Systems and methods for high-throughput protein screening

Abstract

The present disclosure relates to systems and methods for screening proteins (e.g., libraries of protein variants). In particular, the present disclosure provides systems and methods for generating DNA-encoded protein libraries on hydrogel beads using particle-templated emulsification.

Description

STDU2 43691.601S24-348SYSTEMS AND METHODS FOR HIGH-THROUGHPUT PROTEIN SCREENINGFIELD

[0001] The present disclosure relates to systems and methods for screening proteins (e.g„ libraries of protein variants). In particular, the present disclosure provides systems and methods for generating DNA-encoded protein libraries on hydrogel beads using particle-templated emulsification.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 707,264, filed October 15, 2024, the content of which is herein incorporated by reference in its entirety.SEQUENCE LISTING STATEMENT

[0003] The content of the electronic sequence listing titled “STDU2-43691-601_SQL.xml” (Size: 26,120 bytes; and Date of Creation: October 14, 2025) is herein incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with Government support under contract CA290563 awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND

[0005] The ability to design and rapidly characterize a large library of protein variants that function in diverse environments is vital for a variety of therapeutic, industrial, and biotechnological applications. Current methods for characterizing protein function at massive scale (~le3-le9 variants per experiment) face significant limitations due to the requirement for cell-based assays, or else, complex in vitro protocols and equipment. High-throughput cell-based assays using mammalian, yeast, or bacterial cells face confounding factors from the cellular environment and are incompatible with a wide range of temperature, buffer, and reagent conditions. High-throughput in vitro assays enable precise control over assay conditions, but are limited to very small proteins or involve complicated protocols, often requiring microfluidics. Thus, new technologies which allow rapid and efficient screening of protein variants are needed.STDU2 43691.601S24-348SUMMARY

[0006] Embodiments of the present disclosure include methods and systems for high- throughput protein screening.[0007| Provided herein are methods for generating DNA-encoded protein libraries. In some embodiments, the methods comprise at least one or all of: contacting a plurality of hydrogel beads with: a library of template polynucleotides encoding a plurality of proteins of interest and amplification reagents to generate template loaded hydrogel beads; incubating template loaded hydrogel beads in water-in-oil emulsion droplets under conditions for amplification to generate amplicon hydrogel beads; contacting isolated amplicon hydrogel beads with in vitro transcription and translation (IVTT) reagents to generate amplicon-IVTT hydrogel beads; incubating amplicon-IVTT hydrogel beads in water-in-oil emulsion droplets under conditions for cell-free protein synthesis to generate amplicon-protein hydrogel beads; and recovering amplicon-protein hydrogel beads. In some embodiments, the hydrogel beads are functionalized with a DNA capture agent and / or a protein capture agent.

[0008] In some embodiments, the template polynucleotides are plasmids or linear double stranded DNA templates. In some embodiments, the template polynucleotides further comprise a barcode or unique identifier sequence.

[0009] In some embodiments, the library of template polynucleotides is provided at a relative amount of 0.01-5 template polynucleotide molecules per hydrogel bead. In some embodiments, less than about 1% of the template loaded hydrogel beads comprise two or more templates. In some embodiments, each template loaded hydrogel bead is encapsulated into an individual droplet. In some embodiments, at least 90% of the templated loaded hydrogel beads are encapsulated in an individual droplet.

[0010] In some embodiments, the amplification reagents contain a primer set for amplifying the template polynucleotide. In some embodiments, the primer set comprises a bead-immobilized primer. In some embodiments, the primer set comprises a primer functionalized with a protein capture reagent.

[0011] In some embodiments, the protein of interest is tethered to the amplicon-protein hydrogel beads by a protein capture agent. In some embodiments, the protein of interest comprises a moiety configured to bind to the protein capture agent.STDU2 43691.601S24-348

[0012] In some embodiments, the methods further comprise removing excess template polynucleotides and amplification reagents outside of the template loaded hydrogel beads prior to amplification.

[0013] In some embodiments, at least 90% of the amplicon-IVTT hydrogel beads are encapsulated in individual droplets. In some embodiments, each amplicon-IVTT hydrogel bead is encapsulated into an individual droplet.

[0014] In some embodiments, the methods further comprise sorting the amplicon-protein hydrogel bead based on one or more characteristic of the proteins of interest. In some embodiments, the sorting is on individual beads or pooled groups of beads.

[0015] In some embodiments, the methods further comprise measuring the concentration of the amplicons and / or the protein of interest in each amplicon-protein hydrogel bead.[0016| In some embodiments, the methods further comprise conducting one or more of a protein functional assay, a protein phenotypic analysis, or protein or nucleic acid sequencing on recovered amplicon-protein hydrogel beads, or isolated proteins of interest or amplicon from the amplicon-protein hydrogel beads. In some embodiments, the methods comprise separating the amplicon-protein hydrogel beads based on one or more phenotypic properties and identifying sequences of the proteins of interest for each separated group of amplicon-protein hydrogel beads.

[0017] In some embodiments, the phenotypic property may be related to the concentration of amplicons and / or proteins of interest in the hydrogel bead. In some embodiments, the phenotypic property may be related to the binding partner occupancy. In some embodiments, the phenotypic property may be related to the stability of the proteins of interest. In some embodiments, the phenotypic property may be related to the enzymatic activity of the proteins of interest. In some embodiments, the phenotypic property may be related to a chemical modification of the proteins of interest.

[0018] In some embodiments, identifying sequences of the proteins of interest comprises sequencing the amplicons for each separated group of amplicon-protein hydrogel beads. In some embodiments, each separated group comprises a single bead. In some embodiments, each separated group comprises two or more beads with the same or similar phenotypic properties.

[0019] In some embodiments, the methods further comprise conducting a binding assay on recovered amplicon-protein hydrogel beads, or isolated proteins of interest from the amplicon-STDU2 43691.601S24-348 protein hydrogel beads. In some embodiments, the binding assay comprises: incubating the amplicon-protein hydrogel beads with one or more binding partners; separating the ampliconprotein hydrogel beads based on bound binding partner occupancy; and identifying sequences of the proteins of interest for each separated group of amplicon-protein hydrogel beads.

[0020] In some embodiments, the binding partner is a nucleic acid, a protein, a peptide, a small molecule, or a combination thereof. In some embodiments, the binding partner comprises an antibody. In some embodiments, the binding partner comprises a ligand to the protein of interest. In some embodiments, the binding partner has a detectable label. In some embodiments, the separating is based on the relative amount of the detectable label associated with each amplicon-protein hydrogel bead.

[0021] In some embodiments, the methods further comprise calculating one or more functional parameters for the proteins of interest. In some embodiments, calculating one or more functional parameters for the protein functional assay comprises calculating a frequency of each protein sequence in each separated group and calculating the one or more functional parameters based on frequency distributions. In some embodiments, the one or more functional parameters comprise binding affinity, binding specificity, protein stability, and / or enzymatic activity. In some embodiments, the one or more functional parameters comprise dissociation constants, association constants, binding free energy, changes in binding affinity, folding free energy, or changes in folding free energy.

[0022] Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG. 1 is an exemplary workflow (APB-Display) for generating DNA-encoded protein libraries on hydrogel beads.

[0024] FIGS. 2A-2B show that Amplicon / Protein Beads can be successfully partitioned into particle-templated emulsions. FIG. 2A is a schematic of the particle-templated emulsification process. FIG. 2B is exemplary images of APBs loaded within particle-templated emulsions after emulsion PCR and emulsion IVTT.

[0025] FIGS. 3A-3B show the FLAG variant library and binding assay used to validate the APB-Display workflow. FIG. 3A is a schematic of the DNA templates used to generate the APBSTDU2 43691.601S24-348 library. FIG. 3A shows SEQ ID NOs: 1, 6. 7, and 11. FIG. 3B is a schematic of the FLAG / anti- FLAG binding interaction used to quantify a fluorescent binding phenotype for each FEAG peptide variant

[0026] FIGS. 4A-4D contain exemplary microscopy images and histograms to describe the FEAG variant APB library. FIG 4A is a brightfield image and a histogram quantifying bead diameters for the library. FIG 4B is a fluorescent image from the GFP channel and a histogram quantifying median GFP intensities for a sample of beads in the library. FIG 4C is a fluorescent image from the Cy5 channel and a histogram quantifying median Cy5 intensities for a sample of beads in the library. FIG 4D is an image with all channels merged and colored as follows: brightfield (gray), GFP (green), and Cy5 (red). Beads that simultaneously display both GFP and Cy5 fluorescence appear yellow. FIG 4D includes a histogram quantifying Cy5 / GFP intensity ratios for beads with GFP intensities above background (3500 a.u.).

[0027] FIG. 5 depicts an exemplary sorting and sequencing workflow for linking protein genotype to phenotype using Amplicon / Protein Beads.

[0028] FIG. 6 is scatter plots of fluorescence profiles for sorted beads corresponding to each sequence in the FEAG variant APB library. Each point corresponds in an individual sorted bead; each point is colored by Cy5 / GFP ratio and sized according to sequencing read count. For each plot, a black dashed line corresponds to the “mean Cy5 / GFP ratio” estimated for each sequence. SEQ ID NOs: 1, 3, 6-28

[0029] FIGS. 7A-7B show pie charts representing the fraction of protein-coated beads displaying 1, 2, or 3+ unique variants according to statistical theory (FIG. 7 A) or observation (FIG. 7B).

[0030] FIGS. 8A-8B validate the binding measurements generated from Amplicon / Protein Beads. FIG. 8A is a scatter plot comparing mean Cy5 / GFP ratios for five sequences in the FEAG variant APB library to loglO( j)) values collected via an orthogonal fluorescence polarization assay. FIG. 8B is a sequence logo plot of relative binding energies (AAGs) for each single amino acid variant of the FEAG peptide relative to the wildtype sequence (DYKDDDDK; SEQ ID NO: 1). AAG values were calculated as -RTln(^D,var / ^D,wT). using R as the gas constant (1.983 x 103kcal / mol-K), T as temperature (298 K), and K\y values for each sequence calibrated from the regression line in FIG. 8A.STDU2 43691.601S24-348

[0031] FIGS. 9A-9E show successful production of Amplicon / Protein Beads (APBs) using APB-Display. FIG. 9A is a brightfield image of hydrogel beads encapsulated within particle- templated emulsions during emulsion PCR (FIG. 1, step 2). The droplets form a thin shell around each bead, such that the droplet diameter is the same as the bead diameter for droplets that contain only a single bead. FIG. 9B is a brightfield image (left) and GFP image (right) of hydrogel beads encapsulated within particle-templated emulsions during emulsion IVTT. Dilute DNA template concentrations result in only two beads in this field of view expressing SNAP- GFP protein, suggesting that the remaining beads do not display any SNAP-GFP amplicons. FIG. 9C is brightfield (left). Cy5 (middle), and GFP (right) images of recovered Amplicon / Protein Beads. An AlexaFluor-647 labeled primer was used to generate fluorescent amplicons during emulsion PCR. Close alignment between hydrogel beads with fluorescent signals were associated with the presence of attached amplicon and protein molecules. FIG. 9D is a flow cytometry plot of the Amplicon / Protein Beads in (FIG. 9C), using 2% contour lines. Approximately 15% of beads display Amplicon and Protein molecules, due to the use of dilute template concentrations to reduce the probability of amplifying more than one DNA template molecule onto the same bead. FIG. 9E is a gel electrophoresis image of recovered full-length SNAP-GFP amplicon after 25 cycles of PCR using the same primers used for emulsion PCR.

[0032] FIGS. 10A-10C show that APB-Display can be used to generate mixed libraries of two protein variants. FIG. 10A is a schematic of the FLAG / anti-FLAG binding interaction used to validate the ability of APB-Display to keep variants distinct within a pooled bead library. FIG. 10B is amino acid sequences of FLAG epitope variants used for validation (WT - SEQ ID NO: 1; Dead - SEQ ID NO: 2; Low - SEQ ID NO: 3; Mid - SEQ ID NO: 4: High - SEQ ID NO: 5). FIG. 10C is flow cytometry plots (2% contour) for all combinations of WT and Dead FLAG variant libraries prepared with APB-Display. The mixed variant sample has clearly distinguishable populations closely associated with the two variants and no-protein beads, as measured individually.

[0033] FIGS. 11A-1 IB show that APB-Display can be coupled with bead sorting and pooled sequencing to rapidly profile larger variant libraries. FIG. HA is flow cytometry plots showing the distribution of bead fluorescence for three individually-prepared FLAG variant beads incubated with 6nM M2 anti-FLAG antibody. Bin lines are overlaid to demonstrate how 4-way sorting would separate these populations. FIG. 11B is heatmaps representing the conditionalSTDU2 43691.601S24-348 probability of observing a FLAG variant read count across the four sort bins shown in FIG. 11 A. Read counts were standardized using the “spike-in” DNA, as described in the Methods. A single five-member FLAG variant library was prepared using APB -Display, then split into two aliquots for incubation with 2nM (left) or 6nM (right) M2 anti-FLAG antibody. Beads incubated at each antibody concentration were sorted separately into four sort bins, then amplicons from sorted beads were amplified and barcoded for sequencing using PCR. FLAG variant sequences are as those shown in FIG. 10B.DETAILED DESCRIPTION

[0034] The present disclosure relates to systems and methods for high-throughput screening of proteins, for example, for use in furthering understanding of protein function, protein variants, engineering proteins with new and improved functions, and collecting sequence-function data for artificial intelligence (Al)-guided protein design.

[0035] The systems and methods use micron-scale hydrogel beads to facilitate high throughput analysis of protein function (e.g. binding, fluorescence, stability, enzymatic activity) in a cell-free, rapid, accessible, and scalable manner. The hydrogel bead particles are used to template uniform water-in-oil emulsion droplets, with each bead particle partitioned into a separate droplet. Thus, a library of DNA-encoded protein variants suitable for in vitro biochemical characterization is generated, with each protein variant contained within an individual bead.

[0036] While traditional bead display workflows use rigid, and often hydrophobic, beads to link protein genotype and phenotype, the disclosed systems and methods use porous hydrogel beads to rapidly generate high-quality protein libraries. Hydrogel beads enable highly specific DNA and protein capture, compatibility with large proteins, and a solution-like bead interior that retains native protein function and facilitates biochemical reactions relevant to library preparation (including DNA amplification and in vitro transcription / translation).

[0037] To generate protein libraries with a clonal genotype-phenotype linkage on each bead, the disclosed systems and methods leverage the ability of hydrogel beads to soak up assay reagents prior to vortexing with oil, such that a tight oil shell is formed around each bead. This partitioning of the bead library into separate, uniformly-sized droplets prevents protein variants from mixing together while biochemical reactions take place within the hydrogel core of eachSTDU2 43691.601S24-348 bead (e.g., DNA amplification or protein expression, followed by covalent capture of DNA and protein molecules onto the hydrogel matrix). This hydrogel-based emulsification method requires only a few minutes of standard vortexing, as opposed to the specialized expertise, costly equipment, and many hours required to use droplet microfluidics for the same task.

[0038] By combining these hydrogel and emulsification techniques in a workflow termed Amplicon / Protein Bead Display (APB -Display), a bead library of thousands to millions of protein variants can be generated in a single day within a single test tube, starting from pooled libraries of DNA templates, and using only picoliters of reagents per variant and standard lab equipment. Each hydrogel bead corresponds to a different protein variant, with many identical copies of that variant’s DNA and protein molecules covalently attached to the bead. The bead library is immediately ready for a functional assay (e.g., introduction of a binding partner or substrate), followed by high-throughput phenotypic analysis (e.g.. magnetic, affinity, or fluorescence-based sorting), and sequencing to map genotype and phenotype.

[0039] The disclosed systems and methods achieve high reproducibility and accuracy for measuring antibody-peptide binding interactions across a wide dynamic range, offering significant speed and quality advantages over cell-based screening assays (e.g., yeast display, phage display), and significant accessibility improvements over in vitro assays (e.g.. mRNA display, microfluidic assays).

[0040] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.1. Definitions

[0041] Throughout the specification and claims, the following terms take the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase “in one embodiment” as used herein does not necessarily refer to the same embodiment, though it may. Furthermore, the phrase “in another embodiment” as used herein does not necessarily refer to a different embodiment, although it may. Thus, as described below, various embodiments of the invention may be readily combined, without departing from the scope or spirit of the invention.

[0042] In addition, as used herein, the term “or” is an inclusive “or” operator and is equivalent to the term “and / or” unless the context clearly dictates otherwise. The term “based on” is not exclusive and allows for being based on additional factors not described, unless the contextSTDU2 43691.601S24-348 clearly dictates otherwise. In addition, throughout the specification, the meaning of “a,” “an,” and “the” include plural references. The meaning of “in” includes “in” and “on.”

[0043] The terms “comprise(s),” “include(s).” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The transitional phrase “consisting essentially of’ as used in claims in the present application limits the scope of a claim to the specified materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention, as discussed in In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461. 463 (CCPA 1976). For example, a composition “consisting essentially of’ recited elements may contain an unrecited contaminant at a level such that, though present, the contaminant does not alter the function of the recited composition as compared to a pure composition, i.e., a composition “consisting of’ the recited components. As used herein, comprising a certain sequence or a certain SEQ ID NO usually implies that at least one copy of said sequence is present in recited peptide or polynucleotide. However, two or more copies are also contemplated. The present disclosure also contemplates other embodiments “comprising,” “consisting of,” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0044] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9. and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated. The term “one or more,” as used herein, refers to a number higher than one. For example, the term “one or more” encompasses any of the following: two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, twenty or more, fifty or more, 100 or more, or an even greater number.

[0045] Although the terms “first,” “second,” “third,” etc. may be used herein to describe various steps, elements, compositions, components, regions, layers, and / or sections, these steps, elements, compositions, components, regions, layers, and / or sections should not be limited by these terms, unless otherwise indicated. These terms are used to distinguish one step, element, composition, component, region, layer, and / or section from another step, element, composition,STDU2 43691.601S24-348 component, region, layer, and / or section. Terms such as “first.” “second,” and other numerical terms when used herein do not imply a sequence or order unless clearly indicated by the context. Thus, a first step, element, composition, component, region, layer, or section discussed herein could be termed a second step, element, composition, component, region, layer, or section without departing from technology.

[0046] Unless otherwise defined herein, scientific, and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0047] “Polynucleotide” or “oligonucleotide” or “nucleic acid,” as used herein, means at least two nucleotides covalently linked together. The polynucleotide may be DNA, RNA, or a hybrid, where the polynucleotide may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. The nucleic acid, whether DNA or RNA, may comprise non-natural nucleotides, modified nucleotides, and / or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”). Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.Polynucleotides may be single- or double-stranded or may contain portions of both double stranded and single stranded sequence. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.

[0048] As used herein, the term “amplifying” or “amplification” in the context of nucleic acids refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide (e.g., a single polynucleotide molecule), where the amplification products or amplicons are generally detectable. Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes.STDU2 43691.601S24-348

[0049] A “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The proteins may be modified by the addition of sugars, lipids or other moieties not included in the amino acid chain. The terms “polypeptide” and “protein” are used interchangeably herein.

[0050] The term “contacting” as used herein refers to bring or put in contact, to be in or come into contact. The term “contact” as used herein refers to a state or condition of touching or of immediate or local proximity.

[0051] Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.2. Generating Protein Libraries

[0052] The present disclosure provides systems and methods for characterizing proteins. In select embodiments, the systems and methods enable the generation of DNA-encoded protein libraries on hydrogel beads using particle-templated emulsification.

[0053] Currently, there is an overall lack of systems, methods, and components that allow for the rapid and efficient screening of large protein libraries without the use of cells. Yeast surface display and phage display are the current industry standards for screening large libraries of protein binders, but many protein classes and functional assays are incompatible with the cellbased approach. Additionally, cell-based screening assays have many confounding factors and generate qualitative, non-standardized, and often non-reproducible measures of protein function. The disclosed systems and methods provide many advantages over current conventional assays.

[0054] The disclosed systems and methods can be used to characterize proteins that are challenging to study in cells (such as by high throughput cell-based assays (e.g., yeast, bacterial, mammalian display)) due to toxicity, instability, or high background signals. Furthermore, the in vitro nature of the disclosed systems and methods allow for precise control over conditions used for any structural / functional characterization assays, are more compatible with a wide range ofSTDU2 43691.601S24-348 conditions (e.g„ temperature, pH), denaturants, buffers, and other reagents, and remove background concerns from cells.

[0055] Lower throughput in vitro assays require each protein variant sequence to be spatially separated in different tubes, wells, or chambers. Per variant, this amounts to higher costs of DNA synthesis, reagents, and consumables than the disclosed systems and methods, where all variants are pooled within a single test tube and use only picoliters of reagents per variant.

[0056] The disclosed systems and methods parallelize protein expression and purification across the library with a single incubation step and relatively little hands-on time, utilizing commonly-available laboratory equipment and simple protocols, rather than the multi-day process of expression and purifying individual protein variants or use of custom equipment and / or expertise.

[0057] Previous bead display approaches have been limited to very small protein sizes (such as epitope tags, fluorescent proteins, scFvs). This has been attributed to inefficient amplification of the starting DNA templates using bead-immobilized primers. In contrast, the disclosed systems and methods exhibit highly efficient amplification, e.g., of long amplicons up to 4kb, using primers immobilized throughout the hydrogel matrix. The rigid hydrophobic beads, used previously, present a non-native environment for proteins, which can lead to protein inactivation, denaturation, and aggregation on the bead surface. The disclosed systems and methods facilitate a solution-like environment for proteins within the hydrogel matrix and facilitate spatial separation of proteins to prevent aggregation.

[0058] Particle-templated emulsification ensures consistent droplet size, composition, and bead occupancy for highly reproducible results. Previously, bead display approaches used bulk emulsification techniques, such as vortexing, stirring, and extrusion, to rapidly generate a heterogeneous mixture of droplet volumes, often with multiple beads loaded into the same droplet, resulting in non-uniform reaction conditions across the bead library. Hydrogel-coated rigid beads have been previously used to avoid the need for droplet partitioning during protein expression, but significant mixing of protein molecules across beads compromised library quality. Other previous bead display methods have used droplet microfluidics to encapsulate beads in separate droplets. The disclosed systems and methods allow for bulk emulsification which is scalable to larger library sizes, faster to perform, and accessible to labs without microfluidics equipment and expertise.STDU2 43691.601S24-348

[0059] In some embodiments, the methods comprise: contacting a plurality of hydrogel beads with a library of template polynucleotides encoding a plurality of proteins of interest and amplification reagents to generate template loaded hydrogel beads.

[0060] Hydrogel beads are three-dimensional, cross-linked networks of hydrophilic polymers formed in a spherical shape. In an example, the hydrogel beads include from about 60% to about 90% fluid, such as water, and from about 2% to about 30% polymer. The hydrogel beads may be porous, e.g., including open / void space. The porosity is a measure of the void space in a material and is a fraction of the volume of voids over the total volume, as a percentage between 0 and 100% (or a fraction between 0 and 1). In an example, the porosity of the hydrogel beads may range from about 50% (0.5) to about 99% (0.99). The porosity may be sufficient to allow diffusion of reagents (e.g., primers, amplification reagents, IVTT reagents, etc.).[00611 Hydrogels may be prepared by cross-linking hydrophilic biopolymers or synthetic polymers. Thus, in some embodiments, the hydrogel may include a crosslinker. As used herein, the term “crosslinker” refers to a molecule that can form a three-dimensional network when reacted with the appropriate base monomers. Examples of the hydrogel polymers, which may include one or more crosslinkers, include but are not limited to, hyaluronans, chitosans, agar, heparin, sulfate, cellulose, alginates (including alginate sulfate), collagen, dextrans (including dextran sulfate), pectin, carrageenan, polylysine, gelatins (including gelatin type A), agarose, acrylates and methacrylates, PEO-PPO-PEO copolymers (Pluronics), poly(phosphazene), poly (N- vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymers, polyethylene imine), polyethylene glycol (PEG)-thiol, acrylamide, N,N’- bis(acryloyl)cystamine, PEG, polypropylene oxide (PPG), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(N- isopropyl acrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L- glutamic acid), bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetracrylate, or combinations thereof.

[0062] In some embodiments, the hydrogel beads comprise a polyacrylamide hydrogel having acrylamide monomers crosslinked by bis-acrylamide to form a stable polymer. In someSTDU2 43691.601S24-348 embodiments, the acrylamide monomers can be modified to include moieties which facilitate functionalization with DNA and protein capture agents.

[0063] In some embodiments, the methods further comprise generating or preparing the hydrogel beads. Any method known in the art for generating hydrogel beads may be utilized with the disclosed methods, such as the method described in the examples here. In some embodiments, generation or preparation of the hydrogel beads comprises vortex assisted emulsification. In some embodiments, generation or preparation of the hydrogel beads comprises microfluidic droplet generation.

[0064] The hydrogel beads may be of any size, generally in the range of 10 to 200 microns in diameter. For example, the hydrogel beads may be 10 to 200, 10 to 150, 10 to 100, 10 to 50, 10 to 25, 25 to 200, 25 to 150, 25 to 100, 25 to 50, 50 to 200, 50 to 150, 50 to 100, or 100 to 200 microns in diameter. A wide variety of sized beads can be used in the assay. In some embodiments, the beads are uniformly sized, having the same or similar range of diameters.

[0065] In some embodiments, the hydrogel beads are functionalized with DNA capture agent(s) and / or protein capture agent(s). In some embodiments, the hydrogel beads are functionalized with DNA capture agent(s). In some embodiments, the hydrogel beads are functionalized with protein capture agent(s). In some embodiments, the hydrogel beads are functionalized with DNA capture agent(s) and protein capture agent(s). Also provided herein are hydrogel beads are functionalized with DNA capture agent(s) and / or protein capture agent(s).

[0066] DNA capture agents include any moieties, groups, and / or compounds which bind to DNA. Exemplary DNA capture agents include, but are not limited to, anti-DNA antibodies, DNA-binding proteins, nucleic acids, and organic molecules. The DNA capture agents may be specific or non-specific to the sequence of the DNA. The DNA capture agent may covalently bind modified DNA, e.g., chemically-modified DNA. For example, the DNA capture agent may comprise a DNA sequence complementary to the nucleic acid of interest, such that the DNA capture agent and the nucleic acid of interest hybridize, or a sequence-specific binding agent. Alternatively, the DNA capture agent may comprise a moiety or moieties with non-specific binding to DNA, such as acridine, ethidium bromide and 4',6'-diamidino-2-phenylindole (DAPI).

[0067] Protein capture agents include any moieties, groups, or compounds which are configured to bind to a protein directly or indirectly. For example, protein capture agents may be configured to bind specifically to a protein or be configured to bind to a moiety appended to aSTDU2 43691.601S24-348 protein of interest. In some embodiments, each of the proteins of interest comprise a tag or one half of a protein binding pair, the other half being used as the protein capture agent. For example, the protein of interest may comprise a tag (e.g., a FLAG tag, an HA tag, a Myc tag, biotin, SNAP tag, Halo Tag, CLIP tag, and the like), and the protein capture agent may be configured to bind to the tag.

[0068] The template polynucleotides may comprise any polynucleotides which include a sequence encoding a protein of interest. For example, the template polynucleotide may be a plasmid or linear double stranded DNA template. In some embodiments, the template polynucleotides further comprise a barcode or unique identifier sequence. In some embodiments, each of the template polynucleotides comprise a different barcode or unique identifier sequence. As such, the barcode or unique identifier sequence provide a sequence which can be used to identify the protein of interest. Alternatively, one or more template polynucleotides can comprise the same barcode or unique identifier sequence. For example, a single barcode or unique identifier sequence can be used to group the proteins of interest based on one or more characteristics (e.g., mutations, deletions, or variations) as compared to other proteins of interest in the library. The barcode or unique identifier sequence may be any length or sequence.

[0069] In some embodiments, the library of template polynucleotides is contacted with the hydrogel beads in a limited quantity such that many, a majority, or all of the hydrogel beads contact no more than a single template polynucleotide. In some embodiments, less than about 1% of the template loaded hydrogel beads comprise two or more templates. In some embodiments, the library of template polynucleotides is provided at a relative amount of 0.01-5 template polynucleotide molecules per hydrogel bead. Also provided herein are compositions comprising a plurality of hydrogel beads, wherein at least a portion of the hydrogel beads comprise a template polynucleotide.

[0070] The dilute nature of the template polynucleotides may result in a quantity of hydrogel beads which do not contain a template polynucleotide. In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or more hydrogel beads do not contain a template polynucleotide. In some embodiments, less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10% of hydrogel beads contain at least one template polynucleotide. Thus, in some embodiments, the library of templateSTDU2 43691.601S24-348 polynucleotides is provided at a relative amount where many, a majority, or all of the hydrogel beads contact no more than a single template polynucleotide. Accordingly, in some embodiments, the library of template polynucleotides is provided at a relative amount of 0.01-1 (e.g., 0.01-0.5, 0.1-0.5, 0.1-1) template polynucleotide molecules per hydrogel bead. The library of template polynucleotides may be provided at about 0.01, about 0.05, about 0.1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, or about 1 template polynucleotide molecules per hydrogel bead.[0071| In some embodiments, template polynucleotides are contacted with the hydrogel beads in a higher quantity, e.g., 2-5 templates per bead, 2-3 templates per bead. While selected beads will display multiple different protein possibilities, on average the pool of selected beads will be enriched for the TRUE positives relative to the FALSE positives. The higher quantity would also facilitate screening ultra large libraries for activity. For example, multiple proteins are displayed on a given bead and following an assay for activity, the responsible protein among the multiple proteins from that bead are individually measured to determine the responsible protein showing the desired activity.

[0072] In some embodiments, the methods further comprise removing excess template polynucleotides and amplification reagents outside of the template loaded hydrogel beads prior to amplification. Removal of the excess template polynucleotides after contacting them with the hydrogel beads for a period of time prevents unwanted amplification and association of template polynucleotides within hydrogel beads which already comprise a template polynucleotide.[0073| The methods comprise incubating template loaded hydrogel beads in water-in-oil emulsion droplets under conditions for amplification to generate amplicon hydrogel beads. In some embodiments, each template loaded hydrogel bead is encapsulated into an individual droplet. In some embodiments, less than about 10%, about 5%, or about 2% of the template loaded hydrogel bead are encapsulated in droplets comprising two or more template loaded hydrogel beads.

[0074] The terms “amplification conditions” or “conditions for amplification” as used herein, refers to conditions that promote annealing and / or extension of the primers. Such conditions are well known in the art and depend on the selected amplification method. For example, PCR amplification conditions generally comprise thermal cycling, e.g., cycling of the reaction mixture between two or more temperatures. In isothermal amplification reactions, amplification occursSTDU2 43691.601S24-348 without thermal cycling although an initial temperature increase may be required to initiate the reaction. Amplification conditions encompass all reaction conditions including, but not limited to, temperature and / or temperature cycling, buffer, salt, ionic strength, pH, and the like.

[0075] Amplifying the target sequence within the template polynucleotides can be performed using any suitable nucleic acid sequence amplification method known in the art. In some embodiments, the amplification includes, but is not limited to, polymerase chain reaction (PCR), reverse-transcriptase PCR (RT-PCR), real-time PCR, digital PCR, transcription-mediated amplification (TMA), rolling circle amplification, nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), single primer isothermal amplification (SPIA), helicase-dependent amplification (HDA), loop mediated amplification (LAMP), recombinase- polymerase amplification (RPA), and ligase chain reaction (LCR).In some embodiments, amplification of the target sequence within the template polynucleotides is performed using PCR. Any suitable PCR methodology, combination of PCR methodologies, or combination of PCR with other amplification techniques may be used.

[0076] As used herein, the phrase “amplification reagents” refers to reagents used in amplification reactions and may include, but is not limited to, buffers, reagents, enzymes having reverse transcriptase and / or polymerase activity or exonuclease activity; enzyme cofactors such as magnesium or manganese; salts; and deoxynucleotide triphosphates (dNTPs) such as deoxy adenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP) and deoxyuridine triphosphate (dUTP). Particular amplification reagents, and combinations thereof, are dependent on the amplification method and conditions employed.

[0077] In some embodiments, the amplification reagents contain a primer set for amplifying the template polynucleotide. As used herein, the term “primer set” refers to two or more primers which together are capable of priming the amplification of a target sequence or target nucleic acid of interest (e.g., a target sequence within the template polynucleotides). In certain embodiments, the term “set” refers to a pair of primers including a first primer that hybridizes with the 5 ’-end of the target sequence or target nucleic acid to be amplified and a second primer that hybridizes with the complement of the target sequence or target nucleic acid to be amplified.STDU2 43691.601S24-348

[0078] The terms “primer,” “primer oligonucleotide,” and “amplification oligonucleotide” are used interchangeably herein to refer to an oligonucleotide which is capable of acting as a point of initiation of synthesis of an extension product that is a complementary strand of nucleic acid (all types of DNA or RNA) when placed under suitable amplification conditions (e.g., buffer, salt, temperature and pH) in the presence of nucleotides and an agent for nucleic acid polymerization (e.g., a DNA-dependent or RNA-dependent polymerase). The amplification oligonucleotides of the present disclosure can be of any suitable size, and desirably comprise, consist essentially of, or consist of about 15 to 50 nucleotides, preferably about 15 to 30 nucleotides. The amplification oligonucleotides of the present disclosure can contain other nucleotides in addition to those described herein.

[0079] In some embodiments, the primer set comprises a bead-immobilized primer. For example, if the primer set comprises a first oligonucleotide and a second oligonucleotide, at least one of the first oligonucleotide and a second oligonucleotide is immobilized on the hydrogel bead.

[0080] In some embodiments, the primer set comprises a primer functionalized with a protein capture reagent, as described above. Thus, in some embodiments, the protein, or moiety on the protein, binds the displayed DNA rather than the bead itself or protein capture agent.

[0081] Any of the oligonucleotides described herein may be modified in any suitable manner so as to stabilize or enhance the binding affinity of the oligonucleotide for its target. For example, an oligonucleotide sequence as described herein may comprise one or more modified oligonucleotide bases. Furthermore, any of the sequences listed which include internal spacers or modifications may be used without the modifications or spacers.

[0082] The methods comprise contacting isolated amplicon hydrogel beads with in vitro transcription and translation (IVTT) reagents to generate amplicon-IVTT hydrogel beads. Also provided herein are compositions comprising amplicon-IVTT hydrogel beads.

[0083] The terms “in vitro transcription” and “cell-free transcription” are used interchangeably herein and are intended to refer to any method for cell-free synthesis of RNA from DNA without synthesis of protein from the RNA. A preferred RNA is messenger RNA (mRNA), which encodes proteins. The terms “in vitro transcription-translation” (IVTT) and “cell-free transcription-translation” are used interchangeably herein and are intended to refer toSTDU2 43691.601S24-348 any method for cell-free synthesis of mRNA from DNA (transcription) and of protein from mRNA (translation).[0084| Coupled or complementary transcription and translation systems, which carry out the synthesis of both RNA and protein in the same reaction, have been developed. In such in vitro transcription and translation (IVTT) systems, the reagents contain all the components necessary both for transcription (to produce mRNA) and for translation (to synthesize protein) in a single system.[0085| In vitro transcription and translation reagents typically comprise an RNA polymerase that recognizes the promoter(s) to which the template nucleic acid encoding the enzyme of interest is operably linked and, optionally, one or more transcription factors directed to an optional regulatory sequence to which the template nucleic acid is operably linked; ribonucleotide triphosphates (rNTPs); ribosomes; transfer RNA (tRNA); optionally, other transcription factors and co-factors thereof; amino acids (optionally comprising one or more detectably labeled amino acids); one or more energy sources, (e.g., ATP, GTP); and other or optional translation factors (e.g., translation initiation, elongation and termination factors) and co-factors thereof. In some embodiments, the in vitro transcription and translation reagents are purified components of the transcription and translation machinery from an organism. In some embodiments, the in vitro transcription and translation components include reagents for incorporating non-canonical amino acids into the proteins of interest.

[0086] In some embodiments, the methods comprise incubating amplicon-IVTT hydrogel beads in water-in-oil emulsion droplets under conditions for cell-free protein synthesis to generate amplicon-protein hydrogel beads. In some embodiments, each amplicon-IVTT hydrogel bead is encapsulated into an individual droplet. In some embodiments, less than 10% of the amplicon-IVTT hydrogel beads are encapsulated droplets comprising two or more amplicon- IVTT hydrogel beads. The terms “cell-free protein synthesis (CFPS),” “in vitro protein synthesis,” “in vitro translation,” “cell-free translation,” “RNA template-driven in vitro protein synthesis,” “RNA template-driven cell-free protein synthesis,” and “RNA template- driven cell-free protein synthesis,” are used interchangeably herein and are intended to refer to any method for cell-free synthesis of a protein.

[0087] The conditions for cell-free protein synthesis are dependent on the selected in vitro transcription and translation reagents. For example, the processivity and optimizedSTDU2 43691.601S24-348 temperature / pH parameters for the polymerase and the ribosomes will generally control the reactions conditions. In some embodiments the incubation is for at least 30 minutes and up to 12 hours. The incubation may be for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, or more. In some embodiments, the incubation temperature is between 20° C and 40° C.

[0088] In some embodiments, the methods further comprise recovering amplicon-protein hydrogel beads from emulsion droplets. In some embodiments, the protein of interest is tethered to the amplicon-protein hydrogel beads by a protein capture agent, as described above. Also provided herein are compositions comprising amplicon-protein hydrogel beads.

[0089] In some embodiments, the methods further comprise determining protein concentration in each droplet following incubation. Concentration can be measured by any of the known methods of measuring protein concentration. For example, concentration can be determined using a variety of spectrophotometric assays. In some embodiments, protein concentration can be determined by measuring absorbance at 280 nm or another wavelength based on the properties of the protein of interest. Alternatively, a variety of protein interactive dyes or agents which result in colorimetric signal and / or absorbance change upon protein binding (e.g., Coomassie Blue, BCA, Folin- Ciocalteu reagent, ninhydrin, or Anorogenic dyes) can be used, preferably in indirect measurements in which an aliquot of the protein of interest is utilized. In some embodiments, each template polynucleotide encodes a protein of interest fused to a detectable polypeptide moiety. The detectable polypeptide moiety can be used in direct concentration measurements (e.g.. the polypeptide moiety is a fluorescent protein) or indirect concentration measurement (e.g., the polypeptide moiety specifically interacts with a dye or agent which result in colorimetric signal and / or absorbance change upon binding to the moiety).

[0090] In some embodiments, the methods further comprise conducting one or more of a protein functional assay, a protein phenotypic analysis, or protein or nucleic acid sequencing on recovered amplicon-protein hydrogel beads or isolated proteins of interest or amplicons from the amplicon-protein hydrogel beads. As such, the library of proteins generated using the disclosed method can be further biochemically characterized by any of a number of biochemical or characterization assays of the recovered amplicon-protein hydrogel beads or isolated proteins of interest or amplicons from the amplicon-protein hydrogel beads. The biochemical or characterization assays (e.g., protein functional assay, a protein phenotypic analysis, or protein orSTDU2 43691.601S24-348 nucleic acid sequencing) may include bead-based assays as known in the art. The methods may comprise contacting the proteins of interest or the amplicon-protein hydrogel beads or droplets comprising thereof with reagents necessary for their characterization. Alternatively or in addition, the biochemical or characterization assays (e.g., protein functional assay, a protein phenotypic analysis, or protein or nucleic acid sequencing) may be completed on isolated proteins of interest or amplicons. Accordingly, in some embodiments, the methods further comprise isolating the proteins of interest or amplicons from the recovered amplicon-protein hydrogel beads.

[0091] In some embodiments, the methods further comprise sorting or separating the amplicon-protein hydrogel beads based on one or more characteristics of the proteins of interest (e.g., one or more phenotypic properties). The sorting may be on individual beads or pooled groups of beads (e.g., beads that have the same or similar characteristics or phenotypic properties). The characteristics or phenotype properties include, but are not limited to, concentration of amplicons and / or proteins of interest in the hydrogel bead, stability of the proteins of interest, enzymatic activity of the proteins of interest, chemical modification of the proteins of interest, and or binding activity of the proteins of interest. Similar characteristics would, for example, include those phenotypic properties within a range of similar values for stability, concentration, binding activity, or include those proteins which have or confer the same chemical modifications and / or chemical modification at certain locations or residues. The methods can make use of any approach which links and / or separates the protein sequence(s) based on the characteristics or phenotypic properties. In one specific embodiment, as described further below, the bead library can be directly queried by introduction of a binding partner or substrate recognized by the library of proteins and separation through a variety of sorting or separating methods, including, but not limited to, magnetic, affinity, proximity, or fluorescencebased methods, to categorize the library of proteins by their phenotype for amount of binding to the binding partner or substrate.

[0092] The separated groups may comprise any number of beads depending on the characteristics or phenotypic properties of the proteins of interest. For example, the separated groups may comprise a single bead. In some embodiments, each separated group comprises two or more beads with the same or similar characteristics or phenotypic properties of the proteins of interest.STDU2 43691.601S24-348

[0093] The methods can make use of any approach which identifies the proteins of interest for any given characteristic or phenotypic property. In some embodiments, identifying sequences of the proteins of interest comprises sequencing the amplicons for each separated group of amplicon-protein hydrogel beads. In some embodiments, a unique barcode is attached to the amplicons within each separated group. Use of the unique barcode for each separated group allows an amplicon sequence to be connected to the characteristic or phenotypic property while being sequenced in a bulk sequencing reaction with amplicons with one or more other separated groups. Sequencing can be accomplished using high-throughput systems, some of which allow detection of a sequenced nucleotide immediately after or upon its incorporation into a growing strand, e.g., detection of sequence in real time or substantially real time. In some embodiments, sequencing the amplicons utilizes next- generation sequencing. In some embodiments, sequencing the amplicons utilizes long-read sequencing.

[0094] In some embodiments, the methods comprise conducting a binding assay on recovered amplicon-protein hydrogel beads, or isolated proteins of interest from the amplicon-protein hydrogel beads. In some embodiments, the binding assay comprises: incubating the ampliconprotein hydrogel beads with one or more binding partners; separating the amplicon-protein hydrogel beads based on bound binding partner occupancy; and identifying sequences of the proteins of interest for each separated group of amplicon-protein hydrogel beads. In some embodiments, the binding assay queries two or more aliquots of amplicon-protein hydrogel beads with one or more binding partners, where each aliquot is incubated with different concentrations of the one or more binding partners. In some embodiments, the binding assay comprises: incubating two or more aliquots of amplicon-protein hydrogel beads with one or more binding partners, each aliquot being incubated with a different concentration of the one or more binding partners; separating each of the two or more aliquots of amplicon-protein hydrogel beads based on bound binding partner occupancy; and identifying sequences of proteins of interest for each separated group of amplicon-protein hydrogel beads. Thus, the binding assay and methods herein can be adapted to quantitatively measuring both weak and strong binding interactions. Alternatively, the binding assay can be used to qualitatively measure the presence or absence of a binding interactions.

[0095] The binding partner may be any agent, moiety, or otherwise which binds or is suspected to bind to the protein of interest. For example, the binding partner may be a nucleicSTDU2 43691.601S24-348 acid, a protein, a peptide, a small molecule, or a combination thereof. In some embodiments, the binding partner comprises an antibody. In embodiments in which the one or more binding partners are different putative antibodies for the protein(s) of interest, the methods may be used to screen antibodies against the protein(s) of interest. For example, the methods may be used to screen antibodies against a variety of protein variants. In some embodiments, the binding partner comprises a natural or engineered ligand of the protein(s) of interest.

[0096] In some embodiments, the binding partner has a detectable label. For example, the detectable label may be a Anorogenic, chromogenic, or luminescent moiety. Such detectable labels may be constitutively detectable (e.g., by absorbance, Auorescence, luminescence, or imaging techniques) or detectable only upon binding the protein of interest. Alternatively, the detectable label may produce a product with a separately detectable signal upon interaction with the protein of interest. The means of detection is dependent on the nature of the detectable label, or detection system. Generally, detectable labels suitable for use in the disclosed methods are those readily detected and / or quantified using various types of spectroscopies, e.g., Auorescence, absorbance, luminescence, mass spectrometry, or a combination thereof. In some embodiments, separating the amplicon-protein hydrogel beads based on bound binding partner occupancy is based on the relative amount of the detectable label associated with each amplicon-protein hydrogel bead.

[0097] The methods can also be used to calculate one or more functional parameters for the proteins of interest. The one or more functional parameters may include, but are not limited to, binding affinity, binding specificity, protein stability, and / or enzymatic activity. The functional parameters may be qualitative or quantitative measurements. For example, calculating one or more functional parameters for the proteins of interest may include calculating a frequency of each protein sequence in each separated group and determining the one or more functional parameters based on frequency distributions.

[0098] The invention is not limited by the type or number of functional parameters. Largely, the functional parameters capable of being determined depend on the nature and type of the assay being conducted on the amplicon-protein hydrogel beads, or isolated proteins of interest or amplicons from the amplicon-protein hydrogel beads. For example, the functional parameters may include dissociation constants, association constants, binding free energy, changes in binding affinity, folding free energy, or changes in folding free energy. In embodiments in which the methods include a binding assay, the methods may facilitate measurements of dissociationSTDU2 43691.601S24-348 constants, association constants, binding free energy, AG, and / or changes in binding affinity, AAG, e.g., as caused by mutations in different protein variants.

[0099] In some embodiments, the disclosed systems and methods are utilized to characterize a library of protein variants, or fragments thereof. The protein variants or fragments thereof may be derived from a single starting protein sequence. The variants may comprise one or more amino acid substitutions, additions, or deletions as compared to the starting sequence. For example, the methods may comprise a library of variants of a wild-type protein sequence, each variant with one or more substitutions, additions, or deletions. In some embodiments, the library of protein variants or fragments thereof may be derived from multiple starting protein sequences.

[0100] The library may comprise a variety of artificially generated sequences. For example, the systems and methods may be utilized to screen a plurality of artificially generated proteins.[0101| In some embodiments, the library of protein variants comprises one or more control or reference sequences. For example, the library may comprise a wild-type version of the protein from which the variants are derived, or a protein which has a similar property or biochemical activity as those proteins being characterized in the library.3. Systems and Kits

[0102] Also provided are kits or systems that can be used to conduct the methods described herein. Such kits or systems can be used to characterize a plurality of proteins. The kits or systems may include any combination of hydrogel beads, functionalized with DNA and / or protein capture reagents, or configured for functionalization, compositions comprising template loaded hydrogel beads, amplicon hydrogel beads, amplicon-IVTT hydrogel beads, or ampliconprotein hydrogel beads, as described herein, or components for making thereof, in vitro transcription and translation reagents, and amplification reagents (e.g., primers). In some embodiments, the kits or systems further comprise a library of polynucleotides encoding proteins of interest.

[0103] The kits or systems may further comprise one or more control or reference samples and reagents. For example, the kits may include polynucleotides for control or reference samples (e.g., known proteins). The known protein may be a similar type of protein or have a similar function of structure as those proteins of interest.STDU2 43691.601S24-348

[0104] The systems may further comprise an incubation system or incubator, a means for encapsulating the hydrogel beads, and / or an empty template polynucleotide for inserting the sequence encoding the protein of interest.

[0105] Individual member components of the kits may be physically packaged together or separately. The components of the kits may be provided in bulk packages (e.g., multi-use packages) or single-use packages. The kits provided herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like.

[0106] The kits can also comprise instructions for using the components of the kit. The instructions are relevant materials or methodologies pertaining to the kits. The materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the compositions, troubleshooting, references, technical support, and any other related documents. Instructions can be supplied with the kits or as a separate member component, either as a paper form or an electronic form which may be supplied on a computer readable memory device or downloaded from an internet website, or as a recorded presentation.

[0107] It is understood that the disclosed kits can be employed in connection with the disclosed methods.4. ExamplesExample 1Overview of the APB-Display workflow

[0108] Described herein is a bead-based platform for cell-free expression and purification of large protein libraries termed Amplicon / Protein Bead Display, or APB-Display (FIG. 1). Each Amplicon / Protein Bead (APB) is coated with many copies of a clonal DNA amplicon sequence and the protein molecules it encodes, all covalently coupled to the hydrogel bead matrix. APB libraries can be mixed with assay reagents such as binding partners, substrates, denaturants, or chemical modifiers to perform a high-throughput functional assay that can be detected with a sequencing-based readout.

[0109] Generating APB libraries requires: (1) a pooled DNA library encoding cell-free protein synthesis of SNAP- and eGFP-tagged protein variants, and (2) dual-functionalized hydrogel beads that enable covalent capture of PCR-amplified DNA and expressed protein variants (FIG. 1). The hydrogel beads are generated with a simple flow-focusing microfluidicSTDU2 43691.601S24-348 droplet generator. To enable covalent capture of DNA and protein molecules, respectively, polyacrylamide beads are polymerized in the presence of acrydite-modified oligonucleotides and benzylguanine (BG)-modified monomers.

[0110] To amplify and attach DNA templates, the hydrogel beads are encapsulated within aqueous-in-oil droplets containing PCR reagents via particle-templated emulsification (PTE) with fluorinated oil. PTE rapidly partitions beads into uniform droplets without needing microfluidics (FIG. 2A). Each droplet contains a single bead, PCR buffer, enzymes, nucleotides, and free-floating forward primer. A small fraction of droplets also contains a single DNA template molecule; this dilute concentration of DNA template reduces the probability that multiple unique template molecules attach to the same bead. During emulsion PCR, the acrydite- modified DNA oligonucleotides crosslinked into each bead serve as reverse primers that covalently anchor each amplified dsDNA molecule to the bead (FIG. 1).

[0111] After emulsion PCR, droplets are chemically broken to release the amplicon-coated beads (Amplicon Beads), enabling pooling and washing prior to protein synthesis.

[0112] To express and covalently capture protein molecules onto the Amplicon Bead that encoded them, PTE is again used to encapsulate all Amplicon Beads with reagents for in vitro transcription and translation (IVTT). The C -terminal eGFP tag on each expressed protein molecule enables direct quantification of expression levels via fluorescence, while the N- terminal SNAP tag enables covalent coupling of each expressed protein molecule to the Amplicon Bead that encoded it via conjugation to polymerized BG moieties (FIG. 1). After emulsion IVTT, chemically breaking the droplets and washing yields purified Amplicon / Protein Beads (APBs).

[0113] Particle-templated emulsion droplets remain stable throughout both the emulsion PCR and emulsion IVTT steps, with minimal droplet merging observed after each step (FIG. 2B).Example 2 Generating protein libraries with APB-Display

[0114] Binding interactions between the FLAG epitope (DYKDDDDK; SEQ ID NO: 1) and the commonly-used M2 antibody have previously been characterized at scale via a variety of orthogonal techniques, providing an ideal model system for optimizing and validating the APB- Display method for generating DNA-encoded protein libraries. To investigate if the method can produce full-length functional proteins that are compatible with sequencing-based functionalSTDU2 43691.601S24-348 analysis, APB -Display was used to generate a bead library consisting of the wildtype FLAG peptide (DYKDDDDK; SEQ ID NO: 1) and 24 peptide variants with individual residues mutated to either alanine (A), leucine (L), or glutamic acid (E) (FIG. 3A). To enable a fluorescence-based binding assay, the purified APB library was mixed with equal concentrations of M2 anti-FLAG antibody and a Cy5-labelled secondary antibody (FIG. 3B).

[0115] The FLAG variant APB library was first analyzed via microscopy. B rightfield microscopy revealed that most beads were uniform and well -dispersed, with diameters around 18 microns (FIG. 4A). Fluorescence microscopy in the GFP channel confirmed that APB-Display can generate hydrogel beads displaying full-length proteins that fold and function as intended. GFP fluorescence was observed for approximately 8 percent of the bead library (FIG. 4B), suggesting that 8 percent of the bead library was programmed with one or more FLAG variant sequences, while 92 percent of the bead library was left blank. Fluorescence microscopy in the Cy5 channel shows that 5 percent of the bead library exhibited antibody binding signal (FIG. 4C). Merging all three channels revealed that Amplicon / Protein Beads can facilitate sequencespecific binding interactions. Most binding signal (Cy5, red) localized to beads with FLAG protein expression (GFP, green), resulting in a population of yellow beads in the merged image (FIG. 4D). This suggests that the M2 antibody specifically binds to FLAG peptides, with minimal nonspecific binding to hydrogel beads. Normalizing the binding signal (Cy5) by the expression signal (GFP) for each GFP+ bead yielded a Cy5 / GFP ratio that corresponds to the fractional occupancy of the M2 antibody on each bead (FIG. 4D).Example 3 Linking genotype to phenotype on Amplicon / Protein Beads

[0116] As the APB-Display workflow generates DNA-encoded protein libraries on hydrogel beads, DNA sequencing-based readouts link protein genotype with phenotype. A sorting and sequencing workflow can be used to generate parallelized binding measurements for APB libraries (FIG. 5).

[0117] Using a BD FACS Aria II sorter, 384 GFP-positive beads from the FLAG variant APB library were sorted into individual wells of a 384-well plate. The fluorescence profile of each sorted bead was recorded using the “index sort” feature. To enable pooled sequencing of the amplicons on each sorted bead, a unique barcode was added to each well during plate-based PCR amplification, then the barcoded amplicons were pooled together for long-read sequencing.STDU2 43691.601S24-348Demultiplexing the pooled sequencing reads linked FLAG variant sequences with well- specific barcodes. The well- specific barcodes mapped each FLAG variant sequence to the fluorescence profiles of individual beads sorted into the corresponding wells. To assign a quantitative binding phenotype to each variant sequence, a “mean Cy5 / GFP ratio” was calculated as the read count- weighted average of Cy5 / GFP ratios across sorted beads displaying that variant sequence.

[0118] Across all 25 FLAG variants, individual beads containing at least 100 reads for a given FLAG variant sequence cluster in distinct regions of Cy5 and GFP fluorescence space, with the mean Cy5 / GFP ratio typically representing the center of a tight distribution of observed Cy5 / GFP values for that variant (FIG. 6). This pattern suggests that Amplicon / Protein Beads programmed with the same DNA sequence generate a reproducible binding phenotype. It also confirmed that the amplicon molecules covalently attached to Amplicon / Protein Beads can be extracted for sequencing using PCR-based methods.

[0119] Outlier beads for each variant in FIG. 6 likely represented beads that were programmed with multiple distinct variant sequences during the APB-Display workflow. To investigate the source of these outliers, the fraction of beads displaying multiple DNA sequences was compared between theory and observation. The first step of the APB-Display workflow, emulsion PGR. stochastically links individual DNA template molecules with hydrogel beads. Poisson statistics based on the observation of 8 percent GFP+ beads in the FLAG variant APB library predicts that 96 percent of GFP+ beads display a single variant sequence while 4 percent display two or more sequences (FIG. 7A). In contrast, analysis of the sequencing data for the APB library showed that 85 percent of sorted beads displayed a single sequence, while 15 percent contained two or more unique sequences (FIG. 7B). This analysis revealed that the APB- Display bead generation workflow and / or the sorting and sequencing workflow introduced additional sources of molecular crosstalk beyond the stochastic DNA loading step. The effect of outlier bead noise on Cy5 / GFP ratio estimates should decrease as the bead population increases.

[0120] To test the quality of binding measurements generated with Amplicon / Protein Beads, mean Cy5 / GFP ratios calculated for six FLAG variants were compared with gold-standard KD values measured with an orthogonal fluorescence polarization assay (FIG. 8A). These values were highly correlated (R2=0.97) for KD values ranging from 3-1500nM, suggesting that binding occupancies measured using Amplicon / Protein Beads can directly report on thermodynamic constants across a wide dynamic range. This calibration curve enabled direct conversion of theSTDU2 43691.601S24-348 mean Cy5 / GFP value for each variant into a AAG value relative to the wildtype peptide. A sequence logo plot representing the AAG value for each variant reveals the expected epitope motif for the M2 antibody (FIG. 7B), further confirming that APB-Display can be used to generate bead libraries with expected genotype-phenotype linkages.

[0121] Together, these data demonstrate that that APB libraries can be paired with sorting and sequencing-based workflows to rapidly and accurately quantify protein binding affinities at scale.Methods

[0122] Plasmid construction

[0123] Gibson assembly was used to generate a Golden Gate destination plasmid with an N- terminal SNAP-tag and C-terminal eGFP (SMT213). This plasmid also contains a chloramphenicol resistance gene. T7 promoter, E. coli translation initiation site, and hairpin terminator for compatibility with cell-free transcription and translation. FLAG variant DNA sequences with flanking Bsal recognition sequences were ordered as gB locks (Integrated DNA Technologies), then cloned into the SMT213 vector using Golden Gate assembly. Wholeplasmid sequencing confirmed proper assembly of all variants.

[0124] Chemical synthesis of benzylguanine methacrylate

[0125] Benzylguanine methacrylate (BG-MA) was synthesized as previously described in Fryer et. al, ACS Cent. Sci, 2022. Briefly, equal volumes of 40 mM of BG-PEG-NH2 (New England Biolabs) and 40 mM methacrylic acid NHS ester (Sigma Aldrich) and 60mM triethylamine (Sigma Aldrich) were combined. All stock solutions were prepared fresh in DMSO (Sigma Aldrich). The reaction was incubated for 16 hours at 30° C, with shaking at 400 rpm. The reaction was quenched with the addition of one volume of 100 mM Tris-HCl (pH 7.5, Invitrogen), followed by 3 hours of rotation at room temperature. The resulting 5 mM BG-MA stock solution (concentration estimate based on 75% completion) was stored at -20° C for further use.

[0126] Microfluidic Generation of functionalized hydrogel beads

[0127] To generate hydrogel droplets functionalized with DNA and protein capture reagents, unpolymerized hydrogel mix was prepared with 10 mM Tris-HCl pH 7.5, 15 mM NaCl, 1 mM EDTA, 6% v / v mono:bis-acrylamide (37.5:1 ratio, BioRad), 0.3% ammonium persulfate (Sigma Aldrich), 30 pM of a 5’ acrydite-modified oligonucleotideSTDU2 43691.601S24-348(ACCGTATTACCGCCTTTGAGTGAG (SEQ ID NO: 29). IDT), and 50 pM benzyl-guanine methacrylate (BG-MA). An oil mix was prepared with 0.4% TEMED (Sigma Aldrich) in dSurf fluorinated oil (Fluigent).

[0128] A flow-focusing microfluidic droplet generator device was used to generate uniform hydrogel droplets (approx. 18 microns in diameter). The unpolymerized hydrogel mix was filtered through a 0.22 pm filter, then each of the hydrogel and oil mixes were loaded into syringes and connected to syringe pumps. Hydrogel-in-oil droplets were formed by flowing the oil mix at 500 pL / hr and the unpolymerized hydrogel mix at 200 pL / hr, generating ~3pL droplets at -18.5 kHz (e.g., 66 million droplets / hr). Droplets were collected in 0.5mL tubes and incubated at room temperature overnight to facilitate hydrogel polymerization.

[0129] Polymerized hydrogel beads were recovered from the emulsions after >18 hours. After excess oil solution was drained from each tube by pipetting, 1 / 7. 17 / .2 / 7.2 / 7- Perfluoro- 1 -octanol (PFO, Sigma Aldrich) was added at -50% of the volume of the emulsion pellet, and the tube was inverted -5 times to promote emulsion destabilization. TE-Tween buffer (10 mM Tris HC1 pH 7.5, 0.1 mM EDTA, 0.1% Tween-20) was added in 5-10x excess of the PFO-emulsion volume to extract the hydrogel beads into aqueous buffer solution. After vigorous tube inversion, a clear separation between aqueous and oil phases was observed, and the upper aqueous / hydrogel bead layer was transferred to fresh tubes. A second extraction with TE-Tween buffer was performed to improve bead recovery. Recovered hydrogel beads were washed 3x with TE-Tween buffer by pelleting the beads via centrifugation, removing supernatant, and replacing with fresh buffer. Brightfield imaging using a calibration slide and image processing with custom python scripts were used to quantify the diameters of recovered hydrogel beads. Functionalized beads were stored at 4° C for further use.

[0130] Emulsion PCR

[0131] 20 pL of pelleted dual-functionalized hydrogel beads were used for each emulsionPCR reaction. Bead pellets were washed twice with Tris-Tween buffer (10 mM Tris HC1 pH 7.5, 0.1% Tween-20) and transferred to a 0.2-mL PCR strip tube. PCR reagents were added to a final volume of 35 pL (lx PrimeSTAR GXL buffer, PrimeStarGXL DNA polymerase (0.05 units / pL, Takara), 200 pM dNTPs, 0.2 pM forward primer). Plasmid DNA template was quantified using a Qubit dsDNA HS assay kit (Invitrogen). and added to the reaction at the molar concentration required to achieve approximately 0.05-0.1 DNA molecules per -3 pL hydrogel bead.STDU2 43691.601S24-348

[0132] Assembled PCR reactions were mixed briefly by vortexing and incubated on ice for 5 min to allow PCR reagents to diffuse into the hydrogel beads. After incubation, the beads were pelleted by centrifugation and 10 pL of supernatant was removed by pipetting. The remaining bead pellet was vortexed briefly before the addition of 60uL of EvaGreen droplet oil (BioRad) to each reaction (2-3x the final reaction volume).

[0133] To generate particle-templated emulsions, the sample tubes were vortexed for 5 minutes at maximum speed (3000 rpm) on a Fisher Scientific digital vortex mixer (120V, Cat No. 0215370). For best emulsion quality, tubes were placed horizontally on the vortex mixer and secured using lab tape, presumably to increase the force exerted on the hydrogel bead particles. The resulting emulsion was placed in a thermal cycler for 32 cycles of amplification (2 min 96° C, 32 cycles of [10 sec 96° C, 15 sec 60° C, 1 min / kb 68° C], 5 min 68° C, 12° C hold).[0134| After amplification, Amplicon Beads were recovered from the emulsions by draining excess oil and adding 20 pL PFO. Tubes were inverted 10 times to promote emulsion destabilization. Next, 100 pL of Tris-Tween buffer was added to extract Amplicon Beads into the aqueous buffer solution. After vigorous tube inversion, a clear separation between aqueous and oil phases was observed, and the upper aqueous / hydrogel bead layer was transferred to fresh 0.2-mL PCR tubes. A second extraction with 100 pL of Tris-Tween buffer was performed to improve bead recovery. Amplicon Beads were washed 3x with 150 pL of Tris-Tween buffer, via cycles of buffer addition, vortexing, centrifugation, and supernatant removal. Amplicon Beads were stored at 4° C until further use.

[0135] Emulsion IVTT

[0136] Emulsion IVTT reactions (typically 30 pL) were prepared by adding in vitro transcription and translation reagents to the Amplicon Bead pellets recovered from the emulsion PCR step. PURExpress reagents (12 pL Part A, 9 pL Part B, New England Biolabs) were allowed to defrost on ice, then combined together on ice with 0.8 Units / uL of SUPERase-In RNase inhibitor (Invitrogen). The IVTT mixture was added directly to the washed Amplicon Bead pellets in 0.2-mL tubes and mixed by vortexing. The sample was allowed to incubate on ice for 5 min to allow the IVTT reagents to soak into the hydrogel beads.

[0137] Next, 70uL of EvaGreen oil (BioRad) was added to each tube, and particle-templated emulsions were generated by vortexing horizontally at 3000 rpm for 5 minutes. Emulsion IVTT samples were incubated at 37° C for 2 hours in a thermocycler to promote protein expression andSTDU2 43691.601S24-348SNAP-tag mediated bead capture. After incubation, Amplicon / Protein Beads were recovered from emulsions exactly as described in the emulsion PCR section, with the exception that a SNAP-blocking buffer (IX UltraPure Phosphate Buffered Saline (gibco), 0.1% Tween-20 (Fisher), 35 pg / mL chloramphenicol (Sigma), 10 pM SNAP-Surface Block (New England Biolabs)) was used for the bead extraction steps to prevent further protein translation or SNAP- tag attachment to beads. Amplicon / Protein Bead pellets were washed 3x with 200 pL PBS-T buffer (IX UltraPure Phosphate Buffered Saline, 0.1 % Tween-20). Amplicon / Protein Beads were stored at 4° C, protected from light, until further use.

[0138] FLAG / anti-FLAG binding assay

[0139] To measure binding of murine M2 anti-FLAG antibody (Sigma F1804) to libraries of FLAG epitope variants, Amplicon / Protein Beads displaying SNAP-FLAG-eGFP proteins were mixed with 6 nM (1 ng / pL) of the M2 antibody in PBS-T + 0.1% BSA buffer in a total volume of 150 pL. 6 nM (1 ng / pL) of Cy5-labeled secondary antibody (goat anti-mouse IgG, Thermo Fisher A 10524) was added for fluorescence visualization. Reaction tubes were protected from light and incubated for >20 hours on a rotator at 4° C to allow the binding interactions to reach equilibrium.

[0140] Fluorescence microscopy

[0141] A Nikon Ti2 scope with SOLA light engine and Zymo CMOS camera was used to collect all microscopy images. Droplets were imaged using Countess cell counting slides (Invitrogen), while beads were imaged within silicone gaskets (CultureWell, Grace Bio-Labs) adhered to glass slides. All images were collected with a lOx objective and 2x2 binning. Brightfield images were collected using overhead white light illumination passing through a Cy5 filter cube. Fluorescence images were collected using GFP and Cy5 filter cubes, then darkfield- and flatfield- corrected with a custom python script. Microscopy images were analyzed using the magnify image-processing package and custom python scripts (github.com / FordyceLab / magnify)

[0142] Bead analysis with flow cytometry

[0143] A BD Accuri flow cytometer (owned by BioHub) was used for fluorescence analysis of Amplicon / Protein Beads. Bead samples were diluted in PBS-T buffer and analyzed in the FITC and APC channels after forward and side scatter singlet gating.

[0144] Bead sorting with FACSSTDU2 43691.601S24-348

[0145] Prior to bead sorting, beads were filtered with a 20 pm strainer into 5-mL FACS tubes. Beads were sorted on a BD FACS Aria II sorter (in the Stanford Shared FACS Facility) equipped with a 100 pm nozzle. Drop delay calibration was performed with 6 pm Accudrop beads (BD) and fine-tuned with 20 pm AccuCount beads (Spherotech). Upon flowing APBs fluorescently labeled with eGFP-tagged FLAG variants and Cy5-labelled antibodies, singlet beads were identified using forward and side scatter parameters, while GFP-positive beads were identified relative to the large population of blank beads in the APB sample. For single-bead sorting, 384 GFP-positive beads were sorted into individual wells of an empty 384-well plate using the “index sort” feature to record the fluorescence profiles of each sorted bead. For pooled sorting, GFP-positive beads were sorted into four 1.5-mL tubes pre-filled with Tris-Tween buffer according to diagonal gates designed to separate variants with different Cy5 / GFP ratios.

[0146] Amplicon sequencing from sorted single beads

[0147] DNA amplicons were recovered from sorted Amplicon / Protein Beads via multi-stage PCR. First, sorted beads were concentrated at the bottom of the 384 well plate by centrifugation. Next, PCR reagents were added to each well to a final volume of 8 pL (lx PrimeSTAR GXL buffer, PrimeStarGXL DNA polymerase (0.025 units / pL), 200uM dNTPs, 0.2 pM inner forward primer, 0.2 pM inner reverse primer). To extract only the FLAG variant region, universal inner primers recognizing the conserved regions flanking the variant region were used for the first 10 rounds of amplification (1 min 96° C, 10 cycles of [10 sec 96° C, 15 sec 60° C, 15 sec 68° C], 1 min 68° C, 12° C hold). To append well-specific barcodes. 2 pL of 384 uniquely-barcoded outer primers (0.2 pM each) from the evSeq pipeline (fhalab.github.io / evSeq / ) were stamped onto the plate prior to 15 more rounds of amplification (1 min 96° C, 15 cycles of [10 sec 96° C, 15 sec 60° C, 20 sec 68° C], 1 min 68° C, 12° C hold).

[0148] Plate-based PCR samples were pooled and gel-purified as described in the evSeq protocol with minor adjustments. Briefly, 5 pL of PCR supernatant from each well were pooled together in the presence of 4mM EDTA (pH 8.1). Amplicons of target length (262 bp) were extracted from a 1% agarose gel and purified with the ZymoClean Gel DNA recovery kit (Zymo Research D4001), and eluted into nuclease-free water. Purified amplicon DNA from each gel slice was quantified using a Qubit dsDNA HS assay kit (Invitrogen). Purified samples were combined in equal molar ratios for custom long-read sequencing by Plasmidsaurus (Eugene,STDU2 43691.601S24-348OR). Sequencing reads were filtered for exact matches to FLAG variant and barcode sequences, demultiplexed, and analyzed using a custom python script.[0149| Amplicon sequencing from four-way sorted beads

[0150] DNA amplicons were recovered from four-way sorted Amplicon / Protein Beads via PCR.

[0151] Briefly, sorted beads were concentrated at the bottom of the sort tube by brief centrifugation, then transferred to 0.2mL PCR tubes. PCR reagents were added to a final volume of 20uL (lx PrimeSTAR GXL buffer, PrimeStarGXL DNA polymerase (0.025 units / uL), 200uM dNTPs, 0.2uM forward primer, 0.2uM reverse primer). A reference DNA template (SNAP- linker-GFP) was added to every PCR reaction in equal amounts (3.63 pg) to control for different numbers of beads sorted into each bin. For full-length amplicon recovery, the same primers were used as in the emulsion PCR reaction. To recover only the FLAG variant region, primers recognizing the conserved regions flanking the variant region were used, with the reverse primer barcoded such that each sort tube received a different 12 nt barcode. PCR samples were transferred to a thermocycler for 15 cycles of amplification (2 min 96° C, 32 cycles of [10 sec 96° C, 15sec 60° C, Imin / kb 68° C], 5min 68° C, 12° C hold). PCR cleanup was performed using the DNA Clean & Concentrator-5 kit (Zymo Research), and purified DNA was quantified using a Qubit dsDNA HS assay kit (Invitrogen). Purified and barcoded DNA samples were pooled together for amplicon sequencing by Plasmidsaurus (Eugene, OR). Sequencing reads were filtered for exact matches to FLAG variant and barcode sequences, demultiplexed, and analyzed using a custom python script.

[0152] Microfluidic device fabrication The droplet generation device with a 10 pm nozzle diameter was slightly modified from Fryer et al. ACS Cent Sci. 2022 in AutoCAD2023 (Autodesk, Inc.) and ordered as a film photomask at 32,000 dpi (Fineline Imaging). Silicon master molds with 10 pm relief heights were constructed using SU-8-2010 photoresist and standard photolithography techniques. Poly(dimethylsiloxane) (PDMS) microfluidic devices were fabricated from the master molds using soft-lithography at a 1:5 elastomer base:crosslinker ratio (Momentive RTV 615). After a 15 min bake at 80° C, droplet generation devices were hole punched using a 1 mm biopsy punch (PicoPunch), monolithically bonded to a blank 1:10 PDMS slab, and baked at 80° C for 48 hours to bond the slabs together.STDU2 43691.601S24-348

[0153] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0154] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0155] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein.Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

STDU2 43691.601S24-348CLAIMSWhat is claimed is:

1. A method for generating DNA-encoded protein libraries comprising: contacting a plurality of hydrogel beads functionalized with a DNA capture agent and / or a protein capture agent with a library of template polynucleotides encoding a plurality of proteins of interest and amplification reagents to generate template loaded hydrogel beads; incubating template loaded hydrogel beads in water-in-oil emulsion droplets under conditions for amplification to generate amplicon hydrogel beads; contacting isolated amplicon hydrogel beads with in vitro transcription and translation (IVTT) reagents to generate amplicon-IVTT hydrogel beads; incubating amplicon-IVTT hydrogel beads in water-in-oil emulsion droplets under conditions for cell-free protein synthesis to generate amplicon-protein hydrogel beads; and recovering amplicon-protein hydrogel beads.

2. The method of claim 1, wherein the template polynucleotides are plasmids or linear double stranded DNA templates.

3. The method of claim 1 or 2, wherein the template polynucleotides further comprise a barcode or unique identifier sequence.

4. The method of any of claims 1-3, wherein the library of template polynucleotides is provided at a relative amount of 0.01-5 template polynucleotide molecules per hydrogel bead.

5. The method of any of claims 1-4, wherein less than about 1% of the template loaded hydrogel beads comprise two or more templates.

6. The method of any of claims 1-5, wherein at least 90% of the templated loaded hydrogel beads are encapsulated in an individual droplet.

7. The method of any of claims 1-6, wherein each template loaded hydrogel bead is encapsulated into an individual droplet.

8. The method of any of claims 1-7, wherein the amplification reagents contain a primer set for amplifying the template polynucleotide.STDU2 43691.601S24-3489. The method of claim 8, wherein the primer set comprises a bead-immobilized primer.

10. The method of claim 8 or 9, wherein the primer set comprises a primer functionalized with a protein capture reagent.

11. The method of any of claims 1-10, wherein the protein of interest is tethered to the amplicon-protein hydrogel beads by a protein capture agent.

12. The method of any of claims 1-11, wherein the protein of interest comprises a moiety configured to bind to the protein capture agent.

13. The method of any of claims 1-12, further comprising removing excess template polynucleotides and amplification reagents outside of the template loaded hydrogel beads prior to amplification.

14. The method of any of claims 1-13, wherein at least 90% of the amplicon-IVTT hydrogel beads are encapsulated in individual droplets.

15. The method of any of claims 1-14, wherein each amplicon-IVTT hydrogel bead is encapsulated into an individual droplet.

16. The method of any of claims 1-15, further comprising measuring concentration of the amplicons and / or protein of interest in each amplicon-protein hydrogel bead, or droplet comprising thereof.

17. The method of any of claims 1-16, wherein the method further comprises sorting or separating the amplicon-protein hydrogel bead based on one or more characteristics or phenotypic properties of the proteins of interest.

18. The method of claim 17, wherein the sorting or separating is on individual beads or pooled groups of beads.

19. The method of claim 17 or 18, wherein the one or more characteristics or phenotypic properties include the concentration of amplicons and / or proteins of interest in the hydrogel bead, stability of the proteins of interest, enzymatic activity of the proteins of interest, chemical modification of the proteins of interest, and or binding activity of the proteins of interest.STDU2 43691.601S24-34820. The method of any of claims 17-19, further comprising identifying sequences of the proteins of interest for each separated group of amplicon-protein hydrogel beads.

21. The method of claim 20, wherein identifying sequences of the proteins of interest comprises sequencing the amplicons for each separated group of amplicon-protein hydrogel beads.

22. The method of any of claims 1-21, further comprising conducting one or more of a protein functional assay, a protein phenotypic analysis, or protein or nucleic acid sequencing on recovered amplicon-protein hydrogel beads, or isolated proteins of interest or amplicons from the amplicon-protein hydrogel beads.

23. The method of any of claims 1-22, further comprising conducting a binding assay on recovered amplicon-protein hydrogel beads, or isolated proteins of interest from the ampliconprotein hydrogel beads.

24. The method of claim 23, wherein the binding assay comprises: incubating the amplicon-protein hydrogel beads with one or more binding partners; separating the amplicon-protein hydrogel beads based on bound binding partner occupancy; and identifying sequences of the proteins of interest for each separated group of ampliconprotein hydrogel beads.

25. The method of claim 24, wherein each binding partner is a nucleic acid, a protein, a peptide, a small molecule, or a combination thereof.

26. The method of claim 25, wherein the binding partner comprises an antibody.

27. The method of claim 25, wherein the binding partner comprises a ligand to the proteins of interest.

28. The method of any of claims 24-27, wherein the binding partner has a detectable label.

29. The method of claim 28, wherein the separating is based on the relative amount of the detectable label associated with each amplicon-protein hydrogel bead.

30. The method of claim 17-29, wherein each separated group comprises a single bead.STDU2 43691.601S24-34831. The method of claim 17-29, wherein each separated group comprises two or more beads with the same or similar phenotypic properties.

32. The method of any of claims 1-31. further comprising calculating one or more functional parameters for the protein of interest.

33. The method of claim 32, wherein calculating one or more functional parameters for the protein of interest comprises calculating a frequency of each protein sequence in each separated group and determining the one or more functional parameters based on frequency distributions.

34. The method of claim 32 or 33, wherein the one or more functional parameters comprise binding affinity, binding specificity, protein stability, and / or enzymatic activity.

35. The method of any of claims 32-34, wherein the one or more functional parameters comprise dissociation constants, association constants, binding free energy, changes in binding affinity, folding free energy, or changes in folding free energy.

36. A composition comprising: a plurality of template loaded hydrogel beads, a plurality of amplicon hydrogel beads, a plurality of amplicon-IVTT hydrogel beads, or a plurality of amplicon-protein hydrogel beads.

Images