Simple and efficient method for detecting cariogenic bacteria, periodontal disease bacteria, and total oral bacteria, and primer set and kit for said method
The method addresses inefficiencies in existing bacterial detection by using PCR with optimized primers and short target genes for rapid and specific identification of periodontal and caries bacteria, enhancing diagnostic accuracy and disease severity assessment.
Patent Information
- Application Number
- PCT/JP2024/035925
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-10-08
- Publication Date
- 2026-04-16
AI Technical Summary
Existing methods for detecting cariogenic and periodontal disease bacteria are inefficient, lack specificity, and struggle with quantitative accuracy, particularly in determining the clinical relevance of bacterial counts.
A method involving gene amplification using PCR at a single temperature with short target genes (≤500 bp, preferably 100 bp) and optimized primer sets for Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, Streptococcus mutans, and 16S rRNA genes, enabling rapid and specific detection and quantification of these bacteria in oral samples.
Facilitates rapid, efficient, and specific detection and quantification of periodontal disease and caries-causing bacteria, allowing for accurate assessment of disease severity by calculating bacterial ratios, thereby improving clinical diagnostics.
Smart Images

Figure JP2024035925_16042026_PF_FP_ABST
Abstract
Description
A simple and efficient method for detecting caries bacteria, periodontal disease bacteria, and total oral bacteria, and a primer set and kit therefor.
[0001] This invention relates to a simple and efficient method for detecting cariogenic bacteria, periodontal disease bacteria, and total oral bacteria, a primer set therefor, and a kit containing the same.
[0002] Dental caries and periodontal disease are infectious diseases caused by pathogenic bacteria. Although periodontal disease-related bacteria are present in high levels in subgingival plaque, they are often detected in healthy areas as well, and it is believed that an increase in bacterial count enhances pathogenicity (Non-Patent Literature 1).
[0003] Today, common bacterial testing methods used in dentistry include visual inspection of supragingival plaque using staining or probes, and observation of collected plaque under a phase-contrast microscope. While both methods can determine the presence or absence of oral bacteria, they do not target specific bacteria or bacterial groups. Although suitable for comprehensively examining the entire bacterial flora inhabiting the infection site, it has been difficult to determine whether the bacteria are clinically useful.
[0004] In the field of periodontal disease, bacterial testing methods include bacterial culture, immunological techniques, enzyme activity measurement, and methods applying genetic engineering (Patent Documents 1-5). Among these, polymerase chain reaction (PCR) has developed particularly well as a genetic diagnostic method for specifically and sensitively detecting causative bacteria from patients with infectious diseases. However, the methods described in Patent Documents 2-5 still have issues in terms of quantitative accuracy, etc.
[0005] Polymerase chain reaction (PCR), known as a method that allows for rapid gene amplification, is the most commonly used gene amplification method and is also useful in routine testing.
[0006] A report has been made regarding gene amplification primers for detecting oral bacteria using real-time PCR (Patent Document 1). The primers are designed using specific base sites in the 16S rRNA gene of oral bacteria as indicators. Since the annealing temperature depends on the melting temperature (Tm) at which double strands dissolve into single strands, the PCR reaction using the reported primers requires that the annealing and extension reactions be performed at different temperatures. In other words, the method in Patent Document 1 has problems in terms of efficiency, simplicity, and speed, as it requires performing the PCR at a Tm value of 50-70°C to obtain a highly specific PCR product and selecting and using primers with similar Tm values.
[0007] Japanese Patent Publication No. 2016-192950, Japanese Patent Publication No. 2007-222136, Japanese Patent Publication No. 2007-244349, Japanese Patent Publication No. 2004-229537, Japanese Patent Publication No. 2007-289179
[0008] AD Haffajee, et al. , Periodontol 2000. 1994:5:78-111
[0009] The present invention aims to provide a gene amplification method for establishing a simple, efficient, and rapid method for bacterial gene testing in clinical settings, for specifically detecting and evaluating bacteria associated with periodontal disease and caries, or for examining and evaluating the ratio of bacteria associated with periodontal disease and caries to the total number of oral bacteria, as well as a primer set for gene amplification reactions and a kit for detecting the genes of causative bacteria of periodontal disease or caries, including the same.
[0010] The present invention provides a method for detecting oral bacteria or causative agents of periodontal disease or caries by detecting the genes of such oral bacteria or causative agents of periodontal disease or caries in supragingival or subgingival plaque or saliva using a gene amplification method, characterized in that (1) the annealing and extension reactions in the gene amplification method are carried out at substantially the same temperature, and / or (2) the gene length of the target gene as the amplification product is short.
[0011] In the method of the present invention, the gene length of the target gene may be 500 bp or less.
[0012] In the method of the present invention, the gene length of the target gene may be 100 bp or less.
[0013] In the method of the present invention, a method for detecting microorganisms contained in a sample, wherein the primer set may use the DNA region of a gene encoding at least one gene selected from the causative bacteria of periodontal disease or dental caries and the group of microorganisms involved in oral bacteria, and may be able to form a sequence-specific complementary strand to said DNA region.
[0014] In the method of the present invention, the gene amplification method may be a polymerase chain reaction (hereinafter also referred to as "PCR").
[0015] In the method of the present invention, the PCR method may be fluorescence PCR or EIS (Electrochemical Impedance Spectroscopy)-PCR.
[0016] In the method of the present invention, the causative bacteria of periodontal disease may be one or more periodontal disease bacteria selected from the group consisting of Porphyromonas gingivalis (Pg), Treponema denticola (Td), and Tannerella forsythia (Tf), the causative bacteria of dental caries may be Streptococcus mutans (Sm), and the oral bacteria may be bacteria having a 16S rRNA gene.
[0017] In the method of the present invention, the bacteria having the 16S rRNA gene are Abiotrophia defectiva, Achromobacter xylosoxidans, Acinetobacter baumannii, Acinetobacter sp., Actinobaculum sp., Actinomyces cardiffensis, Actinomyces dentalis, Actinomyces georgiae, Actinomyces gerencseriae, Actinomyces graevenitzii, Actinomyces israelii, Actinomyces johnsonii, Actinomyces lingnae [NVP], Actinomyces massiliensis, Actinomyces meyeri, Actinomyces naeslundii, Actinomyces odontolyticus, Actinomyces oricola, Actinomyces oris, Actinomyces radicidentis, Actinomyces sp., Actinomyces timonensis, Actinomyces viscosus, Afipia broomeae, Afipia sp. genosp. 4, Aggregatibacter actinomycetemcomitans, Aggregatibacter aphrophilus, Aggregatibacter paraphrophilus, Aggregatibacter segnis, Aggregatibacter sp., Agrobacterium tumefaciens, Alloiococcus otitis, Alloprevotella rava, Alloprevotella sp., Alloprevotella tannerae, Alloscardovia omnicolens, Anaerococcus lactolyticus, Anaerococcus prevotii, Anaerococcus tetradius, Anaeroglobus geminatus, Anaerolineae sp., Arcanobacterium haemolyticum, Arsenicicoccus bolidensis, Atopobium minutum, Atopobium parvulum, Atopobium rimae, Atopobium sp., Atopobium vaginae, Bacillus anthracis, Bacillus clausii, Bacillus subtilis, Bacteroidaceae sp., Bacteroidales sp., Bacteroides heparinolyticus, Bacteroides pyogenes, Bacteroides zoogleoformans, Bacteroidetes sp., Bartonella schoenbuchensis, Bdellovibrio sp., Bergeyella sp., Bifidobacteriaceae sp., Bifidobacterium animalis subsp. lactis, Bifidobacterium breve, Bifidobacterium dentium, Bifidobacterium longum, Bifidobacterium scardovii, Bifidobacterium subtile, Bordetella pertussis, Bosea vestrisii, Bradyrhizobium elkanii, Brevundimonas diminuta, Bulleidia extructa, Burkholderia cepacia, Butyrivibrio sp., Campylobacter concisus, Campylobacter curvus, Campylobacter gracilis, Campylobacter rectus, Campylobacter showae, Campylobacter sp., Campylobacter sputorum, Campylobacter ureolyticus, Capnocytophaga gingivalis, Capnocytophaga granulosa, Capnocytophaga haemolytica, Capnocytophaga leadbetteri, Capnocytophaga ochracea, Capnocytophaga sp., Capnocytophaga sputigena, Cardiobacterium hominis, Cardiobacterium valvarum, Catonella morbi, Catonella sp., Caulobacter sp., Centipeda periodontii, Chlamydophila pneumoniae, Clostridiales sp., Comamonas testosteroni, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium matruchotii, Corynebacterium mucifaciens, Corynebacterium tuscaniense, Corynebacterium urealyticum, Cronobacter sakazakii, Cryptobacterium curtum, Cupriavidus gilardii, Defluvibacter lusatiensis, Delftia acidovorans, Desulfobulbus sp., Desulfomicrobium orale, Desulfovibrio fairfieldensis, Desulfovibrio sp., Dialister invisus, Dialister micraerophilus, Dialister pneumosintes, Dialister sp., Dietzia cinnamea, Dolosigranulum pigrum, Eggerthella lenta, Eggerthia catenaformis, Eikenella corrodens, Eikenella sp., Enterobacter cancerogenus, Enterobacter hormaechei, Enterococcus casseliflavus, Enterococcus durans, Enterococcus faecalis, Enterococcus italicus, Enterococcus saccharolyticus, Erysipelothrix tonsillarum, Erysipelotrichaceae sp., Erythromicrobium ramosum, Escherichia coli, Eubacterium limosum, Fastidiosipila sanguinis, Filifactor alocis, Finegoldia magna, Flavitalea sp., Fretibacterium fastidiosum, Fretibacterium sp., Fusobacterium gonidiaformans, Fusobacterium naviforme, Fusobacterium necrophorum, Fusobacterium nucleatum subsp. animalis, Fusobacterium periodonticum, Fusobacterium sp., Gardnerella vaginalis, Gemella bergeri, Gemella haemolysans, Gemella morbillorum, Gemella sanguinis, Gemella sp., Granulicatella adiacens, Granulicatella elegans, Haemophilus aegyptius, Haemophilus ducreyi, Haemophilus haemolyticus, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Haemophilus pittmaniae, Haemophilus sp., Haemophilus spitorum, Helicobacter pylori, Johnsonella ignava, Johnsonella sp., Jonquetella anthropi, Kingella denitrificans, Kingella kingae, Kingella oralis, Kingella sp., Klebsiella pneumoniae, Kluyvera ascorbata, Kocuria sp., Kytococcus sedentarius, Lachnoanaerobaculum orale, Lachnoanaerobaculum saburreum, Lachnoanaerobaculum sp., Lachnoanaerobaculum umeaense, Lachnospiraceae sp., Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus coleohominis, Lactobacillus crispatus, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus kisonensis, Lactobacillus oris, Lactobacillus panis, Lactobacillus paracasei, Lactobacillus parafarraginis, Lactobacillus pentosus, Lactobacillus plantarum, Lactobacillus rapi, Lactobacillus reuteri genosp. 1、Lactobacillus rhamnosus、Lactobacillus salivarius、Lactobacillus sp.、Lactobacillus ultunensis、Lactobacillus vaginalis、Lactococcus lactis、Lautropia mirabilis、Leptothrix sp., Leptotrichia buccalis, Leptotrichia goodfellowii, Leptotrichia hofstadii, Leptotrichia hongkongensis, Leptotrichia shahii, Leptotrichia sp., Leptotrichia wadei, Listeria monocytogenes, Lysinibacillus fusiformis, Megasphaera micronuciformis, Megasphaera sp., Mesorhizobium loti, Microbacterium flavescens, Microbacterium ginsengisoli, Mitsuokella multacida, Mitsuokella sp., Mobiluncus mulieris, Mogibacterium diversum, Mogibacterium neglectum, Mogibacterium pumilum, Mogibacterium timidum, Mogibacterium vescum, Mollicute sp., Moraxella catarrhalis, Moraxella osloensis, Mycobacterium leprae, Mycobacterium neoaurum, Mycobacterium tuberculosis, Mycoplasma buccale, Mycoplasma faucium, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma lipophilum, Mycoplasma orale, Mycoplasma pneumoniae, Mycoplasma salivarium, Neisseria bacilliformis, Neisseria elongata, Neisseria flava, Neisseria flavescens, Neisseria gonorrhoeae, Neisseria lactamica, Neisseria meningitidis, Neisseria mucosa, Neisseria oralis, Neisseria pharyngis, Neisseria polysaccharea, Neisseria sicca, Neisseria sp., Neisseria subflava, Neisseria weaveri, Ochrobactrum anthropi, Olsenella profusa, Olsenella sp., Olsenella uli, Oribacterium asaccharolyticum, Oribacterium parvum, Oribacterium sinus, Oribacterium sp., Ottowia sp., Paenibacillus glucanolyticus, Paenibacillus phoenicis, Paenibacillus sp., Parascardovia denticolens, Parvimonas micra, Parvimonas sp., Pedobacter sp., Peptococcus sp., Peptoniphilaceae sp., Peptoniphilus asaccharolyticus, Peptoniphilus indolicus, Peptoniphilus lacrimalis, Peptoniphilus sp., Peptostreptococcaceae sulci, Peptostreptococcus anaerobius, Peptostreptococcus stomatis, Porphyrobacter tepidarius, Porphyromonas asaccharolytica, Porphyromonas catoniae, Porphyromonas endodontalis, Porphyromonas gingivalis, Porphyromonas pasteri, Porphyromonas sp., Porphyromonas uenonis, Prevotella aurantiaca, Prevotella baroniae, Prevotella bivia, Prevotella buccae, Prevotella buccalis, Prevotella dentalis, Prevotella denticola, Prevotella enoeca, Prevotella fusca, Prevotella histicola, Prevotella intermedia, Prevotella loescheii, Prevotella maculosa, Prevotella marshii, Prevotella melaninogenica, Prevotella micans, Prevotella multiformis, Prevotella multisaccharivorax, Prevotella nanceiensis, Prevotella nigrescens, Prevotella oralis, Prevotella oris, Prevotella oulorum, Prevotella pallens, Prevotella pleuritidis, Prevotella saccharolytica, Prevotella salivae, Prevotella scopos, Prevotella shahii, Prevotella sp., Prevotella veroralis, Propionibacterium acidifaciens, Propionibacterium acnes, Propionibacterium avidum, Propionibacterium propionicum, Propionibacterium sp., Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas otitidis, Pseudomonas pseudoalcaligenes, Pseudomonas sp., Pseudomonas stutzeri, Pseudodoramibacter alactolyticus, Pyramidobacter piscolens, Ralstonia pickettii, Ralstonia sp., Rhodobacter capsulatus, Rhodocyclus sp., Rothia aeria, Rothia dentocariosa, Rothia mucilaginosa, Ruminococcaceae sp., Sanguibacter keddieii, Scardovia inopinata, Scardovia wiggsiae, Schlegelella aquatica, Schlegelella thermodepolymerans, Selenomonas artemidis, Selenomonas dianae, Selenomonas flueggei, Selenomonas infelix, Selenomonas noxia, Selenomonas sp., Selenomonas sputigena, Shuttleworthia satelles, Simonsiella muelleri, Slackia exigua, Sneathia amnii, Sneathia sanguinegens, Solobacterium moorei, Sphingomonas echinoides, Sphingomonas sp., Staphylococcus aureus, Staphylococcus caprae, Staphylococcus epidermidis, Staphylococcus warneri, Stenotrophomonas maltophilia, Stenotrophomonas nitritireducens, Stomatobaculum longum, Stomatobaculum sp., Streptococcus agalactiae, Streptococcus anginosus, Streptococcus australis, Streptococcus constellatus, Streptococcus cristatus, Streptococcus dentisani, Streptococcus downei, Streptococcus gordonii, Streptococcus infantis, Streptococcus intermedius, Streptococcus lactarius, Streptococcus mitis, Streptococcus mutans, Streptococcus oligofermentans, Streptococcus oralis, Streptococcus parasanguinis, Streptococcus peroris, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus salivarius, Streptococcus sanguinis, Streptococcus sinensis, Streptococcus sobrinus, Streptococcus sp., Streptococcus tigurinus, Streptococcus vestibularis, Syntrophomonadaceae sp., Tannerella forsythia, Tannerella sp., Treponema amylovorum, Treponema denticola, Treponema lecithinolyticum, Treponema maltophilum, Treponema medium, Treponema pallidum, Treponema parvum, Treponema pectinovorum, Treponema putidum, Treponema socranskii subsp. buccale, Treponema sp., Treponema vincentii, Turicella otitidis, Variovorax paradoxus, Veillonella atypica, Veillonella denticariosi, Veillonella dispar, Veillonella parvula, Veillonella rogosae, Veillonella sp., and Yersinia pestis may be at least one species selected from the group consisting of.
[0018] In the method of the present invention, at least one selected from the group consisting of the following primer sets may be used: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene; and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene; and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, SEQ ID NOs. 15-16, and SEQ ID NOs. 17-18, targeting the RNA polymerase β subunit gene; and - flagellar hook Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the protein gene; (3) For Tannerella forsythia: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene; Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, SEQ ID NOs. 33-34, SEQ ID NOs. 35-36, SEQ ID NOs. 37-38, SEQ ID NOs. 39-40, and SEQ ID NOs. 41-42, targeting the Surface layer protein gene; A primer set consisting of nucleic acid sequences 43-44,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, targeting the sortase A gene, and (5) Targeting the 16S rRNA gene of oral bacteria, A primer set consisting of sequence numbers 67-73, or a primer set consisting of degenerate primer sequences 74-75.
[0019] Furthermore, the present invention provides a method for evaluating the severity of periodontal disease and / or caries, comprising one or more steps: (1) using the method described above to detect genes of causative bacteria of periodontal disease or caries in supragingival or subgingival plaque or saliva; (2) using a gene amplification method to detect genes of total oral bacteria; and (3) calculating the ratio of the detected value of the causative bacteria's genes to the detected value of the total oral bacteria's genes, or the ratio of the number of causative bacteria to the total number of oral bacteria, to evaluate the severity of periodontal disease and / or caries.
[0020] In the evaluation method of the present invention, the gene amplification method may be the PCR method.
[0021] In the evaluation method of the present invention, the PCR method may be a fluorescence PCR method or an EIS-PCR method.
[0022] In the evaluation method of the present invention, the total number of oral bacteria may be detected by gene amplification using a primer that targets the 16S rRNA gene of oral bacteria.
[0023] In the evaluation method of the present invention, the primer set of primers targeting the 16S rRNA gene of oral bacteria may be: (1) a primer set consisting of sequence numbers 67 to 73, or (2) a primer set of degenerate primer sequences consisting of sequence numbers 74 to 75.
[0024] In the evaluation method of the present invention, detection may be performed using a primer set with an optimized formulation ratio that targets the genes of oral bacteria.
[0025] In the evaluation method of the present invention, when the nucleic acid sequence of SEQ ID NO: 67 is used as forward primer A, the nucleic acid sequence of SEQ ID NO: 68 as forward primer B, the nucleic acid sequence of SEQ ID NO: 69 as forward primer C, the nucleic acid sequence of SEQ ID NO: 70 as forward primer D, the nucleic acid sequence of SEQ ID NO: 71 as forward primer E, the nucleic acid sequence of SEQ ID NO: 72 as reverse primer F, and the nucleic acid sequence of SEQ ID NO: 73 as reverse primer G, the ratio of forward primers A:B:C:D:E is approximately 72:177:173:121:334, and the ratio of reverse primers F:G is approximately 58:335, the 16S rRNA gene of oral bacteria may be detected.
[0026] Furthermore, the present invention provides at least one primer set selected from the group consisting of the following gene amplification primer sets for detecting genes of periodontal disease or caries-causing bacteria or oral bacteria in supragingival or subgingival plaque or saliva using a gene amplification method: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene as the target gene, and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene, and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, targeting the RNA polymerase β subunit gene as the target gene, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 15-16, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 17-18, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the flagellar hook protein gene as the target gene, and (3) For Tannerella forsythia: - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene as the target gene, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, and SEQ ID NOs. 33-34, targeting the Surface layer protein gene as the target gene, A primer set consisting of nucleic acid sequences of SEQ ID NOs. 35-36, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 37-38, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 39-40,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 41-42, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 43-44, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, and, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 65-66, and, (5) A primer set consisting of sequence numbers 67-73 and sequence numbers 74-75, targeting the 16S rRNA gene of oral bacteria.
[0027] In the primer set of the present invention, the gene amplification method may be PCR.
[0028] Furthermore, the present invention provides a kit comprising one or more of the primer sets for detecting periodontal disease or caries-causing bacteria, or genes of oral bacteria, in supragingival or subgingival plaque or saliva.
[0029] The kit of the present invention may be a kit for detecting the genes of the causative bacteria or oral bacteria in a sample, which uses the EIS-PCR method and includes a mediator, which is an electron transfer substance for electrochemically detecting the sample, in a PCR reaction composition.
[0030] The present invention provides a simple, efficient, and rapid method for bacterial gene testing in clinical settings, a gene amplification method for specifically detecting and evaluating bacteria associated with periodontal disease or caries, or for detecting the proportion of bacteria associated with periodontal disease or caries to the total number of oral bacteria and evaluating the severity of periodontal disease or caries, as well as a primer set for gene amplification reactions, and a kit for detecting the genes of causative bacteria of periodontal disease or caries and a kit for evaluating the severity of periodontal disease or caries, including the same.
[0031] This graph shows that when five types of forward primers (SEQ ID NOs. 67-71) and two types of reverse primers (SEQ ID NOs. 72-73) are mixed according to oral bacterial cell ratios (solid line), the Ct value (cycle threshold) is smaller than when they are mixed in equal ratios (dashed line). The vertical axis represents fluorescence intensity (dimensionless), and the horizontal axis represents the number of PCR cycles. The two plots where the PCR cycle count rises from around 21 (370 pg target genomic DNA) are oral bacterial samples derived from human specimens, while the two plots where the PCR cycle count rises from around 29 are bacterial samples (3 pg purified genomic DNA of four bacterial species mixed: Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, and Streptococcus mutans). This is an agarose gel electrophoresis image showing that no nonspecific gene amplification is observed with combinations of five forward primers (SEQ ID NOs. 67-71) and two reverse primers (SEQ ID NOs. 72-73). This is a |Z|Real graph of Porphyromonas gingivalis (gingipain gene) in EIS-PCR. This is a Δ|Z| graph of Porphyromonas gingivalis (gingipain gene) in EIS-PCR. This is a |Z|Real graph of Treponema denticola (flagellar hook protein gene) in EIS-PCR. This is a Δ|Z| graph of Treponema denticola (flagellar hook protein gene) in EIS-PCR. This is a graph of |Z|Real for Tannerella forsythia (Surface layer protein gene) in EIS-PCR. This is a graph of Δ|Z| for Tannerella forsythia (Surface layer protein gene) in EIS-PCR. This is a graph of |Z|Real for Streptococcus mutans (glycosyltransferase gene) in EIS-PCR. This is a graph of Δ|Z| for Streptococcus mutans (glycosyltransferase gene) in EIS-PCR. This is a graph of |Z|Real for oral bacteria (16S rRNA gene) in EIS-PCR.This is a graph of Δ|Z| for oral bacteria (16S rRNA gene) in EIS-PCR. This is a graph of fluorescence intensity (370 pg human oral bacteria sample) in fluorescence PCR. This is a graph of Δ fluorescence intensity (370 pg human oral bacteria sample) in fluorescence PCR. This is a graph of fluorescence intensity (3 pg of purified genomic DNA of 4 bacterial species) in fluorescence PCR. This is a graph of Δ fluorescence intensity (3 pg of purified genomic DNA of 4 bacterial species) in fluorescence PCR. |Z|Real (copy number: 10) by EIS-PCR. 4 This is a graph of Δ|Z| (copy number: 10) obtained by EIS-PCR. 4 This is a graph of |Z|Real (copy number: 10) obtained by EIS-PCR. 2 This is a graph of Δ|Z| (copy number: 10) obtained by EIS-PCR. 2 This is a graph of ).
[0032] The outline of the present invention is described below.
[0033] The present invention provides a means for specifically detecting one or more periodontal disease bacteria selected from the group consisting of Porphyromonas gingivalis (Pg), Treponema denticola (Td), and Tannerella forsythia (Tf), which are representative causative bacteria of periodontal disease (collectively referred to as the "Red Complex"), as well as Streptococcus mutans (Sm), known as a caries (dental caries) bacterium, and oral bacteria, a group of primer sets for carrying out the method, and a kit for detecting the genes of causative bacteria of periodontal disease or caries in supragingival or subgingival plaque or saliva, including the primer set.
[0034] The present invention selects genes possessed by Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, known as the red complex which is the causative bacterium of periodontal disease with high malignancy, Streptococcus mutans known as the causative bacterium of dental caries, and oral bacteria having a 16S rRNA gene, respectively, and designs a primer set targeting these genes.
[0035] In the detection of total oral bacteria, it is common to use the PCR method with the highly homologous 16S rRNA gene as the target gene. However, when the 16S rRNA gene is used as the target gene, it has been found that non-specific amplification reactions often occur and amplification bias occurs among bacteria. While universal primers that are as leak-free as possible among bacteria are used, since the sequences of the 16S rRNA genes differ among bacteria, the annealing temperature is not constant, and it was necessary to individually select the temperature according to the primers used. Furthermore, in the amplification reaction using existing universal primers, only PCR products with a long chain length could be obtained. The disadvantage was that it took a long time for the extension reaction to amplify PCR products with a long chain length, making it unsuitable for rapid analysis.
[0036] The smaller the number of base pairs, the faster the PCR can be performed. Therefore, in the present invention, although the primer group for amplifying oral bacteria targets the 16S rRNA gene, the time for the extension reaction is shortened by using a sequence that generates short double-stranded DNA with a PCR product of 500 base pairs or less, more preferably 100 base pairs or less. For this reason, a primer pair targeting a gene site different from the existing gene region was newly designed to solve the problem.
[0037] The present invention also includes those related to a primer set specialized for the detection of oral bacteria, and high-efficiency amplification was achieved by formulating primers according to the ratio of known oral bacterial species at different concentrations.
[0038] Specifically, when using the nucleic acid sequence of SEQ ID NO: 67 as forward primer A, the nucleic acid sequence of SEQ ID NO: 68 as forward primer B, the nucleic acid sequence of SEQ ID NO: 69 as forward primer C, the nucleic acid sequence of SEQ ID NO: 70 as forward primer D, the nucleic acid sequence of SEQ ID NO: 71 as forward primer E, the nucleic acid sequence of SEQ ID NO: 72 as reverse primer F, and the nucleic acid sequence of SEQ ID NO: 73 as reverse primer G, the forward primers A:B:C:D:E are approximately 72:177:173:121:334, and the reverse primers F:G are in a mixing ratio of approximately 58:335 to quantify the 16S rRNA gene of oral bacteria.
[0039] In the present specification, "approximately" refers to a numerical value within the range of ±20% of each subsequent numerical value, preferably within the range of ±10%, more preferably within the range of ±5%, still more preferably within the range of ±3%, and most preferably within the range of ±1%.
[0040] The designed primers for Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, Streptococcus mutans, and the 16S rRNA gene of oral bacteria are sequences that can perform annealing and extension reactions at the same temperature, and the primer sequences were determined so that a PCR product of 500 base pairs or less, particularly preferably 100 base pairs or less, could be obtained.
[0041] Normal PCR is performed in the "three steps" of a denaturation step, an annealing step, and an extension step. However, according to the present invention, since annealing and extension reactions can be performed at the same temperature, it can be made into the "two steps" of a denaturation step and an annealing & extension step, so the time required for PCR can be shortened.
[0042] When real-time PCR was performed using each designed primer with genomic DNA as a template, a correlation was confirmed between the Ct value calculated from the growth curve according to the amount of template genomic DNA and the amount of template genomic DNA, thus completing the present invention.
[0043] Furthermore, it has been found that the primer set that solves the problems of the present invention can also be used in the EIS-PCR method. It can be applied to methods other than existing real-time PCR methods. The EIS-PCR method can be carried out according to the method of Yamashita Ichiro et al. (Japanese Patent Publication No. 6803629, Japanese Patent Application No. 2013-207786). In short, the detection of a target substance present in a solution is achieved by measuring impedance using the EIS method, wherein the solution contains at least the target substance, an impedance observation substance A, and a substance B that alters the charge transfer properties of the impedance observation substance A, and the substance B that alters the charge transfer properties has the property of being incorporated into the target substance.Therefore, the present invention provides a kit for detecting microorganisms in a sample using the EIS-PCR method, which includes a mediator, which is an electron transfer substance for electrochemically detecting the sample, in a PCR reaction composition.
[0044] The embodiments of the present invention will be described in detail below for each form.
[0045] 1. Detection Method One embodiment of the present invention is a method for detecting oral bacteria or causative bacteria of periodontal disease or caries by detecting the genes of oral bacteria or causative bacteria of periodontal disease or caries in supragingival or subgingival plaque or saliva using a gene amplification method.
[0046] The detection method of the present invention is characterized by (1) carrying out the annealing and extension reactions in the gene amplification method at substantially the same temperature, and / or (2) having a short gene length as the amplification product of the target gene.
[0047] In this specification, "detection" refers not only to detection in the narrow sense, which involves measuring whether or not a target gene is present in a sample, but also to quantifying the copy number or bacterial count of the target gene in the sample. For example, when detecting a target gene in a sample using the PCR method, the presence or absence of the target gene in the sample can be determined by the Ct (Cycle threshold) value being smaller than the Ct value when the target gene is not present. Furthermore, when quantifying the number of bacteria possessing the target gene, a calibration curve can be created in advance by determining the Ct value of a standard sample with a known bacterial concentration, for example, using the PCR method, and then determining the relationship between the bacterial concentration and the Ct value. Next, the Ct value of a sample with an unknown bacterial concentration is measured, and this Ct value is applied to the calibration curve to determine the number of bacteria in the sample.
[0048] Furthermore, an example of the gene amplification method mentioned above is the polymerase chain reaction (hereinafter also referred to as "PCR") method.
[0049] Examples of the aforementioned PCR method include fluorescence PCR or EIS (Electrochemical Impedance Spectroscopy)-PCR.
[0050] In this specification, fluorescence PCR refers to a method of measuring a target gene by measuring the fluorescence emitted when a fluorescent probe or fluorescent reagent binds to the amplified target gene. An example of fluorescence PCR is real-time PCR.
[0051] Real-time PCR methods include those using fluorescently labeled probes and those using fluorescent reagents, depending on the method of detecting the gene amplification product. Methods using fluorescently labeled probes include the TaqMan method, molecular beacon method, and cycling probe method, which use the TaqMan probe, molecular beacon probe, and cycling probe, respectively. Methods using fluorescent reagents include the intercalator method, in which an intercalator such as SYBR Green I, a compound that emits fluorescence when it binds to double-stranded DNA along with a primer pair, is added to the PCR reaction system, but the TaqMan method is preferred.
[0052] Examples of the gene amplification methods mentioned above include, in addition to the PCR method, the SDA method (strand dispersion amplification), LAMP method (loop-mediated isothermal amplification), ICAN method (isothermal and chemeric primer-initiated amplification of nuclear acids), NASBA method (nucleic acid sequence-based amplification), TMA method (transcription-mediated amplification), and TRC method (transcription-reverse). Methods such as transcription-concerted (Transcription Concerned) are examples. In these methods as well, primers are used in the process leading up to the start of the amplification cycle. Although there are characteristics in the enzymes and primer structures that can be used in each amplification method, gene amplification starts from a single-stranded DNA of 20 to 40 bases regardless of the method used. Therefore, regardless of which nucleic acid amplification method is employed, it is essential to design primers with sequences complementary to the target gene.
[0053] In the method of the present invention, the gene length of the target gene is 500 bp or less, and is particularly preferably a short-chain gene of 100 bp or less.
[0054] Furthermore, the method of the present invention is a method for detecting microorganisms contained in a sample, wherein the primer set described below uses the DNA region of a gene encoding at least one gene selected from the causative bacteria of periodontal disease or caries and the group of microorganisms involved in oral bacteria, and is capable of forming a sequence-specific complementary strand to said DNA region.
[0055] In the method of the present invention, the example of the causative bacteria of periodontal disease is one or more periodontal disease bacteria selected from the group consisting of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia; the example of the causative bacteria of dental caries is Streptococcus mutans; and the example of oral bacteria is a bacterium having a 16S rRNA gene.
[0056] Examples of bacteria possessing the 16S rRNA gene include at least one selected from the group consisting of oral bacteria listed in the above [Means for Solving the Problem].
[0057] The specimen is not particularly limited as long as it is a biological sample that may contain the periodontal disease causative bacteria Porphyromonas gingivalis, Treponema denticola, or Tannerella forsythia, or the caries causative bacteria Streptococcus mutans, or oral bacteria. Typical examples include saliva, plaque (supragingival plaque and / or subgingival plaque), tongue coating, and gingival crevicular exudate collected from the oral cavity of the subject. Saliva can be spit out or gargled with water. Plaque can be collected by brushing the tooth surface with a dental scaler, brush, or cotton swab, or by inserting a paper point. Tongue coating can be collected with a brush, cotton swab, or gauze. Gingival crevicular exudate can be collected by inserting a paper point into the gingival crevicular sulcus.
[0058] DNA extraction from the above-mentioned samples can be carried out using the same methods as for the preparation of conventional genomic DNA. For example, it can be performed using conventional methods such as the SDS method, phenol method, or ethanol method, or by using an automated DNA extraction machine, from samples such as saliva or plaque on paper points.
[0059] Next, the extracted DNA is used as a template, and PCR amplification is performed using the primer set of the present invention described below. The PCR amplification is not particularly limited except for the use of the aforementioned primer set and the ability to perform the annealing and extension reactions at the same temperature, which is one of the features of the present invention; it can be performed according to conventional methods. Specifically, the base sequence characteristic of the causative bacteria of periodontal disease or caries, or oral bacteria, is amplified by repeating a cycle that includes denaturation of the template DNA, annealing of the template to the primer, and extension of the primer using a heat-resistant enzyme (DNA polymerase such as Taq polymerase or Tth DNA polymerase derived from Thermus themophilis). The composition of the PCR solution (amount of template DNA, type of buffer, primer concentration, type and concentration of DNA polymerase, dNTP concentration, etc.) and PCR reaction conditions (temperature cycle, number of cycles, etc.) can be appropriately selected and set by those skilled in the art.
[0060] In the method of the present invention, at least one primer set selected from the group consisting of the following primer sets can be used: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene as the target gene; and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene; and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, SEQ ID NOs. 15-16, and SEQ ID NOs. 17-18, targeting the RNA polymerase β subunit gene as the target gene; and - flagellar hook Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the protein gene; (3) For Tannerella forsythia: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene; Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, SEQ ID NOs. 33-34, SEQ ID NOs. 35-36, SEQ ID NOs. 37-38, SEQ ID NOs. 39-40, and SEQ ID NOs. 41-42, targeting the Surface layer protein gene; A primer set consisting of nucleic acid sequences 43-44,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, targeting the sortase A gene, and (5) Targeting the 16S rRNA gene of oral bacteria, A primer set consisting of sequence numbers 67-73, or a primer set consisting of degenerate primer sequences 74-75.
[0061] The primers used in the method of the present invention can be synthesized using any standard oligonucleotide synthesis method known to those skilled in the art. For example, it can be performed using a solid-phase synthesis method (phosphoamidite method) with a DNA synthesizer.
[0062] In the detection method of the present invention, in order to quantify periodontal disease bacteria, a strain of the periodontal disease bacteria to be detected may be used as a standard, or a standard DNA such as a plasmid containing a gene fragment amplified by the primer set of the present invention may be used as a standard. However, it is preferable to use standard DNA in terms of ease of handling and preservation. The plasmid used as standard DNA (standard plasmid) may be any plasmid containing at least one gene fragment amplified by the primer set of the present invention corresponding to the periodontal disease bacteria to be detected, but a plasmid containing a gene fragment amplified by the above primer set is preferred. Specifically, a calibration curve can be obtained using two or more dilution series of standard plasmids, and the number of periodontal disease bacteria in the sample can be quantified by quantifying the copy number of the gene DNA fragment of the caries or periodontal disease causative bacteria to be detected from the obtained calibration curve.
[0063] 2. Method for evaluating the severity of periodontal disease and / or dental caries Another embodiment of the present invention is a method for evaluating the severity of periodontal disease and / or dental caries.
[0064] The present invention provides a method for evaluating the severity of periodontal disease and / or caries, comprising one or more of the following steps: (1) using the detection method described above to quantify the genes of causative bacteria of periodontal disease or caries in supragingival or subgingival plaque or saliva; (2) using a gene amplification method to detect the genes of total oral bacteria or to quantify the total number of oral bacteria; and (3) calculating the ratio of the detected value of the genes of the causative bacteria to the detected value of the genes of the total oral bacteria, or the ratio of the number of causative bacteria to the total number of oral bacteria, and evaluating the severity of periodontal disease and / or caries.
[0065] An example of the gene amplification method is the PCR method. An example of the PCR method is the fluorescence PCR method or the EIS-PCR method.
[0066] As an example of measuring the total number of oral bacteria, detection can be performed using a gene amplification method with a primer set that targets the 16S rRNA gene of oral bacteria.
[0067] Examples of primer sets targeting the 16S rRNA gene of oral bacteria include: (1) a primer set consisting of sequence numbers 67-73, or (2) a primer set of degenerate primer sequences consisting of sequence numbers 74-75.
[0068] Furthermore, as an example of a primer set with an optimized formulation ratio that targets the genes of oral bacteria, as shown in the example below, the severity of caries or periodontal disease can be evaluated by detecting oral bacteria using a primer set that targets the 16S rRNA gene of oral bacteria.
[0069] As a specific example of a primer set formulation, when the nucleic acid sequence of SEQ ID NO: 67 is used as forward primer A, the nucleic acid sequence of SEQ ID NO: 68 as forward primer B, the nucleic acid sequence of SEQ ID NO: 69 as forward primer C, the nucleic acid sequence of SEQ ID NO: 70 as forward primer D, the nucleic acid sequence of SEQ ID NO: 71 as forward primer E, the nucleic acid sequence of SEQ ID NO: 72 as reverse primer F, and the nucleic acid sequence of SEQ ID NO: 73 as reverse primer G, the ratio of forward primers A:B:C:D:E is approximately 72:177:173:121:334, and the ratio of reverse primers F:G is approximately 58:335, the severity of dental caries or periodontal disease can be evaluated by detecting the 16S rRNA gene of oral bacteria with this formulation.
[0070] 3. Primer Set Another embodiment of the present invention is a primer set.
[0071] Specific examples include at least one primer set selected from the group consisting of the following gene amplification primer sets for detecting the genes of periodontal disease or caries-causing bacteria or oral bacteria in supragingival or subgingival plaque or saliva using gene amplification methods: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene as the target gene, and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene, and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, targeting the RNA polymerase β subunit gene as the target gene, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 15-16, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 17-18, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the flagellar hook protein gene as the target gene, and (3) For Tannerella forsythia: - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene as the target gene, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, and SEQ ID NOs. 33-34, targeting the Surface layer protein gene as the target gene, A primer set consisting of nucleic acid sequences of SEQ ID NOs. 35-36, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 37-38, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 39-40,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 41-42, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 43-44, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, and, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 65-66, and, (5) A primer set consisting of sequence numbers 67-73 and sequence numbers 74-75, targeting the 16S rRNA gene of oral bacteria.
[0072] The primers used in this invention can be synthesized using any standard oligonucleotide synthesis method known to those skilled in the art. For example, it can be performed using a solid-phase synthesis method (phosphoamidite method) with a DNA synthesizer.
[0073] In the invention of the primer set of the present invention, the PCR method can be cited as an example of the gene amplification method.
[0074] 4. Kit Another embodiment of the present invention is a kit.
[0075] Specifically, the kit includes one or more of the aforementioned primer sets and is for detecting periodontal disease or caries-causing bacteria, or genes of oral bacteria, in supragingival or subgingival plaque or saliva.
[0076] Furthermore, the kit of the present invention may also include, as a standard DNA for quantifying the number of causative bacteria of dental caries or periodontal disease, a plasmid containing the gene of the causative bacteria to be detected or the target region of the 16S rRNA gene of oral bacteria, which is amplified by the primer set of the present invention. Specifically, the standard DNA may include at least one, preferably all four, gene fragments that are amplified by the primer set of the present invention established for Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, or Streptococcus mutans. In addition to the primer set and standard DNA, the kit of the present invention may also include, as necessary, molecular weight markers usable for gene amplification and confirmation of amplification products, DNA extraction reagents, PCR reagents such as PCR buffer and DNA polymerase, labeling substances, sterile water, standards (standard bacterial strains, etc.), instructions, etc.
[0077] Furthermore, an example of a kit of the present invention is a kit for detecting the genes of the causative bacteria or oral bacteria in a sample, which uses the EIS-PCR method and includes a mediator, which is an electron transfer substance for electrochemically detecting the sample, in the PCR reaction composition.
[0078] The present invention will be described in more detail below with reference to examples, but may be modified as appropriate without departing from the spirit of the invention. Accordingly, the scope of the present invention should not be interpreted as being limited by the specific examples shown below.
[0079] In the following examples, the preparation of genomic DNA, PCR, etc., can be carried out using methods well known and commonly used by those skilled in the art. For example, see Molecular Cloning: a Laboratory Manual, 4th ed. (Michael R. Green and Joseph Sambrook), etc.
[0080] Template DNA: Genomic DNA of oral bacteria was extracted from human saliva. Purification was performed using the Saliva DNA Isolation Kit (RU45400, Norgen Biotek Corp.). The purified genomic DNA was dissolved in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) buffer. In addition, Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tannerella forsythia (Tf), and Streptococcus mutans (Sm) were obtained from the RIKEN BioResource Research Center (BRC), and their genomic DNA was purified using a commercially available kit (QIAamp DNA Microbiome Kit, Qiagen). The purified genomic DNA was dissolved in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) buffer.
[0081] A reaction solution was prepared by mixing PCR-purified genomic DNA (Pg: 0.5 ng, Td: 0.05 ng, Tf: 0.3 ng, Sm: 0.5 ng), DNA polymerase derived from thermophilic bacteria (Taq DNA polymerase (1 unit)), reaction buffer (final concentration: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 6.5 mM MgCl2), 1 mM potassium ferricyanide (potassium hexacyanoferrate(III)), 1 mM potassium ferrocyanide (potassium hexacyanoferrate(II) acetate), SYBR Gold (×0.5 to ×1) or SYTOX Green analog (50 to 500 nM), and primers described later (10 pmol forward primer, 10 pmol reverse primer).
[0082] PCR was performed using either a CronoSTAR 96 Real-Time PCR System (Clonetech) or an EIS-PCR device (see Japanese Patent Publication No. 6803629). The PCR reaction conditions were 98°C for 15 seconds, followed by 96°C for 5 seconds, and then 68°C for 10 seconds, repeated for 40 cycles. After the PCR reaction was complete, the reaction solution was stored at 4°C.
[0083] To confirm amplification by PCR, the presence or absence of PCR products was checked by agarose gel electrophoresis. Agarose X (Wako Pure Chemical Industries) was added to a TBE (89 mM Tris, 89 mM borate, 2 mM EDTA) solution to a concentration of 4% (w / v), and the agarose was dissolved in a microwave oven to prepare an agarose gel for electrophoresis. Electrophoresis was performed using a MUPID electrophoresis apparatus (Cosmo Bio). MaestroSafe nucleic acid loading dye (Gellex International) was added to each sample, and electrophoresis was performed. After electrophoresis was completed, the agarose gel was transferred to a transilluminator and photographs were taken.
[0084] Primer design and synthesis were carried out as follows: The nucleotide sequence information of the target gene was searched using the nucleotide sequence database GenBank (National Center for Biotechnology Information: NCB). From the obtained nucleotide sequences, primer sequences were obtained using the primer design tool Primer-BLAST (NCBI) program. Subsequently, the GC content, melting temperature (Tm), secondary structure between each oligo, and possible duplex structure of each primer sequence were predicted using a primer dimer analysis tool. Furthermore, the primers were manually moved back and forth by approximately ±10 nucleotides on the target gene sequence to confirm that there were no complementary sequences within or between the primers, and then optimized. Specific amplification was confirmed using the NCBI BLAST search. Primer synthesis was commissioned to Thermo Fisher Scientific or FASMAC. The target genes and primer sequences used in this invention are shown below for each bacterium.
[0085] In Porphyromonas gingivalis, the RNA polymerase β subunit gene and the gingipain gene were targeted. The primer sequences for amplifying partial sequences of each gene are as follows:
[0086] RNA polymerase β subunit gene forward primer: ACTTCCTTCAGTTAGATACTCCGCCCGAGAG (SEQ ID NO: 1) Reverse primer: GTCGCAAAATCTTCGTGATCAGGATCCGTAC (SEQ ID NO: 2) (PCR product: 244 bp) Forward primer: CCTTCAGTTAGATACTCCGCCCG (SEQ ID NO: 3) Reverse primer: GGTGAGCCCCCTGCTAAGAC (SEQ ID NO: 4) (PCR product: 172 bp) Forward primer: CAACTCAAGTCGTTCCATGACTTCCTTCAGTTAG (SEQ ID NO: 5) Reverse primer: GCTCCATTTATAACAAATGTGCCGGAACTTG (SEQ ID NO: 6) (PCR product: 330 bp) Forward primer: CAAGTCGTTCCATGACTTCCTTCAGTTAG (SEQ ID NO: 7) Reverse primer: CCATTTATAACAAATGTGCCGGAACTTG (SEQ ID NO: 8) (PCR product: 330 bp)
[0087] Gingipain gene forward primer: TGGCGGTCAGCGACGGATCTGCCCAT (SEQ ID NO: 9) Reverse primer: CGGTGTCGGCTTTGCCAACTATACAGCGCA (SEQ ID NO: 10) (PCR product: 72 bp)
[0088] In Treponema denticola, the RNA polymerase β subunit gene and the flagellar hook protein gene were targeted. The primer sequences for amplifying partial sequences of each gene are as follows:
[0089] RNA polymerase β subunit gene forward primer: GCTCCCTATGTAAAGGTTGTAAACGGGGTTGCTAC (SEQ ID NO: 11) Reverse primer: CCCGAATCATAGGCGCACTTTTTTTCCATACC (SEQ ID NO: 12) (PCR product: 374 bp) Forward primer: GGCCAGATTTTGGAATCGGAGCTGGG (SEQ ID NO: 13) Reverse primer: GTTTTCAAAGAGGCGGCCGGTTAAGC (SEQ ID NO: 14) (PCR product: 180 bp) Forward primer: GATGTCTATGTAAAGGGTGAAGACGGC (SEQ ID NO: 15) Reverse primer: CCTTTCACGTCATCGGAATAGTCG (SEQ ID NO: 16) (PCR product: 401 bp) Forward primer: CCAGAGATGTCTATGTAAAGGGTGAAGACGGC (SEQ ID NO: 17) Reverse primer: GGTTGTACCTTTCACGTCATCGGAATAGTCG (SEQ ID NO: 18) (PCR product: 413 bp)
[0090] Flagellar hook protein gene forward primer: TGCCCGAAGGAGCAAACCGGGCTCA (SEQ ID NO: 19) Reverse primer: AGCTCGTGGGCTTCACCGAAGCTGT (SEQ ID NO: 20) (PCR product: 91 bp) Forward primer: CGGGGAAGTAAATGCTTGGCGGGCAACCGTAAATG (SEQ ID NO: 21) Reverse primer: CTTGTGGGAGCTCCGGCTTCATCAGGGTTTG (SEQ ID NO: 22) (PCR product: 252 bp) Forward primer: CAGCTCGTGGGCTTCACCGAAGCTGTC (SEQ ID NO: 23) Reverse primer: TGCCCGAAGGAGCAAACCGGGCTCAAA (SEQ ID NO: 24) (PCR product: 92 bp) Forward primer: GCTCCGGCTTCATCAGGGTTTGCGCCTA (SEQ ID NO: 25) Reverse primer: CGTAACGTCTCCCGCAGGGCAAGTTTTGGT (SEQ ID NO: 26) (PCR product: 78 bp)
[0091] In Tannerella forsythia, the RNA polymerase β subunit gene and the surface layer protein gene were targeted. The primer sequences for amplifying the partial sequences of each gene are as follows:
[0092] RNA polymerase β subunit gene forward primer: GTCACGTACTTCCTGAAGCTGGGACAC (SEQ ID NO: 27) Reverse primer: CCCGGTTTAGGCATATTCTCTCCTTTCACAATC (SEQ ID NO: 28) (PCR product: 269 bp) Forward primer: GGACCGATACCTTATATGACTGATCGG (SEQ ID NO: 29) Reverse primer: GGATACTGTCTTCGCTTAATTCCGC (SEQ ID NO: 30) (PCR product: 481 bp)
[0093] Surface layer protein gene forward primer: TCTGGGCTGCCCGGTTTGCGGTGA (SEQ ID NO: 31) Reverse primer: CGTCCGGATGTCCGGCCAAGCGAG (SEQ ID NO: 32) (PCR product: 107 bp) Forward primer: CCGTGGCCCGGAGTTATCCCGCT (SEQ ID NO: 33) Reverse primer: ACTCGGAACCCGAGGTCCGGGAGTG (SEQ ID NO: 34) (PCR product: 153 bp) Forward primer: CACTCCCGGACCTCGGGTTCCGAGT (SEQ ID NO: 35) Reverse primer: TCGTGACACACCACAGACCGGCTGCAC (SEQ ID NO: 36) (PCR product: 86 bp) Forward primer: TGCAGCCGGTCTGTGGTGTGTCACG (SEQ ID NO: 37) Reverse primer: CAGCCGTCGACATCCTTCGGCCAGC (SEQ ID NO: 38) (PCR product: 144 bp) Forward primer: TGCAGCCGGTCTGTGGTGTGTCACG (SEQ ID NO: 39) Reverse primer: GCGGACGGCCGCCTTTCACGCCTGT (SEQ ID NO: 40) (PCR product: 257 bp) Forward primer: TGCCAAAGCGGATGCAGGTACGCCGAA (SEQ ID NO: 41) Reverse primer: ACACCAAGCGGTTCCAAGCCGTACCCC (SEQ ID NO: 42) (PCR product: 70 bp) Forward primer: GCCGCGGTGCGTATACCGACTGGATTG (SEQ ID NO: 43) Reverse primer: CGCTTCGGCATTGGCCAGCGGAGACTTC (SEQ ID NO: 44) (PCR product: 89 bp) Forward primer: GGGCTGCCCGGTTTGCGGTGAAGATCA (SEQ ID NO: 45) Reverse primer: CGGATGTCCGGCCAAGCGAGCCGAATC (SEQ ID NO: 46) (PCR product: 100 bp) Forward primer: GCGCGACCCTTTTACGGGGATGCGGTT (SEQ ID NO: 47) Reverse primer: CCGGTCCGGTAGCGGTTTGCAGCGTTA (SEQ ID NO: 48) (PCR product: 100 bp)
[0094] In Streptococcus mutans, the glycosyltransferase gene and the sortase A gene were targeted. The primer sequences for amplifying partial sequences of each gene are as follows:
[0095] Glycosyltransferase gene forward primer: GCGAGAAAACAAATTTCCACAGGGGTTCCG (SEQ ID NO: 49) Reverse primer: CTTTAAGACATAGCCTGCTCCGCGCC (SEQ ID NO: 50) (PCR product: 122 bp) Forward primer: GCGAGAAAACAAATTTCCACAGGGGTTCCG (SEQ ID NO: 51) Reverse primer: AACACCGTTAATTGATTGAGCACCAGTGACC (SEQ ID NO: 52) (PCR product: 357 bp) Forward primer: CAAATTTCCACAGGGGTTCCG (SEQ ID NO: 53) Reverse primer: CACCGTTAATTGATTGAGCACCAGTG (SEQ ID NO: 54) (PCR product: 347 bp) Forward primer: GCGAGAAAACAAATTTCCACAGGGGTTC (SEQ ID NO: 55) Forward primer: CAAATTTCCACAGGGGTTCCGATGG (SEQ ID NO: 56) Reverse primer: CACCGTTAATTGATTGAGCACCAGTGACC (SEQ ID NO: 57) Reverse primer: GTTATTGATTGAGCACCAGTGACCATATAACCG (SEQ ID NO: 58) (PCR product (SEQ ID NO: 55 / 57): 355 bp) (PCR product (SEQ ID NO: 55 / 58): 351 bp) (PCR product (SEQ ID NO: 56 / 57): 346 bp) (PCR product (SEQ ID NO: 56 / 58): 342 bp) Forward primer: AGCGGCAGCTGATAACACTCAAGCAGCACA (SEQ ID NO: 59) Reverse primer: CTGCCGCTGCTGCACTTGCTGCCCAT (SEQ ID NO: 60) (PCR product: 275 bp) Forward primer: ACCCGTTTGACTGGTTGGTGTGCGGTTCA (SEQ ID NO: 61) Reverse primer: CGCAGCAAACCCAGTGGCTGCGTGAT (SEQ ID NO: 62) (PCR product: 206 bp) Forward primer: GAGCTTCCCAGTGTTGTGGAGCCCAAGGT (SEQ ID NO: 63) Reverse primer: GCACTGGGTAACCGTTGCTGTCGCTTCTGG (SEQ ID NO: 64) (PCR product: 66 bp)
[0096] Sortase A gene forward primer: AGAAGGATATTGAACGCAACAAGGCTGCC (SEQ ID NO: 65) Reverse primer: GCTTCTGGGCAGCCATTTGTGCTGC (SEQ ID NO: 66) (PCR product: 108 bp)
[0097] The primer sequences for amplifying the partial sequence of the 16S rRNA gene used for detecting oral bacteria are as follows:
[0098] Primer sequences for amplifying partial sequences of the 16S rRNA gene for oral bacteria detection: Forward primer A: AGGTGCTGCATGGCTGTCGTCAGCTCGTGC (SEQ ID NO: 67) Forward primer B: AGGTGCTGCATGGCTGTCGTCAGCTCGTGT (SEQ ID NO: 68) Forward primer C: AGGTGCTGCATGGTTGTCGTCAGCTCGTGC (SEQ ID NO: 69) Forward primer D: AGGTGGTGCATGGCTGTCGTCAGCTCGTGT (SEQ ID NO: 70) Forward primer E: AGGTGGTGCATGGTTGTCGTCAGCTCGTGT (SEQ ID NO: 71) Reverse primer F: GGGTTGCGCTCGTTATGGCACTTAAGCC (SEQ ID NO: 72) Reverse primer G: GGGTTGCGCTCGTTGCGGGACTTAACCC (SEQ ID NO: 73)
[0099] The method for determining primer sequences to amplify partial sequences of 16S rRNA genes for detecting oral bacteria was as follows. First, the 16S rRNA gene sequences of 1015 types of oral bacteria registered in the Human Oral Microbiome Database (Database URL: http: / / www.homd.org) were obtained. Alignment analysis was performed on the obtained 16S rRNA genes of oral bacteria using the genetic information processing software GENETYX to obtain consensus sequences. From the consensus sequences, gene regions that enable amplification of particularly desirable short-chain DNA of 100 bp or less were selected, and the following degenerate primer sequences were constructed. Degenerate forward primer: AGGTGNTGCATGGNTGTCGTCAGCTCGTGN (SEQ ID NO: 74) Degenerate reverse primer: GGGTTGCGCTCGTTNNGGGACTTAANCC (SEQ ID NO: 75) (N: any of A / C / G / T)
[0100] The oral bacteria whose 16S rRNA gene could be amplified using the above-mentioned degenerate forward primer were as follows. Additionally, there were 140 species of oral bacteria whose 16S rRNA gene could not be amplified using the above-mentioned degenerate forward primer.
[0101] Forward primer sequences (types of oral bacteria that can be amplified) (Sequence number) AGGTGCTGCATGGCTGTCGTCAGCTCGTGC(72) (Sequence number 67) (A) AGGTGCTGCATGGCTGTCGTCAGCTCGTGT(175) (Sequence number 68) (B) AGGTGCTGCATGGTTGTCGTCAGCTCGTGC(171) (Sequence number 69) (C) AGGTGGTGCATGGCTGTCGTCAGCTCGTGT(121) (Sequence number 70) (D) AGGTGGTGCATGGTTGTCGTCAGCTCGTGT(334) (Sequence number 71) (E) AGGTGGTGCATGGCTGTCGTCAGCTCGTGC(0) (Sequence number 76) AGGTGGTGCATGGTTGTCGTCAGCTCGTGC(0) (Sequence number 77) AGGTGCTGCATGGTTGTCGTCAGCTCGTGT(2) (Sequence number 78)
[0102] The oral bacteria whose 16S rRNA gene could be amplified using the above-mentioned degenerate reverse primer were as follows. Additionally, there were 229 species of oral bacteria whose 16S rRNA gene could not be amplified using the above-mentioned degenerate reverse primer.
[0103] Reverse primer sequences (types of oral bacteria that can be amplified) (Sequence IDs) GGGTTGCGCTCGTTATGGCACTTAAGCC (116) (Sequence ID 72) (F) GGGTTGCGCTCGTTGCGGGACTTAACCC (670) (Sequence ID 73) (G)
[0104] Hairpin structure prediction was performed for all of the above primer sequence combinations for the 16S rRNA gene, and the Gibbs free energy thermodynamic parameter was calculated. Specifically, the free energy change during hairpin formation and the free energy change during primer double-strand formation were determined. As a result, ΔG, an indicator of the free energy change when adopting a hairpin structure, was greater than -9.0 kcal / mole, confirming that hairpin structure formation is limited. Furthermore, primer dimer prediction was performed, and the free energy change was determined, confirming that the influence of homodimer and heterodimer formation is limited. Therefore, it was found that the above primer combination can be used for PCR amplification of 16S rRNA of oral bacteria. In addition, it was found that by using a primer group mixed with the above five forward primers (SEQ ID NOs. 67-71) and two reverse primers (SEQ ID NOs. 72-73), 77.44% of the total oral bacteria registered in the database, and 80.04% if bacteria unrelated to periodontal disease are excluded, can be detected.
[0105] Next, we performed a search for 16S rRNA genes against oral bacteria using the five forward primers A to E (SEQ ID NOs. 67 to 71) and the two reverse primers F to G (SEQ ID NOs. 72 to 73) mentioned above, and determined the proportion of complementary strand formation. The results were as follows: Forward primers A:B:C:D:E ≈ 72:177:173:121:334 Reverse primers F:G ≈ 58:335
[0106] Therefore, we compared the results of mixing five types of forward primers (SEQ ID NOs. 67-71) A-E and two types of reverse primers (SEQ ID NOs. 72-73) F-G in the same proportions (same concentration) versus mixing them according to the bacterial cell ratio. In this comparison, PCR was performed using four types of purified bacterial genomic DNA samples obtained from RIKEN and genomic DNA of oral bacteria prepared from human samples as template DNA. When the four types of bacterial genomic DNA were used as template DNA and the primers were mixed in the same proportions (equal ratios), the Ct value was 33.723, while when the primers were mixed according to the bacterial cell ratio, the Ct value was 32.121. Furthermore, when the genomic DNA of oral bacteria prepared from human samples was used as template DNA and the primers were mixed in the same proportions (equal ratios), the Ct value was 25.160, while when the primers were mixed according to the bacterial cell ratio, the Ct value was 24.551. These results showed that the Ct value was smaller when primers were mixed in proportion to oral bacterial cells than when primers were mixed in equal proportions (Figure 1). Furthermore, when the reaction mixture was subjected to electrophoresis after PCR, no nonspecific gene amplification was observed with the combinations of the five forward primers (SEQ ID NOs. 67-71) and the two reverse primers (SEQ ID NOs. 72-73) (Figure 2).
[0107] EIS-PCR was performed using genomic DNA of oral bacteria prepared from human samples and the following primer set, and the PCR products of each bacterium were measured by EIS. The method for measuring double-stranded DNA by EIS was performed according to the method described in Japanese Patent No. 6803629.
[0108] (1) Porphyromonas gingivalis (gingipain gene) Forward primer: TGGCGGTCAGCGACGGATCTGCCCAT (SEQ ID NO: 9) Reverse primer: CGGTGTCGGCTTTGCCAACTATACAGCGCA (SEQ ID NO: 10) (2) Treponema denticola (flagellar hook protein gene) Forward primer: GCTCCGGCTTCATCAGGGTTTGCGCCTA (SEQ ID NO: 25) Reverse primer: CGTAACGTCTCCCGCAGGGCAAGTTTTGGT (SEQ ID NO: 26) (3) Tannerella forsythia (Surface layer protein gene) Forward primer: TGCCAAAGCGGATGCAGGTACGCCGAA (SEQ ID NO: 41) Reverse primer: ACACCAAGCGGTTCCAAGCCGTACCCC (SEQ ID NO: 42) (4) Streptococcus mutans (glycosyltransferase gene) Forward primer: GAGCTTCCCAGTGTTGTGGAGCCCAAGGT (SEQ ID NO: 63) Reverse primer: GCACTGGGTAACCGTTGCTGTCGCTTCTGG (SEQ ID NO: 64) (5) Oral bacteria (16S rRNA gene) Forward primer A: AGGTGCTGCATGGCTGTCGTCAGCTCGTGC (SEQ ID NO: 67) Forward primer B: AGGTGCTGCATGGCTGTCGTCAGCTCGTGT (SEQ ID NO: 68) Forward primer C: AGGTGCTGCATGGTTGTCGTCAGCTCGTGC (SEQ ID NO: 69) Forward primer D: AGGTGGTGCATGGCTGTCGTCAGCTCGTGT (SEQ ID NO: 70) Forward primer E: AGGTGGTGCATGGTTGTCGTCAGCTCGTGT (SEQ ID NO: 71) (Mixing ratio A:B:C:D:E ≈ 72:177:173:121:334) Reverse primer F: GGGTTGCGCTCGTTATGGCACTTAAGCC (SEQ ID NO: 72) Reverse primer G: GGGTTGCGCTCGTTGCGGGACTTAACCC (SEQ ID NO: 73) (Mixing ratio F:G ≈ 58:335)
[0109] The results of EIS-PCR showed specific impedance changes (|Z|Real and Δ|Z|) for each bacterium (each gene). Figure 3 is the |Z|Real graph for Porphyromonas gingivalis (gingipain gene), and Figure 4 is the Δ|Z| graph for Porphyromonas gingivalis (gingipain gene). Figure 5 is the |Z|Real graph for Treponema denticola (flagellar hook protein gene), and Figure 6 is the Δ|Z| graph for Treponema denticola (flagellar hook protein gene). Figure 7 is a graph of |Z|Real for Tannerella forsythia (Surface layer protein gene), and Figure 8 is a graph of Δ|Z| for Tannerella forsythia (Surface layer protein gene). Figure 9 is a graph of |Z|Real for Streptococcus mutans (glycosyltransferase gene), and Figure 10 is a graph of Δ|Z| for Streptococcus mutans (glycosyltransferase gene). Figure 11 is a graph of |Z|Real for oral bacteria (16S rRNA gene), and Figure 12 is a graph of Δ|Z| for oral bacteria (16S rRNA gene). In Figures 3 to 12, solid lines represent graphs during the annealing and elongation steps, and dotted lines represent graphs during the degeneration step. These results indicate that the primer set described above was able to specifically and quantitatively measure oral bacteria.
[0110] Furthermore, the Ct values for each primer set were as follows, indicating that the number of specific bacteria could be determined: Porphyromonas gingivalis (gingipain gene): 27.552 Treponema denticola (flagellar hook protein gene): 30.841 Tannerella forsythia (Surface layer protein gene): 30.264 Streptococcus mutans (glycosyltransferase gene): 27.661 Oral bacteria (16S rRNA gene): 22.171
[0111] Comparison between Fluorescence Method and EIS Method: Invasive Factors of Salmonella Typhimurium and Salmonella Enteritidis: A linear double-stranded DNA (34.43 fg, 0.3443 fg) obtained by digesting a plasmid with an inserted partial sequence of the invA gene, which is an invasive factor possessed by Salmonella Typhimurium and Salmonella Enteritidis, with the restriction enzyme PvuII (TOYOBO) was used as the template DNA. Using the following primer sets (10 pmol forward primer, 10 pmol reverse primer), fluorescence real-time PCR and EIS-PCR were performed in the same manner as above to compare the fluorescence method and the EIS method. Forward primer for the partial sequence of the invA gene: CGCCATGGTATGGATTTGTCCTCCGCCCTG (SEQ ID NO: 79), Reverse primer: GCGGGGATCTGGGCGACAAGACCATCACC (SEQ ID NO: 80) (PCR product: 83 bp). The graph of the fluorescence intensity (copy number: 10 4 ) in the fluorescence method is shown in Fig. 13, and the graph of the Δ fluorescence intensity (copy number: 10 4 ) in the fluorescence method is shown in Fig. 14. Also, the graph of the fluorescence intensity (copy number: 10 2 ) in the fluorescence method is shown in Fig. 15, and the graph of the Δ fluorescence intensity (copy number: 10 2 ) in the fluorescence method is shown in Fig. 16. Also, the graph of |Z|Real (copy number: 10 4 ) by the EIS method is shown in Fig. 17, and the graph of Δ|Z| (copy number: 10 4 ) by the EIS method is shown in Fig. 18. The graph of |Z|Real (copy number: 10 2 ) by the EIS method is shown in Fig. 19, and the graph of Δ|Z| (copy number: 10 2 ) by the EIS method is shown in Fig. 20. The Ct value of the fluorescence real-time PCR was 26.238 when the copy number was 10 4 , and 33.035 when the copy number was 10 2 . Also, the Ct value of the EIS-PCR was 26.0 when the copy number was 10 4 , and 32.5 when the copy number was 10 2 . Although the detection principles of the fluorescence real-time PCR and the EIS-PCR are different and they cannot be simply compared, the Ct values were almost the same for both.
[0112] The present invention provides a gene amplification method for specifically detecting and evaluating bacteria associated with periodontal disease and caries, a primer set for gene amplification reactions, and a kit containing the same for detecting the genes of causative bacteria of periodontal disease or caries, and a kit for evaluating the severity of periodontal disease or caries.
Claims
1. A method for detecting oral bacteria or causative agents of periodontal disease or caries by detecting the genes of oral bacteria or causative agents of periodontal disease or caries in supragingival or subgingival plaque or saliva using a gene amplification method, characterized in that (1) the annealing and extension reactions in the gene amplification method are carried out at substantially the same temperature, and / or (2) the gene length of the target gene as the amplification product is short.
2. The method according to claim 1, characterized in that the gene length of the target gene is 500 bp or less.
3. The method according to claim 2, characterized in that the gene length of the target gene is 100 bp or less.
4. A method for detecting microorganisms contained in a sample, characterized in that the primer set uses the DNA region of a gene encoding at least one gene selected from the causative agents of periodontal disease or dental caries and the microbial community involved in oral bacteria, and is capable of forming a sequence-specific complementary strand to said DNA region, as described in claim 1.
5. The method according to claim 1, characterized in that the gene amplification method is a polymerase chain reaction (hereinafter also referred to as "PCR") method.
6. The method according to claim 5, characterized in that the PCR method is fluorescence PCR or EIS (Electrochemical Impedance Spectroscopy)-PCR.
7. The method according to claim 1, characterized in that the causative agent of periodontal disease is one or more periodontal disease bacteria selected from the group consisting of Porphyromonas gingivalis (Pg), Treponema denticola (Td), and Tannerella forsythia (Tf), the causative agent of dental caries is Streptococcus mutans (Sm), and the oral bacteria are bacteria having a 16S rRNA gene.
8. Bacteria having the 16S rRNA gene include Abiotrophia defectiva, Achromobacter xylosoxidans, Acinetobacter baumannii, Acinetobacter sp., Actinobaculum sp., Actinomyces cardiffensis, Actinomyces dentalis, Actinomyces georgiae, Actinomyces gerencseriae, Actinomyces graevenitzii, Actinomyces israelii, Actinomyces johnsonii, Actinomyces lingnae [NVP], Actinomyces massiliensis, Actinomyces meyeri, Actinomyces naeslundii, Actinomyces odontolyticus, Actinomyces oricola, Actinomyces oris, Actinomyces radicidentis, Actinomyces sp., Actinomyces timonensis, Actinomyces viscosus, Afipia broomeae, Afipia sp. genosp. 4, Aggregatibacter actinomycetemcomitans, Aggregatibacter aphrophilus, Aggregatibacter paraphrophilus, Aggregatibacter segnis, Aggregatibacter sp., Agrobacterium tumefaciens, Alloiococcus otitis, Alloprevotella rava, Alloprevotella sp., Alloprevotella tannerae, Alloscardovia omnicolens, Anaerococcus lactolyticus, Anaerococcus prevotii, Anaerococcus tetradius, Anaeroglobus geminatus, Anaerolineae sp., Arcanobacterium haemolyticum, Arsenicicoccus bolidensis, Atopobium minutum, Atopobium parvulum, Atopobium rimae, Atopobium sp., Atopobium vaginae, Bacillus anthracis, Bacillus clausii, Bacillus subtilis, Bacteroidaceae sp., Bacteroidales sp., Bacteroides heparinolyticus, Bacteroides pyogenes, Bacteroides zoogleoformans, Bacteroidetes sp., Bartonella schoenbuchensis, Bdellovibrio sp., Bergeyella sp., Bifidobacteriaceae sp., Bifidobacterium animalis subsp. lactis, Bifidobacterium breve, Bifidobacterium dentium, Bifidobacterium longum, Bifidobacterium scardovii, Bifidobacterium subtile, Bordetella pertussis, Bosea vestrisii, Bradyrhizobium elkanii, Brevundimonas diminuta, Bulleidia extructa, Burkholderia cepacia, Butyrivibrio sp., Campylobacter concisus, Campylobacter curvus, Campylobacter gracilis, Campylobacter rectus, Campylobacter showae, Campylobacter sp., Campylobacter sputorum, Campylobacter ureolyticus, Capnocytophaga gingivalis, Capnocytophaga granulosa, Capnocytophaga haemolytica, Capnocytophaga leadbetteri, Capnocytophaga ochracea, Capnocytophaga sp., Capnocytophaga sputigena, Cardiobacterium hominis, Cardiobacterium valvarum, Catonella morbi, Catonella sp., Caulobacter sp., Centipeda periodontii, Chlamydophila pneumoniae, Clostridiales sp., Comamonas testosteroni, Corynebacterium diphtheriae, Corynebacterium durum, Corynebacterium matruchotii, Corynebacterium mucifaciens, Corynebacterium tuscaniense, Corynebacterium urealyticum, Cronobacter sakazakii, Cryptobacterium curtum, Cupriavidus gilardii, Defluvibacter lusatiensis, Delftia acidovorans, Desulfobulbus sp., Desulfomicrobium orale, Desulfovibrio fairfieldensis, Desulfovibrio sp., Dialister invisus, Dialister micraerophilus, Dialister pneumosintes, Dialister sp., Dietzia cinnamea, Dolosigranulum pigrum, Eggerthella lenta, Eggerthia catenaformis, Eikenella corrodens, Eikenella sp., Enterobacter cancerogenus, Enterobacter hormaechei, Enterococcus casseliflavus, Enterococcus durans, Enterococcus faecalis, Enterococcus italicus, Enterococcus saccharolyticus, Erysipelothrix tonsillarum, Erysipelotrichaceae sp., Erythromicrobium ramosum, Escherichia coli, Eubacterium limosum, Fastidiosipila sanguinis, Filifactor alocis, Finegoldia magna, Flavitalea sp., Fretibacterium fastidiosum, Fretibacterium sp., Fusobacterium gonidiaformans, Fusobacterium naviforme, Fusobacterium necrophorum, Fusobacterium nucleatum subsp. animalis, Fusobacterium periodonticum, Fusobacterium sp., Gardnerella vaginalis, Gemella bergeri, Gemella haemolysans, Gemella morbillorum, Gemella sanguinis, Gemella sp., Granulicatella adiacens, Granulicatella elegans, Haemophilus aegyptius, Haemophilus ducreyi, Haemophilus haemolyticus, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus parainfluenzae, Haemophilus pittmaniae, Haemophilus sp., Haemophilus spitorum, Helicobacter pylori, Johnsonella ignava, Johnsonella sp., Jonquetella anthropi, Kingella denitrificans, Kingella kingae, Kingella oralis, Kingella sp., Klebsiella pneumoniae, Kluyvera ascorbata, Kocuria sp., Kytococcus sedentarius, Lachnoanaerobaculum orale, Lachnoanaerobaculum saburreum, Lachnoanaerobaculum sp., Lachnoanaerobaculum umeaense, Lachnospiraceae sp., Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus coleohominis, Lactobacillus crispatus, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus kisonensis, Lactobacillus oris, Lactobacillus panis, Lactobacillus paracasei, Lactobacillus parafarraginis, Lactobacillus pentosus, Lactobacillus plantarum, Lactobacillus rapi, Lactobacillus reuteri genosp. 1、Lactobacillus rhamnosus、Lactobacillus salivarius、Lactobacillus sp.、Lactobacillus ultunensis、Lactobacillus vaginalis、Lactococcus lactis、Lautropia mirabilis、Leptothrix sp., Leptotrichia buccalis, Leptotrichia goodfellowii, Leptotrichia hofstadii, Leptotrichia hongkongensis, Leptotrichia shahii, Leptotrichia sp., Leptotrichia wadei, Listeria monocytogenes, Lysinibacillus fusiformis, Megasphaera micronuciformis, Megasphaera sp., Mesorhizobium loti, Microbacterium flavescens, Microbacterium ginsengisoli, Mitsuokella multacida, Mitsuokella sp., Mobiluncus mulieris, Mogibacterium diversum, Mogibacterium neglectum, Mogibacterium pumilum, Mogibacterium timidum, Mogibacterium vescum, Mollicute sp., Moraxella catarrhalis, Moraxella osloensis, Mycobacterium leprae, Mycobacterium neoaurum, Mycobacterium tuberculosis, Mycoplasma buccale, Mycoplasma faucium, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma lipophilum, Mycoplasma orale, Mycoplasma pneumoniae, Mycoplasma salivarium, Neisseria bacilliformis, Neisseria elongata, Neisseria flava, Neisseria flavescens, Neisseria gonorrhoeae, Neisseria lactamica, Neisseria meningitidis, Neisseria mucosa, Neisseria oralis, Neisseria pharyngis, Neisseria polysaccharea, Neisseria sicca, Neisseria sp., Neisseria subflava, Neisseria weaveri, Ochrobactrum anthropi, Olsenella profusa, Olsenella sp., Olsenella uli, Oribacterium asaccharolyticum, Oribacterium parvum, Oribacterium sinus, Oribacterium sp., Ottowia sp., Paenibacillus glucanolyticus, Paenibacillus phoenicis, Paenibacillus sp., Parascardovia denticolens, Parvimonas micra, Parvimonas sp., Pedobacter sp., Peptococcus sp., Peptoniphilaceae sp., Peptoniphilus asaccharolyticus, Peptoniphilus indolicus, Peptoniphilus lacrimalis, Peptoniphilus sp., Peptostreptococcaceae sulci, Peptostreptococcus anaerobius, Peptostreptococcus stomatis, Porphyrobacter tepidarius, Porphyromonas asaccharolytica, Porphyromonas catoniae, Porphyromonas endodontalis, Porphyromonas gingivalis, Porphyromonas pasteri, Porphyromonas sp., Porphyromonas uenonis, Prevotella aurantiaca, Prevotella baroniae, Prevotella bivia, Prevotella buccae, Prevotella buccalis, Prevotella dentalis, Prevotella denticola, Prevotella enoeca, Prevotella fusca, Prevotella histicola, Prevotella intermedia, Prevotella loescheii, Prevotella maculosa, Prevotella marshii, Prevotella melaninogenica, Prevotella micans, Prevotella multiformis, Prevotella multisaccharivorax, Prevotella nanceiensis, Prevotella nigrescens, Prevotella oralis, Prevotella oris, Prevotella oulorum, Prevotella pallens, Prevotella pleuritidis, Prevotella saccharolytica, Prevotella salivae, Prevotella scopos, Prevotella shahii, Prevotella sp., Prevotella veroralis, Propionibacterium acidifaciens, Propionibacterium acnes, Propionibacterium avidum, Propionibacterium propionicum, Propionibacterium sp., Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas otitidis, Pseudomonas pseudoalcaligenes, Pseudomonas sp., Pseudomonas stutzeri, Pseudodoramibacter alactolyticus, Pyramidobacter piscolens, Ralstonia pickettii, Ralstonia sp., Rhodobacter capsulatus, Rhodocyclus sp., Rothia aeria, Rothia dentocariosa, Rothia mucilaginosa, Ruminococcaceae sp., Sanguibacter keddieii, Scardovia inopinata, Scardovia wiggsiae, Schlegelella aquatica, Schlegelella thermodepolymerans, Selenomonas artemidis, Selenomonas dianae, Selenomonas flueggei, Selenomonas infelix, Selenomonas noxia, Selenomonas sp., Selenomonas sputigena, Shuttleworthia satelles, Simonsiella muelleri, Slackia exigua, Sneathia amnii, Sneathia sanguinegens, Solobacterium moorei, Sphingomonas echinoides, Sphingomonas sp., Staphylococcus aureus, Staphylococcus caprae, Staphylococcus epidermidis, Staphylococcus warneri, Stenotrophomonas maltophilia, Stenotrophomonas nitritireducens, Stomatobaculum longum, Stomatobaculum sp., Streptococcus agalactiae, Streptococcus anginosus, Streptococcus australis, Streptococcus constellatus, Streptococcus cristatus, Streptococcus dentisani, Streptococcus downei, Streptococcus gordonii, Streptococcus infantis, Streptococcus intermedius, Streptococcus lactarius, Streptococcus mitis, Streptococcus mutans, Streptococcus oligofermentans, Streptococcus oralis, Streptococcus parasanguinis, Streptococcus peroris, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus salivarius, Streptococcus sanguinis, Streptococcus sinensis, Streptococcus sobrinus, Streptococcus sp., Streptococcus tigurinus, Streptococcus vestibularis, Syntrophomonadaceae sp., Tannerella forsythia, Tannerella sp.The method according to claim 7, wherein the at least one is selected from the group consisting of Treponema amylovorum, Treponema denticola, Treponema lecithinolyticum, Treponema maltophilum, Treponema medium, Treponema pallidum, Treponema parvum, Treponema pectinovorum, Treponema putidum, Treponema socranskii subsp. buccale, Treponema sp., Treponema vincentii, Turicella otitidis, Variovorax paradoxus, Veillonella atypica, Veillonella denticariosi, Veillonella dispar, Veillonella parvula, Veillonella rogosae, Veillonella sp., and Yersinia pestis.
9. The method according to claim 7, characterized by using at least one selected from the group consisting of the following primer sets: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene as the target gene, and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene, and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, SEQ ID NOs. 15-16, and SEQ ID NOs. 17-18, targeting the RNA polymerase β subunit gene as the target gene, and - flagellar hook Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the protein gene; (3) For Tannerella forsythia: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene; Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, SEQ ID NOs. 33-34, SEQ ID NOs. 35-36, SEQ ID NOs. 37-38, SEQ ID NOs. 39-40, and SEQ ID NOs. 41-42, targeting the Surface layer protein gene; A primer set consisting of nucleic acid sequences 43-44,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, targeting the sortase A gene, and (5) Targeting the 16S rRNA gene of oral bacteria, A primer set consisting of sequence numbers 67-73, or a primer set consisting of degenerate primer sequences 74-75.
10. A method for evaluating the severity of periodontal disease and / or caries, comprising one or more of the following steps: (1) detecting genes of causative bacteria of periodontal disease or caries in supragingival or subgingival plaque or saliva using the method described in claim 1; (2) detecting genes of total oral bacteria using a gene amplification method; and (3) calculating the ratio of the detected value of the genes of the causative bacteria to the detected value of the genes of the total oral bacteria, or the ratio of the number of causative bacteria to the total number of oral bacteria, to evaluate the severity of periodontal disease and / or caries.
11. The evaluation method according to claim 10, characterized in that the gene amplification method is the PCR method.
12. The evaluation method according to claim 11, characterized in that the PCR method is a fluorescence PCR method or an EIS-PCR method.
13. The evaluation method according to claim 10, characterized in that the total number of oral bacteria is detected by gene amplification using a primer that targets the 16S rRNA gene of oral bacteria.
14. The evaluation method according to claim 10, characterized in that the primer set of primers targeting the 16S rRNA gene of oral bacteria is: (1) a primer set of primers consisting of sequence numbers 67 to 73, or (2) a primer set of degenerate primer sequences consisting of sequence numbers 74 to 75.
15. The evaluation method according to claim 14, characterized in that a primer set targeting the genes of oral bacteria is detected using a primer set with an optimized formulation ratio.
16. The evaluation method according to claim 15, characterized in that when the nucleic acid sequence of SEQ ID NO: 67 is used as forward primer A, the nucleic acid sequence of SEQ ID NO: 68 is used as forward primer B, the nucleic acid sequence of SEQ ID NO: 69 is used as forward primer C, the nucleic acid sequence of SEQ ID NO: 70 is used as forward primer D, the nucleic acid sequence of SEQ ID NO: 71 is used as forward primer E, the nucleic acid sequence of SEQ ID NO: 72 is used as reverse primer F, and the nucleic acid sequence of SEQ ID NO: 73 is used as reverse primer G, the ratio of forward primers A:B:C:D:E is approximately 72:177:173:121:334, and the ratio of reverse primers F:G is approximately 58:335, the evaluation method according to claim 15.
17. At least one primer set selected from the group consisting of the following gene amplification primer sets for detecting the genes of periodontal disease or caries-causing bacteria or oral bacteria in supragingival or subgingival plaque or saliva using gene amplification methods: (1) For Porphyromonas gingivalis: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 1-2, SEQ ID NOs. 3-4, SEQ ID NOs. 5-6, and SEQ ID NOs. 7-8, targeting the RNA polymerase β subunit gene as the target gene, and - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 9-10, targeting the gingipain gene, and (2) For Treponema denticola: - A primer set consisting of the nucleic acid sequences of SEQ ID NOs. 11-12, SEQ ID NOs. 13-14, targeting the RNA polymerase β subunit gene as the target gene, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 15-16, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 17-18, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 19-20, SEQ ID NOs. 21-22, SEQ ID NOs. 23-24, and SEQ ID NOs. 25-26, targeting the flagellar hook protein gene as the target gene, and (3) For Tannerella forsythia: - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 27-28, and SEQ ID NOs. 29-30, targeting the RNA polymerase β subunit gene as the target gene, and - Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 31-32, and SEQ ID NOs. 33-34, targeting the Surface layer protein gene as the target gene, A primer set consisting of nucleic acid sequences of SEQ ID NOs. 35-36, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 37-38, a primer set consisting of nucleic acid sequences of SEQ ID NOs. 39-40,Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 41-42, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 43-44, primer sets consisting of nucleic acid sequences of SEQ ID NOs. 45-46, and primer sets consisting of nucleic acid sequences of SEQ ID NOs. 47-48, and (4) For Streptococcus mutans: Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 49-50, SEQ ID NOs. 51-52, SEQ ID NOs. 53-54, SEQ ID NOs. 55-58, SEQ ID NOs. 59-60, SEQ ID NOs. 61-62, and SEQ ID NOs. 63-64, and, Primer sets consisting of nucleic acid sequences of SEQ ID NOs. 65-66, and, (5) A primer set consisting of sequence numbers 67-73 and sequence numbers 74-75, targeting the 16S rRNA gene of oral bacteria.
18. The primer set according to claim 17, characterized in that the gene amplification method is the PCR method.
19. A kit for detecting periodontal disease or caries-causing bacteria, or genes of oral bacteria, in supragingival or subgingival plaque or saliva, comprising one or more primer sets as described in claim 17.
20. The kit according to claim 19, which uses the EIS-PCR method according to claim 6 or 12 and includes a mediator, which is an electron transfer substance for electrochemically detecting the sample, in the PCR reaction composition for detecting the genes of the causative bacteria or oral bacteria in the sample.
Citation Information
Patent Citations
Polynucleotide, polynucleotide set, method for detecting porphyromonas gingivalis, method for assessing periodontal disease susceptibility, porphyromonas gingivalis detection kit, and periodontal disease susceptibility assessment kit
EP4174180A1
Method and system for detecting a target substance present in a solution
JP6803629B2
Method for cultivating ginseng sprout nd ginseng sprout cutivated thereby
KR102520256B1
Voltage control device based on the measured equipment load voltage
KR102537638B1
Intra-oral inspection method using information for bacteria groups associated with clinical indices
WO2019088272A1