Compositions and methods for reprogramming of cells
Novel miRNA mimics with complete strand complementarity enhance the reprogramming of somatic cells to iPSCs, improving efficiency and viability, addressing inefficiencies and safety concerns in existing mRNA-based methods.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ROSLIN CELL THERAPIES LTD
- Filing Date
- 2025-10-17
- Publication Date
- 2026-04-23
AI Technical Summary
Existing methods for reprogramming somatic cells to induced pluripotent stem cells (iPSCs) using mRNA are inefficient and require extended passaging for exogenous factor clearance, posing risks to operator safety and inefficiencies in generating iPSCs.
The use of novel miRNA mimics with complete complementarity between strands, lacking bulges or hairpins, to enhance the reprogramming process by introducing RNA polynucleotides encoding reprogramming factors, resulting in higher iPSC yields and sustained expression.
This approach significantly increases the number and viability of iPSCs, reduces the time required for generation, and maintains pluripotency across multiple passages, outperforming conventional methods.
Smart Images

Figure IB2025060575_23042026_PF_FP_ABST
Abstract
Description
Docket No. 65907-703.601COMPOSITIONS AND METHODS FOR REPROGRAMMING OF CELLSCROSS REFERENCE
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 708,483, filed October 17, 2024, which is incorporated herein by reference in its entirety.BACKGROUND
[0002] Reprogramming somatic cells to induced pluripotent stem cells (iPSC) using mRNA to deliver Yamanaka factors can offer many advantages over alternative techniques; RNA is nonintegrating, efficiently reprograms somatic cells to iPSCs and, unlike Sendai vector, does not require extended passaging for exogenous factor clearance. In addition, the risk to operator safety is negligible as compared with integrating retroviral vectors or even Sendai.SUMMARY OF THE DISCLOSURE
[0003] Provided herein are compositions and methods for reprogramming of cells. The compositions and methods comprise novel miRNA mimics that generated higher numbers of induced pluripotent stem cells compared to corresponding commercially available miRNAs. The improved compositions and methods using these compositions showed highly efficient reprogramming of fibroblasts from different donors to induced pluripotent cells (iPSCs), with as little as three transfections producing iPSC colonies with a typical self-renewal marker expression profile for iPSCs. iPSC colonies were generated in only 6 days. Additionally, inhibition of PKR pathway or OAS pathway was not required for successful reprogramming with RNA polynucleotide encoding reprogramming factors, using the novel miRNA mimics.
[0004] In one aspect, provided herein is a method of producing induced pluripotent stem cells, comprising: (a) providing a population of differentiated cells; (b) introducing into the population of differentiated cells: (i) one or more RNA polynucleotides that encode a reprograming factor, and (ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and (c) culturing the population of differentiated cells from step (b) under conditions suitable to produce the induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
[0005] In some embodiments, the at least one double stranded miRNA mimic lacks a bulge region.
[0006] In one aspect, provided herein is a method of producing induced pluripotent stem cells, comprising: (a) providing a population of differentiated cells; (b) introducing in said population of differentiated cells: (i) one or more RNA polynucleotides that encode a reprogramming factor, and (ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and (c) culturing the population of differentiated cells from step (b) under conditions suitable to generateDocket No. 65907-703.601 induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic lacks a bulge region.
[0007] In some embodiments, the at least one double stranded miRNA mimic lacks a hairpin region.
[0008] In some embodiments, the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
[0009] In some embodiments, the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA.
[0010] In some embodiments, the first strand is partially complementary to a target mRNA in the population of differentiated cells.
[0011] In some embodiments, the first strand is completely complementary to the target mRNA.
[0012] In some embodiments, the first strand binds the target mRNA.
[0013] In some embodiments, the at least one double stranded miRNA mimic inhibits translation of the target mRNA.
[0014] In some embodiments, the at least one double stranded miRNA mimic induces deadenylation, decapping, and / or exonucleolytic digestion of the target mRNA.
[0015] In some embodiments, the culturing in step (c) results in expression of the one or more RNA polynucleotides in the population of differentiated cells from step (b), thereby producing the induced pluripotent stem cells.
[0016] In some embodiments, the expression of the one or more RNA polynucleotides is sustained for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week or more.
[0017] In some embodiments, the induced pluripotent stem cells are viable for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month or longer.
[0018] In some embodiments, the induced pluripotent cells maintain pluripotency across at least 3, 4, 5, 6, 7, 8, 9, 10 or more passages.
[0019] In some embodiments, the expression of the one or more RNA polynucleotides is higher relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the expression of the one or more RNA polynucleotides is higher by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, the expression of the one or more RNA polynucleotides is sustained for a longer duration relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the expression of the one or more RNA polynucleotides is sustained for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week longer relative to thatDocket No. 65907-703.601 in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
[0020] In some embodiments, the level of induced pluripotent stem cells produced is higher relative to that in a corresponding method lacking the step of introducing the at least one double stranded miRNA mimic.
[0021] In some embodiments, the level of induced pluripotent stem cells produced is higher by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that in a corresponding method lacking the step of introducing the at least one double stranded miRNA mimic.
[0022] In some embodiments, the induced pluripotent stem cells are (i) viable for a longer duration, (ii) exhibit reduced spontaneous differentiation, and / or (iii) maintain pluripotency across at least 3, 4, 5, 6, 7, 8, 9, 10 or more passages compared those generated by a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
[0023] In some embodiments, wherein the induced pluripotent stem cells are viable for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week longer compared to those generated by a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
[0024] In some embodiments, the corresponding method comprises introducing a reference double stranded miRNA. In some embodiments, the method described herein further comprises expanding the induced pluripotent stem cells.
[0025] In some embodiments, the differentiated cells are mammalian cells.
[0026] In some embodiments, the differentiated cells are somatic cells.
[0027] In some embodiments, the differentiated cells are human cells.
[0028] In some embodiments, the differentiated cells are fibroblast cells.
[0029] In some embodiments, the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to the sequence of the naturally occurring miRNA.
[0030] In certain embodiments, the first strand comprises a nucleotide sequence identical to a sequence of a guide strand of the naturally occurring miRNA.
[0031] In some embodiments, the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides.
[0032] In some embodiments, the first strand is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.Docket No. 65907-703.601
[0033] In some embodiments, the second strand is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0034] In some embodiments, the first strand and the second strand are of the same length or of different lengths.
[0035] In some embodiments, the first strand is a guide strand.
[0036] In some embodiments, the second strand is a passenger strand.
[0037] In some embodiments, the one or more RNA polynucleotides lack a nucleotide modification, optionally wherein the nucleotide modification is a chemical modification.
[0038] In some embodiments, the first strand comprises a phosphate group at the 5’ end.
[0039] In some embodiments, the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end.
[0040] In some embodiments, the second strand lacks a nucleotide modification, optionally wherein the nucleotide modification is a chemical modification.
[0041] In some embodiments, the at least one double stranded miRNA mimic lacks a hairpin region, a mismatch between the first strand and the second strand, a bulge region, or a combination thereof.
[0042] In some embodiments, the first strand and / or the second strand further comprises an overhang of at least one, 2, 3, 4 5, or more nucleotides at the 5' end and / or the 3' end.
[0043] In some embodiments, the second strand further comprises a one or two nucleotide overhang on the 3' end.
[0044] In some embodiments, the first strand further comprises a one or two nucleotide overhang on the 3' end.
[0045] In some embodiments, the introducing at least one double stranded miRNA comprises introducing at least 2, 3, 4, 5, or more double stranded miRNA mimics.
[0046] In some embodiments, the at least one double stranded miRNA mimic comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a first strand that comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA that is different.
[0047] In some embodiments, the at least one double stranded miRNA mimic comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a first strand that binds a different target mRNA in the population of differentiated cells.
[0048] In certain embodiments related to the embodiment wherein the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA, the corresponding naturally occurring miRNA is a human miRNA. In some embodiments, the corresponding naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa- miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
[0049] In some embodiments, the at least one double stranded miRNA mimic comprises: (a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identicalDocket No. 65907-703.601 to a portion of a sequence of a hsa-miR-367, (b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR- 302a, (c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b, (d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of hsa-miR-302c, (e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of hsa-miR-302d, or (f) a combination thereof.
[0050] In some embodiments, the one or more RNA polynucleotides comprises a 5 ’-Cap structure, optionally wherein the Cap structure is a 5' diguanosine cap, an anti-reverse Cap analog (ARCA), m7GpppNmp-RNA or m7GpppNp-RNA, optionally wherein the 5’ cap analog is a 5' diguanosine cap. In some embodiments, the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L- MYC, a N-MYC, a LIN28 and a NANOG.
[0051] In some embodiments, the reprogramming factor is selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28.
[0052] In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combination thereof. In some embodiments, the c-MYC comprises at least one amino acid mutation relative to a corresponding WT c-MYC. In some embodiments, the at least one amino acid mutation comprises an amino acid substitution, an amino acid deletion and / or an amino acid insertion. In some embodiments, the at least one amino acid mutation comprises a mutation at amino acid residue T58 relative to a corresponding WT c-MYC. In some embodiments, the mutation at amino acid residue T58 is a T58A amino acid substitution. In some embodiments, the step (b) of the method further comprises introducing at least one modulator of interferon response or a nucleic acid encoding said at least one modulator of interferon response.
[0053] In some embodiments, the at least one modulator of interferon response comprises an interferon decoy molecule. In some embodiments, the at least one modulator of interferon response comprises a B18R or a nucleic acid encoding the B18R, an NS3 / 4A or a nucleic acid encoding the NS3 / 4A, or a combination thereof. In some embodiments, the nucleic acid encoding the B18R is an RNA encoding the B 18R, optionally wherein the RNA encoding the B 18R lacks a nucleotideDocket No. 65907-703.601 modification. In some embodiments, the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A, optionally wherein the RNA encoding the NS3 / 4A lacks a nucleotide modification.
[0054] In some embodiments, the method lacks the step of introducing a modulator of interferon response or a nucleic acid encoding the modulator of interferon response.
[0055] In some embodiments, the method lacks the step of introducing an inhibitor of the PKR dependent pathway and / or the OAS-dependent pathway. In some embodiments, the inhibitor of the PKR dependent pathway is an inhibitor of the activity or activation of PKR polypeptide, dephosphorylates eIF2-alpha and / or inhibits phosphorylation of eIF2-alpha. In some embodiments, the inhibitor of OAS dependent pathway is an inhibitor of the expression and / or activity of OAS protein and / or RNase L. In some embodiments, the inhibitor of PKR pathway is a vaccinia virus E3 polypeptide, a vaccinia virus K3 polypeptide, or both.
[0056] In some embodiments, the first strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 1, 2, 3, 4 or 5.
[0057] In some embodiments, the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10.
[0058] In some embodiments, the introducing the at least one double stranded miRNA mimic comprises introducing (a) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, (b) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, (c) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, (d) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, (e) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or (f) a combination thereof.
[0059] In some embodiments, the introducing the at least one double stranded miRNA mimic comprises introducing (a) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6, (b) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7, (c) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8, (d) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9, (e) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or (f) a combination thereof.
[0060] In some embodiments, introducing the at least one double stranded miRNA mimic comprises introducing (a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6, (b) a double stranded miRNA mimic that comprises the firstDocket No. 65907-703.601 strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7, (c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8, (d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, (e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10, or (f) a combination thereof.
[0061] In some embodiments, the introducing of step b is performed once daily for 3 days or less, and the culturing is performed for 10 days or less, for example, 3 days or less.
[0062] In some embodiments, the first strand comprises a 5’ phosphate group.
[0063] In some embodiments, the first lacks further nucleotide modification other than the 5 ’ phosphate group.
[0064] In some embodiments, the second strand lacks a nucleotide modification.
[0065] In some embodiments, the one or more RNA polynucleotides comprises a 5’ cap structure.
[0066] In some embodiments, the one or more RNA polynucleotide lacks further nucleotide modifications.
[0067] In some embodiments, the introducing is performed by electroporation or lipofection.
[0068] In some embodiments, the one or more RNA polynucleotides that encode a reprogramming factor of (i), and the at least one double stranded miRNA mimic that comprises a first strand and a second strand of (ii) (ii) are introduced sequentially or simultaneously. In some embodiments, the at least one double stranded miRNA mimic is introduced at a concentration of at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng per at least about 20,000 differentiated cells. In some embodiments, provided herein is a method for improving efficiency of generating a population of induced pluripotent stem cells, the method comprising the steps of: (a) providing a population of differentiated cells; (b) introducing into said population of differentiated cells: (i) one or more RNA polynucleotides that encode a reprograming factor; and (ii) at least one double stranded miRNA mimic; and (c) culturing the population of differentiated cells from step (b) under conditions suitable to generate said population of induced pluripotent stem cells, wherein the method results in (i) a decrease in time required for generation of the induced pluripotent cells upon the culturing step, (ii) an increase in number of induced pluripotent cells generated, (iii) an increase in viability of generated induced pluripotent cells, or (iv) a combination thereof, thereby improving efficiency relative to a corresponding method that lacks the step of introducing the at least one doubleDocket No. 65907-703.601 stranded miRNA mimic. In some embodiments, the concentration of the at least one double stranded miRNA mimic is not cytotoxic to the cells
[0069] In one aspect, provided herein is a composition for generating reprogrammed cells comprising: (a) one or more RNA polynucleotides that encode a reprograming factor; and (b) at least one double stranded miRNA mimic that comprises a first strand and a second strand, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
[0070] In one aspect, provided herein is a composition for generating reprogrammed cells comprising: (a) one or more RNA polynucleotides that encode a reprogramming factor; and (b) at least one double stranded miRNA mimic that comprises a first strand and a second strand, wherein the at least one double stranded mimic lacks a bulge region.
[0071] In some embodiments, the double stranded miRNA of the composition described herein mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides.
[0072] In some embodiments, the first strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0073] In some embodiments, the second strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0074] In some embodiments, the first strand and the second strand are of the same length or of different lengths.
[0075] In some embodiments, the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA. In some embodiments, the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to the sequence of the naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to a guide sequence of the naturally occurring miRNA. In some embodiments, the first strand is partially complementary to a target mRNA.
[0076] In certain embodiments, the first strand is completely complementary to the target mRNA. In some embodiments, the first strand is a guide strand. In some embodiments, the second strand is a passenger strand. In certain embodiments, the one or more RNA polynucleotides lack a nucleotide modification. In some embodiments, the first strand comprises a phosphate group at the 5’ end. In some embodiments, the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end.
[0077] In some embodiments, the second strand lacks a nucleotide modification. In some embodiments, the at least one double stranded miRNA mimic lacks a hairpin region, a mismatch, a bulge region, or a combination thereof. In some embodiments, the first strand and / or the second strand further comprises one or more nucleotide overhangs at the 5' end and / or the 3' end. In someDocket No. 65907-703.601 embodiments, the second strand further comprises a one or two nucleotide overhang on the 3' end. In some embodiments, the first strand further comprises a one or two nucleotide overhang on the 3' end. In some embodiments, the composition comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different.
[0078] In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
[0079] In certain embodiments, the composition comprises: (a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-367, (b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302a, (c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b, (d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302c, (e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302d, or (f) a combination thereof.
[0080] In some embodiments, the one or more RNA polynucleotides comprises a 5 ’-Cap structure, optionally wherein the 5 ’-Cap structure is m7GpppNmp-RNA or m7GpppNp-RNA, 5' cap analog, or an anti -reverse Cap analog (ARC A), optionally wherein the 5' cap analog is a 5' diguanosine cap. In some embodiments, the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MY C, a LIN28 and a NANOG. In some embodiments, the reprogramming factor polypeptide is selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combination thereof.
[0081] In certain embodiments, the c-MYC comprises at least one amino acid mutation relative to a corresponding WT c-MYC. In some embodiments, the at least one amino acid mutation comprises an amino acid substitution, an amino acid deletion and / or an amino acid insertion. In some embodiments, the at least one amino acid mutation comprises a mutation at amino acid residue T58 relative to aDocket No. 65907-703.601 corresponding WT c-MYC. In some embodiments, the mutation at amino acid residue T58 is a T58A amino acid substitution.
[0082] In certain embodiments, the method further comprising at least one modulator of interferon response or a nucleic acid encoding said at least one modulator of interferon response. In some embodiments, the at least one modulator of interferon response comprises an interferon decoy molecule. In some embodiments, the at least one modulator of interferon response comprises a B18R or a nucleic acid encoding the B 18R, an NS3 / 4A or a nucleic acid encoding the NS3 / 4A, or a combination thereof. In some embodiments, the nucleic acid encoding the B 18R is an RNA encoding the B 18R, optionally wherein the RNA encoding the B 18R lacks a nucleotide modification. In some embodiments, the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A, optionally wherein the RNA encoding the NS 3 / 4 A lacks a nucleotide modification.
[0083] In certain embodiments, the first strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 1, 2, 3, 4 or 5. In some embodiments, the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10.
[0084] In some embodiments of the composition described in any one of the previous embodiments, (a) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 6, (b) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 7, (c) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 8, (d) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 9, or (e) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0085] In some embodiments, the composition comprises: (a) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, (b) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, (c) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, (d) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, (e) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or (f) a combination thereof.
[0086] In some embodiments, the composition comprises: (a) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6, (b) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7, (c) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8, (d) a double stranded miRNA mimicDocket No. 65907-703.601 that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9, (e) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or (f) a combination thereof.
[0087] In some embodiments, the composition comprises: (a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6, (b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7, (c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8, (d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, (e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10, or (f) a combination thereof. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng.
[0088] In one aspect, provided herein is a composition, comprising: (a) one or more RNA polynucleotide encoding a reprogramming factor, and (b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6, (c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7, (d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8, (e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, and (f) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0089] In one aspect, provided herein is a population of induced pluripotent stem cells generated by the method of any one of the embodiments described above. In some embodiments, the composition comprises the population of induced pluripotent stem cells as described in the above embodiment.Docket No. 65907-703.601
[0090] Use of the composition of any one of embodiments described above, for treatment of a subject in need thereof, optionally wherein the treatment comprises administering an effective amount of the composition to the subject.
[0091] Use of the composition of any one of the embodiments described above, for a method to reprogram a population of differentiated cells. The use according to the embodiment, wherein the population of differentiated cells are reprogrammed to a population of induced pluripotent stem cells.
[0092] Provided herein is a pharmaceutical composition comprising the population of induced pluripotent stem cells described in the embodiment above.
[0093] The composition of any one of the embodiments described herein, for use to manufacture a population of induced pluripotent stem cells.
[0094] The composition of any one of the embodiments described herein, for use to generate a population of cells having stem cell characteristics from a population of differentiated cells, optionally wherein the population of differentiated cells are somatic cells.
[0095] In one aspect, provided herein is a kit comprising an effective amount of a composition of any one of embodiments described above. In some embodiments, the kit further comprises one or more of:(i) a delivery vehicle for introducing the one or more components of the composition into cells,(ii) a buffer solution,(iii) a reconstitution solution,(iv) a stabilizing solution,(v) a culture media(vi) an RNase inhibitor, and(vii) instructions for reprogramming differentiated cells or instructions for manufacturing a population of induced pluripotent cells.INCORPORATION BY REFERENCE
[0096] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS
[0097] Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0098] FIG. 1 shows design of DNA template sequences used for mRNA synthesis by in vitro transcription reaction.Docket No. 65907-703.601
[0099] FIG. 2 shows steps for preparation of mRNA encoding the reprogramming factor or IFN response modulator.
[0100] FIG. 3 shows an exemplary approach of reprogramming.
[0101] FIGs. 4A-4B show testing of viral protein mRNA innate immune protection.
[0102] FIG. 4A shows Day 5 XTT viability assay results for initially tested viral protein mRNA combinations. Four daily transfections with GFP mRNA using RNAiMAX (grey, 50%) resulted in a decrease in viability compared to both controls. The combination of SFSV+NS4b rescued this viability drop at all concentrations tested (square dot). AcPIO + NS4b rescued the viability drop only at the lowest concentration (solid, circle). The two remaining combinations, SFSV+MHV NS2 (round dot) and AcPIO+MHV NS2 (dash), appeared toxic at all concentrations.
[0103] FIG. 4B shows GFP and brightfield images from all conditions at 0. 1 pg at day 4 demonstrating an increase in cell density vs GFP alone for SFSV+NS4b and AcP10+NS4b, and reduced cell density when using SFSV+MHV NS2 and AcPIO+MHV NS2.
[0104] FIG. 5 shows repeat XTT viability assay using lower concentrations of MHV NS2, along with testing of an additional viral protein (Influenza A NS1). Transfection with GFP once again reduced cell viability, which could be rescued using the lowest concentration of SFSV+MHV only. Influenza A NS 1 was toxic at all concentrations tested.
[0105] FIG. 6 shows colony images on Day 15. Compact colonies formed in the conditions without additional PKR / OAS inhibitors, with a clear increase in number of colonies as the number of transfections increased. A small number of non-compact colonies appeared for SFSV + NS4b conditions, while complete cell death occurred when using AcPIO + NS4b (Day 10 image due to cell death before Day 15).
[0106] FIGs. 7A-7C show self-renewal marker expression for picked clones.
[0107] FIG. 7A shows representative images from expanded clones prior to flow cytometry, demonstrating iPSC-like morphology and growth characteristics.
[0108] FIG. 7B shows representative histogram plots demonstrating expression of the self-renewal markers Tra-1-81, Tra-1-60, OCT3 / 4, SSEA4 and the negative marker SSEA1. All plots show fully stained (red) vs FMO control (black).
[0109] FIG. 7C shows % of cells that were positive for each marker from two picked clones. Values are the mean of 3 technical repeats.
[0110] FIG. 8 shows in house designed non-modified miRNA mimics promote more reprogramming events versus commercially available miRNAs after six transfections. In-house designed and produced optimized transcription factor and IFN modulator mRNA (OSKMLNB) was used in both experiments.[oni] FIG. 9 shows representative brightfield images at 4x magnification on reprogramming day 5 for in-house designed miRNA mimics (top panel, in house miRNA) and commercial miRNA. TheDocket No. 65907-703.601 images show an increase in cell density during the initial transfection period as miRNA quantity increases.
[0112] FIG. 10 shows representative brightfield images at 4x magnification on reprogramming days 8 and 12 during testing of the final reprogramming mix. The images show an increase in cell density during the initial transfection period with the addition of B 18R and / or NS3 / 4A. All conditions include 0.96pg miRNA and the mutated T58A c-Myc in place of wildtype.
[0113] FIGs. 11A-1 IB show self-renewal marker flow cytometry assay results using the final reprogramming kit components.
[0114] FIG. 11A shows % expression of each individual marker across 3 technical repeats.
[0115] FIG. 1 IB shows histogram overlays for each marker compared to its corresponding fluorescence minus one (FMO) control.
[0116] FIG. 12 shows examples of ideal colonies indicating successful reprogramming and in comparison, non-ideal colonies.
[0117] FIG. 13 shows blot evaluating quality of mRNA produced.
[0118] FIG. 14 shows representative brightfield images at 4x magnification on days 6 and 12 after commencement of reprogramming BJ, adult (dermal) and juvenile (foreskin) fibroblasts.
[0119] FIG. 15 shows representative brightfield images at 4x magnification on reprogramming day 11 After three and four transfections of BJ, adult dermal and juvenile foreskin fibroblasts.
[0120] FIGs. l6A-16B show self-renewal marker expression in iPSCs generated after three transfections of adult dermal and juvenile foreskin fibroblasts with the reprogramming mixture.
[0121] FIG. 16A shows % expression of each individual marker.
[0122] FIG. 16B shows histogram overlays for each marker compared to its corresponding fluorescence minus one (FMO) control.DETAILED DESCRIPTION OF THE DISCLOSURE
[0123] Provided herein are compositions and methods for reprogramming of cells. It is to be understood that this application is not limited to particular formulations or process parameters, as these may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Further, it is understood that a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present inventions.Compositions
[0124] In some embodiments, a composition of the disclosure comprises at least 1, 2, 3, 4, 5 or more double stranded miRNA mimic. In certain embodiments, a composition of the disclosure includes at least 1 double stranded miRNA mimic. In embodiments, a composition of the disclosure includes at least 2 double stranded miRNA mimic. In some embodiments, a composition of the disclosure includes at least 3 double stranded miRNA mimic. In certain embodiments, a composition of theDocket No. 65907-703.601 disclosure includes at least 4 double stranded miRNA mimic. In embodiments, a composition of the disclosure includes at least 5 double stranded miRNA mimic. In some embodiments, a composition of the disclosure comprises at lease 1, 2, 3, 4, 5 or more double stranded miRNA mimic. In some embodiments, the composition of the disclosure further comprises one or more nucleic acids i.e., one or more polynucleotides optionally one or more RNA polynucleotides encoding a reprogramming factor. In some embodiments, the compositions of the disclosure further comprises at least one modulator of an interferon response or a nucleic encoding the at least one modulator or the interferon response. In some embodiments, provided herein is a composition comprising (a) one or more RNA polynucleotides that encode a reprograming factor; and (b) at least one double stranded miRNA mimic that comprises a first strand and a second strand. In some embodiments, the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides. In some embodiments, provided herein is a composition for generating reprogrammed cells comprising: one or more RNA polynucleotides that encode a reprogramming factor; and at least one double stranded miRNA mimic that comprises a first strand and a second strand. In some embodiments, the at least one double stranded mimic lacks a bulge region. In some embodiments, the provided herein is a composition that comprises one or more RNA polynucleotides that encode a reprograming factor, and at least one double stranded miRNA mimic at a concentration of at least about 960 ng.
[0125] In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 18 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 19 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 20 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 21 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 22 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 23 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 24 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 25 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region ofDocket No. 65907-703.601 complete complementarity between the first strand and the second strand over at least 26 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides.
[0126] In some embodiments, the first strand is at least 17 nucleotides in length. In some embodiments, the first strand is at least 18 nucleotides in length. In some embodiments, the first strand is at least 19 nucleotides in length. In some embodiments, the first strand is at least 20 nucleotides in length. In some embodiments, the first strand is at least 21 nucleotides in length. In some embodiments, the first strand is at least 22 nucleotides in length. In some embodiments, the first strand is at least 23 nucleotides in length.
[0127] In some embodiments, the first strand is at least 24 nucleotides in length. In some embodiments, the first strand is at least 25 nucleotides in length. In some embodiments, the first strand is at least 26 nucleotides in length. In some embodiments, the first strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
[0128] In some embodiments, the second strand is at least 17 nucleotides in length. In some embodiments, the second strand is at least 18 nucleotides in length. In some embodiments, the second strand is at least 19 nucleotides in length. In some embodiments, the second strand is at least 20 nucleotides in length. In some embodiments, the second strand is at least 21 nucleotides in length. In some embodiments, the second strand is at least 22 nucleotides in length. In some embodiments, the second strand is at least 23 nucleotides in length. In some embodiments, the second strand is at least 24 nucleotides in length. In some embodiments, the second strand is at least 25 nucleotides in length.
[0129] In some embodiments, the second strand is at least 26 nucleotides in length. In some embodiments, the second strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length. In some embodiments, the first strand and the second strand are of the same length or of different lengths. In some embodiments, the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA.
[0130] In some embodiments, the portion comprises at least 15 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 16 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 17 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 18 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 19 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 20 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 21 contiguous nucleotides of the sequence of the naturally occurring miRNA.Docket No. 65907-703.601
[0131] In some embodiments, the portion comprises at least 21 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 22 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 23 contiguous nucleotides of the sequence of the naturally occurring miRNA.
[0132] In some embodiments, the portion comprises at least 24 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 25 nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 26 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA.
[0133] In some embodiments, the first strand comprises a nucleotide sequence identical to the sequence of the naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to a guide sequence of the naturally occurring miRNA. In some embodiments, the first strand and / or the second strand further comprises one or more nucleotide overhangs at the 5' end and / or the 3' end. In some embodiments, the second strand further comprises a one or two nucleotide overhang on the 3' end. In some embodiments, the first strand further comprises a one or two nucleotide overhang on the 3' end.
[0134] In some embodiments, the composition comprises at least 2 double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the composition comprises at least 3 double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the composition comprises at least 3 double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the composition comprises at least 4 double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the composition comprises at least 5 double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA. In some embodiments, the composition comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different. In some embodiments, the naturally occurring miRNA is a human miRNA.Docket No. 65907-703.601
[0135] In some embodiments, the naturally occurring miRNA is hsa-miR-367. In some embodiments, the naturally occurring miRNA is hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
[0136] In some embodiments, the naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa-miR-302a. In some embodiments, the naturally occurring miRNA is hsa-miR- 302b.
[0137] In some embodiments, the naturally occurring miRNA is hsa-miR-302c. In some embodiments, the naturally occurring miRNA is hsa-miR-302d.
[0138] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-367. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302a. In some embodiments, the composition comprises a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302c. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302d, or a combination thereof. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-367, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302a, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302c, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302d, or a combination thereof.
[0139] In some embodiments, the first strand comprises a nucleotide sequence as set forth SEQ ID No: 1. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 2. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 3. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 4. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 5.
[0140] In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 6. In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 7. In some embodiments, the second strand comprises a nucleotide sequence as set forthDocket No. 65907-703.601SEQ ID No: 8. In some embodiments, the second strand comprises a nucleotide sequence as set forth SEQ ID No: 9.
[0141] In some embodiments, the second strand comprises a nucleotide sequence as set forth SEQ ID No: 10. In some embodiments, the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10.
[0142] In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 6. In embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 7. In certain embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 8. In further embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 9. In additional embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0143] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10.
[0144] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4. In some embodiments, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2,Docket No. 65907-703.601 a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or a combination thereof.
[0145] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10.
[0146] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or a combination thereof.
[0147] In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the composition comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10. In some embodiments, the compositionDocket No. 65907-703.601 comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10, or a combination thereof.
[0148] In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6. In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0149] In some embodiments, provided herein is a composition, comprising: one or more RNA polynucleotide encoding a reprogramming factor, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7, aDocket No. 65907-703.601 double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, and a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0150] In some embodiments, the first strand is partially complementary to a target mRNA. In some embodiments, the first strand is completely complementary to the target mRNA. In some embodiments, the first strand is a guide strand. In some embodiments, the second strand is a passenger strand. In some embodiments, the one or more RNA polynucleotides lack a nucleotide modification. In some embodiments, the first strand comprises a phosphate group at the 5’ end. In some embodiments, the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end. In some embodiments, the second strand lacks a nucleotide modification.
[0151] In some embodiments, the at least one double stranded miRNA mimic lacks a hairpin region. In some embodiments, the at least one double stranded miRNA mimic lacks a mismatch between the first strand and the second strand. In some embodiments, the at least one double stranded miRNA mimic lacks a bulge region.
[0152] In some embodiments, the one or more RNA polynucleotides comprise a 5’-Cap structure. In some embodiments, the 5’-Cap structure is m7GpppNmp-RNA. In some embodiments, the 5’-Cap structure is m7GpppNp-RNA. In some embodiments, the one or more RNA polynucleotides comprise 5' cap analog. In some embodiments, the one or more RNA polynucleotides comprise an anti reverse Cap analog (ARCA). In some embodiments, the 5' cap analog is a 5' diguanosine cap. In some embodiments, the one or more RNA polynucleotides comprises a 5 ’-Cap structure, optionally wherein the 5’-Cap structure is m7GpppNmp-RNA or m7GpppNp-RNA, 5' cap analog, or an anti reverse Cap analog (ARCA), optionally wherein the 5' cap analog is a 5' diguanosine cap. In some embodiments, the reprogramming factor is OCT4. In some embodiments, the reprogramming factor is OCT3. In some embodiments, the reprogramming factor is SOX1. In some embodiments, the reprogramming factor is SOX2. In some embodiments, the reprogramming factor is SOX3. In some embodiments, the reprogramming factor is SOX15. In some embodiments, the reprogramming factor is KLF1. In some embodiments, the reprogramming factor is KLF2. In some embodiments, the reprogramming factor is KLF4. In some embodiments, the reprogramming factor is KLF5. In some embodiments, the reprogramming factor is c-Myc. In some embodiments, the reprogramming factor is L-Myc. In some embodiments, the reprogramming factor is N-Myc. In some embodiments, the reprogramming factor is LIN28. In some embodiments, the reprogramming factor is NANOG. In some embodiments, the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MYC, a LIN28 and aDocket No. 65907-703.601NANOG. In some embodiments, the reprogramming factor polypeptide is selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28.
[0153] In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4.In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT3.In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX1. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX2. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX3. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX15. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF1. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF2. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF4. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF5. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes c-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes L-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes N-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes LIN28. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes NANOG. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combination thereof.
[0154] In some embodiments, the c-MYC comprises at least one amino acid mutation relative to a corresponding WT c-MYC. In some embodiments, the at least one amino acid mutation comprises an amino acid substitution, an amino acid deletion and / or an amino acid insertion. In some embodiments, the at least one amino acid mutation comprises a mutation at amino acid residue T58 relative to a corresponding WT c-MYC. In some embodiments, the mutation at amino acid residue T58 is a T58A amino acid substitution. In some embodiments, the composition of any one of embodiments, further comprising at least one modulator of interferon response or a nucleic acid encoding said at least one modulator of interferon response.Docket No. 65907-703.601
[0155] In some embodiments, the at least one modulator of interferon response comprises an interferon decoy molecule. In some embodiments, the at least one modulator of interferon response comprises a B18R. In some embodiments, the at least one modulator of interferon response comprises an NS3 / 4A. In some embodiments, the at least one modulator of interferon response comprises a nucleic acid encoding the NS3 / 4A.
[0156] In some embodiments, the at least one modulator of interferon response comprises a B18R or a nucleic acid encoding the B18R, an NS3 / 4A or a nucleic acid encoding the NS3 / 4A, or a combination thereof.
[0157] In some embodiments, the nucleic acid encoding the B18R is an RNA encoding the B18R. In some embodiments, the RNA encoding the B18R lacks a nucleotide modification. In some embodiments, the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A. In some embodiments, the RNA encoding the NS3 / 4A lacks a nucleotide modification. In some embodiments, the one or more RNA polynucleotides further comprise a poly(A) tail, a Kozak sequence, a 3' untranslated region, a 5' untranslated region, or any combination thereof. In some embodiments, the one or more RNA polynucleotides are synthetic. In some embodiments, the one or more RNA polynucleotide are recombinant. In some embodiments, the one or more RNA polynucleotides are in vitro transcribed.
[0158] In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 10 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 20 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 30 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 40 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 50 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 60 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 70 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 80 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 90 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 100 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 150 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 200 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 250 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 300 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 350 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at leastDocket No. 65907-703.601 about 400 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 450 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 500 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 550 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 600 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 650 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 700 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 750 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 800 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 850 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 900 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 950 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 960 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 970 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 980 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 990 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 1000 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration of at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration that is higher than 300 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration that is higher than 400 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration that is higher than 450 ng. In some embodiments, the at least one double stranded miRNA mimic is present at a concentration that is higher than 500 ng. miRNA mimicIn some embodiments the compositions and methods herein comprise at least one double stranded miRNA mimic. As used herein, the term “mimic” refers to a molecule that is structurally different from the reference molecule (e.g., the corresponding naturally existing molecule) but is capable of performing one or more or all of the biological, physiological, and / or chemical functions that are within the capabilities of the reference molecule. The mimic and the reference molecule do not haveDocket No. 65907-703.601 to be functional equivalents but the mimetic should be able to perform one or more functions, and exhibiting at least 5% or more, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more of the activity of the reference molecule, as measured and compared using assays or parameters that are suitable to represent the shared function(s). As used herein, a miRNA mimic is a double stranded nucleic acid (synthetic or recombinant) that is structurally different but shares at least one function with its corresponding naturally occurring miRNA. In some embodiments, the naturally occurring miRNA of the disclosure is a human miRNA. In some embodiments, the naturally occurring miRNA is hsa-miR-367. In some embodiments, the naturally occurring miRNA is hsa-miR-302a. In some embodiments, the naturally occurring miRNA is hsa-miR-302b. In some embodiments, the naturally occurring miRNA is hsa- miR-302c. In some embodiments, the naturally occurring miRNA is hsa-miR-302d.
[0159] In some embodiments, the naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
[0160] The term “miRNA” (microRNA) or a “naturally occurring miRNA” relates to noncoding RNAs found in eukaryotic cells that, by inducing degradation and / or preventing translation of target mRNAs, modulate a plethora of cell functions, including those related to ESC self- renewal / differentiation and cell cycle progression. miRNAs are post-transcriptional regulators that bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing. In some embodiments, the naturally occurring miRNA is hsa-miR-302b (MIMAT0000715). In some embodiments, the naturally occurring miRNA is hsa-miR-302c (MIMAT0000717). In some embodiments, the naturally occurring miRNA is hsa-miR 302a (MIMAT0000684). In some embodiments, the naturally occurring miRNA is hsa- miR-302d (MIMAT0000718). In some embodiments, the naturally occurring miRNA is hsa-miR-367 (MIMAT0000719).
[0161] In some embodiments, the naturally occurring miRNA is the following RNA sequences registered in the miRbase, hsa-miR-302b (MIMAT0000715), hsa-miR-302c (MIMAT0000717), hsa- miR 302a (MIMAT0000684), hsa-miR-302d (MIMAT0000718), hsa-miR-367 (MIMAT0000719) or a combination thereof. In some embodiments, the naturally occurring miRNA comprises miRNA included in RNA specified by hsa-miR-302-367. The symbol “hsa-miR-” represents human miRNA, and the symbol “mmu-miR-” represents mouse miRNA. miRNA is first transcribed as pri-miRNA from a corresponding gene, then this pri-miRNA generates pre-miRNA having a characteristic hairpin structure of about 70 nucleotides, and this pre-miRNA is further processed into mature miRNA, which is mediated by Dicer. Pre-miRNA in the cellular nucleus is transported from the nucleus to the cytosol by exportin protein or the like, and is further processed in the cytosol by another RNase known as Dicer to thereby produce double-stranded mature microRNA (miR). One RNA strand of double-stranded miR is selected, activated by binding to the ribonucleoprotein complex RISC, and binds to target mRNA based on the sequence of miR. This strand is typicallyDocket No. 65907-703.601 called a guide strand. Naturally occurring miRNAs are characterized by imperfect complementarity between the guide strand and their target sequences.
[0162] The other strand of the double stranded mature miRNA is ejected from the RISC complex and degraded. This typically discarded strand is generally referred to as a passenger strand. A distinguishing feature of mature miRNA is the presence of bulges and base mismatches. As such, miRNA duplexes are imperfectly paired i.e., the guide strand and the passenger strand of a miRNA are not 100% complementary and comprise one or more mismatches. In some embodiments, a naturally occurring miRNA is a pri-miRNA. In some embodiments, a naturally occurring miRNA is a pre-miRNA. In some embodiments, a naturally occurring miRNA is a mature double stranded microRNA.
[0163] In some embodiments, a naturally occurring miRNA encompasses any naturally occurring form of a miRNA e.g., a pri-miRNA, a pre-miRNA, or a mature double stranded microRNA.
[0164] The miRNA mimic of the disclosure is double stranded and comprises a first strand and a second strand. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 18 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 19 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 20 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 21 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 22 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 23 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 24 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 25 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 26 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 27 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 28 contiguousDocket No. 65907-703.601 nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 29 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 30 contiguous nucleotides. In some embodiments, the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides.
[0165] In some embodiments, the first strand comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 18 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 19 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 20 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 21 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 22 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 23 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 24 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 25 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 26 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 27 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 28 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 29 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 30 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA.
[0166] In some embodiments, the first strand comprises a nucleotide sequence identical to at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA.Docket No. 65907-703.601
[0167] In some embodiments, the miRNA mimic lacks a hairpin region of the corresponding naturally occurring miRNA. In some embodiments, the miRNA mimic lacks a bulge region (typically formed due to mismatches between the guide strand and the passenger strand of the miRNA) of the naturally occurring miRNA.First strand
[0168] In some embodiments, the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA. In some embodiments, the portion comprises at least 15 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 16 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 17 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 18 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 19 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 20 contiguous nucleotides of the sequence of the naturally occurring miRNA.
[0169] In some embodiments, the portion comprises at least 21 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 22 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 23 contiguous nucleotides of the sequence of the naturally occurring miRNA.
[0170] In some embodiments, the portion comprises at least 24 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 25 contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA (i.e., a naturally occurring miRNA. By “a contiguous nucleotides” is meant a continuous series of at least 17 nucleotides or at least 17 nucleotide positions without any gap, nick, or interruption. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 17 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 18 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 19 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100%Docket No. 65907-703.601 identical) to at least 20 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 21 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 22 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 23 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 24 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 25 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 26 contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical (e.g., 100% identical) to at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or more contiguous nucleotides of a nucleotide sequence (e.g., nucleotide sequence of a guide strand) of a naturally occurring miRNA. In some embodiments the first strand comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a guide strand of a naturally occurring miRNA. In some embodiments the first strand comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a passenger strand of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to a sequence of a naturally occurring miRNA.Second strand
[0171] In some embodiments, the second strand of the miRNA mimic comprises a nucleotide sequence that is substantially complementary to the nucleotide sequence of the first strand. As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence (e.g., the first strand of the miRNA mimic) in relation to a second nucleotide sequence (e.g., the second strand of the miRNA mimic), refers to the ability of the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the second nucleotide sequence, as will be understood by the skilled person.
[0172] The terms “complementary,” “completely complementary” and “substantially complementary” herein can be used with respect to the base matching between the first strand of a miRNA mimic and a second strand of the miRNA mimic. Such sequences can be referred to as “completely complementary” or “substantially complementary” with respect to each other when thereDocket No. 65907-703.601 are 0 mismatched base pairs upon hybridization of the two sequences. Where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences are completely complementary, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of a mRNA target. However, where the first strand and / or the second strand are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a first strand comprising a sequence 21 nucleotides in length and the second strand comprising a sequence 19 nucleotides in length, wherein the longer first strand comprises a sequence of 19 nucleotides that is fully complementary to the shorter second strand, can yet be referred to as “completely complementary” for the purposes described herein.“Complementary” sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
[0173] In some embodiments, the first strand comprises a nucleotide sequence identical to at least 16 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 18 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 19 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 20 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 21 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 22 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 23 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 24 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 25 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 26 contiguous nucleotides of a nucleotide sequence of a naturally occurring miRNA. In some embodiments, the first strand comprises a nucleotide sequence identical to at least 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the nucleotide sequence of the naturally occurring miRNA. In some embodiments, the first strand is at least 16 nucleotides in length. In someDocket No. 65907-703.601 embodiments, the first strand is at least 17 nucleotides in length. In some embodiments, the first strand is at least 18 nucleotides in length. In some embodiments, the first strand is at least 19 nucleotides in length. In some embodiments, the first strand is at least 20 nucleotides in length. In some embodiments, the first strand is at least 21 nucleotides in length. In some embodiments, the first strand is at least 22 nucleotides in length. In some embodiments, the first strand is at least 23 nucleotides in length. In some embodiments, the first strand is at least 24 nucleotides in length. In some embodiments, the first strand is at least 25 nucleotides in length. In some embodiments, the first strand is at least 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length. In some embodiments, the second strand is at least 16 nucleotides in length. In some embodiments, the second strand is at least 17 nucleotides in length. In some embodiments, the second strand is at least 18 nucleotides in length. In some embodiments, the second strand is at least 19 nucleotides in length. In some embodiments, the second strand is at least 20 nucleotides in length. In some embodiments, the second strand is at least 21 nucleotides in length. In some embodiments, the second strand is at least 22 nucleotides in length. In some embodiments, the second strand is at least 23 nucleotides in length. In some embodiments, the second strand is at least 24 nucleotides in length. In some embodiments, the second strand is at least 25 nucleotides in length. In some embodiments, the second strand is at least 26 nucleotides in length. In some embodiments, the second strand is at least 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length. In some embodiments, the first strand and the second strand are of the same length. In some embodiments, the first strand and the second strand are not of the same length. In some embodiments, the first strand is a guide strand. In some embodiments, the second strand is a passenger strand. In some embodiments, the first strand is a passenger strand. In some embodiments, the second strand is a guide strand.
[0174] In some embodiments, the first strand and / or the second strand further comprises an overhang at the 5' end and / or the 3' end. In some embodiments, the overhang is at least one nucleotide. In some embodiments, the overhang is at least 2 nucleotides. In some embodiments, the overhang is at least 3 nucleotides. In some embodiments, the overhang is at least 4 nucleotides. In some embodiments, the overhang is at least 5 nucleotides. In some embodiments, the overhang is at least 6 nucleotides. In some embodiments, the overhang is at least 7 nucleotides. In some embodiments, the overhang is at least 8 nucleotides. In some embodiments, the overhang is at least 9 nucleotides. In some embodiments, the overhang is at least 10 nucleotides. In some embodiments, the overhang is at least one, 2, 3, 4, 5 ,6, 7, 8, 9, 10 or more nucleotides. In some embodiments, the first strand and / or the second strand further comprises a one or two nucleotide overhang at the 5' end and / or the 3' end. In some embodiments, the second strand further comprises a one or two nucleotide overhang on the 3' end. In some embodiments, the first strand further comprises a one or two nucleotide overhang on the 3' end.
[0175] In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the firstDocket No. 65907-703.601 strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-367. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302a. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa- miR-302b. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302c. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302d.
[0176] In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-367, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302a, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302b, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302c, a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a hsa-miR-302d, or a combination thereof.
[0177] In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID No: 1. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 2. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 3. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 4. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ IDNo: 5. In some embodiments, the first strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 1, 2, 3, 4 or 5. In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 6. In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 7. In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 8. In some embodiments, the second strandDocket No. 65907-703.601 comprises a nucleotide sequence as set forth in SEQ ID No: 9. In some embodiments, the second strand comprises a nucleotide sequence as set forth in SEQ ID No: 10. In some embodiments, the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 6. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 10. In some embodiments, the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 6; the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 7; the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 8; the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 9; or the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0178] In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1,Docket No. 65907-703.601 a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or a combination thereof.
[0179] In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10. In some embodiments, the composition and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9, a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or a combination thereof.
[0180] In some embodiments, the composition, and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6. In some embodiments, the composition, and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, the composition, and methods herein (e.g., comprising at least oneDocket No. 65907-703.601 double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the composition, and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9. In some embodiments, the composition, and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10.
[0181] In some embodiments, the composition, and methods herein (e.g., comprising at least one double stranded miRNA mimic) comprises: a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6; a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7; a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8; a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9; a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10; or a combination thereof.
[0182] In some embodiments, the compositions of the disclosure comprise at least 2 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise at least 3 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise at least 4 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise at least 5 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise at least one, at least 2, 3, 4, 5, or more double stranded miRNA mimics.
[0183] In some embodiments, the compositions of the disclosure comprise a cocktail of miRNA mimics that comprises at least 2 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise a cocktail of miRNA mimics that comprises at least 3 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise a cocktail of miRNA mimics that comprises at least 4 double stranded miRNA mimics. In some embodiments, the compositions of the disclosure comprise a cocktail of miRNA mimics that comprises at least 5 double stranded miRNA mimics. In some embodiments, the compositions of theDocket No. 65907-703.601 disclosure comprise a cocktail of miRNA mimics i.e., comprises at least one, at least 2, 3, 4, 5, or more double stranded miRNA mimics.
[0184] In some embodiments, the composition comprises at least 2 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the composition comprises at least 3 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the composition comprises at least 4 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the composition comprises at least 5 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the composition comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 15 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods disclosed herein comprise introducing in a population of cells (e.g., differentiated cells), at least one double stranded miRNA mimic. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 2 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 3 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 4 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 5 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 2, 3, 4, 5, or more double stranded miRNA mimics.
[0185] In some embodiments, the methods herein comprise introducing at least 2 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods herein comprise introducing at least 3 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods herein comprise introducing at least 4 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods herein comprise introducing at least 5 double stranded miRNA mimics, each of whichDocket No. 65907-703.601 comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods herein comprise introducing at least 6 double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different. In some embodiments, the methods herein comprise introducing at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises the first strand that comprises a nucleotide sequence identical to at least 17 contiguous nucleotides of a nucleotide sequence of a miRNA that is different.
[0186] In some embodiments, the first strand comprises a phosphate group at the 5’ end. In some embodiments, the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end. In some embodiments, the second strand lacks a nucleotide modification. In some embodiments, the first strand lacks a nucleotide modification. In some embodiments the nucleotide modification is a chemical modification. In some embodiments, the first strand only comprises standard nucleotides, such as naturally occurring nucleotides. In some embodiments, the second strand only comprises standard nucleotides, such as naturally occurring nucleotides. In some embodiments, the first strand lacks a nucleotide modification (e.g., a chemical modification), wherein the nucleotide modification is ribose modification, a backbone modification, or a nucleobase modification. In some embodiments, the second strand lacks a nucleotide modification (e.g., a chemical modification), wherein the nucleotide modification is ribose modification, a backbone modification, or a nucleobase modification. In some embodiments, the second strand lacks a phosphate group at the 5’ end. In some embodiments, the first strand comprises unmodified nucleotides. In some embodiments, the first strand comprises unmodified nucleotides other than a phosphate group at the 5 ’ end. In some embodiments, the second strand comprises unmodified nucleotides. In some embodiments, a nucleotide lacking a modification is a nucleotide that has a deoxyribose sugar or a ribose sugar and a nucleobase selected from adenine, cytosine, guanine, thymine and uracil. In some embodiments, a nucleotide lacking a modification can also be considered a nucleotide that has a nucleoside selected from cytidine, uridine, 5 -methyluridine, guanosine, adenosine, deoxycytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine. The structures of deoxyribose, ribose, adenine, cytosine, guanine, thymine, uracil, cytidine, uridine, 5-methyluridine, guanosine, adenosine, deoxy cytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine are known to those skilled in the art.RNA polynucleotides that encode a reprogramming factor
[0187] In some embodiments, the compositions and methods herein comprise RNA polynucleotides that encode a reprogramming factor. As used herein, the term "RNA" means a molecule comprising at least one ribonucleotide residue. By "ribonucleotide" is meant a nucleotide with a hydroxyl group at the 2 '-position of a beta-D-ribo-furanose moiety. The term includes double stranded RNA, singleDocket No. 65907-703.601 stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA Nucleotides in RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally occurring RNA.
[0188] According to the present disclosure, the term "RNA" includes and preferably relates to "mRNA" which means "messenger RNA" and relates to a "transcript" which may be produced using DNA as template and encodes a peptide or protein and is translatable in a mammalian cell. mRNA can comprise a 5' non translated region, a protein or peptide coding region and a 3' non translated region. mRNA has a limited halftime in cells and in vitro. In some embodiments, the RNA polynucleotide encoding a reprogramming factor is synthetic. In some embodiments, the RNA polynucleotide encoding a reprogramming factor is recombinant. RNA may include whole-cell RNA or a fraction thereof, which may be obtained by a process comprising the isolation of RNA from cells and / or by recombinant means, in particular by in vitro transcription. In some embodiments, the RNA polynucleotide encoding a reprogramming factor is produced by in vitro transcription using a DNA template. The promoter for controlling in vitro transcription can be any suitable promoter for an RNA polymerase. Examples of RNA polymerases are the T7, T3 and SP6 RNA polymerases. In some embodiments, the in vitro transcription is controlled by a T7 or SP6 promoter.
[0189] A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA. A DNA template may also be obtained by PCT amplification. The cDNA containing vector template may comprise vectors carrying different cDNA inserts which following transcription results in a population of different RNA molecules optionally capable of expressing different factors or may comprise vectors carrying only one species of cDNA insert which following transcription only results in a population of one RNA species capable of expressing only one factor. Thus, it is possible to produce RNA capable of expressing a single factor only or to produce compositions of different RNAs such as RNA libraries and whole-cell RNA capable of expressing more than one factor, e.g., a composition of factors specific for embryonic stem cells. The present invention envisions the introduction of all such RNA into somatic cells.
[0190] In some embodiments, the RNA polynucleotide encoding a reprogramming factor must be translatable by the translation machinery of a eukaryotic, preferably mammalian, and more preferably, human cell. Translation generally requires at least a ribosome binding site, a methionine start codon, and an open reading frame encoding a polypeptide (e.g., a reprogramming factor).
[0191] In some embodiments, the RNA polynucleotide encoding a reprogramming factor comprises a Cap structure e.g., at its 5' end. In some embodiments, the RNA polynucleotide encoding aDocket No. 65907-703.601 reprogramming factor comprises a regulatory sequence, which promotes the translation in the cell. In some embodiments, the cap structure comprises a modified 7-methylguanosine, optionally attached by a 5 '-5' bridge to the first transcribed nucleotide of the mRNA chain. In some embodiments, the one or more RNA polynucleotides further comprise a stop codon, a poly(A) tail, a Kozak sequence, a 3' untranslated region, a 5' untranslated region, or any combination thereof.
[0192] In some embodiments, the 5' cap comprises a 5' cap analog e.g., 5' diguanosine cap, tetraphosphate cap analogs having a methylene-bis(phosphonate) moiety (see e.g., Rydzik, A M et al., (2009) Org Biomol Chem 7(22):4763-76), a dinucleotide cap analog having a phosphorothioate modification (see e.g., Kowalska, J. et al., (2008) RNA 14(6): 1119-1131), a cap analog having a sulfur substitution for a non-bridging oxygen (see e.g., Grudzien-Nogalska, E. et al.,(2007) RNA 13(10): 1745-1755), a N7-benzylated dinucleoside tetraphosphate analog (see e.g., Grudzien, E. et al., (2004) RNA 10(9): 1479-1487), or an anti-reverse cap analog (see e.g., Jemielity, J. et al., (2003) RNA 9(9): 1108-1122 and Stepinski, J. et al., (2001) RNA 7(10): 1486-1495).
[0193] In some embodiments, the 5' cap is a 5' diguanosine cap. The 5' cap can allow recognition and attachment of an mRNA to a ribosome to initiate translation. The 5' cap may protect the synthetic, modified RNA from 5' exonuclease mediated degradation. In some embodiments, the RNA polynucleotide encoding a reprogramming factor lacks a 5' cap.
[0194] In some embodiments, the 5 ’-Cap structure is a m7GpppNmp-RNA. m7GpppNmp-RNA or "cap 1" structure in molecular biology, refers to a modification at the 5' end of an RNA molecule where a 7-methylguanosine (m7G) is attached via a triphosphate linkage to the first nucleotide of the RNA chain, with an additional 2'-O-methylation on the first nucleotide ("N") following the cap.(PLoS One. 2018; 13(3): e0193804).
[0195] In some embodiments, the 5 ’-Cap structure is a m7GpppNp-RNA. m7GpppNp-RNA or “cap 0” structure refers to a modification to the 5’ end of an RNA molecule where a N7-methyl guanosine connected to the 5' nucleotide through a 5' to 5' triphosphate linkage.
[0196] In some embodiments, the RNA polynucleotide can further comprises a 5' and / or 3' untranslated region (UTR). Untranslated regions are regions of the RNA before the start codon (5') and after the stop codon (3'), and are therefore not translated by the translation machinery. In some embodiments, the RNA polynucleotide do not comprise a 5' or 3' UTR.
[0197] In some embodiments, the RNA polynucleotide further comprises a Kozak sequence. The “Kozak sequence” refers to a sequence on eukaryotic mRNA having the consensus (gcc)gccRccAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’.
[0198] In some embodiments, the RNA polynucleotide further comprises a “poly (A) tail”, which refers to a 3' homopolymeric tail of adenine nucleotides, which can vary in length (e.g., at least 5 adenine nucleotides) and can be up to several hundred adenine nucleotides). In some embodiments, the poly(A) tail comprises between 1 and 500 adenine nucleotides; in other embodiments the poly(A)Docket No. 65907-703.601 tail comprises at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 225, at least 250, at least 275, at least 300, at least 325, at least 350, at least 375, at least 400, at least 425, at least 450, at least 475, at least 500 adenine nucleotides or more. In one embodiment, the poly(A) tail comprises between 1 and 150 adenine nucleotides. In another embodiment, the poly(A) tail comprises between 90 and 120 adenine nucleotides. In some such embodiments, the poly(A) tail comprises one or more modified nucleosides.
[0199] It is understood in the context of the disclosure that where the methods or the composition comprise more than one RNA polynucleotides encoding a reprogramming factor that each RNA polynucleotide encodes a different RNA reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT3. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX1. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX2. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX3. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a SOX15. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF1. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF2. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF4. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes a KLF5. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes c-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes L-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes N-MYC. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes LIN28. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes NANOG. In some embodiments, the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combinationDocket No. 65907-703.601 thereof.In some embodiments, an RNA polynucleotide encoding a reprogramming factor lacks a nucleotide modification. In some embodiments, an RNA polynucleotide encoding a reprogramming factor lacks a nucleotide modification other than a cap structure at the 5’ end. In some embodiments the nucleotide modification is a chemical modification. In some embodiments, an RNA polynucleotide encoding a reprogramming factor only comprises standard nucleotides, such as naturally occurring nucleotides. In some embodiments, an RNA polynucleotide encoding a reprogramming factor lacks a nucleotide modification (e.g., a chemical modification), wherein the nucleotide modification is ribose modification, a backbone modification, or a nucleobase modification. In some embodiments, an RNA polynucleotide encoding a reprogramming factor comprises unmodified nucleotides. In some embodiments, a nucleotide lacking a modification is a nucleotide that has a deoxyribose sugar or a ribose sugar and a nucleobase selected from adenine, cytosine, guanine, thymine and uracil. In some embodiments, a nucleotide lacking a modification can also be considered a nucleotide that has a nucleoside selected from cytidine, uridine, 5 -methyluridine, guanosine, adenosine, deoxy cytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine. The structures of deoxyribose, ribose, adenine, cytosine, guanine, thymine, uracil, cytidine, uridine, 5- methyluridine, guanosine, adenosine, deoxy cytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine are known to those skilled in the art.Reprogramming Factor
[0200] The term a “reprogramming factor,” as used herein, refers to a developmental potential altering factor, such as a protein which alters the developmental potential of a cell, e.g., a differentiated cell e.g., a somatic cell, to another developmental state, e.g., a less differentiated state e.g., a pluripotent state or a cell having stem cell characteristics. A reprogramming factor can be, for example, a transcription factor that can reprogram cells to a pluripotent state or a variant, homolog or isoform thereof, such as SOX2, OCT3 / 4, KLF4, NANOG, LIN-28, c-MYC, and the like. In some embodiments, the reprogramming factor is OCT4. In some embodiments, the reprogramming factor is OCT3. In some embodiments, the reprogramming factor is SOX1. In some embodiments, the reprogramming factor is SOX2. In some embodiments, the reprogramming factor is SOX3. In some embodiments, the reprogramming factor is SOX 15. In some embodiments, the reprogramming factor is KLF1. In some embodiments, the reprogramming factor is KLF2. In some embodiments, the reprogramming factor is KLF4. In some embodiments, the reprogramming factor is KLF5. In some embodiments, the reprogramming factor is c-Myc. In some embodiments, the reprogramming factor is L-Myc. In some embodiments, the reprogramming factor is N-Myc. In some embodiments, the reprogramming factor is LIN28. In some embodiments, the reprogramming factor is NANOG. In some embodiments, the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MY C, a LIN28 and a NANOG. In some embodiments, the reprogramming factor polypeptide isDocket No. 65907-703.601 selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28.
[0201] In some embodiments, the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MYC, a LIN28, a NANOG or a variant thereof. In some embodiments, the reprogramming factor comprises at least one mutation relative to the corresponding wild type reprogramming factor. In some embodiments, the reprogramming factor that comprises at least one mutation retains their biological activity e.g., ability to alter the developmental potential of a cell. In some embodiments, the reprogramming factor that comprises the at least one mutation relative to a corresponding WT reprogramming factor exhibits improved biological activity relative to the corresponding WT reprogramming factor.
[0202] In some embodiments, the reprogramming factor is a c-MY C that comprises at least one mutation relative to a corresponding WT c-MYC. In some embodiments, the at least one mutation is an amino acid substitution, deletion and / or insertion. In some embodiments, the c-MYC comprises a mutation at amino acid residue T58 relative to corresponding WT c-MYC. In some embodiments, the mutation at amino acid residue T58 is a T58A amino acid substitution. In some embodiments, exogenous expression of a reprogramming factor, using the compositions and methods thereof described herein, induces endogenous expression of one or more reprogramming factors, such that exogenous expression of one or more reprogramming factors is no longer required for stable maintenance of the cell in the reprogrammed or partially reprogrammed state.A reprogramming factor can also be termed a “de -differentiation factor,” which refers to a developmental potential altering factor that induces a cell to de-differentiate to a less differentiated state or phenotype, that is a de-differentiation factor increases the developmental potential of a cell. In the context of cell ontogeny, the term “differentiate”, or “differentiating” is a relative term that refers to a developmental process by which a cell has progressed further down a developmental pathway than its immediate precursor cell. Thus, in some embodiments, a reprogrammed cell, can differentiate to a lineage-restricted precursor cell (such as a mesodermal stem cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as a tissue specific precursor, for example, a cardiomyocyte precursor), and then to an end-stage differentiated cell, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
[0203] Methods to determine expression of a reprogramming factor can include for example, an RNA polynucleotide encoding a reprogramming factor can be tested for its ability to undergo translation and translation efficiency using an in vitro translation assay (e.g., a rabbit reticulocyte lysate assay, a reporter activity assay, or measurement of a radioactive label in the translated protein) and detecting the amount of the polypeptide produced. The expression of a reprogramming factor can be determined using methods such as SDS-PAGE, Western blot, or immunochemistry assays etc.Docket No. 65907-703.601
[0204] By “Oct4” is meant a protein that is encoded by the POU5F1 gene, or a natural or engineered variant, family-member, orthologue, fragment or fusion construct thereof, for example, human Oct4 protein, mouse Oct4 protein, Octi protein, a protein encoded by POU5F1 pseudogene 2, a DNA- binding domain of Oct4 protein or an Oct4-GFP fusion protein. In some embodiments the Oct4 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO:35.
[0205] By “Sox2” is meant a protein that is encoded by the SOX2 gene, or a natural or engineered variant, family-member, orthologue, fragment or fusion construct thereof, for example, human Sox2 protein, mouse Sox2 protein, a DNA-binding domain of Sox2 protein or a Sox2-GFP fusion protein. In some embodiments the Sox2 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 53.
[0206] By “Klf4” is meant a protein that is encoded by the KLF4 gene, or a natural or engineered variant, family-member, orthologue, fragment or fusion construct thereof, for example, human Klf4 protein, mouse Klf4 protein, a DNA-binding domain of Klf4 protein or a Klf4-GFP fusion protein. In some embodiments the klf4 protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO:38.
[0207] By “c-Myc protein” is meant a protein that is encoded by the MYC gene, or a natural or engineered variant, family-member, orthologue, fragment or fusion construct thereof, for example, human c-Myc protein, mouse c-Myc protein, 1-Myc protein, c-Myc (T58A) protein, a DNA-binding domain of c-Myc protein or a c-Myc-GFP fusion protein. In some embodiments the c-Myc protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO:41 or SEQ ID NO: 44. In some embodiments the c-Myc protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO:41. In some embodiments the c-Myc protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 44.
[0208] NANOG is a NK-2 type homeodomain gene, and has been proposed to play a key role in maintaining stem cell pluripotency presumably by regulating the expression of genes critical to embryonic stem cell renewal and differentiation. NANOG behaves as a transcription activator with two unusually strong activation domains embedded in its C terminus. Reduction of NANOG expression induces differentiation of embryonic stem cells. In some embodiments the nanog protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO:47.
[0209] LIN28 is a conserved cytoplasmic protein with an unusual pairing of RNA-binding motifs: a cold shock domain and a pair of retroviral -type CCHC zinc fingers. In mammals, it is abundant in diverse types of undifferentiated cells. In pluripotent mammalian cells, LIN28 is observed in RNase- sensitive complexes with Poly(A)-Binding Protein, and in polysomal fractions of sucrose gradients, suggesting it is associated with translating mRNAs. In some embodiments the nanog protein comprises an amino acid sequence that has at least 70% identity with SEQ ID NO: 50.Docket No. 65907-703.601Interferon response modulators
[0210] In some embodiments, the compositions and methods herein further comprises at least one modulator of interferon response. In some embodiments, the methods disclosed herein further comprises introducing in the population of differentiated cell a nucleic acid encoding at least one modulator of interferon response. In some embodiments, the nucleic acid encoding at least one modulator of interferon response is a DNA or an RNA. In some embodiments, the methods disclosed herein further comprises contacting the population of differentiated cell with the at least one modulator of interferon response. As used herein, the term “modulator of interferon response” refers to an agent (e.g., small molecule, protein, antibody, antibody fragment, soluble receptor, RNA interference molecule etc.) that: (a) inhibits translation of an interferon polypeptide from an mRNA transcript, (b) inactivates an interferon polypeptide, (c) inhibits i.e., blocks or reduces, interferon polypeptide binding to its cognate receptor or (d) binds / sequesters an interferon polypeptide e.g., for degradation. In some embodiments, the interferon polypeptide is a type I interferon polypeptide. In some embodiments, the modulator of interferon response is present in the form of a nucleic acid encoding the modulator of interferon response, optionally wherein the nucleic acid is RNA. In some embodiments, the at least one modulator of interferon response comprises an interferon decoy molecule. An interferon decoy molecule for example, can be a small molecule, protein, antibody, antibody fragment, soluble receptor or nucleic acid encoding it that acts as a decoy receptor for extracellular interferon polypeptide. In some embodiments, the modulator of interferon response comprises a B 18R or a nucleic acid encoding the B 18R and / or an NS3 / 4A or a nucleic acid encoding the NS3 / 4A. In some embodiments, the composition further comprises an B 18R or a nucleic acid encoding the B18R. In some embodiments, the composition further comprises an NS3 / 4A or a nucleic acid encoding the NS3 / 4A. In some embodiments, the nucleic acid encoding the B18R is an RNA encoding the B 18R, optionally wherein the RNA encoding the B 18R lacks a nucleotide modification. In some embodiments, the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A, optionally wherein the RNA encoding the NS3 / 4A lacks a nucleotide modification. For example, the B 18R protein is a vaccinia virus-encoded type I interferon receptor with specificity for mouse, human, rabbit, pig, rat, and cow type I interferons which has potent neutralizing activity. The B 18R protein encoded by the B 18R gene of the Western Reserve vaccinia virus strain. The 60-65 kD glycoprotein is related to the interleukin- 1 receptors and is a member of the immunoglobulin superfamily, unlike other type I IFN-receptors, which belong to the class II cytokine receptor family. The B18R protein has a high affinity (KD, 174 pM) for human IFN alpha. Among viral host response modifiers, the B 18R protein is unique in that it exists as a soluble extracellular, as well as a cell surface protein, enabling blockage of both autocrine and paracrine IFN functions. The B18R protein has been shown to inhibit the antiviral potency of IFN-alphal, IFN-alpha2, IFN-alpha-8 / 1 / 8, and IFN-omega on human cells. The soluble B18R protein is highly potent for neutralizing type I interferons, which include IFN-alpha, beta, delta, kappa. In some embodiments, the B 18R is a VCV B 18R. In someDocket No. 65907-703.601 embodiments, the B18R comprises an amino acid sequence according to SEQ ID NO: 26 or a variant of said amino acid sequence. The term “B18R” includes any variants, in particular mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologs, in particular those which are naturally present. In some embodiments, for example, the modulator of interferon response reduces the level of Interferon polypeptide (IFN), e.g., extracellular IFN. In some embodiments, the modulator of interferon response inhibits IFN gene expression. For example, Hepatitis C virus serine protease NS3 / 4A protein complex is able to interfere with and reduce IFN promoter activity and is a specific inhibitor of IFN gene expression. In some embodiments, the NS3 / 4A is a HCV NS3 / 4A. In some embodiments, the NS3 / 4A comprises an amino acid sequence according to SEQ ID NO: 29 or a variant thereof. The term “NS3 / 4A” includes any variants, in particular mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologs, in particular those which are naturally present. In some embodiments, the modulator of interferon response is introduced prior to, with or after introducing the one or more RNA polynucleotides encoding a reprogramming factor and / or the miRNA mimic. In some such embodiments, introducing a modulator of IFN response results in a decrease in expression of a Type I or Type II IFN relative to that by a corresponding cell not subjected to the introducing of the modulator of IFN response. In some embodiment, the decrease in expression of a Type I or Type II IFN is at least about 2%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
[0211] In some embodiments, introducing a modulator of IFN response results in a decrease in expression of at least one IFN-signature gene relative to that by a corresponding cell not subjected to the introducing of the modulator of IFN response. An IFN-signature gene can be for example, IFNa, IFNB1, IFIT, OAS1, PKR, RIGI, CCL5, RAP1A, CXCL10, IFIT1, CXCL11, MX1, RP11-167P23.2, HERC5, GALR3, IFIT3, IFIT2, RSAD2, and CDC20. In some embodiments, the decrease in expression of an IFN-signature gene is at least about 2%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
[0212] In some embodiments, introducing a modulator of IFN response results in a decrease in level of unbound IFN polypeptide, relative to that in absence of the introducing a modulator of IFN response. In some embodiments, the decrease in level of unbound IFN polypeptide at least about 2%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
[0213] In some embodiments, the compositions herein lack an interferon response modulator. In some embodiments, the methods herein lack the step of introducing an interferon response modulator. In some embodiments, the compositions herein lack an inhibitor of the PKR dependent pathway and / or the OAS-dependent pathway. In some embodiments, the methods herein lack the step of introducing an inhibitor of the PKR dependent pathway and / or the OAS-dependent pathway. An inhibitor of the PKR dependent pathway as used herein includes an agent that specifically inhibits the activity or activation of PKR polypeptide or dephosphorylates eIF2-alpha or prevents its phosphorylation, thereby terminating the PKR-induced signal. For example, E3 can bind directly toDocket No. 65907-703.601PKR and inhibits its activity, resulting in reduced phosphorylation of eIF2-alpha. Vaccinia virus gene K3L encodes a 10.5 kDa homolog of the eIF2-alpha subunit that acts as a non-phosphorylable pseudosubstrate of PKR and competitively inhibits phosphorylation of eIF2-alpha. An inhibitor of OAS dependent pathway, as used herein includes an agent that directly inhibits the expression and / or activity of OAS protein and / or RNase L.
[0214] In some embodiments, an RNA polynucleotide encoding the modulator of interferon response (e.g., B18R and / or NS3 / 4 A) lacks a nucleotide modification. In some embodiments an RNA polynucleotide encoding the modulator of interferon response (e.g., B 18R and / or NS3 / 4 A) lacks a nucleotide modification other than a cap structure at the 5’ end. In some embodiments the nucleotide modification is a chemical modification. In some embodiments, an RNA polynucleotide encoding the modulator of interferon response (e.g., B 18R and / or NS3 / 4A) only comprises standard nucleotides, such as naturally occurring nucleotides. In some embodiments, an RNA polynucleotide encoding the modulator of interferon response (e.g., B 18R and / or NS3 / 4A) lacks a nucleotide modification (e.g., a chemical modification), wherein the nucleotide modification is ribose modification, a backbone modification, or a nucleobase modification. In some embodiments, an RNA polynucleotide encoding the modulator of interferon response (e.g., B18R and / or NS3 / 4 A) comprises unmodified nucleotides. In some embodiments, a nucleotide lacking a modification is a nucleotide that has a deoxyribose sugar or a ribose sugar and a nucleobase selected from adenine, cytosine, guanine, thymine and uracil. In some embodiments, a nucleotide lacking a modification can also be considered a nucleotide that has a nucleoside selected from cytidine, uridine, 5 -methyluridine, guanosine, adenosine, deoxy cytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine. The structures of deoxyribose, ribose, adenine, cytosine, guanine, thymine, uracil, cytidine, uridine, 5 -methyluridine, guanosine, adenosine, deoxy cytidine, deoxyuridine, deoxyguanosine, deoxyadenosine, and thymidine are known to those skilled in the art.Methods to introducing into cells
[0215] In some embodiments, the methods of the present disclosure comprises introducing one or more RNA polynucleotides (e.g., one or more exogenous RNA polynucleotides) that encode a reprogramming factor into a population of cell (e.g., a differentiated cell). In embodiments of the invention, such methods are ex vivo or in vitro. In some embodiments, the methods of the present disclosure comprises introducing at least one double stranded miRNA mimic (e.g., at least one exogenous RNA polynucleotides). In some embodiments, the methods of the present disclosure comprise introducing at least one modulator of interferon response. In some embodiments, the methods of the disclosure comprise introducing a nucleic acid encoding the modulator of interferon response. In some embodiments, the modulator of interferon response comprises an interferon decoy molecule. In some embodiments, the modulator of interferon response comprises a B18R or a nucleic acid encoding the B18R, an NS3 / 4A or a nucleic acid encoding a NS3 / 4A, or a combination thereof.Docket No. 65907-703.601The term “exogenous” as used herein refers to a molecule that has been introduced by a process involving the hand of man into a biological system such as a cell or organism in which it is not normally found, or in which it is found in lower amounts. A reprogramming factor may be considered exogenous if it is introduced into an immediate precursor cell or a progeny cell that inherits the substance. In contrast, the term “endogenous” refers to a reprogramming factor or expression product that is native to the biological system or cell (e.g., endogenous expression of a gene, such as, e.g., SOX2 refers to production of a SOX2 polypeptide by the endogenous gene in a cell).
[0216] In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 2 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 3 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 4 double stranded miRNA mimics.
[0217] In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 5 double stranded miRNA mimics. In some embodiments, the methods disclosed herein comprises introducing in a population of cells (e.g., differentiated cells) at least 2, 3, 4, 5, or more double stranded miRNA mimics.
[0218] In some embodiments, the one or more RNA polynucleotides comprise at least 2 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 3 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 4 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 5 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 6 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 7 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 8 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 9 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 10 RNA polynucleotides encoding a reprogramming factor. In some embodiments, the one or more RNA polynucleotides comprise at least 2, 3, 4, 5, 6 7, 8, 9, 10 or more RNA polynucleotides encoding a reprogramming factor.
[0219] In some embodiments, the at least 2, 3, 4, 5, 6 7, 8, 9, 10 or more RNA polynucleotides are introduced into the population of cell separately. In some embodiments, the at least 2, 3, 4, 5, 6 7, 8, 9, 10 or more RNA polynucleotides are introduced into the population of cell together, for example, as a single composition. In some embodiments, the at least one miRNA mimic comprises at least 2 double stranded miRNA mimics. In some embodiments, the at least one miRNA mimic comprises atDocket No. 65907-703.601 least 3 double stranded miRNA mimics. In some embodiments, the at least one miRNA mimic comprises at least 4 double stranded miRNA mimics. In some embodiments, the at least one miRNA mimic comprises at least 5 double stranded miRNA mimics. In some embodiments, the at least one miRNA mimic comprises at least 2, 3, 4, 5, 6 ,7, 8, 9, 10 or more double stranded miRNA mimics. In some embodiments, the at least 2, 3, 4, 5, 6 ,7, 8, 9, 10 or more double stranded miRNA mimics are introduced into the population of cell separately. In some embodiments, the at least 2, 3, 4, 5, 6 ,7, 8, 9, 10 or more double stranded miRNA mimic are introduced into the population of cell together, for example, as a single composition.
[0220] In some embodiments, the one or more RNA polynucleotides that encode a reprogramming factor are introduced separately from the at least one double stranded miRNA mimic. In some embodiments, the one or more RNA polynucleotides encoding a reprogramming factor are introduced together with the at least one double stranded miRNA mimic, for example, as a single composition.
[0221] In some embodiments, the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response are introduced in the population of differentiated cells using any suitable methods, for example, methods of introducing in vitro can include subjecting a cell in which the nucleic acid composition is to be introduced to a culture medium that comprises the composition to be introduced, and subjecting the cells with an in vitro transfection method such as lipofection, magnetofection, electroporation etc. The compositions comprising the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response can be formulated in any suitable delivery vehicle such as a liposome, nanoparticle, cationic lipids, virus like particles, or micelles.
[0222] Methods of introducing can include viral based methods of introducing exogenous nucleic acids, or physical treatments such as electroporation, nanoparticles, mist or spray (e.g., alcohol spray composition), magnetofection or chemical based methods using cyclodextrin, polymers, liposomes, and nanoparticles. In some embodiments, cationic lipids or mixtures thereof can be used to introduce the compositions described herein, into a cell, such as DOPA, Lipofectamine and UptiFectin by methods of lipofection. In some embodiments, cationic polymers such as DEAE-dextran or polyethylenimine, can be used.
[0223] In some embodiments, the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response can be introduced, for example, by transfection, nucleofection, lipofection, electroporation (see, e.g., Wong and Neumann, Biochem. Biophys. Res. Common. 107:584-87 (1982)), microinjection (e.g., by direct injection of a synthetic, modified RNA), biolistics, cell fusion, and the like. In some embodiments, the introducing is by transfection. In some embodiments, the introducing is by nucleofection. In some embodiments, the introducing is byDocket No. 65907-703.601 lipofection. In some embodiments, the introducing is by electroporation. In an alternative embodiment, the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response can be introduced using a drug delivery system such as a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of the one or more RNA polynucleotides encoding a reprogramming factor and / or a miRNA mimic and also enhances interactions at the negatively charged cell membrane to permit efficient cellular uptake. Cationic lipids, dendrimers, or polymers can either be bound to the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2): 107-116) that encases the one or more RNA polynucleotides encoding a reprogramming factor and / or a miRNA mimic. Exemplary methods for making and using cationic- modified RNA complexes are well provided in Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer Res. 9: 1291-1300; Arnold, A S et al (2007) J. Hypertens. 25: 197-205, which are incorporated herein by reference in their entirety.
[0224] In some embodiments of the aspects described herein, the composition further comprises a reagent that facilitates uptake of the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response into a cell (transfection reagent), such as an emulsion, a liposome, a cationic lipid, a non-cationic lipid, an anionic lipid, a charged lipid, or a penetration enhancer.
[0225] The process for delivery to a cell will necessarily depend upon the specific approach for transfection chosen. One preferred approach is to add the compositions comprising the nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response complexed with a cationic transfection reagent (see below) directly to the cell culture media for the cells.
[0226] Suitable agents for transfection or lipofection include, for example, calcium phosphate, DEAE dextran, lipofectin, lipofectamine, DIMRIE C™, Superfect™, and Effectin™ (Qiagen™), Unifectin™, Maxifectin™, DOTMA, DOGS™ (Transfectam; dioctadecylamidoglycylspermine), DOPE (l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine), DOTAP (l,2-dioleoyl-3- trimethylammonium propane), DDAB (dimethyl dioctadecylammonium bromide), DHDEAB (N,N- di-n-hexadecyl-N,N-dihydroxyethyl ammonium bromide), HDEAB (N-n-hexadecyl-N,N- dihydroxyethylammonium bromide), polybrene, poly(ethylenimine) (PEI), and the like. (See, e.g., Baneqee et al., Med. Chem. 42:4292-99 (1999); Godbey et al., Gene Ther. 6: 1380-88 (1999); Kichler et al., Gene Ther. 5:855-60 (1998); Birchaa et al., J. Pharm. 183: 195-207 (1999)).Docket No. 65907-703.601
[0227] The nucleic acids of the disclosure e.g., one or more RNA polynucleotides encoding a reprogramming factor, a double stranded miRNA mimic and / or a nucleic acid encoding a modulator of interferon response can be introduced with cationic lipid carriers (e.g., Oligofectamine™) or noncationic lipid-based carriers (e.g., Transit-IKOTM™, Minis Bio LLC, Madison, Wis.). Successful introduction of an RNA polynucleotide into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Successful transfection of a RNA polynucleotide or a nucleic acid encoding a modulator of interferon response can also be determined by measuring the protein expression level of the target polypeptide by e.g., Western Blotting or immunocytochemistry. Successful introduction of the miRNA mimic can be determined by measuring the expression levels of the transcript or polypeptide that the miRNA mimic targets.
[0228] Some exemplary transfection reagents that can be used include, for example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97 / 30731). Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000™ (Invitrogen; Carlsbad, Calif.), 293Fectin™ (Invitrogen; Carlsbad, Calif.), Cellfectin™ (Invitrogen; Carlsbad, Calif.), DMRIE-C™ (Invitrogen; Carlsbad, Calif.), FreeStyle™ MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine™ (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine™ (Invitrogen; Carlsbad, Calif.), Optifect™ (Invitrogen; Carlsbad, Calif.), X- tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wis.), TransFast™ Transfection Reagent (Promega; Madison, Wis.), Tfx™-20 Reagent (Promega; Madison, Wis.), Tfx™-50 Reagent (Promega; Madison, Wis.), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPassa DI Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec™ / LipoGen™ (Invitrogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect™ (B-Bridge International, Mountain View, Calif., USA), among others.Docket No. 65907-703.601
[0229] In other embodiments, highly branched organic compounds, termed “dendrimers,” can be used to bind the exogenous nucleic acid, and introduce it into the cell.
[0230] In other embodiments of the aspects described herein — non-chemical methods of transfection are contemplated. Such methods include, but are not limited to, electroporation (methods whereby an instrument is used to create micro-sized holes transiently in the plasma membrane of cells under an electric discharge), sonoporation (transfection via the application of sonic forces to cells), and optical transfection (methods whereby a tiny (~1 pm diameter) hole is transiently generated in the plasma membrane of a cell using a highly focused laser). In other embodiments, particle-based methods of transfections are contemplated, such as the use of a gene gun, whereby the nucleic acid is coupled to a nanoparticle of an inert solid (commonly gold) which is then “shot” directly into the target cell's nucleus; “magnetofection,” which refers to a transfection method, that uses magnetic force to deliver exogenous nucleic acids coupled to magnetic nanoparticles into target cells; “impalefection,” which is carried out by impaling cells by elongated nanostructures, such as carbon nanofibers or silicon nanowires which have been coupled to exogenous nucleic acids. Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols, such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes, such as limonene and menthone.
[0231] In some embodiments, the one or more RNA polynucleotides encoding a reprogramming factor are introduced by electroporation, microinjection or lipofection. In some embodiments, the at least one miRNA mimic is introduced by electroporation, microinjection or lipofection. In some embodiments, a nucleic acid encoding a modulator of interferon response is introduced by electroporation, microinjection or lipofection. Where introducing is performed in vivo, it can include, for example, administering the compositions herein, such as a pharmaceutical composition, to a subject via an appropriate administration route, such that the composition is introduced in a desired cell in vivo.
[0232] In some embodiments, the one or more RNA polynucleotides encoding a reprogramming factor and the at least one miRNA mimic are introduced sequentially or simultaneously. In some embodiments, the one or more RNA polynucleotides encoding a reprogramming factor are introduced before, after and / or simultaneously with the at least one miRNA mimic. In some embodiments, the one or more RNA polynucleotide encoding a reprogramming factor are introduced at least 1 minute, 2 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, or 1 hour before introducing the at least one miRNA mimic. In some embodiments, the one or more RNA polynucleotides encoding a reprogramming factor are introduced at least 1 minute, 2 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, or 1 hour after introducing the at least one miRNA mimic. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, or more. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least oneDocket No. 65907-703.601 day. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 2 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 3 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 4 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 5 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 6 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 7 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 8 days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 2 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 3 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 4 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 5 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 6 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 7 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 8 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed for at least 2, days, 3 days, 4 days, 5 days, 6 days, or 8 consecutive days.
[0233] In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 2 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 3 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 4 days consecutive days. In some embodiments, the introducing ofDocket No. 65907-703.601 the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 5 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 6 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 7 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 8 days consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed at least once for at least 2 days, 4 days, 5 days, 6 days, or 8 consecutive days. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed once, daily for 2 days, 4 days, 5 days, 6 days, or 8 consecutive days.
[0234] In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed every 30 minutes, every 1 hour, every 10 hours, every 12 hours, every 24 hours, daily, every two days, or weekly. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor and / or the at least one miRNA mimic is performed simultaneously.
[0235] In some embodiments, the methods comprise culturing the cells under condition suitable to produce cells having stem cell characteristics. In some embodiments, the methods comprise culturing the cells under condition suitable to reprogram the cells to a less differentiated state. In some embodiments, the culturing is performed for 21 days or less, 20 days or less, 19 days or less, 18 days or less, 17 days or less, 16 days or less, 15 days or less, 14 days or less, 13 days or less, 12 days or less, 11 days or less, 10 days or less, 9 days or less, 8 days or less, 7 days or less, 6 days or less, 5 days or less, 4 days or less, 3 days or less, 2 days or less. In some embodiments, the culturing is performed for 21 days. In some embodiments, the culturing is performed for 20 days. In some embodiments, the culturing is performed for 19 days. In some embodiments, the culturing is performed for 18 days. In some embodiments, the culturing is performed for 17 days. In some embodiments, the culturing is performed for 16 days. In some embodiments, the culturing is performed for 15 days. In some embodiments, the culturing is performed for 14 days. In some embodiments, the culturing is performed for 13 days. In some embodiments, the culturing is performed for 12 days. In some embodiments, the culturing is performed for 11 days. In some embodiments, the culturing is performed for 10 days. In some embodiments, the culturing is performed for 9 days. In some embodiments, the culturing is performed for 8 days. In some embodiments, the culturing is performed for 7 days. In some embodiments, the culturing is performedDocket No. 65907-703.601 for 6 days. In some embodiments, the culturing is performed for 5 days. In some embodiments, the culturing is performed for 4 days. In some embodiments, the culturing is performed for 3 days.
[0236] In some embodiments, the culture condition comprises a culture condition suitable for expression of the one or more RNA polynucleotides encoding the reprogramming factor in the cell i.e., expression of the reprogramming factor encoded by the one or more RNA polynucleotides. In some embodiments, the culture condition comprises a condition suitable for sustained expression of the one or more RNA polynucleotides in the cell. In some embodiments, the introducing of the one or more RNA polynucleotides encoding a reprogramming factor results in the expression of the reprogramming factor in the cell.
[0237] In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 30 minutes. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 1 hour. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 2 hours. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 5 hours. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 10 hours. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 12 hours. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 15 hours.
[0238] In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 20 hours. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 1 day. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 2 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 3 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 4 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 5 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 10 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 12 days. In some embodiments, the expression of the reprogramming factor is sustained after a single introducing of the one or more polynucleotides for at least 30 min, 1 hour, 2 hour, 5 hours, 10 hours, 12 hours, 15 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 10 days, 12 days or more. In someDocket No. 65907-703.601 embodiments, methods comprise culturing the cells under conditions suitable for expression of the one or more RNA polynucleotides in the cell i.e., expression of the reprogramming factor encoded by the one or more RNA polynucleotides. In some embodiments, the culturing is performed for 21 days or less, 20 days or less, 19 days or less, 18 days or less, 17 days or less, 16 days or less, 15 days or less, 14 days or less, 13 days or less, 12 days or less, 11 days or less, 10 days or less, 9 days or less, 8 days or less, 7 days or less, 6 days or less, 5 days or less, 4 days or less, 3 days or less, 2 days or less. In some embodiments, the culturing is performed for 21 days. In some embodiments, the culturing is performed for 20 days. In some embodiments, the culturing is performed for 19 days. In some embodiments, the culturing is performed for 18 days. In some embodiments, the culturing is performed for 17 days. In some embodiments, the culturing is performed for 16 days. In some embodiments, the culturing is performed for 15 days. In some embodiments, the culturing is performed for 14 days. In some embodiments, the culturing is performed for 13 days. In some embodiments, the culturing is performed for 12 days. In some embodiments, the culturing is performed for 11 days. In some embodiments, the culturing is performed for 10 days. In some embodiments, the culturing is performed for 9 days. In some embodiments, the culturing is performed for 8 days. In some embodiments, the culturing is performed for 7 days. In some embodiments, the culturing is performed for 6 days. In some embodiments, the culturing is performed for 5 days. In some embodiments, the culturing is performed for 4 days. In some embodiments, the culturing is performed for 3 days.
[0239] In some embodiments, the cells are allowed to recover under culture conditions between two consecutive introductions. The suitable culture conditions for the methods herein should be selected so that the reprogramming factors are expressed in the cells in amounts and for periods of time which support the reprogramming process to a less differentiated cell and / or producing cells having stem cell characteristics. In some embodiments, at least about 10 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 20 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 30 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 40 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 50 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 60 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 70 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 80 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 90 ng of the at least one miRNA mimic is introduced.
[0240] In some embodiments, at least about 100 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 150 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 200 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 250 ng of the at least one miRNA mimic is introduced. In someDocket No. 65907-703.601 embodiments, at least about 300 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 350 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 400 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 450 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 500 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 550 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 600 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 650 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 700 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 750 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 800 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 850 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 900 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 950 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 960 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 970 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 980 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 990 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 1000 ng of the at least one miRNA mimic is introduced. In some embodiments, at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng or more of the at least one miRNA mimic is introduced.
[0241] In some embodiments, at least about 10 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 20 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 30 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 40 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 50 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 60 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 70 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 80 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 90 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 100 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 150 ng of the one or moreDocket No. 65907-703.601RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 200 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 250 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 300 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 350 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 400 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 450 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 500 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 550 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 600 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 650 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 700 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 750 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 800 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 850 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 900 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 950 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 960 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 970 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 980 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 990 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. In some embodiments, at least about 1000 ng of the one or more RNA polynucleotides encoding a reprogramming factor is introduced.
[0242] In some embodiments, at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng or more of the one or more RNA polynucleotides encoding a reprogramming factor is introduced. It is understood that where more than one RNA polynucleotidesDocket No. 65907-703.601 encoding a reprogramming factor are introduced, the amount of each RNA polynucleotide encoding a reprogramming factor may be the same or different.
[0243] In some embodiments, at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng or more of the at least one miRNA mimic is introduced. It is understood that where more than one miRNA mimic is introduced, the amount of each miRNA mimic may be the same or different.
[0244] In some embodiments, the methods of the disclosure are performed in vitro, in vivo or ex vivo. The cell culture conditions can comprise maintaining and / or expanding in a suitable culture medium. A suitable media includes, but are not limited to, Dulbecco's Modified Eagle's Medium® (DMEM), DMEM F12 Medium®, Eagle's Minimum Essential Medium®, F-12K Medium®, Iscove's Modified Dulbecco's Medium®, RPMI-1640 Medium®, and serum -free medium for culture and expansion of progenitor cells SFEM®. Many media are also available as low-glucose formulations, with or without sodium.Methods of producing cells having stem cell characteristics
[0245] Provided herein are compositions for use in methods for producing cells having stem cell characteristics. Provided herein are methods for producing cells having stem cells characteristics. In embodiments, such methods are ex vivo or in vitro.
[0246] The terms “stem cell” or “undifferentiated cell” as used herein, refer to a cell in an undifferentiated or partially differentiated state that has the property of self-renewal and has the developmental potential to differentiate into multiple cell types, without a specific implied meaning regarding developmental potential (i.e., totipotent, pluripotent, multipotent, etc.). A stem cell is capable of proliferation and giving rise to more such stem cells while maintaining its developmental potential. In theory, self-renewal can occur by either of two major mechanisms. Stem cells can divide asymmetrically, which is known as obligatory asymmetrical differentiation, with one daughter cell retaining the developmental potential of the parent stem cell and the other daughter cell expressing some distinct other specific function, phenotype and / or developmental potential from the parent cell. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. A differentiated cell may derive from a multipotent cell, which itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types each such stem cell can give rise to, i.e., their developmental potential, can vary considerably. Alternatively, some of the stem cells in a population can divide symmetrically into two stem cells, known as stochastic differentiation, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiatedDocket No. 65907-703.601 progeny only. Accordingly, the term “stem cell” refers to any subset of cells that have the developmental potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retain the capacity, under certain circumstances, to proliferate without substantially differentiating. In some embodiments, the term stem cell refers generally to a parent cell whose descendants (progeny cells) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues.
[0247] Terms such as "cell having stem cell characteristics", "cell having stem cell properties" or "stem like cell" are used herein to designate cells which exhibit one or more features typical for a stem cell as discussed above, for example, in some embodiments, typical for an embryonic stem cell. Such features can include, for example, a stem cell morphology such as compact colonies, high nucleus to cytoplasm ratio and prominent nucleoli, normal karyotypes, expression of telomerase activity, expression of cell surface markers that are characteristic for a stem cell, expression of genes that are characteristic for a stem cell, proliferation without transformation; continuous proliferation; self renewal and capacity to generate a wide range of tissues; the ability to differentiate into either the same or a different cell type. The cell surface marker of a stem cell are known. For example, the cell surface markers that are characteristic for embryonic stem cells can include stage-specific embryonic antigen- 3 (SSEA-3), SSEA-4, tumor-related antigen-1-60 (TRA- 1-60), TRA-1-81, and TRA-2- 49 / 6E. The genes that are characteristic for embryonic stem cells are selected, for example, from the group consisting of endogenous OCT4, endogenous NANOG, growth and differentiation factor 3 (GDF3), reduced expression 1 (REXI), fibroblast growth factor 4 (FGF4), embryonic cell-specific gene 1 (ESG1), developmental pluripotency-associated 2 (DPPA2), DPP A4, and telomerase reverse transcriptase (TERT). In one embodiment, the one or more features typical for stem cells include pluripotency. In some embodiments, the cells having stem cell characteristics, exhibit these characteristics although they are derived from differentiated cells, e.g., non-stem cells e.g., somatic cells.
[0248] In some embodiments, the stem cell like cell is an embryonic stem cell like cell. The term “embryonic stem cell” as used herein refers to naturally occurring pluripotent stem cells of the inner cell mass of the embryonic blastocyst. Such cells can similarly be obtained from the inner cell mass of blastocysts derived from somatic cell nuclear transfer (see, for example, U.S. Pat. Nos. 5,945,577, 5,994,619, 6,235,970, which are incorporated herein by reference). Embryonic stem cells are pluripotent and give rise during development to all derivatives of the three primary germ layers: ectoderm, endoderm and mesoderm. In other words, they can develop into each of the more than 200 cell types of the adult body when given sufficient and necessary stimulation for a specific cell type. They do not contribute to the extra-embryonic membranes or the placenta, i.e., are not totipotent. In some embodiments, the determination of whether a cell has a stem cell like characteristic is made by comparing one or more characteristics of the cell to one or more characteristics of a stem cell lineDocket No. 65907-703.601 cultured within the same laboratory. In embodiments of the invention, the stem cell like cell or embryonic stem cell like cell is not derived from fetal or embryonic tissue or cells. In embodiments, the stem cell like cell or embryonic stem cell like cell is derived from adult tissue or cells. In embodiments, the stem cell like cell or embryonic stem cell like cell is derived from adolescent tissue or cells. In some embodiments, the stem cell like cell or embryonic stem cell like cell is derived from pre-adolescent tissue or cells.
[0249] In some embodiments, the embryonic stem cell like cell exhibits an embryonic stem cell phenotype. A cell has the phenotype of an embryonic stem cell if it possesses one or more of the unique characteristics of an embryonic stem cell, such that that cell can be distinguished from other cells not having the embryonic stem cell phenotype. Exemplary distinguishing embryonic stem cell phenotype characteristics include, without limitation, expression of specific cell-surface or intracellular markers, including protein and microRNAs, gene expression profiles, methylation profiles, deacetylation profiles, proliferative capacity, differentiation capacity, karyotype, responsiveness to particular culture conditions, and the like. In some embodiments, the determination of whether a cell has an “embryonic stem cell phenotype” is made by comparing one or more characteristics of the cell to one or more characteristics of an embryonic stem cell line cultured within the same laboratory.
[0250] In some embodiments, the cell having stem cell characteristic is a somatic stem cell like cell i.e., it has one or more characteristics of a somatic stem cell. The term “somatic stem cell” is used herein to refer to any pluripotent or multipotent stem cell derived from non-embryonic tissue, including fetal, juvenile, and adult tissue. Natural somatic stem cells have been isolated from a wide variety of adult tissues including blood, bone marrow, brain, olfactory epithelium, skin, pancreas, skeletal muscle, and cardiac muscle. Each of these somatic stem cells can be characterized based on gene expression, factor responsiveness, and morphology in culture. Exemplary naturally occurring somatic stem cells include, but are not limited to, neural stem cells, neural crest stem cells, mesenchymal stem cells, hematopoietic stem cells, and pancreatic stem cells. In some embodiments, the cell having a stem cell characteristic is a somatic pluripotent cell. In some aspects, described herein, a “somatic pluripotent cell” refers to a somatic cell, or a progeny cell of the somatic cell, that has had its developmental potential altered, i.e., increased, to that of a pluripotent state by contacting with, or the introduction of, one or more reprogramming factors using the compositions and methods described herein.
[0251] In some embodiments, the cell having stem cell characteristics is a progenitor cell. The term “progenitor cell” is used herein to refer to cells that have greater developmental potential, i.e., a cellular phenotype that is more primitive (e.g., is at an earlier step along a developmental pathway or progression) relative to a cell which it can give rise to by differentiation. Often, progenitor cells have significant or very high proliferative potential. Progenitor cells can give rise to multiple distinct cells having lower developmental potential, i.e., differentiated cell types, or to a single differentiated cellDocket No. 65907-703.601 type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
[0252] Stem cells are classified by their developmental potential as: (1) totipotent, meaning able to give rise to all embryonic and extraembryonic cell types; (2) pluripotent, meaning able to give rise to all embryonic cell types; (3) multipotent, meaning able to give rise to a subset of cell lineages, but all within a particular tissue, organ, or physiological system (for example, hematopoietic stem cells (HSC) can produce progeny that include HSC (self-renewal), blood cell restricted oligopotent progenitors and the cell types and elements (e.g., platelets) that are normal components of the blood); (4) oligopotent, meaning able to give rise to a more restricted subset of cell lineages than multipotent stem cells; and (5) unipotent, meaning able to give rise to a single cell lineage (e.g., spermatogenic stem cells). In some embodiments, the cell having stem cell characteristic is totipotent, pluripotent, multipotent, oligopotent, or unipotent.Methods of reprogramming cells
[0253] Provided herein are compositions for use in methods for reprogramming cells. Provided herein are methods for reprogramming cells. The term “reprogramming” as used herein refers to a process that reverses the developmental potential of a cell or population of cells (e.g., a differentiated cell, e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving a cell to a state with higher developmental potential, i.e., backwards to a less differentiated state. The cell to be reprogrammed (e.g., a differentiated cell) can be either partially or terminally differentiated prior to reprogramming. A less differentiated state refers to having a higher “developmental potential” or “developmental potency” than the parent population of differentiated cells. As used herein, the terms “developmental potential” or “developmental potency” refer to the total of all developmental cell fates or cell types that can be achieved by a cell upon differentiation. Thus, a cell with greater or higher developmental potential or a less differentiated state can differentiate into a greater variety of different cell types than a cell having a lower or decreased developmental potential or a higher differentiated state (e.g., a population of differentiated cells from which the reprogrammed cells are obtained). The developmental potential of a cell can range from the highest developmental potential of a totipotent cell, which, in addition to being able to give rise to all the cells of an organism, can give rise to extra- embryonic tissues; to a “unipotent cell,” which has the capacity to differentiate into only one type of tissue or cell type, but has the property of self-renewal, as described herein; to a “terminally differentiated cell,” which has the lowest developmental potential.
[0254] The term “totipotency” refers to a cell with a developmental potential to make all of the cells in the adult body as well as the extra-embryonic tissues, including the placenta. The fertilized egg (zygote) is totipotent, as are the cells (blastomeres) of the morula (up to the 16-cell stage following fertilization).Docket No. 65907-703.601
[0255] The term “pluripotent” as used herein refers to a cell with the developmental potential, under different conditions, to differentiate to cell types with characteristic of all three germ cell layers, i.e., endoderm (e.g., gut tissue), mesoderm (including blood, muscle, and vessels), and ectoderm (such as skin and nerve). A pluripotent cell has a lower developmental potential than a totipotent cell. The ability of a cell to differentiate to all three germ layers can be determined using, for example, a nude mouse teratoma formation assay. In some embodiments, pluripotency can also evidenced by the expression of embryonic stem (ES) cell markers, although the preferred test for pluripotency of a cell or population of cells generated using the compositions and methods described herein is the demonstration that a cell has the developmental potential to differentiate into cells of each of the three germ layers. In some embodiments, a pluripotent cell is termed an “undifferentiated cell.” Accordingly, the terms “pluripotency” or a “pluripotent state” as used herein refer to the developmental potential of a cell that provides the ability for the cell to differentiate into all three embryonic germ layers (endoderm, mesoderm and ectoderm). A cell in a pluripotent state typically has the potential to divide in vitro for a long period of time, e.g., greater than one year or more than 30 passages.
[0256] The term “multipotent” when used in reference to a “multipotent cell” refers to a cell that has the developmental potential to differentiate into cells of one or more germ layers, but not all three. Thus, a multipotent cell can also be termed a “partially differentiated cell.” Multipotent cells are well known in the art, and examples of multipotent cells include adult stem cells, such as for example, hematopoietic stem cells and neural stem cells. “Multipotent” indicates that a cell may form many types of cells in a given lineage, but not cells of other lineages. For example, a multipotent hematopoietic cell can form the many different types of blood cells (red, white, platelets, etc.), but it cannot form neurons. Accordingly, the term “multipotency” refers to a state of a cell with a degree of developmental potential that is less than totipotent and pluripotent.
[0257] It should be understood that the developmental potential of a cell represents a spectrum: a terminally differentiated cell, e.g., a cardiac myocyte, has essentially no developmental potential under natural conditions — that is, under normal circumstances, it cannot differentiate to another cell type; while at the other end of the spectrum, a totipotent embryonic stem cell has the potential to differentiate to or give rise to cells of every type in an organism, as well as the extra-embryonic structures. The term “developmental potential of a cell” is relative. For example, where a stem cell undergoes differentiation to a more differentiated or specialized phenotype, the resulting cell has a reduced developmental potential relative to the stem cell that produced it. Thus, a cell with greater or higher developmental potential can differentiate into a greater variety of different cell types than a cell having a lower or decreased developmental potential.
[0258] Where, for example, a terminally- or only partially-differentiated cell is reprogrammed using the compositions and methods herein to become an induced pluripotent stem cell (an iPS cell), the resulting cell has increased developmental potential or a less differentiated state relative to the cellDocket No. 65907-703.601 that produced it. As used herein, a “change” or “alteration” in the developmental potential of a cell occurs when the range of phenotypes to which a given cell can differentiate or give rise increases or decreases relative to the range naturally available to the cell prior to a differentiation, dedifferentiation or trans-differentiation event. By “increase” in this context of developmental potential is meant that there is at least additional one cell type or lineage to which a given cell can differentiate relative to the potential of the starting cell.
[0259] In some embodiments, reprogramming encompasses a complete or partial reversion of the differentiation state, i.e., an increase in the developmental potential of a cell, to that of a cell having a pluripotent state. In some embodiments, reprogramming encompasses driving a somatic cell to a pluripotent state, such that the cell has the developmental potential of an embryonic stem cell, i.e., an embryonic stem cell phenotype. In some embodiments, reprogramming also encompasses a partial reversion of the differentiation state or a partial increase of the developmental potential of a cell, such as a somatic cell or a unipotent cell, to a multipotent state. Reprogramming also encompasses partial reversion of the differentiation state of a cell to a state that renders the cell more susceptible to complete reprogramming to a pluripotent state when subjected to manipulations, such as those described herein. Such manipulations can result in endogenous expression of particular genes by the cells, or by the progeny of the cells, the expression of which contributes to or maintains the reprogramming. In certain embodiments, reprogramming of a cell using the compositions and methods described herein causes the cell to assume a multipotent state (e.g., is a multipotent cell). In some embodiments, reprogramming of a cell (e.g., a differentiated cell e.g., a somatic cell) using the compositions and methods described herein causes the cell (e.g., a differentiated cell, e.g., a somatic cell) to assume a pluripotent-like state or an embryonic stem cell phenotype. The resulting cells are referred to herein as “reprogrammed cells,” “somatic pluripotent cells,” or “RNA-induced somatic pluripotent cells.” The term “partially reprogrammed somatic cell” as referred to herein refers to a cell which has been reprogrammed from a cell with lower developmental potential by the methods as disclosed herein, such that the partially reprogrammed cell has not been completely reprogrammed to a pluripotent state but rather to a non-pluripotent, stable intermediate state. Such a partially reprogrammed cell can have a developmental potential lower that a pluripotent cell, but higher than a multipotent cell, as those terms are defined herein. A partially reprogrammed cell can, for example, differentiate into one or two of the three germ layers, but cannot differentiate into all three of the germ layers.Differentiated cells
[0260] In some embodiments, the population of differentiated cells is an isolated population of differentiated cells or can form part of an organ, a tissue and / or an organism. The term “differentiated cell” encompasses any somatic cell that is not, in its native form, pluripotent. Thus, the term a “differentiated cell” also encompasses cells that are partially differentiated, such as multipotent cells,Docket No. 65907-703.601 or cells that are stable, non-pluripotent partially reprogrammed, or partially differentiated cells, generated using any of the compositions and methods described herein. In some embodiments, a differentiated cell is a cell that is a stable intermediate cell, such as a non-pluripotent, partially reprogrammed cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such differentiated or somatic cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition of a differentiated cell (including stable, non-pluripotent partially reprogrammed cell intermediates) to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character upon placement in culture. Reprogrammed and, in some embodiments, partially reprogrammed cells, also have the characteristic of having the capacity to undergo extended passaging without loss of growth potential, relative to parental cells having lower developmental potential, which generally have capacity for only a limited number of divisions in culture. In some embodiments, the term “differentiated cell” also refers to a cell of a more specialized cell type (i.e., decreased developmental potential) derived from a cell of a less specialized cell type (i.e., increased developmental potential) (e.g., from an undifferentiated cell or a reprogrammed cell) where the cell has undergone a cellular differentiation process. In some embodiments, the differentiated cell is a mammalian cell. In some embodiments, the differentiated cell is a human cell. In some embodiments, the differentiated cell is a multipotent cell. In some embodiments, the differentiated cell is a unipotent cell.
[0261] As used herein, the term “somatic cell” refers to any cell other than a germ cell, a cell present in or obtained from a pre-implantation embryo, or a cell resulting from proliferation of such a cell in vitro. Stated another way, a somatic cell refers to any cell forming the body of an organism, as opposed to a germline cell. In mammals, germline cells (also known as “gametes”) are the spermatozoa and ova which fuse during fertilization to produce a cell called a zygote, from which the entire mammalian embryo develops. Every other cell type in the mammalian body — apart from the sperm and ova, the cells from which they are made (gametocytes) and undifferentiated, pluripotent, embryonic stem cells — is a somatic cell: internal organs, skin, bones, blood, and connective tissue are all made up of somatic cells. In some embodiments, the somatic cell is a “non-embryonic somatic cell,” by which is meant a somatic cell that is not present in or obtained from an embryo and does not result from proliferation of such a cell in vitro. In some embodiments, the differentiated cell is a fibroblast cell. In some embodiments, the differentiated cell is a somatic cell that is a fibroblast cell.
[0262] Any primary somatic cell type can be used in the preparation of cells having stem characteristics and / or reprogrammed cells using the compositions and methods herein Some nonlimiting examples of primary cells include, but are not limited to, fibroblast, epithelial, endothelial, neuronal, adipose, cardiac, skeletal muscle, immune cells, hepatic, splenic, lung, circulating blood cells, gastrointestinal, renal, bone marrow, and pancreatic cells. The cell can be a primary cell isolated from any somatic tissue including, but not limited to, brain, liver, lung, gut, stomach, intestine, fat,Docket No. 65907-703.601 muscle, uterus, skin, spleen, endocrine organ, bone, etc. The term “somatic cell” further encompasses primary cells grown in culture, optionally wherein the somatic cells are not immortalized.
[0263] Where the cell is maintained under in vitro conditions, suitable tissue culture conditions and methods can be used.
[0264] Further, the parental cell can be from any mammalian species, with non-limiting examples including a murine, bovine, simian, porcine, equine, ovine, or human cell. In some embodiments, the cell is a human cell. In an alternate embodiment, the cell is from a non-human organism such as a non-human mammal.
[0265] In some embodiments, the somatic cell is an “adult somatic cell,” by which is meant a cell that is present in or obtained from an organism other than an embryo or a fetus or results from proliferation of such a cell in vitro. In some embodiments, the compositions and methods for reprogramming a somatic cell described herein can be performed both in vivo and in vitro (where in vivo is practiced when a somatic cell is present within a subject, and where in vitro is practiced using an isolated somatic cell maintained in culture).
[0266] In some embodiments, the differentiated cells are partially differentiated cells. In some embodiments, the differentiated cells are terminally differentiated cells. In some embodiments, the differentiated are obtained from a subject. In some embodiments, the differentiated cells are obtained by in vitro differentiation of a stem cell or a partially differentiated cell. In some embodiments, the differentiated cells are obtained from a cell bank. In some embodiments, the differentiated cells are cultured prior to introducing the compositions herein or performing the methods disclosed herein.
[0267] In some embodiments, the population of differentiated cells is in vitro, ex vivo or in vivo. In some embodiments, the population of differentiated cells is an isolated population of differentiated cells. The term “isolated population” with respect to an isolated population of cells as used herein refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some embodiments, an isolated population is a “substantially pure” population of cells as compared to the heterogeneous population from which the cells were isolated or enriched. In some embodiments, the isolated population is an isolated population of pluripotent cells which comprise a substantially pure population of pluripotent cells as compared to a heterogeneous population of somatic cells from which the pluripotent cells were derived.
[0268] Essentially any cell type can be used with the compositions and methods disclosed herein. In some embodiments, the population of differentiated cells is from a cell line. In some embodiments, the cell line is a mammalian cell line. In some embodiments, the cell line is a human cell line. Examples of human cell lines include, but are not limited to, 293T (embryonic kidney), BT-549 (breast), DMS 114 (small cell lung), DU145 (prostate), HT-1080 (fibrosarcoma), HEK 293 (embryonic kidney), HeLa (cervical carcinoma), HepG2 (hepatocellular carcinoma), HL-60(TB) (leukemia), HS 578T (breast), HT-29 (colon adenocarcinoma), Jurkat (T lymphocyte), M14 (melanoma), MCF7 (mammary), MDA-MB-453 (mammary epithelial), PERC6® (El -transformedDocket No. 65907-703.601 embryonal retina), RXF 393 (renal), SF-268 (CNS), SF-295 (CNS), THP-1 (monocyte-derived macrophages), TK-10 (renal), U293 (kidney), UACC-257 (melanoma), and XF 498 (CNS).
[0269] Examples of rodent cell include, but are not limited to, mouse Sertoli (TM4) cells, mouse mammary tumor (MMT) cells, rat hepatoma (HTC) cells, mouse myeloma (NSO) cells, murine hybridoma (Sp2 / 0) cells, mouse thymoma (EL4) cells, Chinese Hamster Ovary (CHO) cells and CHO cell derivatives, murine embryonic (NIH / 3T3, 3T3 LI) cells, rat myocardial (H9c2) cells, mouse myoblast (C2C12) cells, and mouse kidney (miMCD-3) cells.
[0270] Examples of non-human primate cell lines include, but are not limited to, monkey kidney (CVI-76) cells, African green monkey kidney (VERO-76) cells, green monkey fibroblast (Cos-1) cells, and monkey kidney (CVI) cells transformed by SV40 (Cos-7). Additional exemplary mammalian cell lines are catalogued at the American Type Culture Collection catalog (ATCC®, Mamassas, Va.).
[0271] The description herein is not meant to be limiting and any cell known or used in the art can be reprogrammed by introducing the compositions described herein and / or using the methods herein. In embodiments relating to tissue regeneration or transplantation in a subject, the cells can be from an autologous, i.e., from the same subject, or from heterologous sources.
[0272] In some embodiments, the methods of the present disclosure result in an increase in stability of the one or more RNA polynucleotides relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the methods of the present disclosure result in an increase in expression of the one or more RNA polynucleotides relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the methods of the present disclosure result in an increase in duration of expression of the one or more RNA polynucleotides relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the methods of the present disclosure result in an increase in level of production of cells having stem cell characteristics relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the methods of the present disclosure result in an increase in viability of produced cells having stem cell characteristics relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the methods of the present disclosure result in an increase in number of produced cells having stem cell characteristics relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic. In some embodiments, the corresponding method is a method that introduces the one or more RNA polynucleotide encoding a reprograming factor alone. In some embodiments, the corresponding method comprises introducing a reference double stranded miRNA (e.g., a commercial miRNA) that lacks the region of complete complementarity between a first strand and a second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides e.g., over at least 17Docket No. 65907-703.601 contiguous nucleotide. In some embodiments, the corresponding method comprises introducing a naturally occurring miRNA. In some embodiments, the increase is at least about 1.1%. In some embodiments, the increase is at least about 1.2%. In some embodiments, the increase is at least about 1.5%. In some embodiments, the increase is at least about 2%. In some embodiments, the increase is at least about 3%. In some embodiments, the increase is at least about 4%. In some embodiments, the increase is at least about 5%. In some embodiments, the increase is at least about 6%. In some embodiments, the increase is at least about 7%. In some embodiments, the increase is at least about 8%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 10%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 20%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 30%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 40%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 50%. In some embodiments, the increase is at least about 1.1%, 1.2%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more.
[0273] The methods of the present disclosure result in an increase in stability of the one or more RNA polynucleotides, an increase in expression of the one or more RNA polynucleotides, an increase in duration of expression of the one or more RNA polynucleotides, an increase in level of production of cells having stem cell characteristics, an increase in viability of produced cells having stem cell characteristics; an increase in number of produced cells having stem cell characteristics; or a combination thereof, relative to that upon introducing the one or more RNA polynucleotide encoding a reprograming factor and a corresponding miRNA mimic wherein the second strand does not comprise the nucleotide sequence that is substantially complementary to the nucleotide sequence of the first strand. In some embodiments, the increase in reprogramming efficiency from a starting population of differentiated cells is at least about 1.1%, 1.2%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the increase is at least about 1.1%. In some embodiments, the increase is at least about 1.2%. In some embodiments, the increase is at least about 1.5%. In some embodiments, the increase is at least about 2%. In some embodiments, the increase is at least about 3%. In some embodiments, the increase is at least about 4%. In some embodiments, the increase is at least about 5%. In some embodiments, the increase is at least about 6%. In some embodiments, the increase is at least about 7%. In some embodiments, the increase is at least about 8%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 10%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 20%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 30%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least aboutDocket No. 65907-703.60140%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 50%.
[0274] The term “stability” of RNA relates to the “half-life” of RNA. “Half-life” relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules. In the context of the present disclosure, the half-life of an RNA is indicative for the stability of said RNA. The half-life of RNA may influence the “duration of expression” of the RNA. It can be expected that RNA having a long half-life will be expressed for an extended time period. The term “expression” is used according to its most general meaning and comprises the production of RNA and / or peptides or proteins, e.g., by transcription and / or translation. With respect to RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins. It also comprises partial expression of nucleic acids. In some embodiments, the expression can be transient. In some embodiments, the expression can be stable. Terms such as “RNA expression”, “expressing RNA”, or “expression of RNA” relate to the production of peptide or protein encoded by the RNA. Preferably, such terms relate to the translation of RNA so as to express, i.e., produce peptide or protein encoded by the RNA (e.g., a reprogramming factor).
[0275] An increase in viability mean in the context of the present disclosure that the amount of viable or living cells under certain conditions is higher than the amount of viable or living cells under other conditions, wherein cultivation is performed under the same conditions except the condition which results in the enhanced or increased cell viability, such as introducing the RNA polynucleotide encoding a reprogramming factor and a miRNA mimic. In this context, “same conditions” refer to a situation wherein the same cells are used, the cells are cultured under the same conditions (except the condition which results in the enhanced or increased cell viability) and the cell viability is measured by the same means.
[0276] In some embodiments, the compositions and methods herein result in an improved (i.e., an increased) reprogramming efficiency of the population of differentiation cells to a less differentiated state relative to that upon introducing relative to that upon introducing the one or more RNA polynucleotide encoding a reprograming factor alone. In some embodiments, the increase in reprogramming efficiency from a starting population of differentiated cells is at least about 1.1%, 1.2%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the increase is at least about 1.1%. In some embodiments, the increase is at least about 1.2%. In some embodiments, the increase is at least about 1.5%. In some embodiments, the increase is at least about 2%. In some embodiments, the increase is at least about 3%. In some embodiments, the increase is at least about 4%. In some embodiments, the increase is at least about 5%. In some embodiments, the increase is at least about 6%. In some embodiments, the increase is at least about 7%. In some embodiments, the increase is at least about 8%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 10%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is atDocket No. 65907-703.601 least about 20%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 30%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 40%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 50%.
[0277] In some embodiments, the compositions and methods herein result in an improved (i.e., an increased) reprogramming efficiency of the population of differentiation cells to a less differentiated state relative to that upon introducing relative to that upon introducing upon introducing the one or more RNA polynucleotide encoding a reprograming factor and a corresponding miRNA mimic wherein the second strand does not comprise the nucleotide sequence that is substantially complementary to the nucleotide sequence of the first strand. In some embodiments, the increase is at least about 1.1%, 1.2%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the increase is at least about 1.1%. In some embodiments, the increase is at least about 1.2%. In some embodiments, the increase is at least about 1.5%. In some embodiments, the increase is at least about 2%. In some embodiments, the increase is at least about 3%. In some embodiments, the increase is at least about 4%. In some embodiments, the increase is at least about 5%. In some embodiments, the increase is at least about 6%. In some embodiments, the increase is at least about 7%. In some embodiments, the increase is at least about 8%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 10%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 20%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 30%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 40%. In some embodiments, the increase is at least about 9%. In some embodiments, the increase is at least about 50%.Reprogrammed cells
[0278] In some embodiments, provided herein are reprogrammed cells produced using the compositions and methods discloses herein. The reprogrammed cells are obtained using the compositions and methods disclosed herein from a population of differentiated cells. In some embodiments, the reprogrammed cells are cells having one or more stem cells characteristics. In some embodiments, the reprogrammed cells are cells exhibiting a less differentiated state than the population of differentiated cells from which they are obtained.
[0279] In some embodiments, the reprogrammed cells are isolated reprogrammed cells. In some embodiments, the reprogrammed cells are in vitro, ex vivo or in vivo. In some embodiments, the reprogrammed cells are further cultured. In some embodiments, the reprogrammed cells are cryopreserved. In some embodiments, the reprogrammed cells are administered to a subject in need thereof. In some embodiments, the subject has, is or will be undergoing a transplantation. In some embodiments, the subject is in need of a stem cell therapy. In some embodiments, the subject has, isDocket No. 65907-703.601 or will be undergoing a cancer therapy, for example, a chemotherapy, or a radiation therapy. In some embodiments, the reprogrammed cells are for use in cancer therapy. In some embodiments, the reprogrammed cells are for use in stem cell therapy. In some embodiments, the reprogrammed cells are for use in treatment of radiation induced injury. In some embodiments, the reprogrammed cells are for use in conjunction with an organ transplantation. In some embodiments, the population of differentiated cells from which the reprogrammed cells are obtained are autologous to the subject in need thereof. In some embodiments, the population of differentiated cells from which the reprogrammed cells are obtained are allogeneic to the subject in need thereof. In some embodiments, the reprogrammed cells are totipotent, pluripotent, multipotent, oligopotent, or unipotent. In some embodiments, the reprogrammed cells are stem cells. In some embodiments, the reprogrammed cells are embryonic stem cells, progenitor cell or somatic pluripotent cells.
[0280] To confirm the generation of reprogrammed cells, isolated clones can be tested for the expression of an endogenous stem cell marker. Such expression identifies the cells as induced pluripotent stem cells. Stem cell markers can be selected from the non-limiting group including SSEA1, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl. Methods for detecting the expression of such markers can include, for example, RT- PCR and immunological methods that detect the presence of the encoded polypeptides. Further evidence of reprogramming is shown by a reduction in or the loss of lamin A / C protein expression. Alternatively, reprogramming is detected by measuring an increase in acetylation, such as increased acetylation of H3 and H4 within the promoter of Oct4, or by measuring a decrease in methylation, for example, by measuring the demethylation of lysine 9 of histone 3. In each of these cases, reprogramming is measured relative to a control cell. In other embodiments, reprogramming is assayed by any other method that detects chromatin remodeling leading to the activation of an embryonic stem cell marker, such as Oct4.
[0281] The reprogrammed cells generated using the methods disclosed herein can be used for subjects in need of a stem cell therapy or regenerative medicine. In some embodiments, the methods comprise administering an effective amount of reprogrammed cells generated using the compositions and methods herein to a subject in need thereof. Methods for administering cells to subjects can include systemic injection, for example, i.v. injection, or implantation of cells into a target site in a subject. Cells may be inserted into a delivery device which facilitates introduction by injection or implantation into the subject. Such delivery devices can include tubes, e.g., catheters, for injecting cells and fluids into the body of a recipient subject. In one preferred embodiment, the tubes additionally have a needle, e.g., through which the cells can be introduced into the subject at a desired location. The cells can be prepared for delivery in a variety of different forms. For example, the cells can be suspended in a solution or gel or embedded in a support matrix when contained in such a delivery device. Cells can be mixed with a pharmaceutically acceptable carrier or diluent in which the cells remain viable. In some embodiments, the reprogrammed cells are provided as a suspension. InDocket No. 65907-703.601 some embodiments, the reprogrammed cells are provided as a tissue matrix, scaffold, ex vivo regenerated tissue.Pharmaceutical compositions
[0282] Provided herein are pharmaceutical compositions that comprise the one or more RNA polynucleotides encoding a reprogramming factor and / or the miRNA mimic. Provided herein are pharmaceutical compositions that comprise the reprogrammed cells generated using the compositions and methods disclosed herein. The pharmaceutical compositions can be delivered to or administered to a subject by a variety of routes depending upon whether local or systemic treatment is desired and upon the area to be treated. Exemplary routes include parenteral, intrathecal, parenchymal, intravenous, nasal, oral, and ocular delivery routes. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration. In some embodiments, the pharmaceutical composition is for use in cancer therapy. In some embodiments, the pharmaceutical composition is for use in stem cell therapy. In some embodiments, the pharmaceutical composition is for use in treatment of radiation induced injury. In some embodiments, the pharmaceutical composition is for use in conjunction with an organ transplantation. In some embodiments, the pharmaceutical composition can be administered in a single dose or in two or more doses, as desired or considered appropriate under the specific circumstances. If desired to facilitate repeated or frequent infusions, a non-implantable delivery device, e.g., needle, syringe, pen device, or implantatable delivery device, e.g., a pump, semipermanent stent (e.g., intravenous, intraperitoneal, intracistemal or intracapsular), or reservoir can be used. In some embodiments, the pharmaceutical compositions comprise a pharmaceutically acceptable carrier, diluent or excipient. As used herein, the terms “pharmaceutically acceptable,” “physiologically tolerable,” and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a mammal without the production of undesirable or unacceptable physiological effects such as toxicity, nausea, dizziness, gastric upset, immune reaction and the like. Exemplary liquid carriers include sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Saline-based carriers are most useful for the administration of cells or cell preparations. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. The dosages of the pharmaceutical compositions will also vary depending upon the approach taken, the mode of delivery and / or the disease to be treated. For example, systemic administration without a targeting approach will generally require greater amounts of than either local administration or administration that employs a targeting or homing approach. Depending upon the targeted cell or tissue and the mode of delivery, effective dosages of theDocket No. 65907-703.601 pharmaceutical composition can include, for example, 1 ng / kg of body weight up to a gram or more per kg of body weight and any amount in between. Preferred amounts can be, for example, in the range of 5 pg / kg body weight to 30 pg / kg of body weight or any amount in between.Modifications of the nucleic acids of the disclosure
[0283] In some embodiments, the compositions and methods of the disclosure comprises nucleic acid e.g., an RNA polynucleotide encoding a reprogramming fact, at least one double stranded miRNA mimic, a nucleic acid encoding at least one modulator of interferon response, or a combination thereof. In some embodiments, the nucleic acids of the disclosure can be unmodified. In some embodiments, the nucleic acids of the disclosure comprise one or more modified nucleotides.
[0284] In some embodiments, the modified nucleotide comprises a sugar modification selected from the group consisting of: 2'-O-methyl (2'-0Me), 2'-O-methoxyethyl (2'-M0E), 2'-O-allyl, 2'-O-propyl, 2'-O-fluoroethyl, 2'-fluoro (2'-F), 2'-deoxy, 2'-amino (2'-NH2), 2'-O-(2-methoxyethylamino), 2'-O-(2- dimethylaminoethyl), 2'-O-(2-hydroxyethyl), 2'-O-(2-methoxyethoxy), 2'-O-(3-aminopropyl), 2'-O- (3 -methoxypropyl), locked nucleic acid (LNA; 2'-O,4'-C-methylene), ethylene-bridged nucleic acid (ENA), tricyclo-DNA, north-locked ribose, south-locked ribose, carbocyclic sugar analogs, 4'-thio and 4'-selenium-modified ribose, 3'-O-methyl, and 3'-fluoro.
[0285] In some embodiments, the modified nucleotide comprises a base modification selected from the group consisting of 5 -methylcytidine (m5C), 5 -hydroxymethylcytidine, 5 -formylcytidine, N6- methyladenosine (m6A), N'-methyladenosine (m'A), N7-methylguanosine (m7G), N6,2'-O- dimethyladenosine (m6Am), pseudouridine ( ). 1 -methylpseudouridine (m ' ). N2-methylguanosine (m2G), N2,N2-dimethylguanosine (m2,2G), inosine (I), queuosine, 5 -methyluridine (m5U), 5- hydroxymethyluridine, 5 -methoxyuridine, 5-propynyluridine, 5-propynylcytidine, 2-thiouridine (s2U), 4-thiouridine (s4U), 2,6-diaminopurine, 7-deazaguanosine, 8-oxoguanosine, 5-halouridines (e.g., 5- bromouridine, 5 -iodouridine), isoguanosine, and isoinosine. In some embodiments, the modified nucleotides comprise one or more of pseudouridine, 1 -methylpseudouridine, N6-methyladenosine, 5- methylcytidine, 2'-O-methyl, and 2'-fluoro.
[0286] In some embodiments, the modified nucleotide comprises backbone or linkage modification selected from the group consisting of: phosphorothioate linkages, phosphorodithioate linkages, phosphoramidate linkages, methylphosphonate linkages, boranophosphate linkages, 2'-5' linkages (e.g., 2'-5' phosphodiester), bridged phosphodiester linkages, thioamidate linkages, triazole linkages, non-ionic backbones, peptide nucleic acid (PNA) backbones, and morpholino backbones.
[0287] In some embodiments, the modified nucleotide comprises terminal or conjugate modifications selected from 5'-cap analogs (e.g., Cap 0, Cap 1, Cap 2, anti-reverse cap analogs (ARCA)), 5'- triphosphate, 5 '-diphosphate, 3 '-inverted nucleotide caps, 3 '-amino caps, poly(A) tail modifications, 3 '-cholesterol, 3 '-biotin, 3 '-PEG, or other substituents or conjugates for delivery or stability.Docket No. 65907-703.601
[0288] In some embodiments, the modified nucleotides are present at one or more positions selected from the group consisting of the 5' untranslated region (5' UTR), coding region, 3' untranslated region (3' UTR), and poly (A) tail.Kits
[0289] Provided herein are kits comprising e.g., for use in generating cells having stem cell characteristics or reprogramming cells to a less differentiated state, or generating induced pluripotent stem cells. In some embodiments, the kit comprises one or more RNA polynucleotides encoding a reprogramming factor. In some embodiments, the kit comprises at least one double stranded miRNA mimic. In some embodiments, the kit further comprises a modulator of an interferon response, optionally wherein the modulator is a nucleic acid encoding the modulator, optionally wherein the nucleic acid encoding the modulator is an RNA. In some embodiments, the kit components (e.g., one or more RNA polynucleotides encoding a reprogramming factor, at least one double stranded miRNA mimic, and a modulator of an interferon response) are provided in a container or a vial. Optionally the kit can comprise one or more control components (e.g., one or more control RNA polynucleotides encoding a reprogramming factor, a control miRNA mimic, and a control modulator of an interferon response. In some embodiments, the kit further comprises packaging materials and instructions for use.
[0290] In some embodiments, the kit comprises a DNA template for generation of the RNA polynucleotide encoding a reprogramming factor. In some embodiments, the kit can further comprise one or more antibodies or primer reagents to detect a cell-type specific marker to identify reprogrammed cells. In some embodiments, the kit comprises two or more RNA polynucleotide in an admixture or as separate RNA aliquots. In some embodiments, the kit comprises two or more miRNA mimics in an admixture or as separate aliquots. In some embodiments, the kit comprises the one or more RNA polynucleotides and the at least one miRNA mimic separately. In some embodiments, the kit comprises the one or more RNA polynucleotides and the at least one miRNA mimic in a single cocktail. In some embodiments, the kit further comprises a buffer, a diluent or a reconstitution buffer. In some embodiments, the buffer is RNase-free TE buffer at pH 7.0. In some embodiments, the kit further comprises a container with a cell culture medium, a transfection medium and / or a media supplement. In some embodiments, the one or more components of the compositions herein are provided as a single composition. In some embodiments, one or more components of the composition are provided separate from each other. In some embodiments, the one or more components of the composition are provided in a solution form or a lyophilized form. In some embodiments, the kit of the disclosure further comprises one or more of: a delivery vehicle for introducing the one or more components of the composition into cells, a buffer solution, a reconstitution solution, a stabilizing solution, a culture media an RNase inhibitor, and instructions for reprogramming differentiated cells or instructions for manufacturing a population of induced pluripotent cells.Docket No. 65907-703.601EXAMPLES
[0291] The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present disclosure and are not construed as limiting the scope thereof.Example 1. Reprogramming reagents, design and preparation thereof
[0292] The RNA reprogramming compositions and methods have been developed. The results demonstrated that these compositions and methods can be used to reproducibly generate induced pluripotent stem cells (iPSCs) from human fibroblasts. The protocol includes delivery of mRNA- encoded transcription factors (Oct4, Sox2, Klf4, c-Myc, Lin28, and Nanog) in combination with mimic of miRNAs (302a / b / c / d and 367) and interferon response modulating proteins HCV NS3 / 4A and VACV B18R. The results show that the resulting iPSCs express high levels of pluripotency markers and demonstrate a typical iPSC morphology. The mRNA sequences and the structure of the miRNAs used were designed in-house. Other than a phosphate group present on the 5' end of one the miRNA mimic strands, there are no other nucleotide modifications present in the reprogramming mixture delivered to cells. Moreover, the results show that increasing the concentration of miRNA mimics in the reprogramming mix above that reported for corresponding miRNA enhances cell survival. The compositions and methods do not require viral proteins that directly block PKR / OAS innate immunity pathways, and they can be omitted from the reprogramming composition with no impact on reprogramming efficiency.The reprogramming reagent combination was composed of the following:1. Messenger RNAs encoding for transcription factors: The mRNA components of reprogramming. Introducing mRNAs for genes related to the maintenance of pluripotency drives reprogramming. Codon optimized variants of reprogramming factors, OCT4, c-MYC, KLF4, LIN28, SOX2 and NANOG were generated and tested them in fibroblasts.2. Micro-RNAs (miRNA): Short RNA sequences that bind to target mRNA and inhibit their function. The reprograming factors were supplemented with miRNAs from the 302 / 367 family cluster (302a / b / c / d and 367) to improve reprogramming efficiency. miRNA concentration optimisation experiments were performed. miRNAs from a commercial source were tested. Corresponding miRNA mimics were designed and generated in house. The generated miRNA mimic were double-stranded, non-modified versions of the corresponding miRNA from the 302 / 367 family cluster (302a / b / c / d and 367).3. Inhibitors of innate immunity: Inhibitors of the anti-viral PKR / OAS pathways, which are activated by the addition of exogenous foreign RNA. A literature search was performed which identified the candidate PKR and OAS pathway inhibitors derived from viral genomes. the following proteins were selected for further analysis:Docket No. 65907-703.601PKR Pathway OAS PathwaySFSV NSs MERS-CoV NS4bAcPIO MHV NS2HSV ICP34.54. Type I IFN modulator and RNA-sensing receptor modulators (henceforth both referred to as “IFN response modulators”): Various cell receptors that form part of innate immunity including retinoic acid inducible gene I (RIG-I) and toll-like receptor 3 (TLR3) recognise viral RNAs and in turn initiate signal transduction that results in activation of IFN expression. Type I IFN is secreted and binds to IFN receptors that results in expression of vast number of antiviral interferon signalling genes (ISGs) that include PKR and OAS. Two modulators of this IFN response, B18R and NS3 / 4A, were prepared as mRNAs in a similar fashion to the transcription factors and tested in the reprogramming mix. B 18R binds to IFN and thus prevents activation of ISGs. NS3 / 4A targets RNA sensing receptors that activate IFN.Design of reagents
[0293] The structure of DNA templates used in the in vitro transcription (IVT) reactions to generate mRNA is shown in FIG. 1.
[0294] All DNA templates used in the in vitro transcription (IVT) reactions to generate mRNA (FIG.1) contain the following sequences:
[0295] T7 promoter: For use with CleanCap Reagent AG, the sequence 5'-TAATACGACTCACTATAAG-3' was used.
[0296] 5'UTR: The 5'UTR sequence is5 ’ -GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC
[0297] 3’ UTR: Derived from human alpha-globin gene.The 3 'UTR sequence is 5’-GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACC TCTTGGTCTTTGAATAAAGCCTGAGTAGGAAGTGAGGGTCTAGAACTAGTGTCGACGC
[0298] Transcription factor / viral protein coding sequence (CDS) - The initial coding sequences for each of the transcription factors and viral proteins were taken from the sources below (Table 1) before undergoing additional final codon optimization.Docket No. 65907-703.601Table 1: Exemplary Transcription factor / viral protein coding sequence sources* C-MYC Thr>Ala58 used Azenta codon optimised C-MYC sequence with A>G point mutation introduced post-optimisation.
[0299] Codon optimized transcription factor and viral protein sequences with T7 promoter and 3' and 5' UTRs were extended either side with random sequence in order to meet the minimum sequence sizes required for ordering as HiFi gene fragments (Integrated DNA technologies). HiFi gene fragments were cloned into the pCR4Blunt-TOPO vector (ThermoFisher; cat. K287520) and grown in TOP 10 chemically competent E. coli on ampicillin containing LB agar. Colonies were picked, further grown in LB broth (amp) and plasmid extracted using QIAprep Miniprep kits (Qiagen; cat. 27104). Presence of correct insert sequences was confirmed by Sanger sequencing. NS3 / 4A and ICP34.5 were ordered as synthetic genes cloned into pUC57 backbones (Genscript)Preparation of mRNA
[0300] mRNA was prepared as outlined in FIG. 2. For each mRNA preparation, 100 pg of the corresponding plasmid was amplified in a 50 pL reaction using Phusion high-fidelity DNA polymerase to generate the in vitro transcription (IVT) reaction starting template. The forward primer annealed upstream of the T7 promoter while the reverse primer annealed to the distal region of the 3'UTR and contained a T
[0130] tail, resulting in an “A-tailed” template for IVT. Column purified PCR product was used to generate mRNA in the HiScribe T7 mRNA Kit with CleanCap AG (New England Biolabs) according to the manufacturer’s instructions. No modified nucleotides were added to the IVT reaction. The resulting mRNA was DNase treated to remove residual plasmid DNA / PCR product and re-purified using columns. Full RNA synthesis protocols are provided in Example 13. Prepared mRNA was aliquoted and store at -80°C.Design and Preparation of nuRNAs
[0301] In initial experiments, commercially available 302a / b / c / d and 367 miRNA mimics were used. For subsequence reprogramming experiments, miRNA mimics designed in house were used. TheDocket No. 65907-703.601 miRNA mimics were designed to mimic mature double-stranded miRNAs without hairpin loops as they would appear post Dicer processing. The target strands (those associated with pluripotency) for each of the miRNA mimics corresponded to the known sequences, however the passenger strand sequence was designed to be complementary to the target strand rather than contain bulges or mismatches as is the case for naturally occurring miRNAs. As understood, a bulge in a doublestranded nucleic acid is a segment of mismatch, that comprise 1, 2, 3, 4, 5, 6 or more mismatching nucleotides in the nucleic acid strands. It was reasoned that this would improve stability of the miRNAs and make purification of annealed RNA oligos less complex. Annealing of the oligos resulted in a staggered overlap (See Table 3). A phosphate group was added to 5' end of the target strand to facilitate its preferential loading onto the Argonaute complex.
[0302] The miRNAs were ordered as HPLC-purified annealed RNA oligos (Integrated DNA Technologies). The miRNA sequences were identified from miRbase and the passenger sequences complementary to the 3p target strand manually entered (Table 2).
[0303] Table 2: Exemplary Source of miRNA sequencesDocket No. 65907-703.601
[0304] Table 3: Sequences of RNA oligos and final annealed miRNA mimics. Bold nucleotides represent staggered overlaps. “P” is the phosphate group.Preparation of Reprogramming Cocktail
[0305] Reprogramming cocktail mixes (comprising transcription factor mRNAs, IFN response modulator mRNAs and miRNAs) were prepared according to Table 4. Depending on the experiment, PKR and OAS inhibitors were also added at the amounts indicated in the experimental methods. mRNAs were normalized to 1 pg / pL in advance and mixed at a molar ratio of 3 : 1 : 1 : 1 : 1 : 1 (OCT3 / 4:SOX2:C-Myc: KLF4: LIN28:NANOG). Individual lyophilized miRNAs were reconstituted in nuclease-free H2O and combined in equal molar ratios and the mix normalized to a concentration of 1 pg / pL.Table 4: Amounts of each reprogramming component used per transfection (based on 12-well plate, 2* 104fibroblasts).* NS3 / 4A only added to the final reprogramming mix composition (see Experiment 7).Docket No. 65907-703.601
[0306] The mRNA / miRNA cocktail was normalized to 6pL per transfection with nuclease-free H2O and stored at -80°C until use.Example 2. Cell culture protocolsReprogramming Protocol (Summary)
[0307] FIG. 3 details the basic steps involved in the mRNA reprogramming of human fibroblasts to iPSCs. A detailed protocol can be found in Example 12.
[0308] Human fibroblasts were thawed and cultured for 3 days in a T25 flask in fibroblast medium (DMEM + 10% FBS + 1%NEAA). Cells were replated on 5pg / mL Laminin-521 -coated 12-well plates at 20,000 cells per well in fibroblast medium.
[0309] After 24 hours, 3-6 daily transfections were performed as follows: a. media switched to 800 pL NutriStem (Sartorius) and cells incubated under hypoxic conditions (5% O2) for 4 hrs. b. Before the end of the 4 hr incubation, 6pL of reprograming cocktail was combined with94 pL of OptiMEM (Tube A), and 2.4 pL of RNAiMax with 97.6pL of OptiMEM (Tube B). c. Tube A and Tube B were combined and incubated for 15 mins. The combined 200pL of transfection mixture was added to the cells dropwise. d. The cells were returned to a hypoxic incubator overnight (37°C / 5% CC>2 / % O2).
[0310] Following the last transfection, wells were fed daily with 1 mb NutriStem until colonies appeared. Colonies can then be picked manually and transferred to new 12-well plates for expansion / QC.Example 3. Experimental outline
[0311] Experiment 1: Screening of PKR / OAS inhibitor combinations (SFSV, NS4b, AcPIO).PKR / OAS inhibitors delivered as non-modified mRNAs and their ability to prevent cytotoxicity and promote translation from co-transfected non-modified GFP mRNA was assessed.
[0312] Experiment 2: First test of reprogramming using in-house developed reagents. Excluding our viral protein combinations (other than B18R) from our reprogramming cocktail resulted in improved reprogramming efficiency. Commercially available miRNAs were employed in this experiment. Reprogramming was successful with 4,6 and 8 sequential daily transfections.
[0313] Experiment 3: Testing of alternative commercially available miRNAs. To ensure an easily accessible source of miRNAs, Qiagen miScript miRNAs were tested in the reprogramming cocktail. Reprogramming efficiency was found to be far lower than for Experiment 2, however a miRNA dose response was observed with the highest efficiency at the maximum dose of 0.96pg. Further testing of SFSV, NS4b and AcPIO confirmed that these VPs do not enhance reprogramming efficiency (B18R included as standard across all conditions).Docket No. 65907-703.601
[0314] Experiment 4: Testing of in-house designed miRNAs mimics. miRNA mimics were designed in-house and had them manufactured externally. These provided a significant improvement in reprogramming efficiency compared to commercial miRNAs that were tested previously (up to 3 -fold with 6 transfections). As before, reprogramming efficiency improved with increasing miRNA mimic concentration with the greatest response at the maximum dose of 0.96pg. However, improved cell survival and viability were observed with increasing doses of in-house developed miRNA mimics.
[0315] Experiment 5: Testing of additional PKR / OAS inhibitors (ICP34.5 and NS3 / 4A). To determine whether other viral proteins could further enhance reprogramming, the IFN response modulator NS3 / 4A and the PKR pathway inhibitor ICP34.5 were tested individually and in combination in the reprogramming cocktail. The addition of NS3 / 4A improved reprogramming efficiency (B 18R included as standard across all conditions).
[0316] Experiment 6: Testing of stabilized c-Myc. A T58A mutation in the c-MYC gene, first identified in Burkitt’s Lymphoma patients, is known to enhance c-Myc stability by blocking protein degradation. The reprogramming efficiency of this mutated form of c-Myc was compared to the wildtype form. The mutated c-Myc protein dramatically improved efficiency.
[0317] Experiment 7: Final Reprograming Cocktail Testing and QC. The final combination of reprogramming factors was tested and the enhanced benefit of NS34 / A and B18R addition demonstrated. Induced pluripotent stem cell clones that resulted from the final reprogramming mix were picked and their phenotype confirmed by flow cytometry for pluripotency marker expression.Example 4. Experiment 1, Screening of PKR / OAS inhibitor combinations (SFSV, NS4b, AcPIO).
[0318] Purpose: To identify PKR and OAS inhibitor combinations that prevent cytotoxicity in the presence of non-modified mRNA and enhance protein translation.
[0319] Methods: Fibroblasts were transfected over consecutive days with GFP mRNA using a commercially available transfection reagent (RNAiMAX) to induce PKR / OAS-mediated cytotoxicity and / or inhibition of GFP translation. Different combinations of viral protein mRNA targeting the PKR and OAS pathways were transfected alongside GFP to assess their ability to reduce cytotoxicity or rescue GFP translation in response to multiple deliveries. Transfections were performed daily for 4 days. Twenty-four hours after the final transfection, an XTT viability assay was performed to determine which, if any, of the viral protein combinations could reduce mRNA-induced cytotoxicity (thus indicating inhibition of the OAS and PKR pathways). The presence or absence of GFP expression was determined by fluorescence microscopy.
[0320] Results: Four daily transfections with GFP mRNA led to a small but measurable reduction in the viability of the fibroblasts versus control transfections (FIG 4A-4B). Co-transfection with SFSV+NS4b at 0.1, 0.2 or 0.3 pg per transfection resulted in increased viability versus GFP alone by day 4, indicating enhancement of reprogramming. Similarly, the combination of AcP10+NS4b prevented a decrease in viability but only at the lowest concentration of 0. 1 pg, again all time pointsDocket No. 65907-703.601 tested. Transfection with SFSV+MHV NS2 or AcPIO+MHV NS2 resulted in significantly reduced viability at all concentrations, indicating these were in fact toxic to cells. GFP images confirmed these results, with a higher cell density using SFSV+NS4b and AcP10+NS4b, and a reduced cell density for combinations containing MHV.
[0321] This experiment was repeated for the toxic SFSV+MHV NS2 and AcP10+ MHV NS2 combinations, using lower concentrations of MHV NS2 along with testing an additional viral protein, Influenza A NS 1 (FIG. 5). XTT viability assay results for days 2 and 5 show that these lower concentrations have a modest ability to rescue the viability drop caused by mRNA transfection at the lowest concentration tested.Example 5. Experiment 2, Reprogramming Using In-House Developed Reagents
[0322] Purpose: To test whether in-house developed reprogramming cocktail in conjunction with candidate PKR / OAS pathway inhibitors (SFSV + NS4b and AcPIO + NS4b) can generate iPSCs from fibroblasts.
[0323] Methods: The in-house developed reprogramming cocktail containing mRNA encoding for the six transcription factors OCT3 / 4, SOX2, KLF4, C-MYC, NANOG and LIN28 (OSKMNL) along with the interferon modulator B 18R (together shortened to OSKMNLB) was delivered to cells for 4, 6 or 8 consecutive days with or without the PKR / OAS inhibitor candidates (SFSV + NS4b and AcPIO + NS4b; 80 ng of each individual mRNA). The human BJ fibroblast cell line was used in all experiments (ATCC, cat. CRL-2522). Images were taken on a brightfield microscope daily until colonies appeared. Micro-RNAs from a third-party commercial reprogramming kit were used in this experiment (0.16 pg per transfection).
[0324] Results: This experiment confirmed that in-house generated codon optimized versions of reprogramming mRNA could successfully generate iPSCs from fibroblasts. Morphological changes became apparent in all conditions from Day 3 onwards. Large numbers of colonies appeared in the 6 and 8 consecutive daily transfection conditions without PKR / OAS inhibitors, however only 2 colonies appeared for the 4-transfection condition. Use of the PKR / OAS inhibitors significantly decreased reprogramming efficiency (SFSV / NS4b) or was toxic to the cells (AcP10 / NS4b) (Table 5). Colonies first appeared from days 13 to 15 after the first transfection (FIG. 6). Clones could be manually picked and expanded, and displayed iPSC-like morphology. Flow cytometry performed on these clones showed high levels of expression of self-renewal markers (FIGs. 7A-7C).Docket No. 65907-703.601
[0325] Table 5. Number of iPSC colonies identified per condition on reprogramming Day 15.Colonies were manually counted using a brightfield microscope at 4x magnification. OSKMNLB = transcription factors + B 18R. TNTC = too numerous to count.Example 6. Experiment 3, Testing of Alternative Commercially Available miRNAs
[0326] Purpose: Test reprogramming potential of miRNAs from an alternative commercial source.
[0327] Methods: After reviewing alternative commercial sources of miRNAs, 302a / b / c / d and 367 family miRNAs were sourced from Qiagen (miScript). Transcription factors and IFN modulator B 18R (OSKMNLB) were included as standard in all conditions (as per Table 4) with both 4 and 6 consecutive daily transfections tested. These new miRNAs were tested in two experiments, at amounts ranging from 0.08 - 0.32 pg per transfection in experiment 1 and 0.16 - 0.96 pg in experiment 2. The previously tested PKR / OAS inhibitors were re-tested in the 2nd experiment. For this, SFSV, AcPIO and NS4b were tested individually at 5, 20 and 80 ng per transfection using 6 transfections only. Colonies were counted on day 16 after transfections commenced.
[0328] Results: The Qiagen miRNAs were considerably less effective at promoting reprogramming than those used in Experiment 2 (7 colonies for 0.16pg Qiagen miRNAs after six transfections versus 77 colonies with other third-party miRNAs under the same conditions in Experiment 2). No colonies were observed after 4 transfections, however, increasing numbers of iPSC colonies were observed with increasing amounts of miRNAs after 6 transfections (Table 6). The experiment was repeated with increased amounts of miRNA (up to 0.96pg) to investigate whether reprogramming efficiency could be further improved. While the dose response was again observed as before, the number of resulting iPSC colonies between experiments was different for the same conditions, highlighting experimental variation. The PKR / OAS inhibitors were once again toxic, causing high cell death and forming no or very few colonies (Table 7).Docket No. 65907-703.601
[0329] Table 6. iPSC colony counts for initial testing of miRNAs (Qiagen). Colonies were counted manually under a brightfield microscope at 4x magnification.Table 7. iPSC colony counts for repeat testing of miRNAs (Qiagen). Colonies were counted manually under a brightfield microscope at 4x magnification.Example 7. Experiment 4, Testing of In-House Designed miRNA mimics
[0330] Purpose: To address the poor performance of commercial miRNAs, non-modified mature miRNA mimics were designed in-house and manufactured. Reprogramming efficiency using these new in-house miRNA mimics was assessed.
[0331] Methods: The design of the double-stranded mature miRNA mimics is described above. Reprogramming efficiency after both 4 and 6 transfections was tested across a range of miRNA amounts (0.08 - 0.96 pg per transfection). Daily images were taken but no clone picking nor flow cytometry was performed. OSKMNLB was included as standard in all conditions, with no additional PKR / OAS inhibitors tested. iPSC colonies were counted on day 17 after transfections commenced.Docket No. 65907-703.601
[0332] Results: The in-house designed miRNA mimics greatly outperformed commercial miRNA, though the 4-transfection conditions produced fewer colonies (FIG. 8 and Table 8). iPSC colony numbers increased as miRNA quantities rose from 0.08 to 0.96 pg per well, again demonstrating miRNA dose dependent reprogramming efficiency. Notably, cell density and survival was seen to increase with increasing miRNA mimic amounts (FIG. 9), indicating that miRNAs appear to either promote cell survival as well as improved reprogramming efficiency. As the number of iPSC colonies generated begins to plateau between 0.64 and 0.96pg of miRNA (FIG. 8), 0.96pg was selected for subsequent experiments.
[0333] Table 8. iPSC colony counts for In-house miRNA testing. Colonies were counted manually under a brightfield microscope at 4x magnification.Example 8. Experiment 5, Testing of Additional Viral Proteins (ICP34.5 and NS3 / 4A)
[0334] Purpose: To investigate whether further improvements in reprogramming efficiency could be achieved, a PKR inhibitor (ICP34.5) and an additional IFN response modulator (NS3 / 4A) was assessed in combination with our reprogramming cocktail comprising the miRNA mimics.
[0335] Methods: ICP34.5 and NS3 / 4A were tested, alone and in combination with each other, at 20, 80, or 160 ng per well. OSKMNLB (as per Table 4) was included as standard across all conditions. To facilitate easier detection of differences in efficiency without having to assess excessive numbers of colonies, just four consecutive daily transfections were performed, and 0.64 pg of in-house miRNA mimics used per transfection. iPSC colonies were counted on day 17 after transfections commenced.
[0336] Results: A relatively low number of iPSC colonies formed overall, however, NS3 / 4A alone appeared to increase reprogramming efficiency. ICP34.5 was toxic to the cells, as a reduction in cell density was observed and fewer iPSC colonies than OSKMNLB alone. This was also observed when combining the two inhibitors (Table 9). NS3 / 4A was therefore selected to include in the final reprogramming mix.Docket No. 65907-703.601
[0337] Table 9. iPSC colony counts fortesting of additional PKR / OAS inhibitors. Colonies were manually counted under a brightfield microscope at 4x magnification.Example 9. Experiment 6, Testing of Stabilized c-Myc
[0338] Purpose: The reprogramming efficiency of a stabilized form of the transcription factor c-Myc was compared to that of the wildtype c-Myc that has been used in experiments above comprising the miRNA mimics.
[0339] Methods: A direct comparison between reprogramming mix (OSKMNLB) with and without mutated c-Myc (c-Myc-T58A) was performed. This mutation increases the half-life of c-Myc by introducing a Thr58-Ala mutation, which removes a phosphate group that is targeted for protein degradation. The experiment was performed under normoxic conditions to determine what effect this would have on reprogramming efficiency.
[0340] Results: Normoxic conditions resulted in lower than expected reprogramming efficiency based on previous results. However, replacing wildtype c-Myc with mutated c-Myc T58A resulted in a 7-fold increase in colony numbers. (Table 10).
[0341] Table 10. iPSC colony counts fortesting of stabilised c-Myc. Colonies were manually counted under a brightfield microscope at 4x magnification.Example 10 - Experiment 7, Final Reprograming Approach Testing and QC
[0342] Purpose: Confirmation that B18R and NS3 / 4A IFN response modulators enhances reprogramming efficiency, and that reducing the number of consecutive daily transfections from six to five with these enhancers still results in a high number of iPSC colonies.
[0343] Methods: To confirm the efficacy of the IFN response modulators, the reprogramming cocktail comprising the miRNA mimics was tested in the absence of these modulators, with B 18R alone and with both B18R and NS3 / 4A. It was also examined whether efficient reprogramming would still be achieved with five transfections in place of six, thus reducing the number of burdensomeDocket No. 65907-703.601 process steps. Other previously optimized conditions were incorporated into this experiment including mutated c-Myc (T58A) and the most effective concentration of miRNA mimic (0.96pg per transfection). Colonies were counted using a brightfield microscope at 4x magnification on day 12 after transfections commenced.
[0344] Results: In the absence of IFN response modulators, only two iPSC colonies appeared, and cell density was reduced on day 8, but recovered by day 12 (Table 11 and FIG. 10). Adding B18R increased reprogramming efficiency over 20-fold and maintained higher cell density. Co-addition of B18R and NS3 / 4A yielded the highest reprogramming efficiency, effectively producing a monolayer of iPSCs by day 12 that made discerning individual colonies not possible owing to density. It was notable that very early iPSC colonies were even visible by day 8 after initiation of transfections, even though only five transfections were performed. The components and concentration of the final mix are indicated in Table 12.
[0345] Table 11. iPSC colony counts from testing of the final reprogramming mix. Colonies were manually counted under a brightfield microscope at 4x magnification. TNTC = too numerous to count. *Mutated c-Myc (T58A).Table 12. Components and mass per transfection of finalized reprogramming mastermix comprising the miRNA mimics.
[0346] To confirm that the colonies generated using this mix are phenotypically normal iPSCs, a single colony was selected for testing using a flow cytometry panel for typical self-renewal markers.Docket No. 65907-703.601The selected colony displayed high levels of expression of Tra-1-81, Tra-1-60, OCT3 / 4, and SSEA4, and low expression of SSEA1, indicating atypical iPSC phenotype (FIGs. 11A-1 IB).Example 11. Experiment 8, Testing of Final reprogramming mix on fibroblasts from other donors
[0347] Purpose: Demonstrate that the optimized reprogramming cocktail comprising the miRNA mimics can generate iPSCs from fibroblasts other than the BJ test lines used in preceding experiments.
[0348] Methods: Primary Adult dermal fibroblasts and juvenile foreskin fibroblasts were each plated at 3 cell densities (I x lO4, 2x l04and 3x l04cells per well of 12-well plate) and 5 transfections were performed using the optimized reprogramming mixture. Colonies were counted using a brightfield microscope at 4x magnification on day 12 after transfections commenced.
[0349] Results: At all cell densities tested, adult dermal and juvenile fibroblasts yielded individual iPSC colonies by day 6 that formed a monolayer by day 12 (Table 13 and FIG. 12). Individual colonies could no longer be ascertained at this timepoint owing to the high efficiency of reprogramming. The BJ fibroblast line used in previous experiments was employed as a control at a single density (3x 104well of 12-well plate) and produced distinct individual colonies that were too numerous to count by day 12, reflecting earlier results. FIG. 14 shows representative brightfield images at 4X magnification on days 6 and 12 after commencement of reprogramming BJ.
[0350] Table 13: iPSC colony counts from BJ, adult (dermal) and juvenile (foreskin) fibroblasts. Colonies were manually counted under a brightfield microscope at 4x magnification. TNTC = too numerous to count. *Mutated c-Myc (T58A).Example 12. Experiment 9; Reprogramming with Reduced Number of Daily Transfections
[0351] Purpose: Demonstrate that reducing the number of consecutive daily transfections of the reprogramming mix comprising the miRNA mimics from five to as few as three still results in robust reprogramming of fibroblasts to iPSCs.
[0352] Methods: BJ, primary adult dermal and juvenile foreskin fibroblasts were each plated at 2x 104cells per well of 12-well plate and transfection three and four times using the optimized reprogramming mixture. Colonies were counted using a brightfield microscope at 4x magnification on day 11 after transfections commenced. To investigate the phenotype of the resulting iPSCs, cells colonies were picked, expanded in culture and underwent flow cytometry to assess pluripotency marker expression.Docket No. 65907-703.601
[0353] Results: Adult dermal and juvenile fibroblasts yielded 62 and 78 iPSC colonies, respectively, after three transfections with the reprogramming mixture (Table 14 and FIG. 15). After four transfections, iPSC colonies were too numerous to count for both conditions. To confirm that the colonies generated after 3 transfections are phenotypically normal iPSCs, colonies from reprogrammed adult dermal and juvenile fibroblasts were assessed for self-renewal marker expression by flow cytometry. The colonies displayed high levels of expression of Tra-1-81, OCT3 / 4, and Nanog, indicating a typical iPSC expression profile.Table 14. iPSC colony counts from after three and four transfections of fibroblasts with reprogramming mixture comprising the miRNA mimics. Colonies were manually counted under a brightfield microscope at 4x magnification. TNTC = too numerous to count. *Mutated c-Myc (T58A).Example 13. Results of Experiment 1-Experiment 9
[0354] The Examples 1-9 show the development of technology and a protocol for reprogramming of human somatic cells to iPSCs using non-modified mRNAs and miRNA mimics. The use of mRNAs to generate iPSCs offers several advantages over other commonly used approaches such as rapid clearance from cells and no integration risk. However, introducing exogenous RNA into cells activates innate immunity pathways resulting in upregulation of the integrated stress response and downregulation of translation. The approach used non-modified nucleotides to facilitate reprogramming. The results show that unexpectedly, omitting PKR / OAS inhibitors from the reprogramming mix led to successful reprogramming and generation of iPSCs with a normal phenotype, as determined by pluripotency marker expression, even in the presence of non-modified nucleotides. Efficient reprogramming was achieved with a minimum of six or eight consecutive daily deliveries of the cocktail. Initial tests with alternative commercial miRNAs from Qiagen demonstrated reduced efficacy, though did yield the discovery that reprogramming efficiency and cell survival is directly proportional to the amount of miRNAs present.
[0355] Double-stranded mature miRNA mimics with complementary RNA oligos and a phosphate group on the target strand to facilitate Argonaute loading were designed and generated. These inhouse miRNA mimics generated almost 3x more colonies at higher amounts (0.96 pg) and up to 55x more colonies at lower amounts (0.16 pg) versus the commercially obtained corresponding miRNA. The same reprogramming dose response was also demonstrated with the miRNA mimics, with the number of iPSC colonies beginning to plateau at the largest amount tested, 0.96 pg. This amount also appears to offer protection against cell loss in response to multiple transfections.Docket No. 65907-703.601
[0356] Two further modifications to the reprogramming cocktail led to significant improvements in its performance. The first was the addition of a second IFN response modulator, NS3 / 4A. While B 18R acts as an IFN decoy to modulate its activity, NS3 / 4A acts upstream of IFN thereby helping to prevent its activation the first place. Stricter blockading of IFN activation and signaling rather than blocking the actions of ISGs appeared to be adequate to allow repeat delivery and translation of exogenous RNA. The second improvement was introducing a T58A mutation into c-Myc, which increases its half-life and therefore bioavailability. With all of these improvements incorporated into the reprogramming mixture, the results demonstrated highly efficient reprogramming of fibroblasts to iPSCs, with as little as three transfections producing a monolayer of iPSC colonies with a typical self renewal marker expression profile for iPSCs.
[0357] The data also showed that PKR and OAS inhibitors are not essential to block innate RNA recognition pathways and facilitate the repeat transfections of non-modified RNA required to drive reprogramming. Instead, the results show that inhibiting PKR or OAS is not required for successful reprogramming with non-modified RNA even when high concentrations of in-house developed miRNA mimics are used in conjunction with combined IFN response modulators B18R and NS3 / 4A.Example 14. Protocols for mRNA reprogramming of cells
[0358] Preparation of Reprogramming Cocktail (OSKMNL / B 18R / NS34A / miRNAs)1. Prepare mRNA stocks according to the method outlined in Example 15.2. Prepare 1 pg / pL working stocks of each mRNA (OCT3 / 4, SOX2, KLF4, C-MYC (T58A), NANOG, LIN28, B18R and NS3 / 4A) in nuclease-free H2O. Aliquot and store at -80°C.3. Reconstitute each miRNA to 1 pg / pL in nuclease-free H2O. Prepare a 1 pg / pL mastermix by combining 40 pL of each reconstituted miRNA into a single tube. Aliquot and store at -80°C.4. Prepare single-use aliquots of a combined reprogramming cocktail in 1.5 mb DNase / RNase- free Eppendorf tubes by mixing the following reagents (based on a single transfection, scale- up as required):0.32 pg combined transcription factor mRNA* 0.08 pg Bl 8R and 0.08 pg NS3 / 4A mRNA 0.96 pg miRNA mastermix5. Make up volume to 6 pL per transfection with nuclease-free H2O.6. Store aliquots at -80°C until use.
[0359] *mRNA is added at a at a molar ratio of 3: 1: 1: 1: 1: 1 for OCT3 / 4, SOX2, C-Myc (T58A), KLF4, LIN28 and NANOG. An example calculation is shown in Table 15. Molecular weights were calculated using online calculators from the open reading frame sequence of each mRNA.Docket No. 65907-703.601Table 15. Calculating mass of each mRNA required in total mastermix.
[0360] Fibroblast Thaw & Expansion1. Prepare Fibroblast Medium by combining the following: DMEM + Glutamax-I, 10% FBS (v / v) and 1% MEM NEAA (v / v). Store at 2-8°C for up to 3 weeks2. Pre-warm Fibroblast Medium to room temperature prior to use.3. Thaw human fibroblasts (cryopreserved in CryoStor CS10 at 0.5xl06live cells in 1 mL) using a ThawStar.4. Transfer the cell suspension to a 15 mL centrifuge tube.5. Using a 10 mL serological pipette, add 9 mL of Fibroblast Medium dropwise to the cell suspension.6. Centrifuge the cell suspension at 200g for 5 minutes.7. Remove the supernatant and resuspend the cell pellet in 5 mL Fibroblast Medium.8. Transfer the entire cell suspension to an uncoated T25 culture flask and incubate at 37°C / 5% CO2.9. Fully exchange the medium every 2 days with 5 mL fresh, pre-warmed Fibroblast medium.10. Fibroblasts can be seeded for transfections 3 days post-thaw.
[0361] Seeding for Transfection1. Coat the required number of wells of a 12-well plate with 5 pg / mL Laminin-521 in DPBS (+ / +), 0.6 mL per well. Incubate at 37°C for at least 2 hours.2. Pre-warm fibroblast medium, TrypLE Select and DPBS (- / -) to room temperature.3. Wash the fibroblast-seeded T25 flask 2x with 3 mL DPBS (- / -).4. Add 3 mL TrypLE Select and incubate at 37°C for 3-5 minutes, until cells have detached.Docket No. 65907-703.6015. Add 7 mL Fibroblast Medium to the flask and pipette across the flask surface 3-5x to detach the cells.6. Transfer the cell suspension to a 50 mL centrifuge tube and mix gently 3x to ensure there is a homogenous single cell suspension.7. Remove 0.5 mL for a cell count.8. Centrifuge the remaining cell suspension at 200g for 5 minutes.9. During the centrifugation, perform 3x single cell counts using a NucleoCounter NC-200.10. After centrifugation, remove the supernatant and resuspend the cell pellet to 20,000 live cells / mL in Fibroblast Medium based on the cell count results.11. Remove the Laminin solution from the pre-coated plate(s) and transfer 1 mL cell suspension to each well.12. Gently rock the plate(s) to evenly distribute the cells and incubate overnight at 37°C / 5%CC>2.13. The day of seeding is described as Reprogramming Day 0.
[0362] Daily TransfectionsStarting from Day 1 (Day after seeding) the fibroblasts undergo 4-6 daily transfections as follows:1. Wipe down an MBSC with RNaseZap and 70% ethanol wipes.2. Pre-warm NutriStem medium to room temperature.3. Perform a full medium change (800 pL per well)4. Incubate under hypoxic conditions (37°C / 5% CC>2 / 5% O2) for 4 hours.5. 3 hours after starting the incubation, pre-warm Opti-MEM medium to room temperature.6. 3.5 hours after starting the incubation, transfer the pre-prepared single use aliquots (Tube “A”) of reprogramming cocktail to the MBSC on a cool rack.7. In separate tubes labelled “B”, combine 2.4 pL RNAiMax and 97.6 pL Opti-MEM. Mix gently lOx.8. Once the “A” tubes have thawed, add 94 pL Opti-MEM and mix gently lOx.9. Combine the tubes by pipetting “B” into “A” and immediately gently mixing lOx.10. Allow the reagents to complex by incubating at room temperature for at least 15 minutes.11. Using a P200 pipette, gently mix 2x and pipette 200 pL dropwise into a 12-well.12. Repeat these steps for all wells undergoing transfection.13. If there are any control wells not undergoing transfection, pipette 200 pL Opti-MEM medium dropwise.14. Repeat transfections daily.15. Following the final transfection, all wells are fed daily with 1 mL NutriStem medium. They are kept in a hypoxic incubator until colonies are ready for picking.Docket No. 65907-703.601
[0363] Clone Picking & Expansion
[0364] Colonies are expected to appear from Day 10 onwards or earlier although they should be allowed to reach a suitable size before picking. The ideal colonies will be large, compact, and separate from other colonies to help ensure clonality. Examples of ideal and non-ideal colonies are shown in FIG. 12.
[0365] Once colonies have been selected, manual colony picking should be performed as follows:1. Coat 12-well plate(s) with 5 pg / mL Laminin-521 in (DPBS (+ / +) for at least 2 hours at 37°C (or overnight at 2-8°C). 1 well should be coated per colony, 0.6 m per well.2. Aspirate the laminin from the wells and add 1 m of NutriStem medium per well, prewarmed to room temperature.3. Using a microscope with a stamp objective, circle the colonies that are to be picked.4. Inside an MB SC, use a P200 pipette to manually scrape around a colony while aspirating. First, in a circle, then lightly zigzagging across the centre.5. Transfer the contents of the pipette tip to one of the coated wells containing NutriStem medium.6. Check both plates under a microscope to confirm that the colony has been removed and transferred.7. Repeat this process for all selected colonies.8. Incubate the plate(s) at 37°C / 5% CO2, performing daily full medium changes with 1 mb prewarmed NutriStem medium.
[0366] Daily observations should be performed to confirm the presence of iPSC colonies in the wells.
[0367] Colonies should be manually passaged using the protocol above until the wells contain healthy iPSC colonies that are confirmed free from fibroblasts and differentiation. Once this has been achieved, the wells can be EDTA passaged to another 12-well as follows:1. Coat 12-well plate(s) with 5 pg / mb Eaminin-521 in (DPBS (+ / +) for at least 2 hours at 37°C (or overnight at 2-8°C). 1 well should be coated per clone, 0.6 mb per well.2. Pre-warm NutriStem medium to room temperature.3. Wash the wells 2x with 1 mb room temperature DPBS (- / -).4. Add 1 mb room temperature 0.5 mM EDTA per well and incubate at room temperature for 5- 8 minutes (until cells are shiny and separated but still attached).5. Remove the EDTA and, using a 1 mb pipette, add 1 mb NutriStem medium and pipette gently across the well surface ~5x to detach the colonies and break them into smaller clumps.6. Remove the laminin solution from a coated well and add the cell suspension. Gently rock the plate to evenly distribute the cells.Docket No. 65907-703.6017. Check both plates under a microscope to confirm that the cells were transferred successfully.8. Repeat this process for all wells requiring passage.9. Incubate the plate(s) at 37°C / 5% CO2, performing daily fully medium changes with 1 mb prewarmed NutriStem medium.
[0368] Once 80-85% confluency has been reached, wells can be expanded as required using the steps above, adjusting the reagent volumes as necessary.
[0369] FIGs. 16A and 16B show data indicating self renewal marker expressions.Example 15. Cloning and mRNA GenerationCloning of Gene Fragments into pCR4Blunt-TOPO
[0370] Each mRNA sequence was designed in Snapgene using sources from the literature. They were ordered as either Hifi gBlocks (IDT) or gene fragments (Azenta). These were cloned into plasmids before undergoing in vitro transcription to generate significant quantities of mRNA.1. gBlock / Gene fragments were ligated into the pCR4Blunt-TOPO backbone using the Zero Blunt TOPO Cloning Kit (ThermoFisher, K287520) according to the manufacturer’s instructions. The supplied chemically competent E.coli were transformed with the ligation mixture and grown overnight on ampicillin LB Agar plates at 37°C.2. Bacterial colonies (2-3 per transformation) were picked and grown in LB broth + ampicillin.3. Plasmid DNA was isolated using the QIAPrep Spin Mini Kit (Qiagen, 27104).4. Samples of each plasmid DNA sequence were sent for Sanger sequencing to confirm the presence of the expected insert. For example, FIG. 13 shows exemplary blot evaluating the mRNA quality produced.In Vitro TranscriptionPlasmid Template PCR
[0371] Plasmids were diluted with nuclease-free H20 to 50 pg / pL. Table 16 provides the mastermix that was prepared using Phusion® High-Fidelity DNA Polymerase (NEB, M0530) and added to 2 pL (100 pg) plasmid. Two reactions were prepared per plasmid and combined post PCR.Docket No. 65907-703.601Table 16. Mastermix components
[0372] *Forward primer sequence (5 ’-3 ’): TTGGACCCTCGTACAGAAGC, reverse primer sequence (5’-3’): [T] 130GCGTCGACACTAGTTCTAGACCC
[0373] Reactions were quickly transferred to a thermal cycler pre-heated to 98°C using the thermocycling conditions (annealing temperature and extension time were optimised for each target) provided in Table 17.Table 17. Thermocycling conditions*66°C (OCT3 / 4, SOX2, KLF4, C-MYC-TA, NANOG, LIN28, B18R); 68°C (NS3 / 4A); 69°C (GFP) **50 seconds (OCT3 / 4, SOX2, KLF4, C-MYC (T58A), NANOG, LIN28, B18R); 70 seconds (NS3 / 4A); 30 seconds (GFP)In Vitro Transcription Reaction
[0374] PCR reactions were purified using the Monarch PCR and DNA Clean Up Kit (NEB, T1030L), quantified using the SPECTROstar Nano plate reader and -500 ng (in nuclease-free H20) from each target was transcribed using the HiScribe® T7 mRNA Kit with CleanCap® Reagent AG (NEB, E2080S) according to reaction provided in Table 16.Docket No. 65907-703.601Table 18 shows in vitro transcription reaction
[0375] Reactions were incubated at 37°C in a thermal cycler for 2 hours before the addition of 2 pL DNase I and a further 15 -minute incubation at 37°C. The resulting mRNA was purified using the Monarch RNA clean up kit (NEB, T2050S), quantified using the SPECTROstar Nano plate reader and stored at -80°C.Evaluating Quality of mRNA
[0376] Integrity of mRNA was confirmed by running the IVT products on a 2% E-Gel™ EX Agarose Gel (ThermoFisher, G401002). A single band of the expected size was observed for each mRNA.
[0377] Table 19. Exemplary Sequences for reprogramming factors, IFN response modulators, and inhibitors of PKR / OAS pathway. Also listed are DNA template sequences fortheir mRNA synthesis by in vitro transcription. The DNA template sequence consists of T7 promoter sequence, 5’ UTR sequence, 3’ UTR sequence, and the coding sequence. Also listed are DNA coding sequences for the corresponding mRNA.Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601Docket No. 65907-703.601EMBODIMENTS
[0378] Embodiment 1. A method of producing induced pluripotent stem cells, comprising:(a) providing a population of differentiated cells;(b) introducing into the population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprograming factor, and(ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to produce the induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
[0379] Embodiment 2. The method of embodiment 1, wherein the at least one double stranded miRNA mimic lacks a bulge region.
[0380] Embodiment 3. A method of producing induced pluripotent stem cells, comprising:(a) providing a population of differentiated cells;(b) introducing in said population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprogramming factor, and(ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to generate induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic lacks a bulge region.
[0381] Embodiment 4. A method of manufacturing induced pluripotent stem cells, comprising:(a) providing a population of differentiated cells;(b) introducing in said population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprogramming factor, and(ii) at least one double stranded miRNA mimic; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to generate induced pluripotent stem cells, wherein said induced pluripotent stem cells are generated upon culturing for 15 days or less and / or introducing said (i) and (ii) once for 4 consecutive days or less.
[0382] Embodiment 5. The method of any one of embodiments 1-4, wherein the induced pluripotent stem cells are generated upon culturing for 6 days.
[0383] Embodiment 6. The method of an one of embodiments 1-5, wherein the induced pluripotent stem cells are generated upon introducing the (i) or (ii) once form 3 consecutive days.Docket No. 65907-703.601
[0384] Embodiment 7. A method for improving efficiency of generating a population of induced pluripotent stem cells, the method comprising the steps of:(a) providing a population of differentiated cells;(b) introducing into said population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprograming factor; and(ii) at least one double stranded miRNA mimic; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to generate said population of induced pluripotent stem cells, wherein the method results in(i) a decrease in time required for generation of the induced pluripotent cells upon the culturing step,(ii) an increase in number of induced pluripotent cells generated,(iii) an increase in viability of generated induced pluripotent cells, or(iv) a combination thereof, thereby improving efficiency relative to a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
[0385] Embodiment 8. The method of embodiment 7, wherein the efficiency is improved by at least 10%, 20%, 50%, 75%, 100%, 150%, 200%, 300% or more compared to a corresponding method that lacks introducing the at least one double stranded miRNA mimic.
[0386] Embodiment 9. A method of manufacturing a population of induced pluripotent stem cells, the method comprising the steps of:(a) providing a population of differentiated cells;(b) introducing into said population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprograming factor; and(ii) at least one double stranded miRNA mimic; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to generate said population of induced pluripotent stem cells, wherein the generated induced pluripotent cells exhibit reduced spontaneous differentiation, or maintain pluripotency across at least 3, 4, 5, 6, 7, 8, 9, 10 or more passages, compared to those generated by a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
[0387] Embodiment 10. A method of producing cells having stem cell characteristics comprising the steps of: providing a population of somatic cells;(a) introducing into said population of somatic cells:(i) one or more RNA polynucleotides that encode a reprograming factor, andDocket No. 65907-703.601(ii) at least one double stranded miRNA mimic that comprise a first strand and a second strand;(b) culturing the population of cells from step (b) under conditions suitable to produce cells having stem cell characteristics, wherein the double stranded miRNA mimic (1) comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides, (2) lacks a bulge region, or (3) comprises the region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides and lacks the bulge region.
[0388] Embodiment 11. The method of embodiment 10, wherein the culturing in step (c) results in expression of the one or more RNA polynucleotides in the population of cells from step (b), thereby producing cells having stem cell characteristics.
[0389] Embodiment 12. The method of any one of embodiments 10-11, wherein the introducing of (i) and (ii) results in:(a) an increase in expression of the one or more RNA polynucleotides,(b) an increase in duration of expression of the one or more RNA polynucleotides,(c) an increase in viability of produced cells having stem cell characteristics;(d) an increase in number of produced cells having stem cell characteristics; or(e) a combination thereof, relative to that in a corresponding method lacking the step of introducing the at least one double stranded miRNA mimic.
[0390] Embodiment 13. The method of any one of embodiments 10-12, wherein the cells having stem cell characteristics exhibit a stem cell morphology, normal karyotype, express telomerase activity, express cell surface marker that are characteristic of a stem cell, and / or express genes that are characteristics of a stem cell.
[0391] Embodiment 14. The method of any one of embodiments 10-13, wherein the cells having stem cell characteristics exhibit a pluripotent state.
[0392] Embodiment 15. The method of any one of embodiments 1-14, wherein the double stranded miRNA mimic (1) comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides, (2) lacks a bulge region, or (3) comprises the region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides and lacks the bulge region.
[0393] Embodiment 16. The method of any one of embodiments 1-15, wherein the at least one double stranded miRNA mimic lacks a hairpin region.
[0394] Embodiment 17. The method of any one of embodiments 1-16, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.Docket No. 65907-703.601
[0395] Embodiment 18. The method of any one of embodiments 1-17, wherein the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA.
[0396] Embodiment 19. The method of any one of embodiments 6-18, wherein the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA.
[0397] Embodiment 20. The method of embodiment 19, wherein the first strand comprises a nucleotide sequence identical to the s...
Claims
Docket No. 65907-703.601CLAIMSWHAT IS CLAIMED IS:
1. A method of producing induced pluripotent stem cells, comprising:(a) providing a population of differentiated cells;(b) introducing into the population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprograming factor, and(ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to produce the induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
2. The method of claim 1, wherein the at least one double stranded miRNA mimic lacks a bulge region.
3. A method of producing induced pluripotent stem cells, comprising:(a) providing a population of differentiated cells;(b) introducing in said population of differentiated cells:(i) one or more RNA polynucleotides that encode a reprogramming factor, and(ii) at least one double stranded miRNA mimic that comprises a first strand and a second strand; and(c) culturing the population of differentiated cells from step (b) under conditions suitable to generate induced pluripotent stem cells, wherein the at least one double stranded miRNA mimic lacks a bulge region.
4. The method of any one of claims 1-3, wherein the at least one double stranded miRNA mimic lacks a hairpin region.
5. The method of any one of claims 3-4, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
6. The method of any one of claims 1-5, wherein the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA.
7. The method of any one of claims 1-6, wherein the first strand is partially complementary to a target mRNA in the population of differentiated cells.
8. The method of any one of claims 1-7, wherein the first strand is completely complementary to the target mRNA.
9. The method of any one of claims 7-8, wherein the first strand binds the target mRNA.Docket No. 65907-703.60110. The method of any one of claims 1-9, wherein the at least one double stranded miRNA mimic inhibits translation of the target mRNA.
11. The method of any one of claims 1-10, wherein the at least one double stranded miRNA mimic induces deadenylation, decapping, and / or exonucleolytic digestion of the target mRNA.
12. The method of any one of claims 1-11, wherein the culturing in step (c) results in expression of the one or more RNA polynucleotides in the population of differentiated cells from step (b), thereby producing the induced pluripotent stem cells.
13. The method of claim 12, wherein the expression of the one or more RNA polynucleotides is sustained for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week or more.
14. The method of any one of claims 1-13, wherein the induced pluripotent stem cells are viable for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month or longer.
15. The method of claim 14, wherein the induced pluripotent cells maintain pluripotency across at least 3, 4, 5, 6, 7, 8, 9, 10 or more passages.
16. The method of any one of claims 12-15, wherein the expression of the one or more RNA polynucleotides is higher relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
17. The method of claim 16, wherein the expression of the one or more RNA polynucleotides is higher by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more.
18. The method of any one of claims 12-17, wherein the expression of the one or more RNA polynucleotides is sustained for a longer duration relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
19. The method of claim 18, wherein the expression of the one or more RNA polynucleotides is sustained for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week longer relative to that in a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
20. The method of any one of claims 1-19, wherein the level of induced pluripotent stem cells produced is higher relative to that in a corresponding method lacking the step of introducing the at least one double stranded miRNA mimic.
21. The method of claim 20, wherein the level of induced pluripotent stem cells produced is higher by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to that in a corresponding method lacking the step of introducing the at least one double stranded miRNA mimic.
22. The method of any one of claims 1-21, wherein the induced pluripotent stem cells areDocket No. 65907-703.601(i) viable for a longer duration,(ii) exhibit reduced spontaneous differentiation, and / or(iii) maintain pluripotency across at least 3, 4, 5, 6, 7, 8, 9, 10 or more passages compared those generated by a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
23. The method of claim 22, wherein the induced pluripotent stem cells are viable for at least 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 14 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week longer compared to those generated by a corresponding method that lacks the step of introducing the at least one double stranded miRNA mimic.
24. The method of any one of claims 16-23, wherein the corresponding method comprises introducing a reference double stranded miRNA.
25. The method of any one of claims 1-24, further comprising expanding the induced pluripotent stem cells.
26. The method of any one of claims 1-25, wherein the differentiated cells are mammalian cells.
27. The method of any one of claims 1-26, wherein the differentiated cells are somatic cells.
28. The method of any one of claims 1-27, wherein the differentiated cells are human cells.
29. The method of any one of claims 1-28, wherein the differentiated cells are fibroblast cells.
30. The method of any one of claims 6-29, wherein the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA.
31. The method of any one of claims 6-30, wherein the first strand comprises a nucleotide sequence identical to the sequence of the naturally occurring miRNA.
32. The method of any one of claims 6-31, wherein the first strand comprises a nucleotide sequence identical to a sequence of a guide strand of the naturally occurring miRNA.
33. The method of any one of claims 1-32, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides.
34. The method of any one of claims 1-33, wherein the first strand is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
35. The method of any one of claims 1-34, wherein the second strand is at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
36. The method of any one of claims 1-35, wherein the first strand and the second strand are of the same length or of different lengths.
37. The method of any one of claims 1-36, wherein the first strand is a guide strand.
38. The method of any one of claims 1-37, wherein the second strand is a passenger strand.
39. The method of any one of claims 1-38, wherein the one or more RNA polynucleotides lack a nucleotide modification, optionally wherein the nucleotide modification is a chemical modification.Docket No. 65907-703.60140. The method of any one of claims 1-39, wherein the first strand comprises a phosphate group at the 5’ end.
41. The method of any one of claims 1-39, wherein the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end.
42. The method of any one of claims 1-41, wherein the second strand lacks a nucleotide modification, optionally wherein the nucleotide modification is a chemical modification.
43. The method of any one of claims 1-42, wherein the at least one double stranded miRNA mimic lacks a hairpin region, a mismatch between the first strand and the second strand, a bulge region, or a combination thereof.
44. The method of any one of claims 1-43, wherein the first strand and / or the second strand further comprises an overhang of at least one, 2, 3, 4 5, or more nucleotides at the 5' end and / or the 3' end.
45. The method of any one of claims 1-44, wherein the second strand further comprises a one or two nucleotide overhang on the 3' end.
46. The method of any one of claims 1-45, wherein the first strand further comprises a one or two nucleotide overhang on the 3' end.
47. The method of any one of claims 1-46, wherein the introducing at least one double stranded miRNA comprises introducing at least 2, 3, 4, 5, or more double stranded miRNA mimics.
48. The method of any one of claims 1-47, wherein the at least one double stranded miRNA mimic comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a first strand that comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA that is different.
49. The method of any one of claims 1-48, wherein the at least one double stranded miRNA mimic comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a first strand that binds a different target mRNA in the population of differentiated cells.
50. The method of any one of claims 6-49, wherein the corresponding naturally occurring miRNA is a human miRNA.
51. The method of any one of claims 6-50, wherein the corresponding naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
52. The method of any one of claims 1-51, wherein the at least one double stranded miRNA mimic comprises:(a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-367,(b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302a,(c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b,Docket No. 65907-703.601(d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of hsa-miR-302c,(e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of hsa-miR-302d, or(f) a combination thereof.
53. The method of any one of claims 1-52, wherein the one or more RNA polynucleotides comprises a 5 ’-Cap structure, optionally wherein the Cap structure is a 5' diguanosine cap, an anti reverse Cap analog (ARCA), m7GpppNmp-RNA or m7GpppNp-RNA, optionally wherein the 5’ cap analog is a 5' diguanosine cap.
54. The method of any one of claims 1-53, wherein the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MYC, a LIN28 and a NANOG.
55. The method of any one of claims 1-54, wherein the reprogramming factor is selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28.
56. The method of any one of claims 1-55, wherein the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combination thereof.
57. The method of any one of claims 54-56, wherein the c-MYC comprises at least one amino acid mutation relative to a corresponding WT c-MYC.
58. The method of claim 57, wherein the at least one amino acid mutation comprises an amino acid substitution, an amino acid deletion and / or an amino acid insertion.
59. The method of any one of claims 57-58, wherein the at least one amino acid mutation comprises a mutation at amino acid residue T58 relative to a corresponding WT c-MYC.
60. The method of claim 59, wherein the mutation at amino acid residue T58 is a T58A amino acid substitution.
61. The method of any one of claims 1-60, wherein step (b) further comprises introducing at least one modulator of interferon response or a nucleic acid encoding said at least one modulator of interferon response.
62. The method of claim 61, wherein the at least one modulator of interferon response comprises an interferon decoy molecule.Docket No. 65907-703.60163. The method of any one of claims 61-62, wherein the at least one modulator of interferon response comprises a B 18R or a nucleic acid encoding the B 18R, an NS3 / 4A or a nucleic acid encoding the NS3 / 4A, or a combination thereof.
64. The method of claim 63, wherein the nucleic acid encoding the B18R is an RNA encoding the B18R, optionally wherein the RNA encoding the B18R lacks a nucleotide modification.
65. The method of claim 63, wherein the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A, optionally wherein the RNA encoding the NS3 / 4A lacks a nucleotide modification.
66. The method of any one of claims 1-60, wherein the method lacks the step of introducing a modulator of interferon response or a nucleic acid encoding the modulator of interferon response.
67. The method of any one of claims 1-66, wherein the method lacks the step of introducing an inhibitor of the PKR dependent pathway and / or the OAS-dependent pathway.
68. The method of claim 67, wherein the inhibitor of the PKR dependent pathway is an inhibitor of the activity or activation of PKR polypeptide, dephosphorylates eIF2-alpha and / or inhibits phosphorylation of eIF2-alpha.
69. The method of claim 67 or claim 68, wherein the inhibitor of OAS dependent pathway is an inhibitor of the expression and / or activity of OAS protein and / or RNase L.
70. The method of any one of claims 67-69, wherein the inhibitor of PKR pathway is a vaccinia virus E3 polypeptide, a vaccinia virus K3 polypeptide, or both.
71. The method of any one of claims 1-70, wherein the first strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 1, 2, 3, 4 or 5.
72. The method of any one of claims 1-71, wherein the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10.
73. The method of any one claims 1-72, wherein introducing the at least one double stranded miRNA mimic comprises introducing(a) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1,(b) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2,(c) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3,(d) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4,(e) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or(f) a combination thereof.Docket No. 65907-703.60174. The method of any one of claims 1-73, wherein introducing the at least one double stranded miRNA mimic comprises introducing(a) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6,(b) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7,(c) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8,(d) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9,(e) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or(f) a combination thereof.
75. The method of any one of claims 1-74, wherein introducing the at least one double stranded miRNA mimic comprises introducing(a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6,(b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7,(c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8,(d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9,(e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10, or(f) a combination thereof.
76. The method of any one of claims 1-75, wherein the introducing of step b is performed once daily for 3 days or less, and the culturing is performed for 10 days or less, for example, 3 days or less.
77. The method of any one of claims 1-76, wherein the first strand comprises a 5’ phosphate group.
78. The method of any one of claims 1-77, wherein the first lacks further nucleotide modification other than the 5’ phosphate group.
79. The method of any one of claims 1-78, wherein the second strand lacks a nucleotide modification.Docket No. 65907-703.60180. The method of any one of claims 1-79, wherein the one or more RNA polynucleotides comprises a 5’ cap structure.
81. The method of any one of claims 1-80, wherein the one or more RNA polynucleotide lacks further nucleotide modifications.
82. The method of any one of claims 1-81, wherein the introducing is performed by electroporation or lipofection.
83. The method of any one of claims 1-82, wherein (i) and (ii) are introduced sequentially or simultaneously.
84. The method of any one of claims 1-83, wherein the at least one double stranded miRNA mimic is introduced at a concentration of at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng, 650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng per at least about 20,000 differentiated cells.
85. A composition for generating reprogrammed cells comprising:(a) one or more RNA polynucleotides that encode a reprograming factor; and(b) at least one double stranded miRNA mimic that comprises a first strand and a second strand, wherein the at least one double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17 contiguous nucleotides.
86. A composition for generating reprogrammed cells comprising:(a) one or more RNA polynucleotides that encode a reprogramming factor; and(b) at least one double stranded miRNA mimic that comprises a first strand and a second strand, wherein the at least one double stranded mimic lacks a bulge region.
87. The composition of any one of claims 85-86, wherein the double stranded miRNA mimic comprises a region of complete complementarity between the first strand and the second strand over at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides.
88. The composition of any one of claims 85-87, wherein the first strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
89. The composition of any one of claims 85-88, wherein the second strand is at least 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length.
90. The composition of any one of claims 85-89, wherein the first strand and the second strand are of the same length or of different lengths.
91. The composition of any one of claims 85-90, wherein the first strand comprises a nucleotide sequence identical to a portion of a sequence of a naturally occurring miRNA.
92. The composition of claim 91, wherein the portion comprises at least 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleotides of the sequence of the naturally occurring miRNA.Docket No. 65907-703.60193. The composition of any one of claims 91-92, wherein the first strand comprises a nucleotide sequence identical to the sequence of the naturally occurring miRNA.
94. The composition of any one of claims 91-93, wherein the first strand comprises a nucleotide sequence identical to a guide sequence of the naturally occurring miRNA.
95. The composition of any one of claims 85-94, wherein the first strand is partially complementary to a target mRNA.
96. The composition of any one of claims 85-95, wherein the first strand is completely complementary to the target mRNA.
97. The composition of any one of claims 85-96, wherein the first strand is a guide strand.
98. The composition of any one of claims 85-97, wherein the second strand is a passenger strand.
99. The composition of any one of claims 85-98, wherein the one or more RNA polynucleotides lack a nucleotide modification.
100. The composition of any one of claims 85-99, wherein the first strand comprises a phosphate group at the 5’ end.
101. The composition of any one of claims 85-100, wherein the first strand lacks a nucleotide modification other than a phosphate group at the 5’ end.
102. The composition of any one of claims 85-101, wherein the second strand lacks a nucleotide modification.
103. The composition of any one of claims 85-102, wherein the at least one double stranded miRNA mimic lacks a hairpin region, a mismatch, a bulge region, or a combination thereof.
104. The composition of any one of claims 85-103, wherein the first strand and / or the second strand further comprises one or more nucleotide overhangs at the 5' end and / or the 3' end.
105. The composition of any one of claims 85-104, wherein the second strand further comprises a one or two nucleotide overhang on the 3' end.
106. The composition of any one of claims 85-105, wherein the first strand further comprises a one or two nucleotide overhang on the 3' end.
107. The composition of any one of claims 85-106, wherein the composition comprises at least 2, 3, 4, 5, or more double stranded miRNA mimics, each of which comprises a nucleotide sequence identical to a portion of a sequence of a the naturally occurring miRNA that is different.
108. The composition of any one of claims 91-107, wherein the naturally occurring miRNA is a human miRNA.
109. The composition of any one of claims 91-108, wherein the naturally occurring miRNA is selected from the group consisting of hsa-miR-367, hsa-miR-302a, hsa-miR-302b, hsa-miR-302c, and hsa-miR-302d.
110. The composition of any one of claims 91-109, wherein the composition comprises:(a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-367,Docket No. 65907-703.601(b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302a,(c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302b,(d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302c,(e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence identical to a portion of a sequence of a hsa-miR-302d, or(f) a combination thereof.
111. The composition of any one of claims 85-110, wherein the one or more RNA polynucleotides comprises a 5 ’-Cap structure, optionally wherein the 5 ’-Cap structure is m7GpppNmp-RNA or m7GpppNp-RNA, 5' cap analog, or an anti reverse Cap analog (ARCA), optionally wherein the 5' cap analog is a 5' diguanosine cap.
112. The composition of any one of claims 85-111, wherein the reprogramming factor is selected from a group consisting of an OCT4, an OCT3, a SOX1, a SOX2, a SOX3, a SOX15, a KLF1, a KLF2, a KLF4, a KLF5, a c-MYC, a L-MYC, a N-MYC, a LIN28 and a NANOG.
113. The composition of any one of claims 85-112, wherein the reprogramming factor polypeptide is selected from a group consisting of OCT3 or a OCT4, a SOX2, a KLF4, a C-MYC, a NANOG, or a LIN28.
114. The composition of any one of claims 85-113, wherein the one or more RNA polynucleotides comprise an RNA polynucleotide that encodes an OCT4, an RNA polynucleotide that encodes an OCT3, an RNA polynucleotide that encodes a SOX1, an RNA polynucleotide that encodes a SOX2, an RNA polynucleotide that encodes a SOX3, an RNA polynucleotide that encodes a SOX15, an RNA polynucleotide that encodes a KLF1, an RNA polynucleotide that encodes a KLF2, an RNA polynucleotide that encodes a KLF4, an RNA polynucleotide that encodes a KLF5, an RNA polynucleotide that encodes c-MYC, an RNA polynucleotide that encodes L-MYC, an RNA polynucleotide that encodes N-MYC, an RNA polynucleotide that encodes LIN28, an RNA polynucleotide that encodes NANOG, or a combination thereof.
115. The composition of any one of claims 112-114, wherein the c-MYC comprises at least one amino acid mutation relative to a corresponding WT c-MYC.
116. The composition of claim 115, wherein the at least one amino acid mutation comprises an amino acid substitution, an amino acid deletion and / or an amino acid insertion.
117. The composition of claim 116, wherein the at least one amino acid mutation comprises a mutation at amino acid residue T58 relative to a corresponding WT c-MYC.
118. The composition of claim 117, wherein the mutation at amino acid residue T58 is a T58A amino acid substitution.Docket No. 65907-703.601119. The composition of any one of claims 85-118, further comprising at least one modulator of interferon response or a nucleic acid encoding said at least one modulator of interferon response.
120. The composition of claim 119, wherein the at least one modulator of interferon response comprises an interferon decoy molecule.
121. The composition of any one of claims 119-120, wherein the at least one modulator of interferon response comprises a B 18R or a nucleic acid encoding the B 18R, an NS3 / 4A or a nucleic acid encoding the NS3 / 4A, or a combination thereof.
122. The composition of claim 121, wherein the nucleic acid encoding the B18R is an RNA encoding the B 18R, optionally wherein the RNA encoding the B 18R lacks a nucleotide modification.
123. The composition of claim 121, wherein the nucleic acid encoding the NS3 / 4A is an RNA encoding the NS3 / 4A, optionally wherein the RNA encoding the NS3 / 4A lacks a nucleotide modification.
124. The composition of any one of claims 85-123, wherein the first strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 1, 2, 3, 4 or 5.
125. The composition of any one of claims 85-124, wherein the second strand comprises a nucleotide sequence as set forth in any one of SEQ ID Nos: 6, 7, 8, 9 or 10.
126. The composition of any one of claims 85-125, wherein(a) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 6,(b) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 7,(c) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 8,(d) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 9, or(e) the first strand comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand comprises a nucleotide sequence set forth in SEQ ID NO: 10.
127. The composition of any one of claims 85-126, wherein the composition comprises:(a) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1,(b) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2,(c) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3,Docket No. 65907-703.601(d) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4,(e) a double stranded miRNA mimic that comprises a first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, or(f) a combination thereof.
128. The composition of any one of claims 85-127, wherein the composition comprises:(a) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 6,(b) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 7,(c) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 8,(d) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 9,(e) a double stranded miRNA mimic that comprises a second strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 10, or(f) a combination thereof.
129. The composition of any one of claims 85-128, wherein the composition comprises:(a) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6,(b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7,(c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8,(d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9,(e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10, or(f) a combination thereof.
130. The composition of any one of claims 85-129, wherein the at least one double stranded miRNA mimic is present at a concentration of at least about 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, 450 ng, 500 ng, 550 ng, 600 ng,Docket No. 65907-703.601650 ng, 700 ng, 750 ng, 800 ng, 850 ng, 900 ng, 910 ng, 920 ng, 930 ng, 940 ng, 950 ng, 960 ng, 970 ng, 980 ng, 990 ng or 1000 ng.
131. A composition, comprising:(a) one or more RNA polynucleotide encoding a reprogramming factor, and(b) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 1, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 6,(c) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 2, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 7,(d) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 3, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 8,(e) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 4, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 9, and(f) a double stranded miRNA mimic that comprises the first strand that comprises a nucleotide sequence as set forth in SEQ ID NO: 5, and the second strand that comprises a nucleotide sequence set forth in SEQ ID NO: 10.
132. A population of induced pluripotent stem cells generated by the method of any one of claims 1- 84.
133. A composition comprising the population of induced pluripotent stem cells of claim 132.
134. Use of the composition of any one of claims 85-131, for treatment of a subject in need thereof, optionally wherein the treatment comprises administering an effective amount of the composition to the subject.
135. Use of the composition of any one of claims 85-131, for a method to reprogram a population of differentiated cells.
136. The use of claim 135, wherein the population of differentiated cells are reprogrammed to a population of induced pluripotent stem cells.
137. A pharmaceutical composition comprising the population of induced pluripotent stem cells of claim 130.
138. The composition of any one of claims 85-131, for use to manufacture a population of induced pluripotent stem cells.
139. The composition of any one of claims 85-131, for use to generate a population of cells having stem cell characteristics from a population of differentiated cells, optionally wherein the population of differentiated cells are somatic cells.
140. A kit comprising an effective amount of a composition of any one of claims 85-131.
Citation Information
Patent Citations
Drug composition containing nucleic acid copolymer
US5705188A
Cloning using donor nuclei from proliferating somatic cells
US5945577A
Production of chimeric bovine or porcine animals using cultured inner cell mass cells
US5994619A
CICM cells and non-human mammalian embryos prepared by nuclear transfer of a proliferating differentiated cell or its nucleus
US6235970B1
Method of preparing polynucleotide-carrier complexes for delivery to cells
WO1997030731A2