette, is separated from the activator expression cassette, e.g., second expression cassette, by an intervening sequence. In some embodiments, the intervening sequence comprises a transcriptional blocking element (TBE). In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 34 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the TBE element comprises the sequence of SEQ ID NO: 34.
[0314] In some embodiments, the activator activates transcription from the inducible promoter of the polynucleotide encoding Rep / Cap (e.g., first polynucleotide) and / or the polynucleotide encoding helper proteins (e.g, second polynucleotide) in the presence of a first triggering agent. In some embodiments, the first triggering agent is doxycycline.
[0315] In some embodiments, the constitutive promoter (e.g., second constitutive promoter) is an EF1α promoter. In some embodiments, the EF1α promoter has a TATA box mutation. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327.
[0316] In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second expression cassette comprises the nucleotide sequence of SEQ ID NO: 336.1. Polynucleotide Encoding VA-RNA
[0317] In some embodiments, a polynucleotide comprises a sequence encoding a viral associated RNA (VA-RNA). In some embodiments, the sequence encoding the VA-RNA is on the same polynucleotide as the sequence encoding the AAV helper proteins, which also can include a sequence encoding the activator. In certain embodiments, the VA-RNA is a mutated VA-RNA. In some embodiments, the VA-RNA is wild-type VA-RNA. In other embodiments, VA-RNA comprises one or more mutations in the VA-RNA internal promoter.
[0318] In some embodiments, the sequence encoding the VA-RNA is part of a further expression cassette, e.g., third expression cassette. In some embodiments, the VA-RNA is operably linked to a promoter. In some embodiments, the expression of VA-RNA is constitutive. In some embodiments, the expression of VA-RNA is inducible. In some embodiments, the constitutive promoter is EF1alpha promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter.
[0319] In some embodiments, the promoter is a constitutive promoter. In some cases, the promoter is an inactive promoter in which two parts of a promoter are separated by an excisable element that when excised result in a functional promoter.
[0320] In some embodiments, the sequence encoding the VA-RNA is operably linked to an inactive promoter comprising a first part of a second constitutive promoter and a second part of the second constitutive promoter separated by a second excisable element comprising a fifth recombination site and a sixth recombination site flanking a stuffer sequence, and excision of the second excisable element by the inducible recombinase generates a functional complete second constitutive promoter operably linked to the VA-RNA coding sequence to allow expression of the VA-RNA. In some embodiments, the fifth and sixth recombination sites are oriented in the same direction.
[0321] Provided herein, in some embodiments, is a second polynucleotide comprising a first expression cassette, wherein the first expression cassette comprises a nucleotide sequence encoding one or more AAV helper proteins, such as described herein; a second expression cassette comprising a constitutive promoter (e.g., first constitutive promoter) operably linked to a nucleotide sequence encoding an activator, as described herein; and a third expression cassette comprising a first part of a constitutive promoter (e.g., second constitutive promoter), am excisable element (e.g. second excisable element), a second part of a constitutive promoter and a sequence encoding VA RNA.
[0322] In some embodiments, the sequence of the VA-RNA expression cassette (e.g., third expression cassette) is downstream of the activator expression cassette (e.g., second expression cassette) and is in the same orientation as the activator expression cassette. In some embodiments, the second excisable element is in an opposite orientation relative to the second constitutive promoter. In some embodiments, the second excisable element comprises a selection cassette (e.g., second selection cassette) flanked by recombination sites (e.g., seventh recombination site and an eighth recombinationsite). In some embodiments, the selection cassette (e.g., second selection cassette) is excised following a recombination event between the flanking recombination sites (e.g., seventh recombination site and the eighth recombination site) thereby generating a functionally complete constitutive promoter operably linked to the sequence encoding VA RNA.
[0323] In some embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of an RNA polymerase III promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of an RNA polymerase III promoter. In other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U6 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U6 promoter. In still other embodiments, the first part of the second constitutive promoter comprises a distal sequence element (DSE) of a U7 promoter, and the second part of the second constitutive promoter comprises a proximal sequence element (PSE) of a U7 promoter.
[0324] In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 364 or SEQ ID NO: 329, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 364 or SEQ ID NO: 329. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 365, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 365. In some embodiments, the functionally complete U6 promoter comprises the nucleotide sequence of SEQ ID NO: 348.
[0325] In certain embodiments, the VA-RNA is a mutated VA-RNA. In some embodiments, the VA-RNA is wild-type VA-RNA. In other embodiments, VA-RNA comprises one or more mutations in the VA-RNA internal promoter.
[0326] In some embodiments, the sequence encoding VA-RNA comprises the nucleotide sequence of any one of SEQ ID NOs: 84, 87, 85, and 86.
[0327] In some embodiments, a polynucleotide encoding a VA-RNA comprises a sequence coding for a transcriptionally dead (e.g., transcriptionally inactive) VA-RNA. In some embodiments, the sequence coding for the VA-RNA comprises a deletion of from about 5-10 nucleotides in the promoter region. In some embodiments, the sequence encoding VA RNA comprises a 10 nt deletion. In some embodiments, the sequence encoding VA-RNA comprises the nucleotide sequence of SEQ ID NO: 85. In some embodiments, the sequence coding for the VA-RNA comprises at least one mutation. In some embodiments, the at least one mutation is in the A Box promoter region. In some embodiments, the at least one mutation is in the B Box promoter region. In some embodiments, the at least one mutation is G16A mutation or a G60A mutation, or a combination thereof. In some embodiments, the VA-RNA comprises a G16A mutation or a G60A mutation, or a combination thereof. In some embodiments, thesequence encoding VA RNA comprises at least one mutation in an internal promoter. In some embodiments, the at least one mutation comprises a G16A mutation with reference to SEQ ID NO: 86. In some embodiments, the sequence encoding VA RNA comprises at least two mutations in an internal promoter. In some embodiments, the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO: 84. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 87 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 87.
[0328] In some embodiments, the second selection cassette comprises a constitutive promoter (e.g., third constitutive promoter) operably linked to a nucleotide sequence encoding a selectable marker. In some embodiments, the selectable marker (e.g., second selectable marker) is an antibiotic resistance gene, such as a puromycin resistance gene. In some embodiments, the selectable marker is a puromycin resistance gene. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 332, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 332.
[0329] In some embodiments, the constitutive promoter (e.g., third consecutive promoter) is a CMV promoter.
[0330] In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 378 , or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 378.
[0331] In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 366, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 366.
[0332] In some embodiments, the expression of the VA-RNA is under the control of an RNA polymerase III promoter. In some embodiments, the expression of VA-RNA is driven by a EF1alpha promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted RNA polymerase III promoter. In some embodiments, the expression of the VA-RNA is under the control of a U6 or U7 promoter. In some embodiments, the expression of the VA-RNA is under the control of an interrupted U6 or U7 promoter. In some embodiments, the expression of VA-RNA is driven by a U6 promoter or a U7 promoter. In some embodiments, the U6 promoter or the U7 promoter comprises a) a first part of a U6 or U7 promoter sequence, b) a stuffer sequence, and c) a second part of a U6 or U7 promoter sequence. In some embodiments, the stuffer sequence is excisable by a recombinase. In some embodiments, the stuffer sequence is excisable by a Cre recombinase. In someembodiments, the stuffer sequence comprises a sequence encoding a gene. In some embodiments, the stuffer sequence comprises a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a CMV promoter. In some embodiments, the polynucleotide construct comprises upstream of the VA-RNA gene sequence, from 5’ to 3’: a) a first part of a U6 or U7 promoter sequence; b) a first recombination site; c) a stuffer sequence; d) a second recombination site; e) a second part of a U6 or U7 promoter sequence.
[0333] In some embodiments, the gene encodes a detectable marker or a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 40. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 41. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z- Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 42. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 43. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 44. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 45.
[0334] In some embodiments, the stuffer sequence further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the stuffer sequence further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 46. In some embodiments, the GT—CH1 produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0335] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39-41 or SEQ ID NO: 47-74. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 75-83.
[0336] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 74 or 73. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 74. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 73.
[0337] In some embodiments, the detectable marker comprises a luminescent marker or a fluorescent marker. In some embodiments, the fluorescent marker is GFP, EGFP, RFP, CFP, BFP, YFP, or mCherry. In some embodiments, an inducible helper construct comprises a polynucleotide constructcoding for a VA-RNA or the VA-RNA construct further comprising a sequence coding for a recombinase. In some embodiments, the recombinase is exogenously provided. In some embodiments, the recombinase is a site-specific recombinase. In some embodiments, the recombinase is a Cre polypeptide or a Flippase polypeptide. In some embodiments, the Cre polypeptide is fused to a ligand binding domain. In some embodiments, the ligand binding domain is a hormone receptor. In some embodiments, the hormone receptor is an estrogen receptor. In some embodiments, the estrogen receptor comprises a point mutation. In some embodiments, the estrogen receptor is ERT2. In some embodiments, the recombinase is a Cre-ERT2 polypeptide. In some embodiments, the first recombination site is a first lox sequence and the second recombination site is a second lox sequence. In some embodiments, the first lox sequence is a first loxP site and the second lox sequence is a second loxP site. In some embodiments, the first recombination site is a first FRT site and the second recombination site is a second FRT site.
[0338] In some embodiments, the construct comprising the VA-RNA as described herein further comprises a sequence coding for a selectable marker. In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 40. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 41. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In some embodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 42. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 43. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein. In some embodiments,the auxotrophic selection element codes for C-terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 44. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 45.
[0339] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the construct comprising the VA-RNA further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH- mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required by PAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 46. In some embodiments, the GTP-CH1 produces the cofactor (6R)-5,6,7,8- tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0340] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39-41 or SEQ ID NO: 47-74. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 75-83.
[0341] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 74 or 73. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 74. In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 73.
[0342] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOS: 84-89. In certain embodiments, the polynucleotide comprising a sequence encoding VA-RNA has sequence of SEQ ID NOS: 84-89.
[0343] In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 84 or 87. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 84 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 84. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA comprises the sequence set forth in SEQ ID NO: 87 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence set forth in SEQ ID NO: 87. In some embodiments, the polynucleotide comprising a sequence encoding VA-RNA has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 88-89. 2. Exemplary Adenoviral Helper Construct
[0344] In some embodiments, the polynucleotide (e.g., second polynucleotide) comprising a sequence encoding adenovirus helper proteins has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 353, 241, 242, and 243. In some embodiments, the polynucleotide (e.g., second polynucleotide) comprising a sequence encoding adenovirus helper proteins comprises the sequence of SEQ ID NO: 253 or SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In some embodiments, the polynucleotide (e.g., second polynucleotide) comprising a sequence encoding adenovirus helper proteins comprises the sequence of SEQ ID NO: 253 or SEQ ID NO: 241. In some embodiments, the second polynucleotide is a helper construct comprising a helper expression cassette comprising the nucleotide sequence of SEQ ID NO: 363, an activator expression cassette comprising the sequence of SEQ ID NO: 336, and a VA-RNA expression cassette comprising the nucleotide sequence of SEQ ID NO: 366. In some embodiments, the helper construct comprises the sequence of SEQ ID NO: 353. In some embodiments, helper construct sequence further comprises 5’ and 3’ ITRsfor genome integration by a transposase. In some embodiments, the helper construct sequence is set forth in SEQ ID NO: 241 (pre-induction) and SEQ ID NO:242 (post-induction). In some embodiments, the helper construct is encoded in a plasmid comprising the nucleotide sequence of SEQ ID NO: 243.
[0345] In some embodiments, the polynucleotide comprising a sequence encoding adenovirus helper proteins has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 36-38. In certain embodiments, the polynucleotide comprising a sequence encoding VA-RNA has sequence of SEQ ID NO: 36-38.
[0346] In some embodiments, a helper construct comprising a sequence encoding adenovirus helper proteins has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 353. In certain embodiments, the polynucleotide comprising a sequence encoding VA-RNA has sequence of SEQ ID NO: 353.
[0347] In certain embodiments, the SEQ ID NO: 35 comprises the polynucleotide.
[0348] An exemplary helper construct, which is shown in Table 12, encodes adenoviral helper proteins and a selection cassette to select cells with integrated helper construct(s). An excisable CRE is also encoded.D. Polynucleotide Encoding Payload
[0349] In embodiments, provided polynucleotide systems include a polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences. Also provided, in some embodiments, is a polynucleotide comprising a payload expression cassette comprising a constitutive promoter operably linked to a nucleotide sequence encoding a payload. In some embodiments, the polynucleotide comprises a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a fifth constitutive promoter operably linked to a nucleotide sequence encoding a payload.
[0350] The payload can be any payload of interest. In some embodiments, a polynucleotide encoding a payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein ofinterest. In certain embodiments, the payload of the polynucleotide is progranulin. In certain embodiments, the sequence encoding progranulin is provided as an exemplary sequence encoding a payload. In some such embodiments, it is understood that the sequence for any desired payload can be substituted in place of the sequence encoding progranulin in any of the polynucleotides encoding a payload described herein. In some embodiments, the polynucleotide encoding adenoviral helper genes comprises the polynucleotide encoding a payload as described herein.
[0351] In some embodiments, a polynucleotide encoding a payload comprises a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In certain embodiments, the payload of the polynucleotide is progranulin. In some embodiments, the polynucleotide encoding adenoviral helper genes comprises the polynucleotide encoding a payload as described herein.
[0352] In some embodiments, the sequence encoding the payload of the polynucleotide comprises a sequence encoding a reporter gene, a therapeutic gene, or a transgene encoding a protein of interest. In some embodiments, the sequence encoding the payload of the fourth polynucleotide is a sequence encoding progranulin. In some embodiments, the sequence encoding progranulin has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 90. In certain embodiments, the sequence encoding progranulin has sequence of SEQ ID NO: 90. In some embodiments, the payload expression cassette comprises the nucleotide sequence of SEQ ID NO: 232, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the payload expression cassette comprises a sequence having at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO: 232, wherein the sequence encoding progranulin (SEQ ID NO: 90) is substituted or replaced with a different sequence encoding a payload (e.g., any payload as described herein).
[0353] In some embodiments, the sequence encoding the payload comprises a sequence encoding a suppressor tRNA, a guide RNA, or a homology region for homology-directed repair.
[0354] In some embodiments, the polynucleotide comprising the sequence encoding the payload comprises the sequence encoding the payload flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR).
[0355] In some embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 91. In certain embodiments, the sequence encoding the payload is flanked by a 5' AAV inverted terminal repeat (5' ITR) and a 3' AAV inverted terminal repeat (3' ITR) has sequence of SEQ ID NO: 91.
[0356] In some embodiments, the polynucleotide sequence encoding the payload is in a self- complementary format. In some embodiments, the polynucleotide comprising the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 92 or 244. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 92 or 244. In some embodiments, the polynucleotide comprising the sequence encoding the payload is a plasmid sequence that comprises the sequence of SEQ ID NO: 92 or 244 and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 93, 96 or 245. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 93, 96 or 245.
[0357] In some embodiments, the polynucleotide sequence encoding the payload is in a single- stranded format. In some embodiments, the polynucleotide comprising the sequence encoding the payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 94 or 246. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 94 or 246. In some embodiments, the polynucleotide comprising the sequence encoding the payload is a plasmid sequence that comprises the sequence of SEQ ID NO: 94 or 246 and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 95 or 247. In certain embodiments, the polynucleotide comprising the sequence encoding the payload has sequence of SEQ ID NO: 95 or 247.
[0358] In some embodiments, the payload construct has at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 96. In some embodiments, the payload construct has at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 92.
[0359] In some embodiments, the polynucleotide sequence encoding the payload comprises a sequence having at least 70%, 75%, 80% 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to one or more of SEQ ID NOS: 92-96 and 244-247, wherein the payload sequence encoding progranulin (SEQ ID NO: 90) is substituted or replaced with a different sequence encoding a payload (e.g., any payload as described herein).
[0360] In some embodiments, the polynucleotide comprises a coding sequence for an expressible payload and a mammalian cell selection element. In an exemplary embodiment, the expressible payload is under the control of a constitutive promoter. This construct can be referred to as a payload construct.
[0361] In some embodiments, the expressible payload encodes a guide RNA. In certain embodiments, the guide RNA directs RNA editing. In some embodiments, the guide RNA directs Cas- mediated DNA editing. In some embodiments, the guide RNA directs ADAR-mediated RNA editing. In some embodiments, the fourth integrated synthetic construct comprises a sequence encoding for any of the expressible payloads disclosed herein. For example, said sequence can encode for any therapeutic. For example, the therapeutic may be a transgene, a guide RNA, an antisense RNA, an oligonucleotide, an mRNA, a miRNA, a shRNA, a tRNA suppressor, a CRISPR-Cas protein, any gene editing enzyme,or any combination thereof. In some embodiments, the transgene encodes for progranulin. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an amber stop codon. In some embodiments, the fourth integrated synthetic construct comprises sequences encoding for more than one of the expressible payloads disclosed herein. For example, the fourth integrated synthetic construct comprises 2 gRNA, 3 gRNA, 4 gRNA, 5 gRNA, 6 gRNA, 7 gRNA, 8 gRNA, 9 gRNA, or 10 gRNA. These gRNAs can all be the same, all be different, or any combination of the same and different. For example, the fourth integrated synthetic construct comprises 2 suppressor tRNAs, 3 suppressor tRNAs, 4 suppressor tRNAs, 5 suppressor tRNAs, 6 suppressor tRNAs, 7 suppressor tRNAs, 8 suppressor tRNAs, 9 suppressor tRNAs, or 10 suppressor tRNAs. These suppressor tRNAs can all be the same, all be different, or any combination of the same and different.
[0362] In some embodiments, the expressible payload encodes a protein. In certain embodiments, the expressible payload is an enzyme, useful for replacement gene therapy. In some embodiments, the protein is a therapeutic antibody. In some embodiments, the protein is a vaccine immunogen. In particular embodiments, the vaccine immunogen is a viral protein.
[0363] In some embodiments, the expressible payload is a homology construct for homologous recombination.
[0364] In various embodiments, the third mammalian cell selection element is an auxotrophic selection element.
[0365] In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 97 or SEQ ID NO: 98. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 97 or SEQ ID NO: 98, wherein SEQ ID NO: 99 in SEQ ID NO: 97 or SEQ ID NO: 98 is replaced with a sequence of the payload of interest. In some embodiments, the payload construct comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to one or more of SEQ ID NOS: 91-96. In some embodiments, the payload construct is a plasmid comprising at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to one of SEQ ID NO: 93, SEQ ID NO: 95, or SEQ ID NO: 96.
[0366] In some embodiments, the payload construct comprises a sequence of a payload flanked by AAV ITR sequences. In some embodiments, expression of the sequence of the payload is driven by a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is an RSV promoter. In some embodiments, the RSV promoter comprises a nucleotide sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 294 or SEQ ID NO: 312. In some embodiments, the promoter and sequence of the payload are flanked by AAV ITR sequences. In some embodiments, the payload construct flanked by ITRs comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 91.
[0367] In some embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a gene. In some embodiments, the gene codes for a selectable marker or detectable marker. In some embodiments, the gene codes for a therapeutic polypeptide or transgene. In some embodiments, the therapeutic polypeptide or transgene is progranulin. In some embodiments, the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a tRNA suppressor or a guide RNA. In some embodiments, the tRNA suppressor is capable of suppressing an opal stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an ochre stop codon. In some embodiments, the tRNA suppressor is capable of suppressing an amber stop codon. In some embodiments, the guide RNA is a polyribonucleotide capable of binding to a protein. In some embodiments, the protein is nuclease. In some embodiments, the protein is a Cas protein, an ADAR protein, or an ADAT protein. In some embodiments, the guide RNA, when bound to a target RNA, recruits an ADAR protein for editing of the target RNA. In some embodiments, the Cas protein is catalytically inactive Cas protein. In some embodiments, the payload construct is stably integrated into the genome of the cell. In some embodiments, a plurality of the payload construct are stably integrated into the genome of the cell. In some embodiments, the plurality of the payload constructs are separately stably integrated into the genome of the cell.
[0368] In some embodiments, the payload construct further comprises a sequence coding for a selectable marker or detectable marker outside of the ITR sequences. In some embodiments, expression of the selectable marker or detectable marker outside of the ITR sequences is driven by a promoter. The promoter can be a constitutive promoter or an inducible promoter. In some embodiments, the constitutive promoter is EF1α (or EF1alpha) promoter or human cytomegalovirus promoter. In some embodiments, the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter. In some embodiments, the selectable marker is a mammalian cell selection element (e.g., a third mammalian cell selection element). In some embodiments, the selectable marker is a mammalian cell selection element. In some embodiments, the selectable marker is an auxotrophic selection element. In some embodiments, the auxotrophic selection element codes for an active protein. In some embodiments, the active protein is glutamine synthetase (GS), thymidylate synthase (TYMS), phenylalanine hydroxylase (PAH), or dihydrofolate reductase (DHFR). In some embodiments, PAH comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39. In some embodiments, GS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 40. In some embodiments, TYMS comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 41. In some embodiments, the auxotrophic selection element codes for an inactive protein that requires expression of a second auxotrophic selection element for activity. In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein Z-Cter and the second auxotrophic selection element codes for N-terminal fragment of an auxotrophic protein Z-Nter, or vice a versa. In someembodiments, the auxotrophic selection element codes for DHFR Z-Cter or DHFR Z-Nter. In some embodiments, the selectable marker is DHFR Z-Nter or DHFR Z-Cter. In some embodiments, the DHFR Z-Nter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 42. In some embodiments, the DHFR Z-Cter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 43.
[0369] In some embodiments, the auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C-terminal intein of a split intein and the second auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of an auxotrophic protein fused to an N-terminal intein of a split intein and the second auxotrophic selection element codes for a C-terminal fragment of the auxotrophic protein fused to a C- terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for C- terminal fragment of PAH, GS, TYMS, or DHFR fused to a C-terminal intein of a split intein. In some embodiments, the auxotrophic selection element codes for an N-terminal fragment of PAH, GS, TYMS, or DHFR fused to a N-terminal intein of a split intein. In some embodiments, the selectable marker is an antibiotic resistance protein. In some embodiments, the selectable marker is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker is a leucine zipper linked to an N- terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the split intein is derived from the Nostoc punctiforme (Npu) DnaE intein, the Synechocystis species, strain PCC6803 (Ssp) DnaE intein, or the consensus DnaE intein (Cfa). In some embodiments, an N-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 44. In some embodiments, a C-terminal intein comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 45.
[0370] In some embodiments, the payload construct further comprises a sequence coding for a selectable marker and a helper enzyme, wherein expression of the helper enzyme facilitates growth of the cell in conjunction with the selectable marker. In certain embodiments, the helper enzyme is an enzyme that facilitates production of a molecule required for cell growth. For example, the helper enzyme may be required for production of a cofactor utilized by the functional enzyme to generate the molecule required for cell growth. In certain embodiments, the cell may produce the helper enzyme at low levels and the expression of the helper enzyme from the helper construct can increase helper enzyme levels thereby increasing production of the molecule required for cell growth, by, e.g., increasing levels of a co-factor required for enzyme activity. In some embodiments, the payload construct further encodes a helper enzyme involved in production of tyrosine from phenylalanine. In some embodiments, the helper enzyme facilitates PAH-mediated production of tyrosine from phenylalanine. In some embodiments, the helper enzyme catalyzes production a co-factor required byPAH for converting phenylalanine to tyrosine. In some embodiments, the helper enzyme is GTP cyclohydrolase I (GTP-CH1). In some embodiments, the helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 46. In some embodiments, the GTP- CH1 produces the cofactor (6R)-5,6,7,8-tetrahydrobiopterin (BH4) that is required for conversion of phenylalanine to tyrosine. In some embodiments, expression of GTP-CH1 facilitates growth of the host cell in conjunction with functional PAH upon application of the single selective pressure.
[0371] In some embodiments, a selectable marker comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 39-41 or SEQ ID NO: 47-74. In some embodiments, the selectable marker and helper enzyme comprises at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 75-83.
[0372] In some embodiments, the selectable marker is outside of the ITR sequences on the payload construct. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the auxotrophic protein or split intein linked to a C-terminus of the auxotrophic protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the auxotrophic or leucine zipper linked to a C-terminus of the auxotrophic. In some embodiments, the selectable marker outside of the ITR sequences is a split intein linked to an N-terminus of the antibiotic resistance protein or split intein linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the selectable marker outside of the ITR sequences is a leucine zipper linked to an N-terminus of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the antibiotic resistance protein. In some embodiments, the antibiotic resistance protein is for puromycin resistance or blasticidin resistance. In some embodiments, the payload construct further comprises a spacer between the 5’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the payload construct further comprises a spacer between the 3’ ITR and the promoter / selectable marker or promoter / detectable marker outside of the ITR sequences. In some embodiments, the spacer ranges in length from 500 base pairs to 5000 base pairs, including any length within this range such as 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1250, 1500, 1750, 2000, 2225, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, or 5000 base pairs. In some embodiments, the spacer length is a sufficient length for decreasing reverse packaging of the selectable marker or detectable marker that is outside the ITR sequences.
[0373] In some embodiments, the third polynucleotide comprises a second part of a split antibiotic resistance gene, and the first polynucleotide comprising an expression cassette for expressing Cap and / or Rep proteins comprises the first part of the split antibiotic resistance gene. As such, a cell that includes both the first polynucleotide and the second polynucleotide is capable of containing both parts of the split antibiotic resistance gene, e.g., a blasticidin resistance gene.
[0374] In some embodiments, the polynucleotide comprising a sequence encoding a payload is further engineered to remove locations having the potential for Rep-mediated nicking. For example, alocation having the potential for Rep-mediated nicking is a location having the sequence CAGTGAGCGAGCGAGCGCGCAG ( SEQ ID NO: 100); a sequence comprising GAGC ( SEQ ID NO: 101) repeats; or the sequence GATGGAGTTGGCCACTCCCTC ( SEQ ID NO: 102). These sequences can be engineered to prevent binding of Rep proteins for Rep-mediated nicking. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 100 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 200 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep- mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 300 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep- mediated nicking is in a region within 400 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 500 nucleotides of an ITR sequence. In some embodiments, the location having the potential for Rep-mediated nicking that is engineered to prevent binding of Rep proteins for Rep-mediated nicking is in a region within 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1250, 1500, 1750, 2000, 2225, 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4750, or 5000 nucleotides of an ITR sequence.
[0375] In some embodiments, a payload construct comprising a sequence encoding a payload has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 354. In certain embodiments, the payload construct has sequence of SEQ ID NO: 354.
[0376] An exemplary construct used to deliver a payload flanked by ITRs and a selection cassette to select cells with integrated payload construct(s) is shown in Table 13.1. Payloads
[0377] Disclosed herein are payloads that may be encoded for by polynucleotide comprising a sequence which encodes for a payload. Thus, disclosed herein are stable mammalian cell lines that encapsidate a payload. In some embodiments, the payload may be an expressible payload. In some embodiments, the polynucleotide may encode for any therapeutic. For example, the therapeutic may be a transgene, a guide RNA, an antisense RNA, an oligonucleotide, an mRNA, a miRNA, a shRNA, a tRNA suppressor, a CRISPR-Cas protein, any gene editing enzyme, or any combination thereof. In some embodiments, the payload is a guide RNA, wherein the guide RNA, when bound to a target RNA, recruits an ADAR enzyme for editing of the target RNA. In some embodiments, the payload is progranulin. In some embodiments, the stable mammalian cell lines disclosed herein can conditionally produce rAAV virions that encapsidate more than one payload. Any combination of payloads disclosed herein is contemplated.
[0378] The sequence encoding a payload as disclosed herein encompasses any nucleotide sequence that is to be delivered to a cell. The nucleotide sequence may be utilized in the cell for, e.g., insertion of the nucleotide sequence or a part thereof. For example, the nucleotide sequence may be used to repair an endogenous DNA. In such a case, the nucleotide sequence itself is the payload being delivered by the rAAV to a cell.
[0379] In other cases, the polynucleotide payload is transcribed in the cell into an RNA which is not translated into a protein. In such a case, the RNA is the payload that is delivered by the polynucleotide payload present in the rAAV. In other cases, the polynucleotide payload is transcribed in the cell into an mRNA which is translated into a protein. In such a case, the protein is the payload that is delivered by the polynucleotide payload present in the rAAV.
[0380] The polynucleotide payload may include a promoter operably linked to a DNA sequence. The promoter may be any promoter that allows for transcription of the DNA in the cell. A payload disclosed herein may be a therapeutic payload.
[0381] The DNA sequence may be transcribed to produce RNA in the cell. The RNA may be mRNA. The RNA may be a guide RNA (gRNA), a tRNA, a suppressor tRNA, an mRNA, or a circular RNA. The RNA may be a regulatory RNA of interest such as, but not limited to, a microRNA (miRNA),a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a small nuclear RNA (snRNA), a long non-coding RNA (lncRNA), an antisense nucleic acid, and the like.
[0382] The polynucleotide payload may be a gene encoding a polypeptide, such as, an antibody, a hormone, a site-specific endonuclease, a reporter gene, a component of a CRISPR / Cas system, an adenosine deaminase acting on RNA (ADAR) enzyme, a transcriptional activator, a transcriptional repressor, a ribozyme, a DNAzyme, or any combination thereof.
[0383] A payload may include any one or combination of the following: a transgene, a tRNA suppressor, a guide RNA, or any other target binding / modifying oligonucleotide or derivative thereof, or payloads may include immunogens for vaccines, and elements for any gene editing machinery (DNA or RNA editing). Payloads may also include those that deliver a transgene encoding antibody chains or fragments that are amenable to viral vector-mediated expression (also referred to as “vectored or vectorized antibody” for gene delivery). See, e.g., Curr Opinion HIV AIDS. 2015 May; 10(3): 190– 197, describing vectored antibody gene delivery for the prevention or treatment of HIV infection. See also, U.S. Pat. No.10,780,182, which describes AAV delivery of trastuzumab (Herceptin) for treatment of HER2+ brain metastases. A payload disclosed herein may not be a therapeutic payload (e.g., a coding for a detectable marker such as GFP). In particular, in some instances the polynucleotide payload refers to a polynucleotide that may be a homology element for homology-directed repair, or polynucleotide transcribed into a guide RNA to be delivered for a variety of purposes. In some embodiments, the transgene refers to a nucleic acid sequence coding for expression of guide RNA for ADAR editing or ADAT editing. In some embodiments, the transgene refers to a transgene packaged for gene therapy. In some embodiments, the transgene refers to synthetic constructs packaged for vaccines. In certain aspects, a polynucleotide payload may be described as encoding an RNA, which is meant to refer to the RNA transcribed from the polynucleotide.
[0384] In certain examples, the sequence encoding the payload comprises two expressible sequences, wherein a first expressible sequence encodes for a first gRNA and a second expressible sequence encodes for a second gRNA. In some embodiments, the first gRNA and the second gRNA are different. In some embodiments, the first gRNA and the second gRNA are the same. In certain examples, the sequence encoding the payload comprises two or more expressible sequences. In some embodiments, the two or more expressible sequences encode for two or more gRNA. In some embodiments, the two or more gRNA are all different gRNA, all the same gRNA, or a combination of the same and different gRNA.
[0385] In some cases, the sequence encoding the payload comprises an expressible sequence encoding both a heterologous RNA and a heterologous polypeptide. In other cases, the expressible sequence encodes two or more heterologous payloads. Where the expressible sequence encodes two heterologous payloads, in some cases, the nucleotide sequences encoding the two heterologous payloads are operably linked to the same promoter. Where the expressible sequence encodes two heterologous payloads, in some cases, the nucleotide sequences encoding the two heterologous payloads are operablylinked to two different promoters. In some cases, sequence encoding the payload comprises an expressible sequence encoding three heterologous payloads. Where the expressible sequence encodes three heterologous payloads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to the same promoter. Where the expressible sequence encodes three heterologous payloads, in some cases, the nucleotide sequences encoding the three heterologous payloads are operably linked to two or three different promoters. In some cases, the fourth polynucleotide construct of the present disclosure comprises two or more expressible sequences, each comprising a nucleotide sequence encoding a heterologous payload.
[0386] In some embodiments, the expressible sequence encodes a polypeptide of interest. The polypeptide of interest may be any type of protein / peptide including, without limitation, an enzyme, an extracellular matrix protein, a receptor, transporter, ion channel, or other membrane protein, a hormone, a neuropeptide, an antibody, or a cytoskeletal protein; or a fragment thereof, or a biologically active domain of interest. In some cases, the payload is a therapeutic polypeptide, e.g., a polypeptide that provides clinical benefit.
[0387] Where the payload is an interfering RNA (RNAi), suitable RNAi include RNAi that decrease the level of an apoptotic or angiogenic factor in a cell. For example, an RNAi may be an shRNA or siRNA that reduces the level of a payload that induces or promotes apoptosis in a cell. A payload may be a gene whose gene product induces or promotes apoptosis are referred to herein as “pro-apoptotic genes” and the products of those genes (mRNA; protein) are referred to as “pro-apoptotic gene products.” Pro-apoptotic gene products include, e.g., Bax, Bid, Bak, and Bad gene products. See, e.g., U.S. Patent No.7,846,730. In another example, the RNAi specifically reduces the level of an RNA and / or a polypeptide product of a defective allele.
[0388] In some embodiments, the payload is an aptamer. In some cases, the aptamer is a therapeutic aptamer. For example, the aptamer may function as an antagonist by blocking interactions at a disease-associated target (e.g., receptor-ligand interactions). Alternatively, an aptamer may serve as an agonist for activating the function of a target receptor. Exemplary aptamers of interest include aptamers against growth factor receptors and growth factors such as aptamers that bind to epidermal growth factor receptor (see, e.g., Wang et al. (2014) Biochem. Biophys. Res. Commun.453(4):681-5), transforming growth factor-beta type III receptor (see, e.g., Ohuchi et al. (2006) Biochimie 88(7):897- 904.), vascular endothelial growth factor (VEGF) (see, e.g., Ng et al. (2006) Nat. Rev. Drug Discovery 5:123; and Lee et al. (2005) Proc. Natl. Acad. Sci. USA 102:18902) or platelet-derived growth factor (PDGF), e.g., E10030 (see, e.g., Ni and Hui (2009) Ophthalmologica 223:401; and Akiyama et al. (2006) J. Cell Physiol.207:407).
[0389] In some embodiments, the expressible sequence encodes a sequence-specific endonuclease for use in genome editing. The sequence specific endonuclease may be used to create a double-stranded break at a specific site in the genome. The double stranded breaks may then be repaired by non- homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), or homology-directed repair (HDR) pathways. Desired genome edits may be introduced into the genome using donor DNA to repair double-strand breaks by homologous recombination. Various sequence-specific endonucleases may be used in genome editing for creation of double-strand breaks in DNA, including, without limitation, engineered zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and clustered regularly interspaced short palindromic repeats (CRISPR) Cas9. See, e.g., Targeted Genome Editing Using Site-Specific Nucleases: ZFNs, TALENs, and the CRISPR / Cas9 System (T. Yamamoto ed., Springer, 2015); Genome Editing: The Next Step in Gene Therapy (Advances in Experimental Medicine and Biology, T. Cathomen, M. Hirsch, and M. Porteus eds., Springer, 2016); Aachen Press Genome Editing (CreateSpace Independent Publishing Platform, 2015); herein incorporated by reference. Precise control over the timing of production of the genome editing enzyme may be achieved by inducibly producing recombinant adenovirus associated virus (rAAV) virions with the vector system to allow turning on and off of expression as desired.
[0390] In some cases, a payload of interest is a site-specific endonuclease that provides for site- specific knock-down of gene function, e.g., where the endonuclease knocks out an allele associated with a disease. For example, in a case where a dominant allele encodes a defective copy of a gene, and the wild-type gene pro...
Claims
CLAIMS What is claimed is:
1. A polynucleotide comprising: an adenovirus L4 coding sequence; and a first promoter operably linked to the adenovirus L4 coding sequence.
2. The polynucleotide of claim 1, further comprising: a selectable marker; and a second promoter operably linked to the first selectable marker.
3. The polynucleotide of claim 1 or claim 2, wherein the first promoter is an inducible promoter.
4. A polynucleotide comprising a late-stage gene cassette comprising an L4 coding sequence and a first promoter, wherein the first promoter is an inducible promoter operably linked to the L4 coding sequence.
5. The polynucleotide of any one of claims 1-4, wherein the L4 coding sequence comprises one or both of a 22K-L4 sequence and a 33K-L4 sequence.
6. The polynucleotide of any one of claims 1-5, wherein the L4 coding sequence comprises a 22K-L4 sequence.
7. The polynucleotide of claim 5 or claim 6, wherein the 22K-L4 sequence comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
270.
8. The polynucleotide of any one of claims 5-7, wherein the 22K-L4 sequence comprises the sequence of SEQ ID NO:
270.
9. The polynucleotide of any one of claims 5-8, wherein the 22K-L4 sequence encodes an 22K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
277.
10. The polynucleotide of any one of claims 5-9, wherein the 22K-L4 sequence encodes an 22K-L4 protein comprising the sequence of SEQ ID NO:
277.
11. The polynucleotide of any one of claims 5 and 7-10, wherein the 33K-L4 sequence comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
273.
12. The polynucleotide of any one of claims 5 and 7-11, wherein the 33K-L4 sequence comprises the sequence of SEQ ID NO:
273.
13. The polynucleotide of any one of claims 5 and 7-12, wherein the 33K-L4 sequence encodes an 33K-L4 protein comprising an amino acid sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 278.
14. The polynucleotide of any one of claims 5 and 7-13, wherein the 33K-L4 sequence encodes an 33K-L4 protein comprising the sequence of SEQ ID NO:
278.
15. The polynucleotide of any one of claims 1-14, where the L4 coding sequence encodes the 22K-L4 and 33K-L4 proteins.
16. The polynucleotide of any one of claims 1-15, wherein the L4 coding sequence comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
271.
17. The polynucleotide of any one of claims 1-15, wherein the L4 coding sequence comprises the sequence of SEQ ID NO:
271.
18. The polynucleotide of any one of claims 1-17, wherein the first promoter comprises a tetracycline-responsive promoter element (TRE).
19. The polynucleotide of claim 18, wherein the TRE comprises a Tet operator (tetO) sequence concatemer fused to a minimal promoter.
20. The polynucleotide of claim 19, wherein the tetO sequence concatemer comprises the sequence of SEQ ID NO:
341.
21. The polynucleotide of claim 19 or claim 20, wherein the minimal promoter is a human cytomegalovirus promoter.
22. The polynucleotide of any one of claims 19-21, wherein the minimal promoter comprises the sequence of SEQ ID NO:
342.
23. The polynucleotide of any one of claims 1-22, wherein the first promoter comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 262., optionally, wherein the first promoter comprises a sequence of SEQ ID NO:
262.
24. The polynucleotide of any one of claims 1-23, wherein transcription of the L4 coding sequence is activated from the first promoter upon binding of an activator, optionally wherein the activator is Tet-on3G.
25. The polynucleotide of claim 24, wherein the activator comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 265, optionally, wherein the activator comprises a sequence of SEQ ID NO:
265.
26. The polynucleotide of claim 24 or 25, wherein the activator binds to the first promoter in the presence of a first triggering agent.
27. The polynucleotide of any of claims 1-3 and 5-26 comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
377.
28. The polynucleotide of any of claims 4-26, wherein the late stage gene expression cassette comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 377.
29. The polynucleotide of any one of claims 1 and 3-28, wherein the polynucleotide construct further comprises a selection cassette comprising a selectable marker and a second promoter, wherein the second promoter is operably linked to the selectable marker.
30. The polynucleotide of any one of claims 2, 3, and 5-29, wherein the second promoter is a constitutive promoter.
31. The polynucleotide of any one of claims 2, 3, and 5-30, wherein the second promoter is an EF1-alpha promoter.
32. The polynucleotide of any one of claims 2, 3, and 5-31, wherein the selectable marker is an antibiotic resistance protein.
33. The polynucleotide of claim 32, wherein the antibiotic resistance protein is selected from a hygromycin resistance protein, a puromycin resistance protein, and an ampicillin resistance protein.
34. The polynucleotide of claim 32 or claim 33, wherein the antibiotic resistance protein is a hygromycin resistance protein.
35. The polynucleotide of claim 34, wherein the sequence of the selectable marker comprises a sequence identity with at least 70%, 80%, 90%, 95%, 99%, or 100% to SEQ ID NO: 276, optionally wherein the selectable marker comprises the sequence of SEQ ID NO:
276.
36. The polynucleotide of any one of claims 2, 3, and 5-35, wherein the selectable marker is a split selectable marker, wherein the polynucleotide comprises a first part of the selectable marker sequence fused to a first reassembly module and wherein another polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module.
37. The polynucleotide of claim 36, wherein the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C-intein) or leucine zippers.
38. The polynucleotide of claim 36 or claim 37, wherein the selectable marker is the split selectable marker that is a split antibiotic resistance protein and the polynucleotide comprises a sequence selected from: a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein; and a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein.
39. The polynucleotide of any one of claims 32-38, wherein the selectable marker is a first part of a split blasticidin resistance gene intein.
40. The polynucleotide of any one of claims 32-38, wherein the selectable marker is a first part of a split hygromycin resistance gene intein.
41. The polynucleotide of any one of claims 1-32, 36, and 37, wherein the selectable marker is a mammalian cell selection element;optionally, wherein the mammalian cell selection element is an auxotrophic selection element; optionally, wherein the auxotrophic selection element codes for an active protein; and optionally, wherein the active protein is DHFR.
42. The polynucleotide of any of claims 1-3 and 5-40 comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 251 or 255.
43. The polynucleotide of any of claims 4-40, wherein the late stage gene expression cassette comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 251 or 255.
44. The polynucleotide of any one of claims 1-43, further comprising a sequence for integration into the genome of a cells, optionally wherein the sequence comprises a 5’ sequence and a 3’ sequence.
45. The polynucleotide of claim 44, wherein the integration is by transposon system integration, wherein the sequence for integration comprises a transposon 5’ inverted terminal repeat and a transposon 3’ inverted terminal repeat that are able to be recognized by a transposase.
46. The polynucleotide of any one of claims 4-45, wherein the polynucleotide comprises a transposon-specific 5’ inverted terminal repeat (ITR) upstream of the late-stage gene cassette and a transposon-specific 3’ ITR downstream of the late-stage gene cassette, wherein the transposon- specific 5’ ITR and 3’ ITR are for integration of the late-stage gene cassette into the genome of a cell by a transposon system.
47. The polynucleotide of claim 45 or claim 46, wherein the transposon system is a Piggybac system.
48. The polynucleotide of claim 44, wherein the integration is by homology directed repair (HDR) into a target loci, wherein the sequence for integration comprises 5’ and 3’ homology arms that are each independently complementary to a sequence of the target loci flanking the site of integration.
49. The polynucleotide of any one of claims 4-44 and 48, wherein the polynucleotide comprises a 5’ homology arm upstream of the late-stage gene cassette and a 3’ homology arm downstream of the late-stage gene cassette, wherein the 5’ and 3’ homology arms are for targeted knock-in of the late-stage gene cassette by homology directed repair (HDR) into a target loci and are each independently complementary to a sequence of the target loci flanking a site of integration.
50. The polynucleotide of claim 48 or claim 49, wherein the target loci is a safe harbor locus, optionally wherein the safe harbor locus is Rogi-1.
51. The polynucleotide of any one of claims 1-50, wherein the polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 377, 248, 249, 250, or 254.
52. A polynucleotide comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO:
377.
53. The polynucleotide of any one of claims 1-52, wherein the polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
251.
54. The polynucleotide of any one of claims 1-53, wherein the polynucleotide comprises the sequence of SEQ ID NO:
251.
55. The polynucleotide of any one of claims 1-52, wherein the polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
249.
56. The polynucleotide of any one of claims 1-52 and 55, wherein the polynucleotide comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
250.
57. A polynucleotide comprising: a) a late-stage gene expression cassette comprising the nucleotide sequence of SEQ ID NO: 377 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and b) a selection cassette comprising the nucleotide sequence of SEQ ID NO: 376 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
58. A system of polynucleotides comprising: a) a first polynucleotide comprising a Rep expression cassette comprising a second promoter and an AAV Rep open reading frame; and b) the polynucleotide of any one of claims 1-57.
59. The system of polynucleotides of claim 58, wherein the first polynucleotide comprises from 5’ to 3’, the second promoter and the Rep open reading frame.
60. The system of polynucleotides of claim 58 or claim 59, wherein the Rep open reading frame comprises a large Rep coding sequence operably linked to the second promoter, and wherein the large Rep coding sequence comprises a small Rep coding sequence.
61. The system of polynucleotides of claim 60, wherein the large Rep coding sequence encodes one or more large Rep proteins, and the small Rep coding sequence encodes one or more small Rep proteins.
62. The system of polynucleotides of claim 60 or claim 61, wherein the large Rep coding sequence further comprises a p19 promoter upstream of the small Rep coding sequence.
63. The system of polynucleotides of claim 62, wherein the small Rep coding sequence is operably linked to the p19 promoter.
64. The system of polynucleotides of any one of claims 61-63, wherein:a) the one or more large Rep proteins comprises Rep78 and the one or more small Rep protein comprises Rep 52, or b) the one or more large Rep proteins comprises Rep78 and Rep68 and the one or more small Rep protein comprises Rep52 and Rep40.
65. The system of polynucleotides of any one of claims 58-64, wherein the Rep open reading frame comprises from 5’ to 3’: a) the large Rep coding sequence, b) an intron comprising: i) a third promoter, and ii) a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, and c) the small Rep coding sequence.
66. The system of polynucleotides of claim 65, wherein the intron is a synthetic intron comprising from 5’ to 3’: i) a 5’ splice donor site, ii) the third promoter iii) the first excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and iv) a second 3’ splice acceptor site, wherein the splice donor and the first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.
67. The system of polynucleotides of claim 65 or claim 66, wherein the third promoter is operably linked to the small Rep coding sequence following a recombination event between the first recombination site and the second recombination site.
68. The system of polynucleotides of any one of claims 58-64, wherein the Rep coding sequence comprises from 5’ to 3’: a) the large Rep coding sequence, b) the p19 promoter, c) a first part of the small Rep coding sequence, d) an intron comprising a first excisable element that comprises a coding sequence comprising a stop signaling sequence flanked by a first recombination site and a second recombination site, and e) a second part of the small Rep coding sequence, wherein the first part and second part of the small Rep coding sequence form the small Rep coding sequence.
69. The system of polynucleotides of claim 68, wherein the intron is a synthetic intron comprising from 5’ to 3’:i) a 5’ splice donor site, ii) the first excisable element further comprising a first 3’ splice acceptor site upstream of the coding sequence comprising a stop signaling sequence, and iii) a second 3’ splice acceptor site, wherein the splice donor and first and second acceptor sites are compatible with a cell used for expressing a large Rep protein.
70. The system of polynucleotides of claim 69, wherein a first 3’ splice acceptor site is a duplicate of the second 3’ splice acceptor site.
71. The system of polynucleotides of claim 69 or claim 70, wherein the first 3’ splice acceptor site is a rabbit beta globin 3’ acceptor splice site; and / or the second 3’ splice acceptor site is a rabbit beta globin 3’ splice acceptor site.
72. The system of polynucleotides of any one of claims 68-71, wherein the synthetic intron comprises from 5’ to 3’: a) the 5’ splice donor site; b) the first recombination site; c) the first 3’ splice acceptor site; d) the stop signaling sequence; e) the second recombination site; and f) the second 3’ splice acceptor site.
73. The system of polynucleotides of any one of claims 68-72, wherein the synthetic intron comprises from 5’ to 3’: a) the 5’ splice donor site; b) a first spacer segment; c) a second spacer segment comprising: i) the first recombination site; ii) the first 3’ splice acceptor site; iv) the stop signaling sequence; and v) the second recombination site; and d) a third spacer segment comprising the second 3’ splice acceptor site.
74. The system of polynucleotides of claim 73, wherein the first spacer sequence comprises an intron.
75. The system of polynucleotides of claim 73 or 74, wherein the first spacer segment comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:
15.
76. The system of polynucleotides of any one of claims 73-75, wherein the second spacer segment comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 16.
77. The system of polynucleotides of any one of claims 73-76, wherein the third spacer segment comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:
17.
78. The system of polynucleotides of any one of claims 73-77, wherein the third spacer segment comprises an intron.
79. The system of polynucleotides of any one of claims 73-78, wherein the first spacer segment and the third spacer segment are capable of being excised by endogenous cellular machinery.
80. The system of polynucleotides of any one of claims 73-79, wherein the second spacer segment comprises the first excisable element.
81. The system of polynucleotides of any one of claims 73-80, wherein the second spacer segment further comprises a polyA sequence.
82. The system of polynucleotides of claim 81, wherein the polyA sequence is 3’ of the exon.
83. The system of polynucleotides of claim 81 or claim 82, wherein the polyA sequence comprises a rabbit beta globin (RBG) polyA sequence.
84. The system of polynucleotides of any one of claims 73-83, wherein the second spacer segment comprises from 5’ to 3’: a) the first recombination site; b) the first 3’ splice acceptor site; c) the coding sequence comprising a stop signaling sequence; and d) the second recombination site.
85. The system of polynucleotides of any one of claims 64-84, wherein the coding sequence comprising a stop signaling sequence in the excisable element is excised following a recombination event between the first recombination site and the second recombination site.
86. The system of polynucleotides of any one of claims 64-85, wherein the first and second recombination sites comprise Lox sites or flippase recognition target (FRT) sites.
87. The system of polynucleotides of any one of claims 64-86, wherein the first and second recombination sites comprise Lox sites.
88. The system of polynucleotides of claim 86 or claim 87, wherein the lox site is a loxP site.
89. The system of polynucleotides of any one of claims 64-88, wherein the coding sequence comprising a stop signaling sequence is a detectable marker, optionally wherein the detectable maker is luminescent marker, a radiolabel, or a fluorescent marker.
90. The system of polynucleotides of claim 89, wherein the detectable maker comprises the nucleotide sequence of SEQ ID NO: 287, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
91. The system of polynucleotides of any one of claims 64-90, wherein the first excisable element comprises the nucleotide sequence of SEQ ID NO: 307 or SEQ ID NO: 292, or a nucleotidesequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
92. The system of polynucleotides of any one of claims 66-91, wherein the recombination event between the first recombination site and the second recombination site is induced in the presence of a recombinase.
93. The system of polynucleotides of claim 92, wherein the recombinase is an inducible recombinase.
94. The system of polynucleotides of claim 92 or claim 93, wherein the recombinase is a Cre polypeptide or a Flippase polypeptide.
95. The system of polynucleotides of any one of claims 92-94, wherein the recombinase is a Cre recombinase.
96. The system of polynucleotides of claim 94 or claim 95, wherein the Cre recombinase is fused to a ligand binding domain.
97. The system of polynucleotides of claim 96, wherein the ligand binding domain is a hormone receptor.
98. The system of polynucleotides of claim 97, wherein the recombinase is a Cre-ERT2 protein fusion.
99. The system of polynucleotides of any one of claims 64-98, wherein the third promoter is heterologous to the small Rep coding sequence.
100. The system of polynucleotides of any one of claims 57-99, wherein the second promoter is heterologous to the large Rep coding sequence.
101. The system of polynucleotides of any one of claims 61-100, wherein the p19 promoter is mutated to substantially reduce promoter activity.
102. The system of polynucleotides of claim 101, wherein the p19 promoter activity is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or is undetectable as compared to the native p19 promoter activity.
103. The system of polynucleotides of any one of claims 64-102, wherein the third promoter has higher promoter activity as compared to the second promoter.
104. The system of polynucleotides of any one of claims 57-103, wherein the second promoter is a p5 promoter.
105. The system of polynucleotides of any one of claims 57-103, wherein the Rep gene lacks a functional p5 promoter.
106. The system of polynucleotides of claim 105, wherein the second promoter replaces the p5 promoter.
107. The system of polynucleotides of any one of claims 57-106, wherein the second promoter and / or third promoter is a constitutive promoter.
108. The system of polynucleotides of any one of claims 57-106, wherein the second heterologous promoter and / or third heterologous promoter is an inducible promoter.
109. The system of polynucleotides of any one of claims 57-108, wherein the second promoter and the third promoter are independently selected from a ubiquitin C (UBC) promoter, a Rous sarcoma virus long terminal repeat (RSV) promoter, a chicken beta actin promoter, a cytomegalovirus (CMV) promoter, a CMV enhancer / chicken beta actin (CAG) promoter, or a phosphoglycerate kinase (PGK) promoter.
110. The system of polynucleotides of any one of claims 57-109, wherein (i) the second promoter is a ubiquitin C (UBC) promoter and the second promoter is a Rous sarcoma virus long terminal repeat (RSV) promoter; (ii) the second promoter is a chicken beta actin promoter and the third promoter is a cytomegalovirus (CMV) promoter; (iii) the second promoter is a CMV enhancer / chicken beta actin (CAG) promoter and the third promoter is a RSV promoter; or (iv) the second promoter is a chicken beta actin promoter and the third promoter is a RSV promoter.
111. The system of polynucleotides of any one of claims 57-110, wherein the second promoter and the third promoter independently comprise a nucleotide sequence selected from any one of SEQ ID NOs: 113, 269, 275, 294, 297, 301, 302, 309, 339, 396, and 397, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
112. The system of polynucleotides of any one of claims 57-111, wherein the second promoter is a UBC promoter and the third promoter is a CAG promoter.
113. The system of polynucleotides of any one of claims 57-112, wherein the second promoter comprises nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 269 or SEQ ID NO: 297 and the third promoter comprises a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 302 or SEQ ID NO: 309 , 396, or 397.
114. The system of polynucleotides of any one of claims 57-113, wherein the AAV Rep expression cassette further comprises a heterologous polyadenylation (polyA) signal sequence downstream of the Rep open reading frame, optionally wherein the PolyA signal sequence is stronger than a native AAV Rep PolyA signal sequence.
115. The system of polynucleotides of claim 114, wherein the polyA signal sequence is selected from the group consisting of: a bovine growth hormone (bGH) polyA signal sequence, a human growth hormone (hGH) polyA signal sequence, a Simian Virus 40 (SV40) polyA signal sequence, a Chinese hamster growth hormone polyA signal sequence, a human neurophilin-1 polyA signal sequence, a nopaline synthase polyA signal sequence, an alpha globulin polyA signal sequence, and a rabbit globin polyA signal sequence.
116. The system of polynucleotides of claim 114 or claim 115, wherein the polyA signal sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 214-222, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
117. The system of polynucleotides of claim 114 or claim 115, wherein the polyA signal sequence is a bGH polyA signal sequence.
118. The system of polynucleotides of any one of claims 114-117, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 214, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:
215.
119. The system of polynucleotides of any one of claims 57-118, wherein the first polynucleotide is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the large Rep proteins and / or large Rep transcripts from a polynucleotide not having the first promoter and / or having a p5 promoter.
120. The system of polynucleotides of any one of claims 57-119, wherein the first polynucleotide is configured to provide for an expression of the small Rep proteins and / or small Rep transcripts at a level that is higher than the expression of the small Rep proteins and / or small Rep transcripts from a polynucleotide not having the third promoter and / or having a p19 promoter.
121. The system of polynucleotides of any one of claims 57-120, wherein the first polynucleotide is configured to provide for an expression of the large Rep proteins and / or large Rep transcripts at a level that is lower than the expression level of the small Rep proteins and / or small Rep transcripts.
122. The system of polynucleotides of any one of claims 57-121, wherein a ratio of the expression level of the small Rep proteins and / or small Rep transcripts to the expression level of the large Rep proteins and / or large Rep transcripts ranges from 1.5:1 to 10,000:1, including 5:1; 6:1; 7:1; 8:1; 9:1; 10:1; 100:1; 1000:1; or 5000:
1.
123. The system of polynucleotides of any one of claims 57-122, wherein the AAV Rep expression cassette further comprises a second excisable element downstream of the Rep open reading frame and upstream of the polyA signal sequence. wherein the second excisable element comprises a sequence encoding a ribozyme flanked by a third recombination site and a fourth recombination site, and wherein the ribozyme mediates degradation of an RNA encoding the ribozyme.
124. The system of polynucleotides of claim 123, wherein the sequence encoding the ribozyme is excised following a recombination event between the third recombination site and the fourth recombination site.
125. The system of polynucleotides of claim 123 or claim 124, where the third and fourth recombination sites comprise Lox sites or flippase recognition target (FRT) sites.
126. The system of polynucleotides of any one of claims 123-125, wherein the third and fourth recombination sites comprise Lox sites.
127. The system of polynucleotides of any one of claims 123-126, wherein: the first and second recombination sites comprise LoxP sequences and the third and fourth recombination sites comprise LoxN sequences, or the first and second recombination sites comprise LoxN sequences and the third and fourth recombination sites comprise LoxP sequences.
128. The system of polynucleotides of any one of claims 123-127, wherein the ribozyme is a self-cleaving ribozyme.
129. The system of polynucleotides of any one of claims 123-128, wherein the ribozyme is a Hammerhead ribozyme.
130. The system of polynucleotides of claim 128 or claim 129, wherein the ribozyme is selected from the group consisting of: a Hammerhead ribozyme Type I, a Hammerhead ribozyme Type II, a Hammerhead ribozyme Type III, a Hammerhead ribozyme HH9, a Hammerhead ribozyme HH10, and a RAGATH-1-hammerhead ribozyme.
131. The system of polynucleotides of any one of claims 128-130, wherein the sequence encoding the ribozyme comprises the nucleotide sequence of SEQ ID NO: 268, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.
132. The system of polynucleotides of any one of claims 57-131, wherein the Rep open reading frame is a sequence of a rep gene of an adeno-associated virus (AAV) selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, or AAVhu68.
133. The system of polynucleotides of any one of claims 57-132, wherein the Rep open reading frame is from AAV2.
134. The system of polynucleotides of any one of claims 57-133, wherein the large Rep coding sequence comprises a Rep78 and / or Rep 68 coding sequence comprising the nucleotide sequence of SEQ ID NO: 298 or SEQ ID NO: 283, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
135. The system of polynucleotides of any one of claims 57-134, wherein the small Rep coding sequence comprises a Rep58 coding sequence comprising the nucleotide sequence of SEQ IDNO: 305, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
136. The system of polynucleotides of any one of claims 57-135, wherein the first part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO: 284, and the second part of the small Rep coding sequence comprises the nucleotide sequence of SEQ ID NO:
290.
137. The system of polynucleotides of any one of claims 57-136, wherein the small Rep coding sequence further comprises a Rep40 coding sequence comprising the nucleotide sequence of SEQ ID NO: 293, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
138. The system of polynucleotides of any one of claims 57-137, wherein the AAV Rep expression cassette comprises the nucleotide sequence of SEQ ID NO: 360 or SEQ ID NO: 361, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
139. The system of polynucleotides of any one of claims 57-138, wherein the first polynucleotide further comprises a Cap coding sequence.
140. The system of polynucleotides of claim 139, wherein the Cap coding sequencing codes for Cap polypeptides.
141. The system of polynucleotides of claim 139 or claim 140, wherein the Cap coding sequence is operably linked to a fourth promoter.
142. The system of polynucleotides of claim 141, wherein the third promoter is a native Cap promoter.
143. The system of polynucleotides of claim 142, wherein the native Cap promoter is a p40 promoter.
144. The system of polynucleotides of claim 139 or claim 140, wherein the Cap coding sequence is comprised in an AAV Cap expression cassette comprising a fourth promoter, wherein the Cap coding sequence is operably linked to the fourth promoter.
145. The system of polynucleotides of claim 144, wherein the fourth promoter is a heterologous promoter.
146. The system of polynucleotides of claim 145, wherein the heterologous promoter is an inducible promoter.
147. The system of polynucleotides of claim 146, wherein the AAV Cap expression cassette comprises, from 5’ to 3’, the inducible promoter and the AAV Cap coding sequence.
148. The system of polynucleotides of claim 146 or claim 147, wherein the inducible promoter is a tetracycline-inducible promoter, an ecdysone-inducible promoter, or a cumate-inducible promoter.
149. The system of polynucleotides of claim 148, wherein the inducible promoter comprises a tetracycline-responsive promoter element (TRE).
150. The system of polynucleotides of claim 149, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.
151. The system of polynucleotides of claim 150, wherein the tetO sequence concatemers comprises the sequence of SEQ ID NO:
341.
152. The system of polynucleotides of claim 150 or claim 151, wherein the minimal promoter is a human cytomegalovirus promoter.
153. The system of polynucleotides of claim 152, wherein the minimal promoter comprises the sequence of SEQ ID NO:
342.
154. The system of polynucleotides of any one of claims 148-153, wherein the inducible promoter is a Tet-On promoter.
155. The system of polynucleotides of any one of claims 148-154, wherein the inducible promoter comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
262.
156. The system of polynucleotides of any one of claims 148-155, wherein the inducible promoter comprises a sequence of SEQ ID NO:
262.
157. The system of polynucleotides 156, wherein transcription of the AAV Cap coding sequence is activated from the inducible promoter upon binding of an activator, optionally wherein the activator is Tet-on3G.
158. The system of polynucleotides of claim 157, wherein the activator comprises a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO: 265, optionally, wherein the activator comprises a sequence of SEQ ID NO:
265.
159. The system of polynucleotides of any one of claims 148-158, wherein the inducible promoter is activated in the presence of a first triggering agent.
160. The system of polynucleotides of claim 159, wherein the first triggering agent is doxycycline.
161. The system of polynucleotides of any one of claims 144-160, wherein the AAV Cap expression cassette is in an opposite orientation relative to the AAV Rep expression cassette.
162. The system of polynucleotides of claim 161, wherein the AAV Cap expression cassette is oriented 3’ to 5’ and the AAV Rep expression cassette is oriented 5’ to 3’, or the AAV Cap expression cassette is oriented 5’ to 3’ and the AAV Rep expression cassette is oriented 3’ to 5’.
163. The system of polynucleotides of any one of claims 144-162, wherein the AAV Cap expression cassette is separated from the AAV Rep expression cassette by an intervening sequence.
164. The system of polynucleotides of claim 163, wherein the intervening sequence comprises a transcriptional blocking element (TBE).
165. The system of polynucleotides of claim 164, wherein the TBE element comprises the sequence of SEQ ID NO: 34 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
166. The system of polynucleotides of any one of claims 144-165, wherein the Cap polypeptides are wildtype Cap polypeptides.
167. The system of polynucleotides of any one of claims 144-166, wherein the Cap polypeptides are AAV capsid proteins.
168. The system of polynucleotides of claim 167, wherein the AAV capsid proteins comprise VP1, VP2, and VP3.
169. The system of polynucleotides of any one of claims 144-168, further comprising a polyadenylation (PolyA) signal sequence downstream of the Cap coding sequence, wherein the PolyA signal sequence is stronger than a native AAV Cap PolyA signal sequence.
170. The system of polynucleotides of claim 162, wherein the PolyA signal sequence is selected from: a bovine growth hormone (bGH) PolyA signal sequence, a human growth hormone (hGH) PolyA signal sequence, a Simian Virus 40 (SV40) PolyA signal sequence, a Chinese hamster growth hormone PolyA signal sequence, a human neurophilin-1 PolyA signal sequence, a nopaline synthase PolyA signal sequence, an alpha globulin PolyA signal sequence, and a rabbit globin PolyA signal sequence.
171. The system of polynucleotides of claim 169 or claim 170, wherein the polyA signal sequence comprises a SV40 polyA signal sequence.
172. The system of polynucleotides of any one of claims 169-171, wherein the polyA signal sequence comprises the nucleotide sequence of SEQ ID NO: 217, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
173. The system of polynucleotides of any one of claims 144-172, wherein the Cap coding sequence is a sequence of a cap gene of an adeno-associated virus (AAV) selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, AAV 12, AAV13, AAV 14, AAV 15 and AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, or AAVhu68.
174. The polynucleotide of any one of claims 144-173, wherein the Cap coding sequence is from AAV9 or AAV2.
175. The polynucleotide of any one of claims 144-173, wherein the Cap coding sequence is from AAV9.
176. The system of polynucleotides of any one of claims 144-175, wherein the Cap coding sequence comprises the nucleotide sequence of SEQ ID NO: 281, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
177. The system of polynucleotides of any one of claims 144-176, wherein the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO:
281.
178. The system of polynucleotides of any one of claims 144-173 and 177, wherein the Cap coding sequence comprises the nucleotide sequence of SEQ ID NO: 295, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
179. The system of polynucleotides of any one of claims 144-173, wherein the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO:
295.
180. The system of polynucleotides of any one of claims 144-173, 178, and 179, wherein the AAV Cap expression cassette comprises the nucleotide sequence of SEQ ID NO: 296, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
181. The system of polynucleotides of any one of claims 57-180, further comprising an enhancer downstream of the PolyA signal sequence downstream of the Rep coding sequence and / or an enhancer downstream of the PolyA signal sequence downstream of the Cap coding sequence.
182. The system of polynucleotides of any one of claims 57-181, wherein the AAV Rep expression cassette further comprises an enhancer downstream of the PolyA sequence.
183. The system of polynucleotides of claim 181 or claim 182, wherein the enhancer is selected from a transcriptional enhancer, a translational enhancer, and a transcriptional and translational enhancer.
184. The system of polynucleotides of any one of claims 181-183, wherein the enhancer comprises one or more sequences selected from SEQ ID NOS: 103-212.
185. The system of polynucleotides of any one of claims 181-184, wherein the enhancer comprises a human telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV promoter / enhancer.
186. The system of polynucleotides of any one of claims 181-185, wherein the enhancer comprises the nucleotide sequence of one or more of SEQ ID NOs: 103-107, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of the foregoing.
187. The system of polynucleotides of any one of claims 181-186, wherein the enhancer is a double enhancer.
188. The system of polynucleotides of claim 187, wherein the double enhancer comprises two of the following enhancers: a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV promoter / enhancer.
189. The system of polynucleotides of claim 187 or 188, wherein the double enhancer comprises a Simian virus 40 (SV40) and a CMV promoter / enhancer.
190. The system of polynucleotides of any one of claims 187-189, wherein the double enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO:
106.
191. The system of polynucleotides of any one of claims 187-190, wherein the double enhancer comprises the nucleotide sequence of SEQ ID NO:
106.
192. The system of polynucleotides of any one of claims 181-186, wherein the enhancer is a triple enhancer.
193. The system of polynucleotides of claim 192, wherein the triple enhancer comprises a telomerase reverse transcriptase (hTERT), a Simian virus 40 (SV40), or a CMV promoter / enhancer.
194. The system of polynucleotides of claim 192 or claim 193, wherein the triple enhancer comprises a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO:
107.
195. The system of polynucleotides of any one of claims 192-194, wherein the triple enhancer comprises the nucleotide sequence of SEQ ID NO:
107.
196. The system of polynucleotides of any one of claims 57-195, wherein the first polynucleotide further comprises a second selection cassette comprising a sequence encoding a second selectable marker operably linked to a constitutive promoter.
197. The system of polynucleotides of claim 196, wherein the second selection cassette comprises, from 5’ to 3’, the constitutive promoter and the second selectable marker.
198. The system of polynucleotides of claim 196 or claim 197, wherein the second selection cassette is located downstream of the AAV Cap expression cassette and is in the same orientation as the AAV Cap expression cassette.
199. The system of polynucleotides of any one of claims 196-198, wherein the constitutive promoter is an EF-1alpha promoter.
200. The system of polynucleotides of claim 199, wherein the EF-1alpha promoter has a TATA box mutation.
201. The system of polynucleotides of any one of claims 196-200, wherein the constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
202. The system of polynucleotides of any one of claims 196-201, wherein the selectable marker is an antibiotic resistance gene.
203. The system of polynucleotides of claim 202, wherein the antibiotic resistance gene is selected from the group consisting of: a blasticidin resistance gene, a hygromycin resistance gene, a puromycin resistance gene, and an ampicillin resistance gene.
204. The system of polynucleotides of any one of claims 196-203, wherein the polynucleotide comprises a first part of the selectable marker sequence fused to a first reassembly module andwherein another polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module.
205. The system of polynucleotides of claim 204, wherein the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C-intein) or leucine zippers.
206. The system of polynucleotides of claim 204 or claim 205, wherein the selectable marker is a split selectable marker that is a split antibiotic resistance protein and the polynucleotide comprises a sequence selected from: a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein; and a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein.
207. The system of polynucleotides of claim 206, wherein the selectable marker is a first part of a split blasticidin resistance gene intein.
208. The system of polynucleotides of claim 206 or claim 207, wherein the selectable marker is a split selectable marker comprising: a) a first part of a blasticidin resistance gene linked to an N-intein, or b) a C-intein linked to a second part of a blasticidin resistance gene.
209. The system of polynucleotides of claim 207 or claim 208, wherein the selectable marker comprises the nucleotide sequence of SEQ ID NO: 74 or SEQ ID NO: 73, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the forgoing.
210. The system of polynucleotides of any one of claims 196-209, wherein the second selection cassette comprises the nucleotide sequence of SEQ ID NO: 362, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.
211. The system of polynucleotides of any one of claims 57-210, wherein the first polynucleotide comprises a sequence selected from: (i) SEQ ID NO: 239, 356, or 358 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof; or (ii) SEQ ID NO: 355, 357, or 359 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereof.
212. The system of polynucleotides of any one of claims 57-211, comprising a second polynucleotide comprising a helper expression cassette, wherein the helper expression cassette comprises a sequence encoding one or more adenoviral (AAV) helper proteins anda promoter operably linked to the sequence encoding the one or more adenoviral helper proteins.
213. The system of polynucleotides of claim 212, wherein the promoter is an inducible promoter.
214. The system of polynucleotides of claim 212 or claim 213, wherein the helper expression cassette comprises, from 5’ to 3’: a) an inducible promoter, b) a self-excising element that comprises a sequence encoding a recombinase that is flanked by a fifth recombination site and a sixth recombination site, and c) a nucleotide sequence encoding one or more helper proteins, wherein the recombinase is operably linked to the inducible promoter.
215. The system of polynucleotides of claim 213 or claim 214, wherein the inducible promoter comprises a tetracycline-responsive promoter element (TRE).
216. The system of polynucleotides of claim 215, wherein the TRE comprises Tet operator (tetO) sequence concatemers fused to a minimal promoter.
217. The system of polynucleotides of claim 216, wherein the tetO sequence concatemers comprises the sequence of SEQ ID NO:
341.
218. The system of polynucleotides of claim 216 or claim 217, wherein the minimal promoter is a human cytomegalovirus promoter.
219. The system of polynucleotides of any one of claims 216-218, wherein the minimal promoter comprises the sequence of SEQ ID NO:
342.
220. The system of polynucleotides of any one of claims 212-219, wherein the promoter comprises a sequence having at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 262, optionally wherein the promoter comprises the sequence of SEQ ID NO:
262.
221. The system of polynucleotides of any one of claims 212-220, wherein transcription is activated from the promoter upon binding of an activator, optionally wherein the activator is Tet- on3G.
222. The system of polynucleotides of claim 221, wherein the activator binds to the promoter in the presence of a first triggering agent.
223. The system of polynucleotides of claim 222, wherein the first triggering agent is tetracycline or doxycycline, optionally wherein the first triggering agent is doxycycline.
224. The system of polynucleotides of any one of claims 57-223, wherein: the inducible promoter of the polynucleotide comprising the L4 coding sequence and the first polynucleotide are the same; the inducible promoter of the polynucleotide comprising the L4 coding sequence and the second polynucleotide are the same;the inducible promoter of the first polynucleotide and the second polynucleotide are the same; or the inducible promoter of the polynucleotide comprising the L4 coding sequence, the first polynucleotide and the second polynucleotide are the same; optionally wherein the inducible promoter that is the same is a TRE3G promoter, optionally wherein the inducible promoter that is the same comprises the sequence set for in SEQ ID NO:
262.
225. The system of polynucleotides of any one of claims 214-224, wherein the sequence encoding the recombinase in the self-excising element is excised following a recombination event between the fifth recombination site and the sixth recombination site.
226. The system of polynucleotides of any one of claims 214-225, wherein the inducible promoter is operably linked to the sequence encoding one or more AAV helper proteins following a recombination event between the fifth recombination site and the sixth recombination site.
227. The system of polynucleotides any one of claims 214-226, wherein the recombinase is a Cre recombinase or a flippase (FLP) recombinase.
228. The system of polynucleotides of any one of claims 214-227, wherein the recombinase is a Cre recombinase.
229. The system of polynucleotides of any one of claims 214-228, wherein the fifth recombination and sixth recombination sites comprise Lox sequences.
230. The system of polynucleotides of any one of claims 214-229, wherein the recombinase is an inducible recombinase.
231. The system of polynucleotides of claim 230, wherein the inducible recombinase is a Cre recombinase fused to an estrogen receptor ligand binding domain.
232. The system of polynucleotides of claim 230 or claim 231, wherein the inducible recombinase is a Cre-ERT2 fusion protein.
233. The system of polynucleotides of any one of claims 230-232, wherein the inducible recombinase is activated in the presence of a second triggering agent.
234. The system of polynucleotides of claim 233, wherein the second triggering agent induces nuclear localization of the inducible recombinase.
235. The system of polynucleotides of claim 233 or claim 234, wherein the second triggering agent is an estrogen receptor ligand.
236. The system of polynucleotides of any one of claims 233-235, wherein the second triggering agent is a selective estrogen receptor modulator (SERM).
237. The system of polynucleotides of claim 236, wherein the second triggering agent is tamoxifen.
238. The system of polynucleotides of any one of claims 233-237, wherein the inducible recombinase comprises the nucleotide sequence of SEQ ID NO: 317, or a nucleotide sequence thathas at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
239. The system of polynucleotides of any one of claims 233-238, wherein the recombination event between the fifth recombination site and the sixth recombination site is induced in the presence of the first and second triggering agents.
240. The system of polynucleotides of any one of claims 212-239, wherein the sequence encoding the one or more AAV helper proteins is a bicistronic open reading frame encoding at least two AAV helper proteins.
241. The system of polynucleotides of any one of claims 212-240, wherein the one or more helper proteins comprise E2A and E4.
242. The system of polynucleotides of claim 241, wherein the E2A protein is encoded by a nucleotide sequence comprising SEQ ID NO: 319 and SEQ ID NO: 321, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
243. The system of polynucleotides of claim 241 or claim 242, wherein the E4 protein is encoded by a nucleotide sequence comprising SEQ ID NO: 324, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
244. The system of polynucleotides of any one of claims 241-243 wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES) or by a cleavable linker.
245. The system of polynucleotides of any one of claims 241-244, wherein the cleavable linker is a 2A peptide, optionally wherein the 2A peptide is P2A, T2A, F2A, or E2A.
246. The system of polynucleotides of any one of claims 233-236, wherein the sequence coding for E2A and the sequence coding for E4 are separated by an internal ribosome entry site (IRES).
247. The system of polynucleotides of claim 246, wherein the IRES comprises that nucleotide sequence of SEQ ID NO: 323, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto 248. The system of polynucleotides of any one of claims 214-247, wherein the helper expression cassette comprises the nucleotide sequence of SEQ ID NO: 363, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
249. The system of polynucleotides of any one of claims 214-248, wherein the second polynucleotide further comprises a second expression cassette comprising a constitutive promoter operably linked to a nucleotide sequence encoding an activator.
250. The system of polynucleotides of claim 249, wherein the second expression cassette is in an opposite orientation relative to the helper expression cassette.
251. The system of polynucleotides of claim 250, wherein the helper expression cassette is oriented 3’ to 5’ and the second expression cassette is oriented 5’ to 3’, or the helper expression cassette is oriented 5’ to 3’ and the second expression cassette is oriented 3’ to 5’.
252. The system of polynucleotides of any one of claims 249-251, wherein the helper expression cassette is separated from the second expression cassette by an intervening sequence.
253. The system of polynucleotides of claim 252, wherein the intervening sequence comprises a transcriptional blocking element (TBE).
254. The system of polynucleotides of claim 253, wherein the TBE element comprises the sequence of SEQ ID NO: 34 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
255. The system of polynucleotides of any one of claims 249-254, wherein the activator activates transcription from the inducible promoter of the polynucleotide comprising the L4 coding sequence, the first polynucleotide and / or the second polynucleotide in the presence of the first triggering agent.
256. The system of polynucleotides of claims 255, wherein the first triggering agent is doxycycline.
257. The system of polynucleotides of any one of claims 249-256, wherein the activator is Tet-on3G.
258. The system of polynucleotides of any one of claims 249-257, wherein the activator comprises the nucleotide sequence of SEQ ID NO: 350 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
259. The system of polynucleotides of any one of claims 249-258, wherein the second constitutive promoter is an EF-1alpha promoter.
260. The system of polynucleotides of claim 259, wherein the EF-1alpha promoter has a TATA box mutation.
261. The system of polynucleotides of any one of claims 249-260, wherein the constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 or SEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
262. The system of polynucleotides of any one of claims 249-261, wherein the helper expression cassette comprises the nucleotide sequence of SEQ ID NO: 336, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
263. The system of polynucleotides of any one of claims 249-261, wherein the second polynucleotide comprises a third expression cassette comprising a first part of a constitutive promoter, an excisable element, a second part of the constitutive promoter and a sequence encoding VA-RNA.
264. The system of polynucleotides of claim 263, wherein the third expression cassette is downstream of the second expression cassette and is in the same orientation as the second expression cassette.
265. The system of polynucleotides of claim 263 or claim 264, wherein the excisable element is in an opposite orientation relative to the constitutive promoter.
266. The system of polynucleotides of any one of claims 263-265, wherein the excisable element comprises a third selection cassette flanked by a seventh recombination site and an eighth recombination site.
267. The system of polynucleotides of claim 266, wherein the third selection cassette is excised following a recombination event between the seventh recombination site and the eighth recombination site thereby generating a functionally complete third constitutive promoter operably linked to the sequence encoding VA-RNA.
268. The system of polynucleotides of any one of claims 263-267, wherein the first part of third the constitutive promoter comprises a U6 promoter distal sequence element (DSE) and the second part of the third constitutive promoter comprises a U6 promoter proximal sequence element (PSE).
269. The system of polynucleotides of claim 268, wherein the U6 promoter DSE comprises the nucleotide sequence of SEQ ID NO: 364, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
270. The system of polynucleotides of claim 268 or claim 269, wherein the U6 promoter PSE comprises the nucleotide sequence of SEQ ID NO: 365, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
271. The system of polynucleotides of any one of claims 263-270, wherein the sequence encoding VA RNA is a transcriptionally dead sequence.
272. The system of polynucleotides of any one of claims 263-271, wherein the sequence encoding VA RNA comprises at least two mutations in an internal promoter.
273. The system of polynucleotides of claim 272, wherein the at least two mutations comprise a G16A mutation and a G60A mutation with reference to SEQ ID NO:
84.
274. The system of polynucleotides of any one of claims 263-273, wherein the sequence encoding VA RNA comprises the nucleotide sequence of SEQ ID NO: 87 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
275. The system of polynucleotides of any one of claims 266-274, wherein the third selection cassette comprises a constitutive promoter operably linked to a nucleotide sequence encoding a third selectable marker.
276. The system of polynucleotides of claim 275, wherein the third selectable marker is a puromycin resistance gene.
277. The system of polynucleotides of claim 276, wherein the puromycin resistance gene comprises the nucleotide sequence of SEQ ID NO: 332, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
278. The system of polynucleotides of any one of claims 275-277, wherein the constitutive promoter is a CMV promoter.
279. The system of polynucleotides of any one of claims 266-277, wherein the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 343, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
280. The system of polynucleotides of any one of claims 263-279, wherein the third expression cassette comprises the nucleotide sequence of SEQ ID NO: 366, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
281. The system of polynucleotides of any one of claims 212-280, wherein the second polynucleotide comprises the sequence of SEQ ID NO: 363, 353 or SEQ ID NO: 241, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
282. The system of polynucleotides of any one of claims 57-281, further comprising a third polynucleotide comprising a sequence encoding a payload.
283. The system of polynucleotides of claim 282, wherein the payload is flanked by AAV inverted terminal repeat (ITR) sequences.
284. The system of polynucleotides of any of claims 282-283, wherein expression of the sequence of the payload is driven by a promoter; optionally wherein the promoter is a first constitutive promoter or a tissue specific promoter.
285. The system of polynucleotides of any one of claims 57-284, further comprising a third polynucleotide comprising a payload expression cassette flanked by AAV ITR sequences, wherein the payload expression cassette comprises a first constitutive promoter operably linked to a sequence of the payload.
286. The system of polynucleotides of any of claims 282-284, wherein the third polynucleotide further comprises a sequence for integration of the sequence of the payload into the genome of a cell, optionally wherein the sequence comprises a 5’ sequence and a 3’ sequence.
287. The system of polynucleotides of claim 286, wherein the integration is by transposon system integration, wherein the sequence for integration comprises a transposon 5’ inverted terminal repeat and a transposon 3’ inverted terminal repeat that are able to be recognized by a transposase.
288. The system of polynucleotides of claim 287, wherein the third polynucleotide comprises a 5’ inverted terminal repeat (ITR) upstream of the sequence of the payload and a 3’ ITR downstream of the sequence encoding the payload, wherein the 5’ ITR and 3’ ITR are for integration of the sequence of the payload into the genome of a cell by a transposon system.
289. The system of polynucleotide of claim 287 or claim 288, wherein the transposon system is a Piggybac system.
290. The system of polynucleotides of claim 285, wherein the integration is by homology directed repair (HDR) into a target loci, wherein the sequence for integration comprises 5’ and 3’ homology arms that are each independently complementary to a sequence of the target loci flanking the site of integration.
291. The system of polynucleotides of any one of claims 284-290, wherein the first constitutive promoter is an RSV promoter.
292. The system of polynucleotides of claim 291, wherein the RSV promoter comprises the nucleotide sequence of SEQ ID NO: 294, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
293. The system of polynucleotides of any one of claims 282-292, wherein the third polynucleotide further comprises a third selection cassette, wherein the third selection cassette comprises a second constitutive promoter operably linked to a sequence encoding a selectable marker.
294. The system of polynucleotides of claim 293, wherein the third polynucleotide further comprises a sequence for integration of the sequence of the payload and selection cassette into the genome of a cell, optionally wherein the sequence comprises a 5’ sequence and a 3’ sequence.
295. The system of polynucleotides of claim 293 or 294, wherein the third polynucleotide comprises a transposon-specific 5’ inverted terminal repeat (ITR) upstream of the sequence of the payload expression cassette and a transposon-specific 3’ ITR downstream of the sequence encoding the third selection cassette, wherein the 5’ ITR and 3’ ITR are for integration of the sequence of the third polynucleotide into the genome of a cell by a transposon system.
296. The system of polynucleotides of claim 295, wherein the integration is by transposon system integration, wherein the sequence for integration comprises a transposon-specific 5’ ITR and a transposon-specific 3’ ITR that are able to be recognized by a transposase.
297. The system of polynucleotides of claim 295 or claim 296, wherein the transposon system is a Piggybac system.
298. The system of polynucleotides of claim 294, the integration is by homology directed repair (HDR) into a target loci, wherein the sequence for integration comprises 5’ and 3’ homologyarms that are each independently complementary to a sequence of the target loci flanking the site of integration.
299. The system of polynucleotides of claim 293, wherein the selectable marker is an antibiotic resistance gene.
300. The system of polynucleotides of claim 293 or claim 294, wherein the selectable marker is a split selectable marker, wherein the third polynucleotide comprises a first part of the selectable marker sequence fused to a first reassembly module and wherein another polynucleotide provides the second part of the selectable marker sequence fused to a second reassembly module.
301. The system of polynucleotides of claim 300, wherein the another polynucleotide is the first polynucleotide of the system of polynucleotides.
302. The system of polynucleotides of claim 300 or claim 301, wherein the first and second reassembly modules are selected from two complementary halves of a split intein (N-intein and C- intein) or leucine zippers.
303. The system of polynucleotides of any one of claims 300-302, wherein the selectable marker is the split selectable marker that is a split antibiotic resistance protein and the third polynucleotide comprises a sequence selected from: a split intein linked to an N-terminus of the first part of the antibiotic resistance protein or a split intein linked to a C-terminus of the first part of the antibiotic resistance protein; and a leucine zipper linked to an N-terminus of the first part of the antibiotic resistance protein or leucine zipper linked to a C-terminus of the first part of the antibiotic resistance protein.
304. The system of polynucleotides of any one of claims 300-303, wherein the selectable marker is a first part of a split blasticidin resistance gene intein.
305. The system of polynucleotides of claim 304, wherein the selectable marker of the first polynucleotide of the system of polynucleotides comprises a second part of the split blasticidin resistance gene.
306. The system of polynucleotides of claim 304 or claim 305, wherein the selectable marker of the third polynucleotide comprises the nucleotide sequence of SEQ ID NO: 315 or SEQ ID NO: 74, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.
307. The system of polynucleotides of any one of claims 293-306, wherein the second constitutive promoter is an EF-1alpha promoter.
308. The system of polynucleotides of claim 307, wherein the EF-1alpha promoter has a TATA box mutation.
309. The system of polynucleotides of any one of claims 293-308, wherein the second constitutive promoter comprises the nucleotide sequence of SEQ ID NO: 405, SEQ ID NO: 263 orSEQ ID NO: 327, or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
310. The system of polynucleotides of any of claims 293-309, wherein the third selection cassette comprises the nucleotide sequence of SEQ ID NO: 362 , or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.
311. The system of polynucleotides of any one of claims 282-310, wherein the sequence of the payload comprises a polynucleotide sequence coding for a gene.
312. The system of polynucleotides of claim 311, wherein the gene codes for a selectable marker or detectable marker.
313. The system of polynucleotides of claim 311, wherein the gene codes for a therapeutic polypeptide or transgene.
314. The system of polynucleotides of any one of claims 282-313, wherein the sequence of the payload comprises a polynucleotide sequence coding for a therapeutic polynucleotide.
315. The system of polynucleotides of claim 314, wherein the therapeutic polynucleotide is a tRNA suppressor or a guide RNA.
316. The system of polynucleotides of claim 315, wherein the guide RNA is a polyribonucleotide capable of binding to a protein.
317. The system of polynucleotides of claim 316, wherein the protein is nuclease.
318. The system of polynucleotides of claim 316 or claim 317, wherein the protein is a Cas protein, an ADAR protein, or an ADAT protein.
319. The system of polynucleotides of claim 318, wherein the Cas protein is catalytically inactive Cas protein.
320. A system of polynucleotides comprising: a) a polynucleotide for expressing late stage L4 proteins comprising a late-stage gene (L4) construct comprising the nucleotide sequence of SEQ ID NO: 251 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and b) a polynucleotide for expressing AAV helper proteins comprising an AAV helper construct comprising the nucleotide sequence of SEQ ID NO: 353 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and c) a polynucleotide for expressing AAV Rep and AAV Cap proteins comprising an AAV Rep / Cap construct comprising the nucleotide sequence of any one of SEQ ID NOs: 398, 399, and 402 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the forgoing.
321. The system of polynucleotides of claim 320 further comprising a polynucleotide comprising a nucleotide sequence encoding a payload flanked by AAV inverted terminal repeats (ITRs).
322. A vector comprising the polynucleotide of any one of claims 1-57.
323. The vector of claim 322 comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 377, 248, 249, 250, 251, or 254.
324. The vector of claim 322 or claim 323, comprising a sequence with at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
251.
325. The vector of any of claims 322-324, comprising the sequence of SEQ ID NO:
251.
326. The vector of claim 322 or claim 323, comprising a sequence with at least 70%, 80%, 90%, 95%, 99%, or 100% sequence identity to the sequence of SEQ ID NO:
250.
327. The vector of any one of claims 322, 323 and 326, comprising the sequence of SEQ ID NO:
250.
328. A vector system for inducible production of recombinant adeno-associated virus (rAAV) comprising: a first vector comprising the polynucleotide of any of claims 1-57; a second vector comprising the first polynucleotide of any of claims 58-319; a third vector comprising the second polynucleotide of any of claims 58-319; and a fourth vector comprising the third polynucleotide of any of claims 58-319.
329. A vector system for producing recombinant adenovirus associated virus (rAAV), comprising: the vector of claim 322-327, wherein the vector is a first vector; a second vector comprising a sequence encoding AAV Rep proteins and / or a sequence encoding AAV Cap proteins; a third vector comprising a sequence encoding one or more AAV helper proteins; and a fourth vector comprising a polynucleotide sequence of a payload flanked by AAV inverted terminal repeats (ITRs).
330. The vector system of claim 329, wherein the second vector comprises a sequence encoding the AAV Rep proteins and the vector system further comprises a vector comprising a sequence encoding AAV Cap proteins.
331. The vector system of claim 329, wherein the second vector comprises a sequence encoding the AAV Cap proteins and the vector system further comprises a vector comprising a sequence encoding AAV Rep proteins.
332. The vector system of claim 329, wherein the second vector comprises a sequence encoding the AAV Rep proteins and a sequence encoding the AAV Cap proteins.
333. A cell comprising the polynucleotide of any one of claims 1-57.
334. The cell of claim 333, wherein the adenovirus L4 coding sequence is integrated into the genome of the cell.
335. The cell of claim 333 or claim 334, wherein the adenovirus L4 coding sequence and the selectable marker is integrated into the genome of the cell.
336. A cell comprising the late-stage gene cassette of the polynucleotide of any of claims 1- 57.
337. The cell of any one of claims 333-336, wherein the late-stage gene cassette is integrated into the genome of the cell.
338. A cell comprising the late-stage gene cassette and the selection cassette comprising the selectable marker of any one of claims 29-56.
339. The cell of any one of claims 333-338, wherein the late-stage gene cassette and the selection cassette comprising the selectable marker are integrated into the genome of the cell.
340. The cell of any one of claims 333-339, comprising: (i) a polynucleotide sequence encoding AAV Rep proteins; (ii) a polynucleotide sequence encoding AAV Cap proteins; (iii) a polynucleotide sequence encoding one or more AAV helper proteins; and / or (iv) a polynucleotide sequence of a payload flanked by AAV inverted terminal repeats (ITRs).
341. The cell of any one of claims 333-340, comprising: (i) a polynucleotide sequence encoding AAV Rep proteins; (ii) a polynucleotide sequence encoding AAV Cap proteins; (iii) a polynucleotide sequence encoding one or more AAV helper proteins; and (iv) a polynucleotide sequence of a payload flanked by AAV inverted terminal repeats (ITRs).
342. The cell of claim 340 or claim 341, wherein one or more of the polynucleotide sequences (i)-(iv) are integrated into the genome of the cell.
343. The cell of claim 340 or claim 341, wherein each of the polynucleotide sequences (i)-(iv) are integrated into the genome of the cell.
344. A cell comprising : the polynucleotide of any of claims 1-57; the first polynucleotide of any of claims 58-319; the second polynucleotide of any of claims 58-319; and the third polynucleotide of any of claims 58-319.
345. The cell of claim 344, wherein: the late stage gene cassette of any of claims 1-57 is integrated into the genome of the cell; the Rep expression cassette of any of claims 58-319 is integrated into the genome of the cell; the Cap expression cassette of any of claims 58-319 is integrated into the genome of the cell; the helper expression cassette of any of claims 58-319 is integrated into the genome of the cell; andthe payload expression cassette of any of claims 58-319 is integrated into the genome of the cell.
346. The cell of claim 344 or claim 345, wherein the selection cassette of any of claims 1-57 is integrated into the genome of the cell.
347. The cell of claim 346, wherein: the second selection cassette of any of claims 58-319 is integrated into the genome of the cell; the second expression cassette of any of claims 58-319 is integrated into the genome of the cell; the third expression cassette of any of claims 58-319 is integrated into the genome of the cell; and / or the third selection cassette of any of claims 58-319 is integrated into the genome of the cell.
348. The cell of any of claims 333-347 that is a stable cell line.
349. A cell comprising an L4 construct and one or more of: a) an AAV helper construct, b) a Rep / Cap construct, and c) a payload construct; optionally wherein the L4 construct, and each of a, b, and c are stably integrated into the genome of the cell.
350. The stable cell line of claim 349, wherein: i) the L4 construct comprises the nucleotide sequence of SEQ ID NO: 251 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; ii) the AAV helper construct comprises the nucleotide sequence of SEQ ID NO: 353 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and / or iii) the AAV Rep / Cap construct comprises the nucleotide sequence of any one of SEQ ID NOs: 398, 399, and 402 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the forgoing.
351. The cell of any of claims 333-348, wherein the cell is a mammalian cell, optionally wherein the mammalian cell is a HEK293 cell, further optionally, wherein the HEK293 cell expresses AAV helper proteins E1A and E1B.
352. The cell of any of claims 333-351, wherein the cell further comprises a knockout of one or more genes encoding a protein involved in programmed cell death.
353. The cell of claim 352, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at leasteight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.
354. The cell of claim 352 or claim 353, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.
355. The cell of any of claims 352-354, wherein the protein involved in programmed cell death comprises CASP3.
356. The cell of any of claims 352-355, wherein the knockout comprises a deletion in an exon within each of the one or more genes.
357. The cell of any of claims 352-356, wherein the knockout was performed using a CRISPR system, optionally wherein the CRISPR system comprises a nuclease and at least one guide RNA.
358. A population of cells comprising the cell of any of claims 333-357.
359. The population of cells of claim 358 that is a monoclonal population.
360. A method for producing recombinant AAV, the method comprising performing transfection of a cell with the vector system of any one of claims 328-332.
361. The method of claim 360, wherein the transfections of the vectors of the vector system are carried out sequentially or simultaneously.
362. The method of claim 361, wherein the method comprises selecting cells for a selectable marker encoding by the vector of a transfection prior to one or more subsequent transfection of vectors of the vector system.
363. The method of any of claims 360-362, further comprising performing a knockout of one or more genes encoding a protein involved in programmed cell death.
364. The method of claim 363, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or fourteen of CASP3, CASP6, CASP7, AIF1, BAK1, BAX, IFNAR1, MYD88, TICAM1, TIRAP, RIGI, CGAS, STING, AIM2, DFFB, and IFI16.
365. The method of claim 363 or claim 364, wherein the protein involved in programmed cell death comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or eight of CASP3, CGAS, STING1, IFNAR1, MYD88, BAK, BAK1, and DFFB.
366. The method of any of claims 363-365, wherein the protein involved in programmed cell death comprises CASP3.
367. The method of any of claims 363-366, wherein the knockout comprises a deletion in an exon within each of the one or more genes.
368. The method of any of claims 363-367, wherein performing the knockout comprises using a CRISPR system.
369. The method of any of claims 363-368, wherein performing the knockout comprises contacting the cell with a nuclease and at least one guide RNA, optionally wherein the nuclease is Cas9.
370. The method of claim 369, wherein the nuclease and at least one guide RNA is introduced into the cell by delivering a ribonucleoprotein (RNP) complex by electroporation.
371. The method of any of claims 360-362, further comprising contacting the cell with a first triggering agent and a second triggering agent, thereby inducing the production of a rAAV.
372. A method of producing rAAV, comprising introducing the system of polynucleotides of any one of claims 57-319 into a cell and adding the triggering agent.
373. The method of claim 372, wherein the triggering agent is the first triggering agent.
374. The method of claim 372, wherein the triggering agent is the first triggering agent and the second triggering agent.
375. The method of claim 373 or claim 374, wherein the first triggering agent is doxycycline.
376. The method of claim 374 or claim 375, wherein the second triggering agent is tamoxifen.
377. A method for producing recombinant AAV, the method comprising contacting the cell of any one of claims 333-357 or the population of cells of claim 358 or claim 359 with a first triggering agent and a second triggering agent.
378. The method of any of claims 371-377, wherein the first triggering agent is doxycycline and the second triggering agent is tamoxifen.
379. The method of any of claims 371-378, further comprising contacting the cell with an apoptosis inhibitor.
380. The method of claim 379, wherein the apoptosis inhibitor is zVAD.fmk.
381. A method of generating a cell for inducibly producing recombinant AAV (rAAV) comprising a payload, the method comprising: (i) introducing into a cell an AAV helper construct comprising an AAV helper expression cassette and a first selection cassette, wherein the first selection cassette comprises, from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a first selectable marker; (ii) selecting for a cell expressing the first selectable marker; (iii) introducing into the cell expressing the first selectable marker an L4 construct encoding an L4 expression cassette and a second selection cassette, wherein the second selection cassette comprises, from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a second selectable marker; (iv) selecting for a cell expressing the first selectable marker and the second selectable marker; (v) introducing into the cell expressing the first and second selectable markers a) an AAV Rep / Cap construct encoding an AAV Rep expression cassette, an AAV Cap expression cassette, and a third selection cassette, wherein the third selection cassette comprises,from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a first portion of a third selectable marker; and b) a payload construct encoding a payload expression cassette, and a fourth selection cassette, wherein the fourth selection cassette comprises from 5’ to 3’, a constitutive promoter operably linked to a nucleotide sequence encoding a second portion of a third selectable marker; and (iv) selecting for a cell expressing the first selectable marker, the second selectable marker, and the third selectable marker.
382. The method of claim 381, wherein: i) the L4 construct comprises the nucleotide sequence of SEQ ID NO: 251 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; ii) the AAV helper construct comprises the nucleotide sequence of SEQ ID NO: 353 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and / or iii) the AAV Rep / Cap construct comprises the nucleotide sequence of any one of SEQ ID NOs: 398, 399, and 402 or a nucleotide sequence that has at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the forgoing.
Citation Information
Patent Citations
Extracellular matrix receptor ligands that modulate leukocyte function
EP0595659A2
Fas ANTIGEN DERIVATIVES
EP0965637A1
Methods and compositions for treating metastatic breast cancer and other cancers in the brain
US10780182B2
Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen
US10912826B2
Compositions and methods of treating Huntington's disease
US11752181B2