Methods of selectively expressing products in EBV-infected cells, and compositions for practicing the same
The use of sensor RNA with editable codons and ADAR editing allows for the selective expression of a toxic protein in EBV-infected cells, effectively addressing the challenge of targeting EBV-infected B cells in autoimmune diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV
- Filing Date
- 2025-10-17
- Publication Date
- 2026-04-23
AI Technical Summary
Current therapies targeting EBV proteins in latency stages II, III, and lytic reactivation are ineffective for treating EBV-associated autoimmune diseases, as EBV down-regulates viral protein expression shortly after infection, making it difficult to selectively target EBV-infected B cells.
A method involving sensor RNA is used to selectively express a product in EBV-infected cells by hybridizing with target RNAs, utilizing a first nucleotide sequence with editable codons, a second nucleotide sequence encoding a cleavage domain, and a third sequence encoding a toxic protein, leveraging ADAR editing to induce cell death.
This approach effectively targets and eliminates EBV-infected B cells, providing a therapeutic strategy for EBV-associated autoimmune diseases by selectively expressing a toxic protein in these cells.
Smart Images

Figure US2025051445_23042026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: STAN-2220WOStanford No.: S24-311METHODS OF SELECTIVELY EXPRESSING PRODUCTS IN EBV-INFECTED CELLS, AND COMPOSITIONS FOR PRACTICING THE SAMEGOVERNMENT RIGHTS
[0001] This invention was made with Government support under contract HT9425-23-1-0595 awarded by the Department of Defense, under contract DGE- 1656518 (FELLOWSHIP) awarded by the National Science Foundation and under contracts AI173189, EB033858, and EB035891 awarded by the National Institutes of Health. The Government has certain rights in the invention.CROSS-REFERENCE TO RELATED APPLICATION
[0002] This application claims priority benefit to the filing date of U.S. Provisional Patent Application Serial No. 63 / 709,335, filed on October 18, 2024, the disclosure of which application is herein incorporated by reference in its entirety.SEQUENCE LISTING
[0003] A Sequence Listing is provided herewith as a Sequence Listing XML, “STAN- 2220WO_Seq_List” created October 14, 2025 and having a size of 48,937 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.INTRODUCTION
[0004] Multiple sclerosis, systemic lupus erythematosus, and several other autoimmune diseases are associated with Epstein-Barr virus (EBV). EBV infects the patient’s B cells months to years prior to the onset of autoimmunity and persists in B cells for life, triggering and sustaining the disease. Targeting EBV-infected B cells promises to be a highly effective therapy for EBV-associated autoimmune diseases, but no such therapy has been developed to date. A major challenge is that shortly after infection, EBV down-regulates all viral protein expression. However, two short noncoding viral RNAs are expressed at millions of copies per infected cell that can be detected in latency stages.
[0005] Provided herein are methods and kits for selectively expressing products in EBV-infected B- cells utilizing ADAR editing.Attorney Docket No.: STAN-2220WOStanford No.: S24-311SUMMARY
[0006] The present disclosure provides a method for expressing a product in an EBV-infected cell, the method comprising: contacting an EBV-infected cell with a sensor RNA comprising: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA present in the EBV-infected cell, wherein the sensor nucleotide sequence comprises one or more editable codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding the product.
[0007] The present disclosure provides a method for treating a subject suffering from or suspected to suffer from an Epstein-Barr Virus (EBV)-associated disease, the method comprising administering to the subject an effective dose of a sensor RNA containing (i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA present in an EBV-infected cell, wherein the sensor nucleotide sequence comprises one or more editable codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding a toxic protein or portion thereof.
[0008] Compositions and kits for practicing the subject methods are also provided.BRIEF DESCRIPTION OF THE FIGURES
[0009] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures.
[0010] FIG. 1 EBV life cycle. EBV infects naive B cells and establishes latency. EBV+ B cells in healthy and autoimmunity reside in latency type 0 and I, expressing one or no viral proteins, but noncoding viral RNAs EBER1 and 2 in high copy numbers. All current approved and experimental approaches target proteins expressed in latency II, III, and during lytic reactivation (gray area) and are ineffective in autoimmunity.
[0011] FIG. 2A-FIG. 2B Therapeutic approach. FIG. 2A, targeting EBV-infected B cells with LNP- encapsulated RADAR-RNA, FIG. 2B, molecular mechanism of RADAR-RNA annealing to viral EBER1 / 2, ADAR-mediated base exchange A->I eliminating the stop codon, toxin translation, followed by cell death of EBV+ B cells.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0012] FIG. 3A-FIG. 3D EBERl / 2-dependent induction of RA-DAR signal. Flow cytometry data of FIG. 3A, FIG. 3B, EBERl-expressing Hek293 cells and FIG. 3C, FIG. 3D, EBER2-expressing Hek293 cells (blue) vs. control cells (orange), transfected with different versions of RADAR sensors: FIG. 3A, FIG. 3C, first RADAR generation (linear), showing robust fluorescent responses to EBER1 / 2 RNAs and very low background fluorescence, vs. FIG. 3B, FIG. 3D, second RADAR generation (modulADAR), with higher background, but also ~ 10-fold higher fluorescent signals.
[0013] FIG. 4 depicts lipid nanoparticle delivery of sensor RNA to EB V-infected B-cells.
[0014] FIG. 5A-FIG. 5B Screening sensors for EBV-encoded RNAs. FIG. 5A Detection of Epstein- Barr virus (EBV) EBER1 RNA using modulADAR and linear sensors. Tiling of the EBER1 sequence with modulADAR sensors reveals improved signal and fold-activation compared to linear sensors designed around CCA motifs. FIG. 5B Tiling of the EBER2 sequence reveals a linear sensor with improved fold-activation but worse signal than modulADAR sensors. Dots represent biological replicates with bars showing group means (n = 2). Statistical significance was assessed using two- tailed Student's t-test with Bonferroni correction for multiple comparisons. Significance levels: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05.
[0015] FIG. 6A-FIG. 6B Developing modulADAR towards sensing viral infection. FIG. 6A-FIG. 6B Traces of mean EGFP fluorescence intensity across bins of mCherry (transfection marker) fluorescence intensity. Transfection efficiency increases from left to right while reporter expression increases from bottom to top. ModulADAR sensors generally outperform linear sensors at lower transfection efficiencies.DEFINITIONS
[0016] Before describing exemplary embodiments in greater detail, the following definitions are set forth to illustrate and define the meaning and scope of the terms used in the description.
[0017] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994). and Hale & Markham. THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein. Still, certain terms are defined below for the sake of clarity and ease of reference.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0018] Certain ranges are presented herein with numerical values being preceded by the term "about. " The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0019] It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. For example, the term “a RNA sensor” refers to one or more RNA sensors, i.e., a single RNA sensor and multiple RNA sensors. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0020] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, this term includes, but is not limited to. single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer including purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms “polynucleotide” and “nucleic acid” should be understood to include, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
[0021] By "hybridizable" or “complementary” or “substantially complementary" it is meant that a nucleic acid (e.g. RNA, DNA) contains a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine / adenosine) (A) pairing with thymidine / thymidine (T), A pairing with uracil / uridine (U), and guanine / guanosine) (G) pairing with cytosine / cytidine (C). Inosine (I) bases pair with cytosine / cytidine. In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule (e.g.. when a DNA splint oligo base pairs with an mRNA segment, etc.): G can also base pair with U. For example, G / U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons inAttorney Docket No.: STAN-2220WOStanford No.: S24-311 mRNA. Thus, in the context of this disclosure, a G (e.g., of a protein-binding segment (e.g., dsRNA duplex) of a guide RNA molecule; of a target nucleic acid (e.g., target DNA or RNA) base pairing with a sensor RNA) is considered complementary to both a U and to C. For example, when a G / U base-pair can be made at a given nucleotide position of a protein-binding segment (e.g., dsRNA duplex) of a sensor RNA molecule, the position is not considered to be non-complementary, but is instead considered to be complementary. Pseudouridine (pseudo-U, T) is meant to stand for an isomer of uridine, where the uracil nucleobase is attached through a carbon-carbon linkage to the sugar. The pseudouridine is in some cases modified. In some cases the pseudouridine modification is methylation, e.g., at the N1 position, forming N1 -methylpseudouridine. Pseudouridine and its modifications base pair like uridine. When U is shown in a sequence, e.g. UAG, the U may be a pseudouridine. When a T is shown in a sequence, it is meant that the RNA encoded by that sequences contains a U, a pseudouridine, or a modified pseudouridine. The DNA that encodes a U or pseudouridine contains T in place of U or pseudouridine. “Mismatched” as used herein refers to a base that is opposite a non-complementary base in an otherwise double-stranded structure (e.g., a C:A mismatch), or that a base is opposite no bases (e.g., a base is in a loop structure).
[0022] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).
[0023] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure, a ‘bulge’, and the like). A polynucleotide can include 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more. 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, wouldAttorney Docket No.: STAN-2220WOStanford No.: S24-311 represent 90 percent complementarity. The remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649- 656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group. University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).
[0024] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
[0025] The term “naturally-occurring” as used herein as applied to a nucleic acid, a protein, a cell, or an organism, refers to a nucleic acid, protein, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is naturally occurring.
[0026] The term “exogenous” as used herein as applied to a nucleic acid or a protein refers to a nucleic acid or protein that is not normally or naturally found in and / or produced by a given bacterium, organism, or cell in nature. As used herein, the term “endogenous nucleic acid” refers to a nucleic acid that is normally found in and / or produced by a given bacterium, organism, or cell in nature. An “endogenous nucleic acid” is also referred to as a “native nucleic acid” or a nucleic acid that is “native” to a given bacterium, organism, or cell. As used herein, the term “endogenous polypeptide” refers to a polypeptide that is normally found in and / or produced by a given bacterium, organism, or cell in nature.
[0027] “Recombinant,” as used herein, means that a particular nucleic acid or protein is the product of various combinations of cloning, restriction, and / or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. Generally, DNA sequences encoding the structural coding sequence can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from aAttorney Docket No.: STAN-2220WOStanford No.: S24-311 recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Such sequences can be provided in the form of an open reading frame uninterrupted by internal non-translated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5’ or 3’ from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms.
[0028] Thus, e.g., the term “recombinant” nucleic acid or “recombinant” protein refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
[0029] By “construct” or “vector” is meant a recombinant nucleic acid, generally recombinant DNA, which has been generated for the purpose of the expression and / or propagation of a nucleotide sequence(s) of interest, or is to be used in the construction of other recombinant nucleotide sequences.
[0030] The term “transformation” or “transfection” refers to a permanent or transient genetic change induced in a cell following introduction of a nucleic acid (i.e„ DNA and / or RNA exogenous to the cell). Genetic change (“modification”) can be accomplished either by incorporation of the new DNA into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a eukaryotic cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell. Suitable methods of genetic modification include viral infection, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, direct microinjection, and the like. The choice of method is generally dependent on the type of cell being transformed and the circumstances under which the transformation is taking place (i.e.. in vitro, ex vivo, or in vivo). A general discussion of these methods can be found in Ausubel et al, Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0031] The terms “regulatory region” and “regulatory elements”, used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, translational start and stop codons, translation initiation sites, splice enhancer / donor / branch / acceptor sites, and the like, that provide for and / or regulate expression of a coding sequence and / or production of an encoded polypeptide in a host cell. As used herein, a "promoter sequence" or “promoter” is a DNA regulatory region capable of binding / recruiting RNA polymerase (e.g., via a transcription initiation complex) and initiating transcription of a downstream (3' direction) sequence (e.g., a protein coding (“coding”) or nonprotein-coding (“non-coding”) sequence. A promoter can be a constitutively active promoter (e.g., a promoter that is constitutively in an active / ”ON” state), it may be an inducible promoter (e.g., a promoter whose state, active / ”ON” or inactive / “OFF”, is controlled by an external stimulus, e.g., the presence of a particular temperature, compound, or protein), it may be a spatially restricted promoter (e.g., tissue specific promoter, cell type specific promoter, etc.), and / or it may be a temporally restricted promoter (e.g., the promoter is in the “ON” state or “OFF” state during specific stages of embryonic development or during specific stages of a biological process, e.g., hair follicle cycle in mice).
[0032] "Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a nucleotide sequence (e.g.. a protein coding sequence, e.g., a sequence encoding an mRNA; a non-protein coding sequence, e.g., a sequence encoding a Shh protein; and the like) if the promoter affects its transcription and / or expression.
[0033] The term “adenosine deaminase acting on RNA” or “ADAR” refers to an enzyme that catalyze the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNA substrates that are double stranded. ADARs preferentially edit double stranded RNAs at sites of mismatches where mismatches containing adenosines and cytosines are editing more efficiently than other mismatches. Editing by ADARs results in nucleotide substitution in RNA, because the purine I generated as the result of the deamination reaction is recognized as G instead of A, both by ribosomes during translational decoding of mRNA and by RNA-dependent polymerases during RNA replication. The term “ADAR” encompasses any known type of ADAR such as ADAR1 (ADAR) or ADAR2 (AD ARB 2).
[0034] As used herein “ADAR1” refers to an adenosine deaminase acting on RNA that catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNA substrates that are doubleAttorney Docket No.: STAN-2220WOStanford No.: S24-311 stranded. AD ARI has 2 main isoforms, pl50 and pl 10. The term “ADAR1” encompasses ADAR1 from various species. Amino acid sequences of AD ARI from various species are publicly available. See, e.g., GenBank Accession Nos. NP_001102 (Homo sapiens ADAR1 pl50), NP_001180424.1 (Homo sapiens AD ARI pl 10), NP_001139768 (Mus musculus ADAR1 pl50), NP_001033676 (Mus musculus ADAR1 pl 10). The term "ADAR1" as used herein also encompasses fragments, fusion proteins, and variants (e.g., variants having one or more amino acid substitutions, addition, deletions, and / or insertions) that retain ADAR1 enzymatic activity.
[0035] As used herein “ADAR2” refers to an adenosine deaminase acting on RNA that catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNA substrates that are double stranded. ADAR2 is exclusively localized to the nucleus. The term “ADAR2” encompasses ADAR2 from various species. Amino acid sequences of ADAR2 from various species are publicly available. See, e.g., GenBank Accession Nos. NP_056648.1 (Homo sapiens ADAR2), NP_001020008.1 (Mus musculus ADAR2), ACO52474.1 (Doryteuthis opalescens ADAR2). The term "ADAR2" as used herein also encompasses fragments, fusion proteins, and variants (e.g., variants having one or more amino acid substitutions, addition, deletions, and / or insertions) that retain ADAR2 enzymatic activity.
[0036] The term “sample” as used herein relates to a material or mixture of materials, typically, although not necessarily, in fluid, i.e., aqueous, form, containing one or more components of interest. Samples may be derived from a variety of sources such as from food stuffs, environmental materials, a biological sample or solid, such as tissue or fluid isolated from an individual, including but not limited to, for example, plasma, serum, spinal fluid, semen, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs, and also samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, putatively virally infected cells, recombinant cells, and cell components). In certain embodiments of the method, the sample includes a cell. In some instances of the method, the cell is in vitro. In some instances of the method, the cell is in vivo.
[0037] The term "biological sample" encompasses a clinical sample or a non-clinical sample, and also includes tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, and the like. A "biological sample" includes a sample obtained from a patient's sample cell, e.g., a sample containing polynucleotides and / or polypeptides that is obtained from a patient's sample cell (e.g., a cell lysate or other cell extract containing polynucleotides and / or polypeptides); and a sampleAttorney Docket No.: STAN-2220WOStanford No.: S24-311 containing sample cells from a patient. A biological sample containing a sample cell from a patient can also include normal, non-diseased cells. A biological sample may be from a plant or an animal. The biological sample may also be from any species. In certain embodiments of the method, the biological sample includes a cell. In some instances of the method, the cell is in vitro. In some instances of the method, the cell is in vivo.
[0038] The term “editable codon” as used herein refers to a 3-nucleotide sequence that is editable by an ADAR protein or a derivative thereof. The codon may be a start codon, a stop codon or an AUA codon. The codon contains a sequence that contains an adenosine base. In general, in the methods disclosed herein, the editable codon is a start codon that is edited to become a non-start codon, a stop codon that is edited to become a non-stop codon, or a non-start codon (i.e.. AUA) that is edited to become a start codon.DETAILED DESCRIPTION
[0039] Before the various embodiments are described, it is to be understood that the teachings of this disclosure are not limited to the particular embodiments described, and as such can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present teachings will be limited only by the appended claims.
[0040] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present teachings, some exemplary methods and materials are now described.
[0042] The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present claims are not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided can be different from the actual publication dates which can be independently confirmed.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0043] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
[0044] All patents and publications, including all sequences disclosed within such patents and publications, referred to herein are expressly incorporated by reference.
[0045] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0046] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0047] Epstein-Barr Virus (EBV; Human gammaherpesvirus 4) is an extremely successful human herpes virus, which infects essentially all human beings at some time during their life span. EBV infection and the associated immune response results in production of antibodies (seroconversion), which occurs mainly during the first years of life, but may also happen during adolescence or later in life. Infection of adolescents can result in infectious mononucleosis, an acute serious condition characterized by massive lymphocytosis. Transmission of EBV mainly occurs through saliva but can rarely be spread through semen or blood, e.g. through organ transplantations and blood transfusions. EBV transmission through oral secretions results in infection of epithelial cells of the oropharynx.Attorney Docket No.: STAN-2220WOStanford No.: S24-311From the epithelial cells EBV can infect B cells, which are the major reservoir for the virus, but other cell types may also become infected. As a result, EBV can shuttle between different cell types, mainly B cells and epithelial cells. Moreover, since the virus can switch between a latent and a lytic life cycle, EBV has the ability to cause chronic relapsing / reactivating infections. Chronic or recurrent EBV infection of epithelial cells has been linked to systemic lupus erythematosus and Sjogren’s syndrome, whereas chronic / recurrent infection of B cells has been associated with rheumatoid arthritis, multiple sclerosis and other diseases. Accordingly, since EBV can shuttle between epithelial cells and B cells, the systemic autoimmune diseases often occur as overlapping syndromes with symptoms and characteristic autoantibodies (e.g. antinuclear antibodies and rheumatoid factors) reflecting epithelial and / or B cell infection.
[0048] EBV can replicate by two means, infected B cell proliferation or lytic virion production. Latent EBV proteins stimulate host cell proliferation and EBV DNA replicates within these cells. Alternatively, EBV can produce infectious virions during lytic replication; however, the latter might be mainly required for transmission, whereas latent infection is the default program of infection in B cells and seems to be sufficient to spread EBV in the infected host. Within B cells, latent EBV proteinencoding genes are predominantly expressed and cause activation, proliferation and resistance to cell death. These genes of the latent EBV infection encode eight EBV proteins, two EBV-encoded small RNAs (EBERs) that are not translated and 25 pre- microRNAs. The respective viral gene expression program is called latency III. Presumably after activation from EBV latency III, B cells enter the germinal center reaction and only three latent EBV proteins can be found in centroblasts and centrocytes. These proteins are Epstein-Barr nuclear antigen 1 (EBNA1) and the two latent membrane proteins (LMP1 and LMP2). Their expression in the so called latency Ila program is thought to ensure that EBV-infected B cells survive the germinal center reaction to gain access to the memory B cell pool, in which EBV persists without viral protein expression in latency 0. Only during homeostatic proliferation is EBNA 1 transiently expressed in memory B cells, and this pattern is called latency I. These latent EBV infection programs in B cells of healthy virus carriers represent the premalignant states of EBV-associated B cell lymphomas and can be associated with autoimmune disorders.. Only from latency 0 and I, and after extensive methylation of the viral genome, can lytic replication with its expression of >80 viral genes be efficiently induced, because the immediate early transcription factor BZLF1 that cooperates with the BRLF1 transcription factor to initiate infectious particle production prefers methylated CpG sequences. It is thought that stimulation of the B cell receptor of EBV-infected B cells expressing latency 0 or I programs leads to lytic reactivation.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0049] In further describing the subject invention, methods for expressing a product in EBV-infected B -cells are described. Next, methods for treating an EBV-associated autoimmune disorder are described. Furthermore, composition and kits for practicing the above methods are described.METHODS FOR SELECTIVELY EXPRESSING A PRODUCT IN AN EBV-INFECTED CELL
[0050] As summarized above, methods are provided for selectively expressing a product in an Epstein-Barr Virus (EBV)-infected cell. By "selectively expressing a product in an EBV-infected cell" it is meant that a desired product may be specifically expressed in an EBV-infected cell where the product would not be expressed in a cell that was not infected by EBV. The product may induce the death, killing of, marking of, or identification of an EBV-infected cell. Selective expression of the desired produced is achieved using a sensor RNA that specifically hybridizes to a target RNA and when hybridized to the target RNA, the sensor RNA is modified to lead to the expression of the desired product as will be described below.
[0051] In embodiments, the methods include contacting an EBV-infected cell with a sensor RNA, e.g., as described below. As summarized above, the sensor RNA employed in embodiments of the invention includes: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA present in the EBV-infected cell, wherein the sensor nucleotide sequence comprises one or more editable codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding the product. Each of these components is now reviewed in greater detail. The target RNA may be any RNA that is associated with EBV-infection. For example, the target RNA includes, without limitation, mRNA, long non-coding RNA, transfer RNA, ribosomal RNA, small RNAs such as microRNA, small interfering RNA, small nucleolar RNAs, etc. In some embodiments, the target RNA is a non-coding RNA associated with EBV. In some embodiments, the target RNA or non-coding RNA is associated with EBV latency 0, EBV latency I, EBV latency II, EBV latency III, or any combination thereof. In some embodiments, the non-coding RNA is associated with EBV latency 0. In some embodiments, the target RNA or noncoding RNA is associated with EBV latency I. In some embodiments, the target RNA or non-coding RNA is associated with EBV latency 0 and I. In some embodiment, the non-coding RNA is EBER1 or EBER2. In some embodiments, the target RNA is a miRNA. In some embodiments, the miRNA is a BART miRNA. In some embodiments, the BART miRNA selected from the group consisting of a BART 1, a BART 2, a BART 3, a BART 4, a BART 5, a BART 6, a BART 7, a BART 8, a BART 9, a BART 10, a BART 11, a BART 12, a BART 13. a BART 14. a BART 15, a BART 16. a BARTAttorney Docket No.: STAN-2220WOStanford No.: S24-31117, a BART 18, a BART 19, a BART 20, a BART 21, a and a BART 22 miRNA. In some embodiments, the miRNA is a BHRF miRNA. In some embodiments, the BHRF miRNA selected from the group consisting of a BHRF 1-1, a BHRF 1-2, and a BHRF 1-3 miRNA. EBV associated miRNAs are known the art and have been described by, for example, Pfeffer et al. (Science. 2004 Apr 30:304(5671):734-6)
[0052] Sequences of EBER1 and EBER2 are known in the art. For instance, EBER1 may have a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: AGGACCUACGCUGCCCUAGAGGUUUUGCUAGGGAGGAGACGUGUGUGGCUGUAGCC ACCCGUCCCGGGUACAAGUCCCGGGUGGUGAGGACGGUGUCUGUGGUUGUCUUCCC AGACUCUGCUUUCUGCCGUCUUCGGUCAAGUACCAGCUGGUGGUCCGCAUGUUUU (SEQ ID NO: 01). EBER2 may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: AGGACAGCCGUUGCCCUAGUGGUUUCGGACACACCGCCAACGCUCAGUGCGGUGCUA CCGACCCGAGGUCAAGUCCCGGGGGAGGAGAAGAGAGGCUUCCCGCCUAGAGCAUU UGCAAGUCAGGAUUCUCUAAUCCCUCUGGGAGAAGGGUAUUCGGCUUGUCCGCUGU UUUU (SEQ ID NO: 02).
[0053] Sequences of BART miRNA are known in the art. For instance, BART 1 may have a sequence that is at least 75%, at least 80%. at least 85%, at least 90%, at least 95%, at least 98%, at least 99%. or 100% identical to the sequence according to: GGGGGUCUUAGUGGAAGUGACGUGCUGUGAAUACAGGUCCAUAGCACCGCUAUCCA CUAUGUCUCGCCCG (SEQ ID NO: 03). BART 2 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:ACUAUUUUCUGCAUUCGCCCUUGCGUGUCCAUUGUUGCAAGGAGCGAUUUGGAGAA AAUAAA (SEQ ID NO: 04). BART 3 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:CCUUUGGUGGAACCUAGUGUUAGUGUUGUGCUGUAAAUAAGUGUCCAGCGCACCAC UAGUCACCAGGUGUCACCGGAGG (SEQ ID NO: 05). BART 4 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:Attorney Docket No.: STAN-2220WOStanford No.: S24-311UUUGGUGGGACCUGAUGCUGCUGGUGUGCUGUAAAUAAGUGCCUAGCACAUCACGU AGGCACCAGGUGUCACCAGG (SEQ ID NO: 06). BART 5 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:GCUCUGUGGCACCUCAAGGUGAAUAUAGCUGCCCAUCGACGUAUCGCUGGAAACCG GUGGGCCGCUGUUCACCUAAAGUGACGCAAGGU (SEQ ID NO: 07). BART 6 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UGACCUUGUUGGUACUUUAAGGUUGGUCCAAUCCAUAGGCUUUUUUUGUGAAAACC CGGGGAUCGGACUAGCCUUAGAGUAACUCAAGGCCA (SEQ ID NO: 08). BART 7 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UCCAGUGUCCUGAUCCUGGACCUUGACUAUGAAACAAUUCUAAAAAAAUGCAUCAU AGUCCAGUGUCCAGGGACAGUGCACUCGGA (SEQ ID NO: 09). BART 8 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UGGGUUCACUGAUUACGGUUUCCUAGAUUGUACAGAUGAACUAGAACUGUCACAAU CUAUGGGGUCGUAGACAGUGUGCUUA (SEQ ID NO: 10). BART 9 miRNA may have a sequences that is at least 75%, at least 80%. at least 85%, at least 90%. at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: CAGCUGUUGUUUGUACUGGACCCUGAAUUGGAAACAGUAACUUGGAUUCUGUAACA CUUCAUGGGUCCCGUAGUGACAACUAUGCUG (SEQ ID NO: 11). BART 10 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: CAGAGGAGUGUCCCGGGGCCACCUCUUUGGUUCUGUACAUAUUUUGUUAUUGUACA UAACCAUGGAGUUGGCUGUGGUGCACUCCAUCUG (SEQ ID NO: 12). BART 11 miRNA may have a sequences that is at least 75%, at least 80%. at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: GGCUUCUGUUGGGUCAGACAGUUUGGUGCGCUAGUUGUGUGCUUAGCAGCAACGCA CACCAGGCUGACUGCCUUAGCAGUGUGGCC (SEQ ID NO: 13). BART 12 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:Attorney Docket No.: STAN-2220WOStanford No.: S24-311CUGGUGACCUAACACCCGCCCAUCACCACCGGACAGAUUCUGAACUUGUCCUGUGGU GUUUGGUGUGGUUUUGGGGUACGCAG (SEQ ID NO: 14). BART 13 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UUGGGCACCUCGAUAACCGGCUCGUGGCUCGUACAGACGAUUGUUUGGCUCUGUAA CUUGCCAGGGACGGCUGACGAUGUGUUUAG (SEQ ID NO: 15). BART 14 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: CAGGGGUGGCCGGUACCCUACGCUGCCGAUUUACAUAAUAUAAAUUGUAAAUGCUG CAGUAGUAGGGAUCUGGACGCGCGACCUG (SEQ ID NO: 16). BART 15 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UGUGCCGCUUGGAGGGAAACAUGACCACCUGAAGUCUGUUAACCAGGUCAGUGGUU UUGUUUCCUUGAUAGAGACACA (SEQ ID NO: 17). BART 16 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: AGGCUUUCAGGUGUGGAAUUUAGAUAGAGUGGGUGUGUGCUCUUGUUUAAUUACAC CAAGAUCACCACCCUCUAUCCAUAUCCCACAAUUGAUAAACCU (SEQ ID NO: 18). BART 17 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: GUUGAACAGGAUGUGGCACCCUAAGAGGACGCAGGCAUACAAGGUUAUUACCCAGU CCUUGUAUGCCUGGUGUCCCCUUAGUGGGACGCAGGCCUAGGUAGC (SEQ ID NO: 19). BART 18 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UUGUUGCCGUUGAAAGACGGGUGUCCUGGCUCAAGUUCGCACUUCCUAUACAGUGU UAAAGCCUUGUAUCGGAAGUUUGGGCUUCGUCCCAGUGUACUCGAUAAUGUCGACU GCUGCGA (SEQ ID NO: 20). BART 19 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:GUAUCCGUGUCCUGACAACAUUCCCCGCAAACAUGACAUGGGUUAAUUUAAACAUG UUUUGUUUGCUUGGGAAUGCUCUUAGGGCCUGGAAGC (SEQ ID NO: 21). BART 20 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at leastAttorney Docket No.: STAN-2220WOStanford No.: S24-31195%, at least 98%, at least 99%, or 100% identical to the sequence according to: UACAGGCGUAGGGCCUAUUGUAGCAGGCAUGUCUUCAUUCCUGCGUACCGAAUGGC AUGAAGGCACAGCCUGUUACCAUUGGCACCUUUUUUCCAUGUA (SEQ ID NO: 22). BART 21 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: GGGCUGGGUAUUCACUAGUGAAGGCAACUAACACAGUUAGACGUGCUAGUUGUGCC CACUGGUGUUUAUCCGGUCC (SEQ ID NO: 23). BART 22 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%. at least 95%, at least 98%. at least 99%, or 100% identical to the sequence according to:GUCACAGGUGCUAGACCCUGGAGUUGAACCAGUACCACUCGGUUACAAAGUCAUGG UCUAGUAGUUGUGAC (SEQ ID NO: 24).
[0054] Sequences of BHRF miRNA are known in the art. For instance, BHRF 1-1 may have a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to: UAUUAACCUGAUCAGCCCCGGAGUUGCCUGUUUCAUCACUAACCCCGGGCCUGAAGA GGUUGACAA (SEQ ID NO: 25). BHRF 1-2 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:CUUUUAAAUUCUGUUGCAGCAGAUAGCUGAUACCCAAUGUUAUCUUUUGCGGCAGA AAUUGAAAG (SEQ ID NO: 26). BHRF 1-3 miRNA may have a sequences that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to the sequence according to:UCUAACGGGAAGUGUGUAAGCACACACGUAAUUUGCAAGCGGUGCUUCACGCUCUU CGUUAAAAU (SEQ ID NO: 27).
[0055] Cells suitable for use in a subject method include cells of a variety of subject hosts that are infected with EBV. Generally, such subject hosts are “mammals” or “mammalian”, where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs and rats), and primates (e.g., humans, chimpanzees and monkeys). In many aspects, the subject host will be a human. In some embodiments, the cells are in vitro. In some embodiments, the cells are in vivo. In some embodiments, the in vivo cells are in a mammal. In some embodiments, the mammal is a human. In some embodiments, the cells are human EBV-infected B-cells. In some embodiments, the cells are human EBV-infectedAttorney Docket No.: STAN-2220WOStanford No.: S24-311 epithelia cells. In some embodiments, the cells are human EBV-infected epithelia cells and human EBV-infected B-cells. In some embodiments, the EBV-infected cell contains the target RNA.
[0056] The products of the present disclosure may be any product that can be expressed in an EBV- infected cell. The products of the present disclosure induces the death, killing, marking, or identification of an EBV-infected cell. In some embodiments, the product is a detectable product. In some embodiments, the detectable product is a fluorescent or luminescent protein. Non-limiting examples of useful fluorescent proteins include but are not limited to GFP, EBFP, Azurite, Cerulean, mCFP, Turquoise, ECFP, mKeima-Red, TagCFP, AmCyan, mTFP, TurboGFP, TagGFP, EGFP, TagYFP, EYFP, Topaz, Venus, mCitrine, TurboYFP, mOrange, TurboRFP, tdTomato, TagRFP, dsRed2, mRFP, mCherry, mPlum mRaspberry, mScarlet, etc. Examples of luminescent proteins include without limitation, Cypridinia luciferase, Gaussia luciferase, Renilla luciferase, Phontinus luciferase, Luciola luciferase, Pyrophorus luciferase, Phrixothrix luciferase, etc.
[0057] In some embodiments, the product is a toxic product, e.g., a toxic protein or portion thereof. The toxic protein of the present disclosure may be any toxin protein that induces the death, killing, or apoptosis of the EBV-infected B-cell. Examples of the toxic proteins of the present disclosure include, without limitation, caspases, AB toxins, human defensins, granzymes, peptide toxins, enzymatically active toxins, etc. The toxic proteins may be intracellular, secreted, transmembrane or membrane- tethered. When toxic proteins are to be trafficked to specific locations within the biological sample then the coding sequence of the product is preceded by a nucleotide sequence encoding the appropriate signal peptide such as those described in Owji et al. (Eur J Cell Biol. 2018 Aug;97(6):422- 441).
[0058] The toxic protein may include, without limitation, tumor necrosis factor alpha (TNFa), Fas ligand (FasL), a caspase such as caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13 or a variant thereof; AB toxins such as anthrax toxin subunit A and B, botulinum toxin subunit A and B, cholera toxin subunit A and B, diphtheria toxin subunit A and B, pertussis toxin subunit A and B, Shiga toxin subunit A and B, tetanus toxin subunit A and B; human a -defensins such as human neutrophil peptides (HNP) HNP1-4, human enteric defensins (HD) HD5,6; human P-defensins (HBD) HBD1- 3; Granzymes such as granzyme A, granzyme B, granzyme H, granzyme K, and granzyme M, peptide toxins such as hemiasterlin and hemiasterlin analogs such as hemiasterlin and hemiasterlin analogs such as HTI-286 (e.g., see USPN 7,579,323; WO 2004 / 026293; and USPN 8,129,407, the full disclosures of which are incorporated herein by reference), abrin, brucine, cicutoxin, batrachotoxin,Attorney Docket No.: STAN-2220WOStanford No.: S24-311 endotoxin, Pseudomonas exotoxin, Pseudomonas endotoxin, falcarinol, fumonisin Bl, fumonisin B2, afla toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, hefutoxin, calciseptine, taicatoxin, calcicludine, geldanamycin, gelonin, lotaustralin, ocratoxin A, patulin, ricin, strychnine, trichothecene, zearlenone, tetradotoxin, Melittin, Captopril, Chlorotoxin, Conotoxin MI, Exenatide, Bivalirudin, Tirofiban, Apitoxin, Cobrotoxin, Desirudin, Enalapril, Eptifibatide, Lixisenatide, Ziconotide, Vespid chemotactic peptide T, Mastoparan, Protonectin, Hainantoxin, Batroxobin, Apamin, Arenicin-1, Aurelin, Hepcidin, Scygonadin, Hyastatin, Tauramamide, Centrocin lb, Calciseptine, p-EPTX-Nal a. crotamine, and amanitin. Enzymatically active toxins and fragments thereof which may be employed include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor, curcin, crotin, Sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and the tricothecenes, etc.
[0059] When the sensor RNA contains a nucleotide sequence that comprises a toxic product, the sensor RNA may comprise a first portion and a second portion of the toxic product, where the first portion and the second portion of the toxic protein form a functional toxic protein in the presence of the target RNA. In some embodiments, the first portion of the toxic protein and the second portion of the toxic protein are AB toxins. AB toxins are a class of toxins that contain two distinct components: the active catalytic domain (A) and the receptor binding domain (B). In some embodiments, the first portion and the second portion of the toxic protein is the A subunit and the B subunit of an AB toxin.
[0060] In some embodiments, the AB toxin is selected from the group consisting of: anthrax toxin, botulinum toxin, cholera toxin, diphtheria toxin, pseudomonas endotoxin, pseudomonas exotoxin, pertussis toxin, shiga toxin, and tetanus toxin. In some embodiments, the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, and tetanus toxin subunit A. In some embodiments, the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, and tetanus toxin subunit B. In some embodiments, wherein the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, and tetanus toxin subunitAttorney Docket No.: STAN-2220WOStanford No.: S24-311B. In some embodiments, the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, and tetanus toxin subunit A. AB toxins and their structures are known in the art and have been described by, for example, Marquez-Lopez et al. (Int J Mol Sci. 2023 Jul 7:24(13): 11227), Odumosui et al. (Toxins (Basel). 2010 Jul; 2(7): 1612- 1645), Michalska et al. (Front Microbiol. 2015 Sep 15:6:963), and Pembroke (Preprints 2023, 2023020416.) each of which are specifically incorporated by reference herein.
[0061] In some embodiments, the first portion and the second portion of the toxic protein is the A subunit of an AB toxin. When the first portion and the second portion of the toxic protein is the A subunit of the AB toxin, the A subunit is split into the first portion and the second portion of toxic protein such that when the first portion and second portion of the toxic protein is expressed the A subunit assembles from the first portion and the second portion of the A subunit into a functional A subunit. In some embodiments, the first portion of the toxic protein is selected from the group consisting of: a first portion of the anthrax toxin subunit A, a first portion of the botulinum toxin subunit A, a first portion of the cholera toxin subunit A, a first portion of the diphtheria toxin subunit A, a first portion of the pseudomonas endotoxin, a first portion of the pseudomonas exotoxin, a first portion of the pertussis toxin subunit A, a first portion of the shiga toxin subunit A, and a first portion of the tetanus toxin subunit A. In some embodiments, the second portion of the toxic protein is selected from the group consisting of: a second portion of the anthrax toxin subunit A, a second portion of the botulinum toxin subunit A, a second portion of the cholera toxin subunit A, a second portion of the diphtheria toxin subunit A, a second portion of the pseudomonas endotoxin, a second portion of the pseudomonas exotoxin, a second portion of the pertussis toxin subunit A, a second portion of the shiga toxin subunit A, and a second portion of the tetanus toxin subunit A.
[0062] In some embodiments, the sensor RNA includes the following: (i) a first nucleotide sequence encoding a first portion of a toxic protein, (ii) a second nucleotide sequence encoding a first cleavage domain, (iii) a third nucleotide sequence including a sensor nucleotide sequence that hybridizes to the target RNA, wherein the sensor nucleotide sequence includes one or more editable codons, (iv) a fourth nucleotide sequence encoding a second cleavage domain, and (v) a fifth nucleotide sequence encoding a second portion of a toxic protein.
[0063] In some embodiments, the sensor RNA includes the following: (i) a first nucleotide sequence containing a stem-loop sequence containing one or more editable codons (ii) a second nucleotide sequence containing a sensor nucleotide sequence that hybridizes to the target RNA, (iii) a thirdAttorney Docket No.: STAN-2220WOStanford No.: S24-311 nucleotide sequence encoding a cleavage domain, and (iv) a fourth nucleotide sequence encoding a product.
[0064] In some embodiments, the sensor RNA includes the following: (i) a first nucleotide sequence containing a sensor nucleotide sequence that hybridizes to the target RNA wherein the sensor nucleotide sequence contains a stem-loop sequence containing one or more editable codons wherein the stem-loop sequence does not hybridize to the target RNA, (ii) a second nucleotide sequence encoding a cleavage domain, and (iii) a third nucleotide sequence encoding a product.
[0065] In some embodiments, the sensor RNA includes the following: (i) a first nucleotide sequence containing a sensor nucleotide sequence that hybridizes to the target RNA, (ii) a second nucleotide sequence containing a stem-loop sequence containing one or more editable codons (iii) a third nucleotide sequence encoding a cleavage domain, and (iv) a fourth nucleotide sequence encoding a product.
[0066] In some embodiments, the sensor RNAs contain a 5’ RNA cap that is 5’ to the first nucleotide sequence. In some embodiments, the sensor RNA contains a sequence encoding a 5’ UTR that is 5’ to the first nucleotide sequence. In some embodiments, the sensor RNA contains a sequence encoding a 5’ UTR that is 5’ to the first nucleotide sequence and a 5’ RNA cap that is 5’ of the sequence encoding the 5’ UTR. In some embodiments, the sensor RNA contains a sequence encoding a 3’ UTR that is 3’ of the sequence encoding the product. In some embodiments, the sensor RNA contains a sequence encoding a polyA tail that is 3’ of the sequence encoding the product. In some embodiments, the sensor RNA contains a sequencing encoding a 3’ UTR that is 3’ of the sequence encoding the product and a sequence encoding a polyA tail that is 3’ of the sequence encoding the polyA tail. In some embodiments, the sensor RNA contains a sequence encoding a 5’ UTR that is 5’ to the first nucleotide sequence and a 5’ RNA cap that is 5’ of the sequence encoding the 5’ UTR, a sequencing encoding a 3’ UTR that is 3’ of the sequence encoding the product and a sequence encoding a polyA tail that is 3’ of the sequence encoding the product.
[0067] A 5’ cap can be a native 7 -methylguanylate cap, or a cap analog, for example anti-reverse cap analog (ARCA), 3 '-O-Me-m7G(5')ppp(5')G- (m7G(5 )ppp(5')G), CapO, Capl, inosine, Nl-methyl- guanosine, 2' fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA- guanosine, 2-azido-guanosine, etc.
[0068] In some embodiments, the sensor RNA has one or more editable codons containing one or more bases that are mismatched with 1) a sequence within the stem-loop opposite the editable codon or 2) a sequence in the target RNA opposite the editable codon. The one or more bases that areAttorney Docket No.: STAN-2220WOStanford No.: S24-311 mismatched are generally not more than 2 bases that are mismatched. In an embodiment, the sensor RNA has one or more editable codons containing only 1 base that is mismatched with 1) a sequence within the stem loop opposite the editable codon or 2) a sequence in the target RNA. In some embodiments, the sensor RNA does not have any mismatched bases.
[0069] In some instances, the target RNA has one or more base mismatches opposite the stem-loop sequence. There may be a range in the number of bases mismatched opposite the stem-loop sequence including, without limitation, one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more than ten. In some embodiments, the target RNA has five or more base mismatches opposite the stem-loop sequence, such as ten or more base mismatches opposite the stem-loop sequence. Sensors that basepair in a way that results in the target RNA having mismatches (bulges or loops) opposite the stem-loop sequence of the sensor RNA have advantages over those that do not. The sensor and trigger form a three-way junction, and the presence of an extra bulge or loop at this junction can aid in increased ADAR binding or editing efficiency by providing greater flexibility or optimal positioning.
[0070] In some instances, the sensor nucleotide sequence contains a stem-loop sequence and the target RNA has one or more base mismatches opposite the stem-loop sequence. The one or more base mismatches may be the result of a sensor nucleotide that hybridizes to two discontinuous sequences. For instance, the sensor nucleotide sequence 3’ of the stem-loop sequence hybridizes to a 5’ sequence of the target RNA and the sensor nucleotide sequence 5’ of the stem-loop sequence hybridizes to a 3’ sequence of the target RNA. The 5’ sequence of the target RNA and the 3’ sequence of the target RNA may be separated by a varying number of nucleotides. For instance, the 5’ sequence of the target RNA and the 3’ sequence of the target RNA may be separated by 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or more than 110 nucleotides.
[0071] In some instances, the sensor nucleotide sequence has one or more bases mismatched 25 or more base pairs upstream or downstream of the editable codon. There may be a range in the number of bases mismatched 25 or more base pairs upstream or downstream of the editable codon including, without limitation, one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, or more than ten. In some embodiments, the mismatched bases of the sensor nucleotide sequence are 35 or more base pairs upstream or downstream of the editable codon. Sensor sequences that basepair with a target RNA in a way that results in a mismatch 25 or more base pairs upstream or downstream of the editable codon haveAttorney Docket No.: STAN-2220WOStanford No.: S24-311 advantages over those that do not. Such distant mismatches have shown to increase ADAR editing efficiency (Uzonyi et al., Molecular Cell 2021; Zambrano-Mila 2023).
[0072] In certain embodiments, the sensor RNA contains the first nucleotide sequence to the third, fourth or fifth nucleotide sequences in order (i.e., the fifth nucleotide sequence follows the fourth nucleotide sequence which follows the third nucleotide sequence which follows the second nucleotide sequence which follows the first nucleotide sequence). In some embodiments, the sensor RNA contains the first nucleotide sequence to the third, fourth or fifth nucleotide sequence that are not in order described above.
[0073] The sensor RNA of the present disclosure contains a sensor nucleotide sequence or a stemloop sequence containing one or more editable codons which is followed by a nucleotide sequence encoding a product. In some embodiments, the sensor RNA contains one or more editable codons that contain at least 1 base that is mismatched with the target RNA or the sequence within the stem-loop. In some embodiments, the sensor RNA does not contain any mismatches with the target RNA. In the presence of the target RNA, the sensor nucleotide sequence of the sensor RNA hybridizes to the target RNA thereby forming a double- stranded RNA molecule that can recruit an ADAR protein. The double-stranded RNA can contain an editable codon with or without mismatches, or an editable codon could be within the stem-loop of the sensor RNA. An ADAR protein then edits the adenosine base within the editable codon(s), e.g., a stop codon, of the sensor RNA to an inosine base. This editing removes the stop codon(s) which then allows the output protein to be produced from the sensor RNA within the biological sample.
[0074] When the sensor RNA contains a nucleotide sequence containing a stem-loop sequence comprising a stop codon, any stem-loop sequence may be used. In some embodiments, the stem loop contains natural editing sites. Natural editing sites are sites within nucleotide sequences which are edited in nature. Natural editing sites are known in the art and have been described in, for example. Gabay et al. (Nat Commun. 2022 Mar 4; 13(1 ): 1184) which is specifically incorporated by reference herein. Examples of natural editing sites include, without limitation, editing sites found in GRIA2, GRIA3, IGFBP7. NEIL1, FLNA, GRIK2, CDK13, GABRA3, GLI1, SPEG, HTR2C. GRIA4, CYFIP2, CADPS, CADPS, RICTOR, COG3, GRIK1, COPA, HBE1, SON, FLNB, MAGEL2, NOVAI, PNMT, WASH1, LAT, DACT3, FXYD5, ZNF717, ZNF551 CAPS1, etc. In some embodiments, the stem-loop sequence is a GluR-B stem-loop or a modified variant thereof. In some embodiments, the stem contains a natural editing site while the loop is a synthetic sequence. In some embodiments, the sequence of the stem is altered compared to the natural editing site by the additionAttorney Docket No.: STAN-2220WOStanford No.: S24-311 or removal of nucleotides in order to add or remove mismatches. In some embodiments, the sequence alteration adds or removes additional stop codons. Stem-loop sequences that useful in the sensor RNAs are known in the art and have been described in, for example, in International Patent Application NO. US2024 / 031501 which is specifically incorporated by reference in its entirety.
[0075] In some embodiments, the sensor nucleotide sequence contains a first region that hybridizes to the target RNA, a second region containing a stem-loop sequence containing one or more editable codons that does not hybridize to the target RNA, and a third region that hybridizes to the target RNA. By “first region”, “second region”, and “third region” it is meant a specific sequence of nucleotides in the sensor nucleotide sequence. In some embodiments, the first region is 5’ of the second region and the second region is 5’ of the third region. In some embodiments, the sensor nucleotide sequence contains a fourth region that hybridizes to the target RNA. In some embodiments, the sensor nucleotide region contains a sixth region that hybridizes to the target RNA. In some embodiments, the sensor nucleotide region contains a seventh region that hybridizes to the target RNA. In some embodiments, the sensor nucleotide region contains an eighth region that hybridizes to the target RNA. In some embodiments, the sensor nucleotide region contains a ninth region that hybridizes to the target RNA. In some embodiments, the sensor nucleotide region contains a tenth region that hybridizes to the target RNA. When the sensor nucleotide sequence has three or more regions that hybridize to the target RNA, i.e., the first region, the third region, and the fourth region, the regions may hybridize to discontinuous regions of the target RNA. Discontinuous regions of the target RNA may be regions of the target RNA that are separated by 10 or more nucleotides such that the discontinuous regions of the target RNA are not directly adjacent.
[0076] In the above embodiment, the stem-loop sequence has a first portion that hybridizes to either the first region or the third region in the absence of the target RNA. In this embodiment, the first portion of the stem-loop hybridizes to the first or the third region and decreases the likelihood of non- specifically producing the product in the absence of the target RNA. The stem-loop sequence has a stem sequence and a loop sequence. In some embodiments, the first portion of the stem-loop sequence is contained within the loop sequence of the stem-loop sequence. When a sensor RNA contains a stem-loop containing a first portion that hybridizes to the first region or the third region it may be referred to as a low background sensor RNA. The first portion of the stem-loop sequence may be any portion of the stem-loop sequence. For instance, the first portion may be 1 / 10. 2 / 10. 3 / 10, 4 / 10, 5 / 10 or 1 / 2, 6 / 10, 7 / 10, 8 / 10, 9 / 10, 10 / 10, 1 / 4, or % of the stem-loop sequence of the loop of the stem-loop sequence. The first portion may be 3 nucleotides, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19,Attorney Docket No.: STAN-2220WOStanford No.: S24-31120, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55. 56. 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72. 73. 74, 75, 76, 77, 78, 79, 80 nucleotides, or more than 80 nucleotides. The first portion may be a range of nucleotides including, without limitation, 3-5 nucleotides, 5-10, 10-15, 15-20, 20-25, 25-30, 30- 35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80. 80-85. 10-20. 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, etc.
[0077] In some embodiments, the stem-loop sequence has a second portion that hybridizes to the first region or third region. When the first portion of the stem-loop sequence hybridizes to the first region, the second portion hybridizes to the third region. When the first portion of the stem-loop sequence hybridizes to the third region, the second portion of the stem-loop sequence hybridizes to the first region. In some embodiments, the second portion of the stem-loop is contained in the loop sequence of the stem-loop sequence. When the stem-loop sequence has the first portion and the second portion, the length of the first portion combined with the length of the second portion amount to at most the full length or 100% of the stem-loop sequence. The second portion of the stem-loop sequence may be any portion of the stem-loop sequence. For instance, the second portion may be 1 / 10, 2 / 10, 3 / 10, 4 / 10, 5 / 10 or 1 / 2, 6 / 10, 7 / 10, 8 / 10, 9 / 10, 10 / 10, 1 / 4, or % of the stem-loop sequence or the loop of the stem-loop sequence. The second portion may be 3 nucleotides, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46. 47. 48. 49. 50. 51. 52. 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64. 65. 66. 67. 68. 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 nucleotides, or more than 80 nucleotides. The second portion may be a range of nucleotides including, without limitation, 3-5 nucleotides, 5-10, 10-15, 15-20, 20- 25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 10-20, 20- 30, 30-40, 40-50, 50-60, 60-70, 70-80, etc.
[0078] When the sensor RNA contains a nucleotide sequence containing a stem-loop sequence containing an editable codon, the length of the stem-loop may have a specific length. For example, the stem-loop may be 4 nucleotides, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29. 30. 31. 32. 33. 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46. 47. 48. 49. 50.51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 nucleotides, or more than 90 nucleotides. The stemloop sequence may be a range of nucleotides including, without limitation, 3-5 nucleotides. 5-10. 10- 15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, SO- 85, 10-20, 20-30, 30-40, 40-50, 50-60. 60-70, 70-80, etc.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0079] When the sensor RNA contains a nucleotide sequence containing a stem-loop sequence containing an editable codon, the length of the stem-loop may have a limit. For example, the stemloop may be 50 bp or less, 45 bp or less, 40 bp or less, 35 bp or less, 30 bp or less, 25 bp or less, or 20 bp or less. In an embodiment, the length of the stem-loop is 18-50 bps.
[0080] In some embodiments, the stem-loop sequence comprises one or more stop codons that are out of frame of the editable codon. In some embodiments, the stem-loop sequence comprises two or more stop codons that are out of frame of the editable codon. In some embodiments, the two or more stop codons that are out of frame are defined by CUAAAUAAA. Other sequences may be employed for the two or more stop codons out of frame with the editable codon. The other sequences abide by the following: 1) any base, 2) a stop codon (UAG, UGA, UAA), 3) any base, 4) a stop codon (UAG, UGA, UAA), and 5) any base. For instance, the sequence may be NUAGNUAG, NUAGNUGA, NUAGNUAA, NUGANUAG, NUGANUGA, NUGANUAA, NUAANUAG, NUAANUGA, or NUAANUAA where N is equivalent to any base. Another sequence may be chosen if the three amino acid peptide encoded by the sequence is better suitable for expression in the reading frame of the editable codon. Sensors containing out of frame stop codons have certain advantages relative to sensor RNAs that do not contain such codons, as these stop codons can halt translation when the ribosome has shifted frames which can lead to skipping of the editable codon in its correct frame and thus loss of translational control. Continuing translation in the wrong frame can also cause unwanted protein products that can have detrimental effects. Sensors containing out of frame stop codons within the stem-loop, particularly in the loop portion, have advantages relative to sensor RNAs containing out of frame stop codons elsewhere. RNA structures interact with ribosomes, and having a strong secondary structure in the form of a stem-loop can make the RNA structures more predictable. Placing the stop codons in the loop may result in more efficient reading of those stops, rather than readthrough.
[0081] In some embodiments, the first cleavage domain contains out-of-frame stop codons. In some embodiments, the second cleavage domain contains out-of-frame stop codons. In some embodiments, the out-of-frame stop codons are in the +1 or +2 frame. In some embodiments, the out-of-frame stop codons are in the +1 frame. In some embodiments, the out-of-frame stop codons are in the +2 frame. In some embodiments, the first cleavage domain is a 2A cleavage sequence that is re-coded to contain one or more out-of-frame stop codons. By “re-coded” it is meant that the sequence encoding the 2A cleavage site is altered such that it contains an out-of-frame stop codon but still encodes a functional 2 cleavage sequence. In some embodiments, the second cleavage domain is a 2A cleavage sequence that is re-coded to contain one or more out-of-frame stop codons. In some embodiments, the 2AAttorney Docket No.: STAN-2220WOStanford No.: S24-311 cleavage sequence is a T2A cleavage sequence. In some embodiments, the 2A cleavage sequence is a P2A cleavage sequence. In some embodiments, the 2A cleavage sequence is an E2A cleavage sequence. In some embodiments, the 2A cleavage sequence is a F2A cleavage sequence.
[0082] Sensor RNAs containing a nucleotide sequence containing a stem-loop sequence containing an editable codon have certain advantages relative to sensor RNAs that do not contain such a stemloop sequence, such as those disclosed in International Application PCT / US2022 / 033459. This is due to ADAR having separate domains for RNA editing (catalytic domain) and dsRNA binding. First, sensor RNAs containing a nucleotide sequence containing a stem-loop sequence containing an editable codon decouples the sequence that is being edited (e.g., a stop codon) from the sequence that recruits the ADAR protein (i.e., the dsRNA segment that is formed when the sensor nucleotide sequence hybridizes to the target RNA). Generally, if the editable codon in the sensor RNA is a UAG (stop codon) and there is only one mismatch in the stop codon relative to the target RNA then the target RNA should have a CCA sequence (or a sequence that hybridizes to a different stop codon having one mismatch with the stop codon). The presence of the CCA sequence (or an equivalent sequence for a different editable codon) potentially limits the number of possible target RNAs. Requiring a specific sequence (such as CCA or an equivalent sequence) to be present in the target RNA can be limiting because it restricts which subsequence a sensor could be created against; for example, a CCA or equivalent sequence may only present in highly structured parts of the target RNA, may only be present in the coding sequence, or may be present in protein-bound sections of a target RNA, all of which may contribute to lower availability for sensor-target hybridization, reducing efficiency. With a sensor containing a stem-loop, the range of suitable subsequences is greatly increased, so problematic target RNA subsequences can be avoided and efficient ones utilized instead. In some embodiments where gene fusions or splice variants are to be distinguished, flexibility in target RNA subsequence choice is needed, and is provided by the stem-loop design. Second, while ADAR editing is largely sequence-agnostic, there are some minor biases primarily driven by the catalytic domain which extend beyond the editable codon. Biases driven by the catalytic domain are known in the art and have been described by. for example, Kuttan et al. (Proc Natl Acad Sci U S A. 2012 Nov 27; 109(48) :E3295-304) which is specifically incorporated by reference herein. Editing sites in the sensor RNA may be dictated by the target RNA which precludes optimization of the editing site (i.e.. the stop or non-stop codons of the present disclosure). By separating out the editing site from the sensor nucleotide sequence that hybridizes to the target RNA, to the editing site and the sensor nucleotide sequence can be optimized separately.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0083] In some embodiments, the sensor RNA contains a non-start codon in place of a stop codon. In these embodiments, the sensor RNA contains the following: (i) a first nucleotide sequence containing a sensor nucleotide sequence that hybridizes to the target RNA, wherein the sensor nucleotide sequence contains a non-start codon (e.g. AUA) that contains at least 1 base that is mismatched with the target RNA sequence, (ii) a second nucleotide sequence encoding a second cleavage domain, and (iii) a third nucleotide sequence encoding an output protein. In the presence of the target RNA, the sensor RNA hybridizes to the target RNA thereby forming a double stranded RNA molecule containing one or more base mismatches within the non-start codon or elsewhere. An ADAR protein then edits the adenosine base within the non-start codon (e.g., AUA to AUI) of the sensor RNA to an inosine base. This editing converts the non-start codon to a start codon which then allows the toxic protein to be produced from the sensor RNA within the EBV-infected B-cell.
[0084] In some cases, it is desired to reduce the immunogenicity of the sensor RNA. Methods of reducing the immunogenicity of RNAs are known in the art such and have been described by. for example, Starostina et al. (Vaccines (Basel). 2021 May 3;9(5):452) which is specifically incorporated by reference herein. In general, methods of reducing the immunogenicity of a sensor RNA involve the incorporation of modified ribonucleic acids into the sensor RNA. Modified ribonucleic acids that find use in the present disclosure includes, without limitation, pyridin-4-one ribonucleoside, 5-aza- uridine. 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hy- droxyuridine, 3-methyluridine, 5 -carboxymethyluridine, 1 -carboxymethyl-pseudouridine, 5- propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl- pseudouridine, 5-taurinomethyl -2-thiouridine, l-tau-rinomethyl-4-thio-uridine, 5-methyl-uridine, 1- methyl-pseudouridine, 4-thio-l-methyl-pseudouridine, 2 -thio-l-methyl-pseudouridine, 1 -methyl- 1- deaza-pseudouridine, 2-thio-l -methyl- 1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine. 2-thio-dihydrouridine, 2-thiodihydropseudouridine, 2-methoxyuridine. 2- methoxy-4-thiouridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-azacytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5- hydroxymethylcytidine. 1-methyl-pseudoisocytidine. pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2- thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio- 1-methyl- pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1-deaza- pseudoisocytidine, zebularine. 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2- thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy- 1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-Attorney Docket No.: STAN-2220WOStanford No.: S24-311 deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyadenosine, 2-methylthio-N-6-(cis- hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6-threonyl-carbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6.N6-dimethyladenosine, 7-methyladenine. 2- methylthio-adenine, 2-methoxy-adenine, inosine, 1-me-thyl-inosine, wyosine, wybutosine, 7-deaza- guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine. 7-methylinosine, 6-methoxy- guanosine, 1 -methylguanosine, N2-methylgua-nosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-me-thyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio -guano sine, N2,N2- dimethyl -6-thio-guanosine, methylcytosine, pseudouridine, methyladenosine, etc. In some embodiments, the methylcytosine is 5- methylcytosine. In some embodiments, the pseudouridine is Nl-methyl-pseudouridine. In some embodiments, the methyladenosine is a N6-methyladenosine. In some embodiments, the methyladenosine is a N1 -methyladenosine. In some embodiments, a portion of the nucleotides present in the sensor RNA are composed of modified ribonucleic acids. For instance, a portion of the uridines in the sensor RNA are replaced with pseudouridines. When the uridines of the sensor RNA are replaced with pseudouridines, a certain percentage of the uridines are replaced with pseudouridines. For instance, about 1-10%, about 10-20%, about 20-30%, about 30- 40%, about 40-50%, about 50-60%. about 60-70%, about 70-80%, 80-90% or greater than 90% of the uridines are replaced with pseudouridines. In an embodiment, 75% or less of the uridines in the sensor RNAs are replaced with pseudouridines. In an embodiment, the sensor sequence or parts of it do not have pseudouridines.
[0085] When a sensor RNA contains pseudouridines, the pseudouridine(s) may be in specific locations. In some embodiments, the pseudouridine(s) are not adjacent to adenosines that are the targets of ADAR editing. In some embodiments, the pseudouridine(s) are not contained in the sensor sequence that hybridizes with a target RNA. When a sensor RNA contains pseudouridines, the sensor may contain a particular stop codon. In some embodiments, the stop codon used is UGA. When the UGA stop codon is used, the adenosine in the UGA may be followed by a specific nucleotide. In some embodiments, the adenosine in the UGA is followed by guanosine such the nucleotide sequence is UGAG.
[0086] In some embodiments, the sensor nucleotide sequence includes bases that are mismatched with adenosine bases within the target RNA that are not within a start or stop codon. In someAttorney Docket No.: STAN-2220WOStanford No.: S24-311 embodiments, the mismatched bases prevent the editing of adenosines that are not within the stop or start codons.
[0087] In some embodiments, the sensor nucleotide sequence includes one or more editing inducing elements (EIEs). Suitable EIEs that find use in the present disclosure are disclosed within Uzonyi et al. (Mol Cell. 2021 Jun 3;81(11):2374-2387) and Danan-Gotthold et al. (Genome Biol. 2017 Oct 23; 18(1): 196).
[0088] In certain embodiments, the sensor RNA includes a nucleotide sequence that encodes a cleavage domain. Cleavage domains that find use in the present disclosure include without limitation, HIV-1 protease cleavage domain, TEV cleavage domain, preScission protease cleavage domain, HCV protease cleavage domain, RecA cleavage domain, self-cleaving domain, etc. When a selfcleaving domain is used then the self-cleaving domain may be a 2A self-cleaving domain. 2A selfcleaving domains that find use in the present disclosure include T2A, P2A, E2A and F2A which are described in Szymczak-Workman et al. (Cold Spring Harb Protoc. 2012 Feb l;2012(2): 199-204). In some embodiments, the sensor RNA includes a first and a second cleavage domain. When the sensor RNA includes a first and a second cleavage domain, the cleavage domains may be of the same type or they may be of a different type. For instance, the first cleavage domain may be a P2A self-cleaving domain and the second cleavage domain may also be a P2A self-cleaving domain or the first cleavage domain may be a P2A self-cleaving domain and the second cleavage domain may be a T2A selfcleaving domain or any combination thereof.
[0089] The sensor nucleotide sequence of the present disclosure may be any length determined necessary for sufficient specificity to the target RNA. For instance, the sensor nucleotide sequence could be less than about 50 nucleotides, from about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 110, about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150. about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200. about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, about 240 to 250, about 250 to 260, about 260 to 270, about 270 to 280, about 280 to 290, about 290 to 300, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400, about 400 to 410, about 410 to 420, about 420 to 430, about 430 to 440, about 440 to 450, about 450 to 460, about 460 to 470, about 470 to 480, about 480 to 490, about 490 to 500 or greater than 500 nucleotides in length.
[0090] When the sensor nucleotide sequence hybridizes to two non-contiguous regions within a target RNA, the distance between the two non-contiguous regions of the target may be any length. ForAttorney Docket No.: STAN-2220WOStanford No.: S24-311 instance, the distance between the two non-contiguous regions of the target may be less than about 50 nucleotides, from about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100. about 100 to 150, about 150 to 200, about 200 to 250, about 250 to 300, about 300 to 350, about 350 to 400, about 400 to 450, about 450 to 500 or greater than 500 nucleotides.
[0091] When the sensor nucleotide sequence hybridizes to two non-contiguous regions within the target RNA, the nucleotide sequence of the sensor nucleotide that hybridizes to the first region of the two non-contiguous regions with the target RNA may be any length. For instance, the nucleotide sequence of the sensor nucleotide that hybridize to the first region of the two non-contiguous regions may be less than about 20 nucleotides, from about 20 to 30, about 30 to 40, about 40 to 50, about 50 to 60, about 60 to 70, about 70 to 80. about 80 to 90, about 90 to 100, about 100 to 110, about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150, about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200, about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, about 240 to 250, about 250 to 260, about 260 to 270, about 270 to 280, about 280 to 290, about 290 to 300, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400, about 400 to 410. about 410 to 420, about 420 to 430, about 430 to 440, about 440 to 450, about 450 to 460, about 460 to 470, about 470 to 480, about 480 to 490, about 490 to 500 or greater than 500 nucleotides in length.
[0092] When the sensor nucleotide sequence hybridizes to two non-contiguous regions with the target RNA, the nucleotide sequence of the sensor nucleotide that hybridizes to the second region of the two non-contiguous regions with the target RNA may be any length. For instance, the nucleotide sequence of the sensor nucleotide that hybridizes to the second region of the two non-contiguous regions may be less than about 20 nucleotides, from about 20 to 30, about 30 to 40, about 40 to 50, about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 110. about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150, about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200, about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, about 240 to 250, about 250 to 260, about 260 to 270, about 270 to 280, about 280 to 290, about 290 to 300, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400. about 400 to 410. about 410 to 420, about 420 to 430, about 430 to 440. about 440 to 450, about 450 to 460, about 460 to 470, about 470 to 480, about 480 to 490, about 490 to 500 or greater than 500 nucleotides in length.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0093] The sensor nucleotide sequence or the stem-loops of the present disclosure may include any stop or start codon including an adenosine residue. For example, the stop codon of the sensor nucleotide sequence may be UAG, UAA, or UGA. In general, the stop codons of the present disclosure are in-frame with the coding sequence of the output protein such that the output protein is produced when the stop codon is edited.
[0094] The methods of the present disclosure also include contacting the EB V-infected B-cell sample with the sensor RNA. The contacting can be done using any convenient method, e.g., including those methods known in the art. In some embodiments, the contacting includes transfecting the EBV- infected B-cell with a recombinant vector containing the sensor RNA. When the EBV-infected B-cell is transfected with the recombinant vector, the recombinant vector may vary, and in some instances includes, without limitation, a plasmid, a viral vector, a cosmid, an artificial chromosome, etc. In some embodiments, the combining contains contacting the biological sample with a lipid nanoparticle containing the sensor RNA. Lipid nanoparticles have been described in the art such as Hou et al. (Nat Rev Mater. 2021 ;6(12): 1078- 1094).
[0095] When transfection of an EBV-infected B-cell is desired, vectors, such as plasmids viral vectors, cosmids, or artificial chromosomes, may be employed to engineer the cell to express the sensor RNA, as desired. Protocols of interest include those described in published PCT application W01999 / 041258, the disclosure of which protocols are herein incorporated by reference.
[0096] Depending on the nature of the cell and / or expression construct, protocols of interest may include electroporation, particle gun technology, calcium phosphate precipitation, direct microinjection, viral infection and the like. The choice of method is generally dependent on the type of cell being transformed and the circumstances under which the transformation is taking place (i.e., in vitro, ex vivo, or in vivo). A general discussion of these methods can be found in Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995. In some embodiments, lipofectamine and calcium mediated gene transfer technologies are used. After the subject nucleic acids have been introduced into a cell, the cell may be incubated, normally at 37°C, sometimes under selection, for a period of about 1-24 hours in order to allow for the expression of the sensor RNA. In mammalian target cells, a number of viral-based expression systems may be utilized to express the sensor RNA(s). In cases where an adenovirus is used as an expression vector, the sensor RNA sequence of interest may be ligated to an adenovirus transcription / translation control complex, e.g.. the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of theAttorney Docket No.: STAN-2220WOStanford No.: S24-311 viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the chimeric protein in infected hosts, (e.g., see Logan & Shenk, Proc. Natl. Acad. Sci. USA 81 :355-359 (1984)). The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
[0097] In some embodiments, the viral vector is a recombinant adeno-associated virus (AAV) vector. AAV vectors are DNA viruses of relatively small size that can integrate, in a stable and site-specific manner, into the genome of the cells that they infect. Such vectors are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies. The AAV genome has been cloned, sequenced and characterized. It encompasses approximately 4700 bases and contains an inverted terminal repeat (ITR) region of approximately 145 bases at each end, which serves as an origin of replication for the virus. The remainder of the genome is divided into two essential regions that carry the encapsidation functions: the left-hand part of the genome, that contains the rep gene involved in viral replication and expression of the viral genes; and the right-hand part of the genome, that contains the cap gene encoding the capsid proteins of the virus.
[0098] The application of AAV as a vector for gene therapy has been rapidly developed in recent years. Wild-type AAV can infect, with a comparatively high titer, dividing or non-dividing cells, or tissues of mammal, including human, and also can integrate into in human cells at specific site (on the long arm of chromosome 19) (Kotin et al, Proc. Natl. Acad. Sci. U.S.A., 1990. 87: 2211-2215; Samulski et al, EMBO J., 1991. 10: 3941-3950 the disclosures of which are hereby incorporated by reference herein in their entireties). AAV vector without the rep and cap genes loses specificity of site-specific integration, but may still mediate long-term stable expression of exogenous genes. AAV vector exists in cells in two forms, wherein one is episomic outside of the chromosome; another is integrated into the chromosome, with the former as the major form. Moreover, AAV has not been found to be associated with any human disease, nor any change of biological characteristics arising from the integration has been observed. There are sixteen serotypes of AAV reported in literature, respectively named AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, wherein AAV5 is originally isolated from humans (Bantel-Schaal. and H. zur Hausen. Virology, 1984. 134: 52-63), while AAV1-4 and AAV6 are all found in the study of adenovirus (Ursula Bantel-Schaal, Hajo Delius and Harald zur Hausen. J. Viral., 1999. 73: 939-947).Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0099] AAV vectors may be prepared using any convenient methods. Adeno-associated viruses of any serotype are suitable (See, e.g., Blacklow, pp. 165-174 of "Parvoviruses and Human Disease" J. R. Pattison, ed. (1988); Rose, Comprehensive Virology 3:1, 1974; P. Tattersall "The Evolution of Parvovirus Taxonomy" In Parvoviruses (J R Kerr, S F Cotmore. ME Bloom, RMLinden, C RParrish, Eds.) p 5-14, Rudder Arnold, London, UK (2006): and D E Bowles. J E Rabinowitz, R J Samulski "The Genus Dependovirus" (J R Kerr, SF Cotmore. ME Bloom, R M Linden, C R Parrish, Eds.) p 15-23, Rudder Arnold, London, UK (2006), the disclosures of which are hereby incorporated by reference herein in their entireties). Methods for purifying for vectors may be found in, for example. U.S. Pat. Nos. 6,566, 118, 6,989,264, and 6,995,006 and W0 / 1999 / 011764 titled "Methods for Generating High Titer Helper-free Preparation of Recombinant AAV Vectors", the disclosures of which are herein incorporated by reference in their entirety. Preparation of hybrid vectors is described in, for example, PCT Application No. PCTIUS2005 / 027091, the disclosure of which is herein incorporated by reference in its entirety. The use of viral vectors derived from the AAVs for transferring genes in vitro and in vivo has been described (See e.g., International Patent Application Publication Nos: 91 / 18088 and WO 93 / 09239; U.S. Pat. Nos. 4,797,368, 6,596,535, and 5,139,941; and European Patent No: 0488528. all of which are herein incorporated by reference in their entirety). These publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced by a gene of interest, and the use of these constructs for transferring the gene of interest in vitro (into cultured cells) or in vivo (directly into an organism). The replication defective recombinant AAVs according to the invention can be prepared by co-transfecting a plasmid containing the nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions, and a plasmid carrying the AAV encapsidation genes (rep and cap genes), into a cell line that is infected with a human helper virus (for example an adenovirus). The AAV recombinants that are produced are then purified by standard techniques.
[0100] In some embodiments, the vector(s) for use in the methods of the invention are encapsidated into a virus particle (e.g., AAV virus particle including, but not limited to, AAV1, AAV2, AAV3, AAV4. AAV5, AAV6, AAV7, AAV8. AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15. and AAV16). Accordingly, the invention includes a recombinant virus particle (recombinant because it contains a recombinant polynucleotide) comprising any of the vectors described herein. Methods of producing such particles are known in the art and are described in U.S. Pat. No. 6,596.535.
[0101] When the EBV-infected B-cell is transfected with a recombinant vector including the sensor RNA, the sensor RNA is operably linked to a promoter. Suitable promoters of the present disclosureAttorney Docket No.: STAN-2220WOStanford No.: S24-311 include, without limitation, a SFFV promoter, a hEFla, a CMV promoter or a variant thereof, an inducible promoter, a CMV-tetO promoter, a tissue or cell specific promoter, etc. When the sensor is operably linked to a promoter, the promoter may be preceded by a 5’ UTR and the sensor RNA sequence may be followed by a 3’ UTR. In some embodiments, the 5’ and 3’ UTR are mmPeglO UTRs. mmPeglO UTRs have been described in the art by, for example. Segel et. al. Science. 2021 Aug 20;373(6557):882-889 which is specifically incorporated by reference herein. Additional 3’ and 5’ UTRs find use in the present disclosure and have been described in, for example, International Patent Application WO2021055855A1 which is specifically incorporated by reference herein. Sensors that are preceded and followed by specific UTRs have certain benefits over those that don’t, for example by increasing expression levels, altering localization, or altering splicing patterns in a way that retains the editable codon in the correct frame (in cases when the promoter causes splicing patterns removing the editable codon from the output reading frame).
[0102] In some embodiments, the 3’ UTR and the 5’ UTR are selected from the group consisting of: a Hs PeglO 3’ and 5’ UTR, a mmPeglO 3’ and 5’ UTR, a HsPNMAl 3’ and 5’ UTR, a mmPNMAl 3’ and 5’ UTR, a HsPNMA3 3’ and 5’ UTR, a mmPNMA3 3’ and 5’ UTR, a HsMAOPl 3’ and 5’ UTR. a mmMAOPl 3’ and 5’ UTR, a HsPNMA5 3’ and 5’ UTR, a mmPNMA5 3’ and 5’ UTR. a HsRTLl 3’ and 5’ UTR, a mmRTLl 3’ and 5’ UTR, a HsZCCHC12 3’ and 5’ UTR, a mmZCCHC12 3’ and 5’ UTR, a HsASPRVl 3’ and 5’ UTR, a mmADPRVl 3’ and 5’ UTR, a HsARCl 3’ and 5’ UTR. and a mmARCl 3’ and 5’ UTR. The term “a portion of a nucleic acid” refers to a truncation of the nucleic acid sequence. The truncation may be a range of different truncations from the 3’end, the 5’ end, or the 3’ and the 5’ end. For instance, the truncation may be a 1-5, 1-10, 1-50, 1-100, 1-200. 1-300, 1-400, 1-500, 1-600, 1-1000, 1-1100, 1-1200, 1-1300, 1-1400, 1-1500, 1-1600, 1-1700, 1- 1800, 1-1900, 1-2000, 10-50, 10-100, 10-200, 10-300, 10-400, 10-500, 10-600, 10-1000, 10-1100, 10-1200, 10-1300, 10-1400, 10-1500. 10-1600, 10-1700, 10-1800, 10-1900, 10-2000. 50-100, 50- 200, 50-300, 50-400, 50-500, 50-600, 50-1000, 50-1100, 50-1200, 50-1300, 50-1400, 50-1500, 50- 1600, 50-1700, 50-1800, 50-1900, 50-2000, 100-200, 100-300, 100-400, 100-500, 100-600, 100- 1000. 100-1100. 100-1200, 100-1300, 100-1400, 100-1500, 100-1600, 100-1700. 100-1800. 100- 1900, 100-2000, 200-300, 200-400, 200-500, 200-600, 200-1000, 200-1100, 200-1200, 200-1300, 200-1400, 200-1500, 200-1600, 200-1700, 200-1800, 200-1900, 200-2000, 500-600, 500-1000, 500- 1100. 500-1200. 500-1300. 500-1400. 500-1500. 500-1600. 500-1700. 500-1800. 500-1900, or 500- 2000 nucleotide truncation of the nucleic acid sequence from the 3’ end, the 5’ end or the 3’ and 5’ end. Sequences of 3 ’and 5’ UTRs are known in the art and have been described by, for example.Attorney Docket No.: STAN-2220WOStanford No.: S24-311International Patent Application No: US2024 / 031501 which is incorporated by reference herein in its entirety.
[0103] In some aspects of the present disclosure, the sensor RNA includes one or more MS2 hairpins. In some embodiments, the sensor RNA includes more than one MS2 hairpin. For example, the sensor RNA may include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten more, or more than ten. In some aspects, the sensor RNA include one or more TAR RNA elements. For example, the sensor RNA may include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten more, or more than ten. In some aspects, the sensor RNA include one or more BoxB stem-loop. For example, the sensor RNA may include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten more, or more than ten. In some aspects, the sensor RNA includes MS2 hairpins and BoxB stem loops, MS2 hairpins and TAR RNA elements, or BoxB stemloops and TAR RNA elements.
[0104] In some embodiments, the method of depleting EBV-infected B-cells further contains contacting the EBV-infected B-cell with an ADAR protein or a coding sequence thereof. The ADAR protein may be any ADAR protein from any species. For instance, the ADAR protein may include without limitation, an ADAR (AD ARI), an ADAR pl 10, an ADAR pl50, an ADAR2, an engineered ADAR protein such as a protein containing a deaminase domain of ADAR2 or a variant thereof and a MS2 RNA binding protein (MCP), an engineered ADAR protein that lacks a nuclear localization sequence, an engineered ADAR protein containing a nuclear export sequence, an engineered ADAR protein containing one or more dsRNA binding domains from one or more distinct ADAR proteins, an engineered ADAR protein containing a TAR RNA binding protein, an engineered ADAR protein containing a Lambda N peptide, a split engineered ADAR protein wherein the N and C terminus of the deaminase domain are produced separately and the two halves binding to one another in the presence of the target RNA, etc. Suitable engineered ADAR proteins have been described in Katrekar et al. (Nat Methods. 2019 Mar;16(3):239-242.), Biswas et al. (iScience. 2020 Jul 24;23(7): 101318), Matthews et al. (Nat Struct Mol Biol. 2016 May;23(5):426-33), Cox et al. (Science. 2017 Nov 24;358(6366):1019-1027) or Kuttan et al. (Proc Natl Acad Sci U S A. 2012 Nov 27;109(48):E3295- 304). Split engineered ADAR proteins are described in Katrekar et al. (Elife. 2022 Jan 19; 1 l:e75555). When the sensor RNA contains a start codon in place of a stop codon, a particular ADAR protein may be used. In some embodiments, the ADAR protein is ADAR2 when the sensor RNA contains a start codon in place of a stop codon.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0105] In some embodiments, RNA editing proteins other than ADARs are used. For instance, proteins of the apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) family may be used. Examples of suitable APOBEC proteins include, without limitation, APOB EC 1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4. etc.
[0106] In some embodiments, the sensor RNA further contains a nucleotide sequence containing a cleavage domain followed by a nucleotide sequence encoding any of the ADAR proteins described above wherein the nucleotide sequence containing the cleavage domain is after the nucleotide sequence encoding the output protein. In some embodiments, an ADAR protein is used instead of a marker protein as the first nucleotide sequence.
[0107] In some embodiments, the sensor RNA further contains a nucleotide sequence encoding a second sensor nucleotide sequence that hybridizes to a second target RNA wherein the sensor nucleotide sequence contains a second editable codon wherein the sequences of the first and second target RNAs are different. In some embodiments, the first target RNA is EBER1 and the second target RNA is EBER2. In some embodiments, the first target RNA is EBER2 and the second target RNA is EBER1. In some embodiments, the editable codon that contains at least 1 base that is mismatched with the second target RNA sequence. In some embodiments, the sensor RNA further contains a nucleotide sequence encoding a second sensor nucleotide sequence that hybridizes to a second target RNA wherein the sensor nucleotide sequence contains a non-start codon that can be edited to a start codon. In some embodiments, the stop, start or non-start codon contains at least 1 base that is mismatched with the second target RNA sequence. In some embodiments, the stop, start or non-start codon is contained with a stem-loop sequence contained in the second sensor nucleotide sequence. In some embodiments, the EBV-infected B-cell is contacted with two or more sensor RNAs that detect two or more distinct target RNAs. In some embodiments, the two or more distinct target RNAs are EBER1 and EBER2.
[0108] Additional embodiments for using the sensor RNAs disclosed herein can be found in, for example, PCT application number US2023 / 063245 which is specifically incorporated by reference herein.METHODS FOR TREATING EBV-ASSOCIATED DISEASES
[0109] Methods for selectively expressing a product in EBV-infected cells may also be used to treat an individual for an EBV-associated disease. In the methods disclosed herein, the product forAttorney Docket No.: STAN-2220WOStanford No.: S24-311 expression in an EBV-infected cell may be a therapeutic product, such as a toxic product, e.g., a toxic protein that is capable of inducing the death, killing, or apoptosis of the EBV-infected cell. Examples of the toxic proteins of the present disclosure include, without limitation, AB toxins, human apoptosis proteins, including procaspases and caspases, Fas and its signaling domains, cytochrome c, Bax, Bak, pro-apoptotic BCL2 family member proteins, defensins, granzymes, and other proapoptotic proteins, peptide toxins, enzymatically active toxins, etc.
[0110] Subjects who receive particular benefit for the methods disclosed herein are subjects who have or are suspected to have an EBV-associated disease. Diseases associated with EB V infection include, without limitation, EBV-associated autoimmune diseases, infectious mononucleosis, EBV-associated cancers, and oral hairy leukoplakia. Autoimmune diseases that are associated with EBV-infection include, without limitation, multiple sclerosis (MS), systemic lupus erythematosus (SLE), Rheumatoid arthritis (RA), Sjogren’s syndrome (SS), etc. Cancers that are associated with EBV infection include, without limitation, Burkitt lymphoma (BL), gastric carcinoma, Hodgkin’s lymphoma (HL), NK / T cell lymphoma (NKTL), nasopharyngeal cancer (NPC), diffused large B cell lymphoma (DLBCL), HIV-associated lymphomas, post-transplant lymphoproliferative disease (PTLD), breast cancer, lymphoepithelial carcinoma of the salivary glands (LECSG). lymphoepithelioma-like carcinoma of the lung (LELC), renal cell carcinoma, thyroid cancer, cervical cancer, bladder cancer, etc.
[0111] The methods disclosed herein are able to target EBV-infected cells when they are in a latent stage and lytic stage. For instance, the sensor RNAs of the present disclosure are capable of targeting EBV-infected cells in with EBV latency 0, EBV latency I, EBV latency II, EBV latency III, lytic EBV activation, and abortive lytic activation.
[0112] The sensor RNAs used in methods for treating EBV-associated diseases are directed to target RNA’s that are associated with EBV-infection. For example, the target RNA includes, without limitation, mRNA, long non-coding RNA, transfer RNA, ribosomal RNA, small RNAs such as microRNA, small interfering RNA, small nucleolar RNAs, etc. In some embodiments, the target RNA is a non-coding RNA associated with EBV. In some embodiments, the target RNA or non-coding RNA is associated with EBV latency 0, EBV latency I, EBV latency II, EBV latency III, lytic activation, abortive lytic activation, or any combination thereof. In some embodiments, the noncoding RNA is associated with EBV latency 0. In some embodiments, the target RNA or non-coding RNA is associated with EBV latency I. In some embodiments, the target RNA or non-coding RNA is associated with EBV latency 0 and I. In some embodiments, the target RNA is a non-coding RNA.Attorney Docket No.: STAN-2220WOStanford No.: S24-311In some embodiment, the non-coding RNA is EBER1 or EBER2. In some embodiments, the noncoding RNA is a BART miRNA. In some embodiments, the BART miRNA selected from the group consisting of a BART 1, a BART 2, a BART 3, a BART 4, a BART 5, a BART 6, a BART 7, a BART 8, a BART 9, a BART 10, a BART 11, a BART 12, a BART 13, a BART 14, a BART 15, a BART 16, a BART 17, a BART 18, a BART 19, a BART 20, a BART 21. a and a BART 22 miRNA. In some embodiments, the non-coding RNA is a BHRF miRNA. In some embodiments, the BHRF miRNA selected from the group consisting of a BHRF 1-1, a BHRF 1-2, and a BHRF 1-3 miRNA. In some embodiments, the non-coding RNA is selected from the group consisting of: EBER1. EBER2, BART 1, BART 2, BART 3, BART 4, BART 5, BART 6, BART 7, BART 8, BART 9, BART 10, BART 11, BART 12, BART 13, BART 14, BART 15, BART 16, BART 17, BART 18, BART 19, BART 20, BART 21, BART 22, BHRF 1-1, BHRF 1-2, and BHRF 1-3.
[0113] The administration may be by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. In some embodiments, the administration is a local administration. In some embodiments, the administration is systemic. When the administration is local, the local administration is in a location that is in proximity to the EBV-infected cells, e.g., EBV-infected B- cells. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal or subcutaneous administration. An agent can be administered in any manner which is medically acceptable. This may include injections, by parenteral routes such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumor, intraperitoneal, intraventricular, intraepidural, or others as well as oral, nasal, ophthalmic, rectal, or topical. Sustained release administration is also specifically included in the disclosure, by such means as depot injections or erodible implants.
[0114] The depletion of EBV-infected cells in a subject who has or is suspected to have an EBV- associated disease may result in the reduction in observable symptoms associated with the EBV- associated autoimmune disorder. The depletion of EBV-infected cells in a subject who has or is suspected to have an EBV-associated disease may result in the reduction in the frequency, dosage, or need for additional medications used in the treatment of the EBV-associated disease. The abovedescribed treatment may deplete EBV-infected cells, e.g., EBV-infected B-cells, to a level such that the severity of the EBV-associated disease is reduced. In some embodiments, the administering results in a partial depletion of the EBV-infected cells. In some embodiments, the administering results in a complete or near complete depletion of the EBV-infected cells such that the EBV-infected cells are near or below a detection threshold.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0115] In addition to the treatment disclosed above, a secondary agent may be administered to the subject to assist in the treatment of the EBV-associated disease or symptoms associated with the disease. When the EBV-associated autoimmune disorder is multiple sclerosis (MS), medications may be provided that modify the disorder such as medications that target inflammation in the central nervous system, corticosteroids, muscle relaxants, medications for fatigue such as amantadine, modafinil, and methylphenidate, medications to improve walking speed such as dalfampridine, etc. When the EBV-associated autoimmune disorder is Systemic Lupus Erythematosus (SLE), medications may be provided such as hydroxychloroquine, nonsteroidal anti-inflammatory drugs, corticosteroids such as methotrexate, azathioprine, methylprednisolone, and mycophenolate, immunosuppresants, Belimumab, etc. When the EBV-associated autoimmune disorder is Rheumatoid arthritis (RA), agents may be provided such as disease modifying antirheumatic drugs (DMARDs) such as methotrexate, sulfasalazine, and leflunomide, TNF inhibitors, IL-6, abatacept, tofacitinib, upadacitinib. baricitinib, methotrexate, hydroxychloroquine, prednisone, adalimumab, etanercept, golimumab, certolizumab pegol, infliximab, rituximab, anakinra, azathioprine, cyclosporine, etc. When the EBV-associated autoimmune disorder is Sjogren’s syndrome (SS), medications may be provided such as agents that decrease eye inflammation such as cyclosporine or lifitegrast, agents that increase saliva production such as pilocarpine and cevimeline, NSAIDs, agents that treat systemic inflammation such as methotrexate or hydroxychloroquine, etc.
[0116] When the EBV-associated disease is cancer, the secondary agent may be a chemotherapeutic agent. Chemotherapeutic agents that find use in the present disclosure include, without limitation, Abitrexate (Methotrexate Injection), Abraxane (Paclitaxel Injection), Adcetris (Brentuximab Vedotin Injection), Adriamycin (Doxorubicin), Adrucil Injection (5-FU (fluorouracil)), Afinitor (Everolimus) , Afinitor Disperz (Everolimus) , Alimta (PEMET EXED), Alkeran Injection (Melphalan Injection), Alkeran Tablets (Melphalan), Aredia (Pamidr onate), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arzerra (Ofatumumab Injection), Avastin (Bevacizumab), Bexxar (Tositumomab), BiCNU (Carmustine), Blenoxane (Bleomycin), Bosulif (Bosutinib), Busulfex Injection (Busulfan Injection), Campath (Alemtuzumab), Camptosar (Irinotecan), Caprelsa (Vandetanib), Casodex (Bicalutamide), CeeNU (Lomustine), CeeNU Dose Pack (Lomustine), Cerubidine (Daunorubicin), Clolar (Clofarabine Injection), Cometriq (Cabozantinib), Cosmegen (Dactinomycin), CytosarU (Cytarabine), Cytoxan (Cytoxan), Cytoxan Injection (Cyclophosphamide Injection), Dacogen (Decitabine), DaunoXome (Daunorubicin Lipid Complex Injection), Decadron (Dexamethasone), DepoCyt (Cytarabine Lipid Complex Injection), Dexamethasone IntensolAttorney Docket No.: STAN-2220WOStanford No.: S24-311(Dexamethasone), Dexpak Taperpak (Dexamethasone), Docefrez (Docetaxel), Doxil (Doxorubicin Lipid Complex Injection), Droxia (Hydroxyurea), DTIC (Decarbazine), Eligard (Leuprolide), Ellence (Ellence (epirubicin)), Eloxatin (Eloxatin (oxaliplatin)), Elspar (Asparaginase), Emcyt (Estramustine), Erbitux (Cetuximab), Erivedge (Vismodegib), Erwinaze (Asparaginase Erwinia chrysanthemi), Ethyol (Amifostine), Etopophos (Etoposide Injection), Eulexin (Flutamide). Fareston (Toremifene), Faslodex (Fulvestrant), Femara (Letrozole), Firmagon (Degarelix Injection), Fludara (Fludarabine), Folex (Methotrexate Injection), Folotyn (Pralatrexate Injection), FUDR (FUDR (floxuridine)), Gemzar (Gemcitabine), Gilotrif (Afatinib). Gleevec (Imatinib Mesylate), Gliadel Wafer (Carmustine wafer), Halaven (Eribulin Injection), Herceptin (Trastuzumab), Hexalen (Altretamine), Hycamtin (Topotecan), Hycamtin (Topotecan), Hydrea (Hydroxyurea), Iclusig (Ponatinib), Idamycin PFS (Idarubicin), Ifex (Ifosfamide), Inlyta (Axitinib), Intron A alfab (Interferon alfa-2a), Iressa (Gefitinib), Istodax (Romidepsin Injection), Ixempra (Ixabepilone Injection), Jakafi (Ruxolitinib), Jevtana (Cabazitaxel Injection), Kadcyla (Ado-trastuzumab Emtansine), Kyprolis (Carfilzomib), Leukeran (Chlorambucil), Leukine (Sargramostim), Leustatin (Cladribine), Lupron (Leuprolide), Lupron Depot (Leuprolide), Lupron DepotPED (Leuprolide), Lysodren (Mitotane), Marqibo Kit (Vincristine Lipid Complex Injection), Matulane (Procarbazine). Megace (Megestrol), Mekinist (Trametinib), Mesnex (Mesna), Mesnex (Mesna Injection), Metastron (Strontium-89 Chloride), Mexate (Methotrexate Injection), Mustargen (Mechlorethamine), Mutamycin (Mitomycin), Myleran (Busulfan), Mylotarg (Gemtuzumab Ozogamicin), Navelbine (Vinorelbine), Neosar Injection (Cyclophosphamide Injection), Neulasta (filgrastim), Neulasta (pegfilgrastim), Neupogen (filgrastim), Nexavar (Sorafenib), Nilandron (Nilandron (nilutamide)), Nipent (Pento statin), Nolvadex (Tamoxifen), Novantrone (Mitoxantrone), Oncaspar (Pegaspargase), Oncovin (Vincristine), Ontak (Denileukin Diftitox), Onxol (Paclitaxel Injection), Panretin (Ali tretinoin), Paraplatin (Carboplatin), Perjeta (Pertuzumab Injection), Platinol (Cisplatin), Platinol (Cisplatin Injection), PlatinolAQ (Cisplatin), PlatinolAQ (Cisplatin Injection), Pomalyst (Pomalidomide), Prednisone Intensol (Prednisone), Proleukin (Aldesleukin), Purinethol (Mercaptopurine). Reclast (Zoledronic acid), Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), RoferonA alfaa (Interferon alfa-2a), Rubex (Doxorubicin), Sandostatin (Octreotide), Sandostatin LAR Depot (Octreotide), Soltamox (Tamoxifen), Sprycel (Dasatinib), Sterapred (Prednisone). Sterapred DS (Prednisone), Stivarga (Regorafenib), Supprelin LA (Histrelin Implant), Sutent (Sunitinib), Sylatron (Peginterferon Alfa-2b Injection (Sylatron)), Synribo (Omacetaxine Injection), Tabloid (Thioguanine), Taflinar (Dabrafenib), Tarceva (Erlotinib).Attorney Docket No.: STAN-2220WOStanford No.: S24-311Targretin Capsules (Bexarotene), Tasigna (Decarbazine), Taxol (Paclitaxel Injection), Taxotere (Docetaxel), Temodar (Temozolomide), Temodar (Temozolomide Injection), Tepadina (Thiotepa). Thalomid (Thalidomide), TheraCys BCG (BCG), Thioplex (Thiotepa), TICE BCG (BCG), Toposar (Etoposide Injection), Torisel (Temsirolimus), Treanda (Bendamustine hydrochloride), Trelstar (Triptorelin Injection), Trexall (Methotrexate), Trisenox (Arsenic trioxide), Tykerb (lapatinib). Valstar (Valrubicin Intravesical), Vantas (Histrelin Implant), Vectibix (Panitumumab), Velban (Vinblastine), Velcade (Bortezomib), Vepesid (Etoposide), Vepesid (Etoposide Injection), Vesanoid (Tretinoin), Vidaza (Azacitidine), Vincasar PFS (Vincristine), Vincrex (Vincristine), Votrient (Pazopanib), Vumon (Teniposide), Wellcovorin IV (Leucovorin Injection), Xalkori (Crizotinib), Xeloda (Capecitabine), Xtandi (Enzalutamide), Yervoy (Ipilimumab Injection), Zaltrap (Ziv- aflibercept Injection), Zanosar (Streptozocin), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zoladex (Goserelin), Zolinza (Vorinostat), Zometa (Zoledronic acid), Zortress (Everolimus), Zytiga (Abiraterone), Nimotuzumab and immune checkpoint inhibitors such as nivolumab, pembrolizumab / MK-3475, pidilizumab and AMP-224 targeting PD-1; and BMS-935559, MEDI4736, MPDL3280A and MSB0010718C targeting PD-L1 and those targeting CTLA-4 such as ipilimumab.METHODS FOR TREATING VIRUS-ASSOCIATED DISEASES
[0117] Methods for selectively expressing a product in EBV-infected cells may also be used to treat an individual for a virus-associated disease or a viral infection. In these embodiments, the target RNA is a virus-associated RNA. In the methods disclosed herein, the product for expression in a virus- infected cell may be a therapeutic product, such as a toxic product, e.g., a toxic protein that is capable of inducing the death, killing, or apoptosis of the virus-infected cell. Examples of the toxic proteins of the present disclosure include, without limitation, AB toxins, human apoptosis proteins, including procaspases and caspases, Fas and its signaling domains, cytochrome c. Bax, Bak, pro-apoptotic BCL2 family member proteins, defensins, granzymes, and other proapoptotic proteins, peptide toxins, enzymatically active toxins, etc.
[0118] The sensor RNAs used in methods for treating virus-associated diseases are directed to target RNA’s that are associated with a viral infection. For example, the target RNA includes, without limitation, mRNA, long non-coding RNA, transfer RNA, ribosomal RNA, small RNAs such as microRNA, small interfering RNA, small nucleolar RNAs, etc. In some embodiments, the target RNA is a non-coding RNA associated with a virus of interest. Viruses of interest include, without limitation,Attorney Docket No.: STAN-2220WOStanford No.: S24-311 cytomegalovirus, herpes simplex virus, Kaposi's sarcoma-associated herpesvirus, West Nile virus, vesicular stomatitis virus, influenza a, human immunodeficiency virus, etc. Non-coding RNAs associated with cytomegalovirus include, without limitation, LncRNA2.7, P-2.7, 5-kb immediate- early sisRNA, etc. Non-coding RNAs associated with herpes simplex virus include, without limitation, LAT, sRNAl, sRNA2, etc. Non-coding RNAs associated Kaposi's sarcoma-associated herpesvirus include, without limitation, PAN, etc. Non-coding RNAs associated West Nile virus include, without limitation, subgenomic flaviviral RNA (sfRNA), etc. Non-coding RNAs associated vesicular stomatitis virus include, without limitation, leRNA, etc. Non-coding RNAs associated Human immunodeficiency Virus include, without limitation, Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), HIV- 1 -enhanced IncRNA (HEAL), uc002yug.2, FAS antisense 1 (FAS-AS1), Tugl IncRNA, etc. Non-coding RNAs associated Influenza A include, without limitation, svRNA, etc. Viral non-coding RNAs are known in the art and have been disclosed in, for example, Tycowski et al. (Genes Dev. 2015 Mar 15;29(6):567-584), Ray et al. (Noncoding RNA. 2020 Mar 13;6(1): 12), Amir et al. (mBio. 2024 Feb 14;15(2):e0192523) each of which is specifically incorporated by reference herein.
[0119] Subjects who receive particular benefit for the methods disclosed herein are subjects who have or are suspected to have a virus-associated disease. Diseases associated with cytomegalovirus including, without limitation, infectious mononucleosis, etc. Diseases associated with herpes simplex virus including, without limitation, mucocutaneous herpes simplex infection, Acute herpetic gingivostomatitis, Herpes labialis, Herpes simplex keratitis, Herpetic whitlow, Herpes encephalitis, Viral meningitis, Lumbosacral myeloradiculitis, Neonatal HSV infection, etc. Diseases associated with Kaposi's sarcoma-associated herpesvirus including, without limitation, Kaposi's sarcoma, HHV- 8-associated multicentric Castleman's disease, Primary effusion lymphoma, KSHV inflammatory cytokine syndrome, etc. Diseases associated with West Nile virus including, without limitation. West Nile fever, West Nie encephalitis, Meningitis, Acute flaccid myelitis, etc.
[0120] The administration may be by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. In some embodiments, the administration is a local administration. In some embodiments, the administration is systemic. When the administration is local, the local administration is in a location that is in proximity to the virus-infected cells. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal or subcutaneous administration. An agent can be administered in any manner which is medically acceptable. This may include injections, by parenteral routes such as intravenous, intravascular.Attorney Docket No.: STAN-2220WOStanford No.: S24-311 intraarterial, subcutaneous, intramuscular, intratumor, intraperitoneal, intraventricular, intraepidural, or others as well as oral, nasal, ophthalmic, rectal, or topical. Sustained release administration is also specifically included in the disclosure, by such means as depot injections or erodible implants.
[0121] The depletion of virus-infected cells in a subject who has or is suspected to have an virus- associated disease may result in the reduction in observable symptoms associated with the virus- associated disease. The depletion of virus-infected cells in a subject who has or is suspected to have an virus-associated disease may result in the reduction in the frequency, dosage, or need for additional medications used in the treatment of the virus-associated disease. The above-described treatment may deplete virus-infected cells, e.g., virus-infected B-cells, to a level such that the severity of the virus- associated disease is reduced. In some embodiments, the administering results in a partial depletion of the virus-infected cells. In some embodiments, the administering results in a complete or near complete depletion of the virus-infected cells such that the virus-infected cells are near or below a detection threshold.COMPOSITIONS
[0122] Also provided are compositions for practicing methods, e.g., as described in the present disclosure. In embodiments, subject compositions may have sensor RNA as described above in addition to a pharmaceutically acceptable excipient. In some embodiments, the subject composition have a sensor RNA contained in lipid nanoparticle. In some embodiments, the subject compositions contain a secondary agent for treating any of the diseases described above.
[0123] Compositions of the present disclosure can be administered by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal or subcutaneous administration. An agent can be administered in any manner which is medically acceptable. This may include injections, by parenteral routes such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumor, intraperitoneal, intraventricular, intraepidural, or others as well as oral, nasal, ophthalmic, rectal, or topical. Sustained release administration is also specifically included in the disclosure, by such means as depot injections or erodible implants.
[0124] As noted above, sensor RNA can be formulated with an a pharmaceutically acceptable carrier (one or more organic or inorganic ingredients, natural or synthetic, with which a subject agent is combined to facilitate its application). A suitable carrier includes sterile saline although other aqueous and non-aqueous isotonic sterile solutions and sterile suspensions known to be pharmaceuticallyAttorney Docket No.: STAN-2220WOStanford No.: S24-311 acceptable are known to those of ordinary skill in the art. An "effective amount" or “effective dose” refers to that amount which is capable of ameliorating or delaying progression of the diseased, degenerative or damaged condition. An effective amount can be determined on an individual basis and will be based, in part, on consideration of the symptoms to be treated and results sought. An effective amount can be determined by one of ordinary skill in the art employing such factors and using no more than routine experimentation.
[0125] The composition may be administered in a unit dosage form and may be prepared by any methods, including those well known in the art. Such methods include combining agent with a pharmaceutically acceptable carrier or diluent which constitutes one or more accessory ingredients. A pharmaceutically acceptable carrier is selected on the basis of the chosen route of administration and standard pharmaceutical practice. Each earner must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. This carrier can be a solid or liquid and the type is generally chosen based on the type of administration being used.
[0016] Depending on the individual and condition being treated and on the administration route, the active agent may be administered in dosages of 0.01 mg to 500 mg / kg body weight per day, e.g. about 20 mg / day for an average person. Dosages will be appropriately adjusted for pediatric formulation.
[0127] In some embodiments, the composition is formulated in an aqueous buffer. Suitable aqueous buffers include, but are not limited to, acetate, succinate, citrate, and phosphate buffers varying in strengths from 5 mM to 100 mM. In some embodiments, the aqueous buffer includes reagents that provide for an isotonic solution. Such reagents include, but are not limited to, sodium chloride; and sugars e.g., mannitol, dextrose, sucrose, and the like. In some embodiments, the aqueous buffer further includes a non-ionic surfactant such as polysorbate 20 or 80. Optionally the composition may further include a preservative. Suitable preservatives include, but are not limited to, a benzyl alcohol, phenol, chlorobutanol, benzalkonium chloride, and the like. In many cases, the composition is stored at about 4°C. Pharmaceutical compositions may also be lyophilized, in which case they generally include cryoprotectants such as sucrose, trehalose, lactose, maltose, mannitol, and the like. Lyophilized formulations can be stored over extended periods of time, even at ambient temperatures.
[0128] Compositions can be prepared as injectables. either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation also can be emulsified or encapsulated in liposomes or micro particles such asAttorney Docket No.: STAN-2220WOStanford No.: S24-311 polylactide, polyglycolide, or copolymer for enhanced adjuvant effect, as discussed above. Langer, Science 249: 1527, 1990 and Hanes, Advanced Drag Delivery Reviews 28: 97-119, 1997. The compositions of this invention can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient. The pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drag Administration.
[0129] As described above, the composition may also contain a secondary agent for treatment of any of the EBV- associated diseases described above.
[0130] When the EBV-associated disease is multiple sclerosis (MS), agents make be provided that modify the disorder such as medications that target inflammation in the central nervous system, corticosteroids, muscle relaxants, medications for fatigue such as amantadine, modafinil, and methylphenidate, medications to improve walking speed such as dalfampridine, etc. When the EBV- associated autoimmune disorder is Systemic Lupus Erythematosus (SLE), agents make be provided such as hydroxychloroquine, nonsteroidal anti-inflammatory drugs, corticosteroids such as methotrexate, azathioprine. methylprednisolone, and mycophenolate, immunosuppresants. Belimumab, etc. When the EBV-associated autoimmune disorder is Rheumatoid arthritis (RA), agents make be provided such as disease modifying antirheumatic drugs (DMARDs) such as methotrexate, sulfasalazine, and leflunomide. TNF inhibitors, IL-6, abatacept. tofacitinib. upadacitinib, baricitinib, methotrexate, hydroxychloroquine, prednisone, adalimumab, etanercept, golimumab, certolizumab pegol, infliximab, rituximab, anakinra, azathioprine, cyclosporine, etc. When the EBV-associated autoimmune disorder is Sjogren’s syndrome (SS), agents make be provided such as agents that decrease eye inflammation such as cyclosporine or lifitegrast, agents that increase saliva production such as pilocarpine and cevimeline, NSAIDs, agents that treat systemic inflammation such as methotrexate or hydroxychloroquine, etc.
[0131] When the EBV-associated disease is cancer, any of the chemotherapeutic agents described above may be included in the composition.
[0132] In some aspects the compositions of the present disclosure are formulated in a lipid nanoparticle (LNP). The use of LNPs enables the effective delivery of the sensor RNA. In one set of embodiments, lipid nanoparticles (LNPs) are provided. In one embodiment, a lipid nanoparticle comprises lipids including an ionizable lipid (such as an ionizable cationic lipid), a structural lipid, a phospholipid, and the sensor RNA. Each of the LNPs described herein may be used as a formulationAttorney Docket No.: STAN-2220WOStanford No.: S24-311 for the sensor RNAs described herein. In one embodiment, a lipid nanoparticle comprises an ionizable lipid, a structural lipid, a phospholipid, and the sensor RNA. In some embodiments, the LNP comprises an ionizable lipid, a PEG-modified lipid, a phospholipid and a structural lipid. In some embodiments, the ionizable lipid is an ionizable amino or cationic lipid and the phospholipid is a neutral lipid, and the structural lipid is a cholesterol.
[0133] Ionizable lipids can be selected from the non-limiting group consisting of 3- (didodecylamino)-N 1 ,N 1 ,4-tridodecyl- 1 -piperazineethanamine (KL 10), Nl-[2-(didodecylamino)ethyl]-Nl,N4,N4-tridodecyl-l,4-piperazinediethanamine (KL22), 14,25-ditridecyl- 15,18,21,24-tetraaza-octatriacontane (KL25), l,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin- DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), heptatriaconta- 6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2- dimethylaminoethyl)[ 1,3] -dioxolane (DLin-KC2-DMA), l,2-dioleyloxy-N,N- dimethylaminopropane (DODMA), ( 13Z, 165Z)-N,N-dimethyl-3-nonydocosa- 13-16-dien- 1 -amine (L608), 2-({8-[(3P)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12- dien-l-yloxy]propan-l -amine (Octyl-CLinDMA), (2R)-2-({8-[(3P)-cholest-5-en-3- yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine (Octyl- CLinDMA (2R)), and (2S)-2-({8-[(3P)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)- octadeca-9,12-dien-l-yloxy]propan-l -amine (Octyl-CLinDMA (2S)). In addition to these, an ionizable amino lipid can also be a lipid including a cyclic amine group.
[0134] The lipid composition of the pharmaceutical composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.
[0135] A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.
[0136] A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
[0137] Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., aAttorney Docket No.: STAN-2220WOStanford No.: S24-311 cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
[0138] Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
[0139] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.
[0140] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine.
[0141] In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present invention is DSPC, or analog thereof, with a modified tail. As described herein, a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof.
[0142] The LNPs disclosed herein can comprise one or more structural lipids. As used herein, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties.
[0143] Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol. stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. InAttorney Docket No.: STAN-2220WOStanford No.: S24-311 certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha- tocopherol.
[0144] The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid.
[0145] As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)-modified lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified l,2-diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG- DMPE, PEG-DPPC, or a PEG-DSPE lipid.
[0146] In some embodiments, the PEG-lipid includes, but not limited to 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), l,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl. PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA).
[0147] The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No. 2005 / 0222064. Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof).
[0148] A polymer can be included in and / or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and / or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, poly acrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
[0149] In some embodiments, a lipid nanoparticle (LNP) may comprise an ionizable lipid. As used herein, the term “ionizable lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable lipid may be positivelyAttorney Docket No.: STAN-2220WOStanford No.: S24-311 charged or negatively charged. An ionizable lipid may be positively charged, in which case it can be referred to as “cationic lipid”. In certain embodiments, an ionizable lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipids. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3. or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidazolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively-charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.
[0150] In some embodiments, the ionizable lipid is an ionizable amino lipid, sometimes referred to in the art as an “ionizable cationic lipid”. In one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.
[0151] In some embodiments, the surface of the lipid nanoparticle contains a targeting moiety. The targeting moiety may be any moiety that binds to or attaches to the surface of a cell of interest or a tissue or surface that is in proximity to a cell of interest. The targeting moiety includes, without limitation, an antibody or fragment thereof, a nanobody, an scFv, a protein, an aptmer, a nucleic acid, a lipid, a small molecule, etc. In some embodiments, the targeting moiety is selected from the group consisting of an antibody or fragment thereof, a nanobody, and an scFv. In some embodiments, the targeting moiety binds to a surface protein on a cell of interest. In some embodiments, the cell of interest is a B-cell. In some embodiments, the cell of interest is an epithelial cell. When the cell of interest is a B-cell, the targeting moiety may bind to a surface antigen including, without limitation, CD19, CD20, CD22, CD27, CD30, CD32B, CD40, CD45, CD52 CD80, CD86, CD69, CD95, CD267, CD269. CD268, etc.
[0152] When the cell of interest is an epithelial cell, the targeting moiety may bind to including, without limitation, A33, ACE / CD143, ALCAM / CD166, Aminopeptidase B / RNPEP, Aminopeptidase Inhibitors. Aminopeptidase N / CD13, Amnionless. B7-H2, B7-H3, CA125 / MUC16, CA15-3 / MUC-1, E-Cadherin, CDla, CDld, CDldl, CD46, CD74, CEACAM-l / CD66a, CEACAM- 3 / CD66d, CEACAM-4, CEACAM-5 / CD66e, CEACAM-6 / CD66c, CEACAM-7, Collagen I.Attorney Docket No.: STAN-2220WOStanford No.: S24-311CTRP5 / ClqTNF5, Cubilin, DDR1, DDR1 / DDR2, beta-Defensin 2, beta-Defensin 3, alpha-Defensin 1, alpha-Defensin 5, Endorepellin / Perlecan, EpCAM / TROPl, Fas Ligand / TNFSF6, Gastrokine 1. HIN-1 / SCGB3A1, Hyaluronan, IGSF4C / SynCAM4, Integrin alpha 4 / CD49d, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-l, IAM-A, JAM-B / VE-JAM, IAM-C, LI CAM, Laminin- 1, MFG- E8, MSPR / Ron, MUC-1, MUC-19. MUC-4, Nectin-1, Nectin-2 / CDl 12. Nectin-3. Nectin-4. Nidogen-l / Entactin, Occludin, PD-L1 / B7-H1, PLET-1, P1GF, Prostasin / Prss8, SLURP2, TfR (Transferrin R), UGRP1 / SCGB3A2, etc.,
[0153] When the cell of interest is a fibroblast cell, the targeting moiety may bind to including, without limitation, CD90 (Thy-1), DLK-1, CD26 / DPPIV, Fibroblast Activation Protein alpha (FAP), TE-7, 1B10, FSP1, Integrin beta 1 / CD29, MAS516, PDGFR alpha, MEFSK4, DDR2, CD90, Seal, CD10, CD26, CD40, CD44, CD90, CD133, CD140b, CD142, CD248, CDH9, FAP1, FAP-a, FSP1, FSA, HSP47, ITGA8, Vimentin, aSMA, etc.
[0154] When the cell of interest is a neuron, the targeting moiety may bind to including, without limitation, CD44, CD15, CD24, CD56, CD133, CD146, CD166, CD184, CD200, etc.
[0155] When the cell of interest is an endothelial cell, the targeting moiety may bind to including, without, limitation, ACE / CD143, ClqRl / CD93. VE-Cadherin, CC Chemokine Receptor D6. CD31 / PECAM-1, CD34, CD36 / SR-B3, CD151, CD160, CD300g / Nepmucin, CL-K1 / COLEC11, CL-P1 / COLEC12, Coagulation Factor IIPTissue Factor, DC-SIGNR / CD299, DCBLD2 / ESDN, EC SCR, EMMPRIN / CD147, Endoglin / CD105. Endomucin, Endosialin / CD248, EPCR, Erythropoietin R, ESAM, FABP5 / E-FABP, FABP6, ICAM-1 / CD54, ICAM-2 / CD102, IL-1 RI, IL- 13 R alpha 1, Integrin alpha 4 / CD49d, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-L Integrin beta 2 / CD18, KLF4, LYVE-1, MCAM / CD146, Nectin-2 / CD112, PD-ECGF / Thymidine Phosphorylase, Podocalyxin, Podoplanin, S1P1 / EDG-1, S1P2 / EDG-5, S1P3 / EDG-3, S1P4 / EDG-6, S1P5 / EDG-8, E-Selectin / CD62E, E-Selectin (CD62E) / P-Selectin (CD62P), P-Selectin / CD62P, SLAM / CD150, Stabilin-1 , Stabilin-2, TEM7 / PLXDC1 , TEM8 / ANTXR1 , Thrombomodulin / BDCA- 3, THSD1, THSD7A, Tie-2, TNF RI / TNFRSF1A, TNF RH / TNFRSF1B, TRA-1-85 / CD147, TRAIL R2 / TNFRSF10B, TRAILR1 / TNFRSF10A. VCAM-1 / CD106. VE-Statin, VEGFRl / Flt-L VEGFR2 / KDR / Flk-1, VEGFR3 / Flt-4, VG5Q, vWF-Al, vWF-A2, etc.KITS
[0156] Also provided are kits for practicing the methods described in the present disclosure. In general, subject kits may contain a sensor RNA as described above. The sensor RNA may beAttorney Docket No.: STAN-2220WOStanford No.: S24-311 contained in a lipid nanoparticle or the sensor RNA may be within a recombinant vector as described above, e.g., an AAV vector. In some cases, the kit further contains an ADAR protein or a coding sequence thereof. When the kit contains a coding sequence of the ADAR it may be in a recombinant vector as described above. When the kit contains the ADAR protein or the coding sequence thereof, the ADAR protein may be any ADAR protein described above. The sensor RNA and the coding sequence of the ADAR protein may be contained on the same recombinant vector or different recombinant vectors.
[0157] In some cases, the kit may further contain a positive and / or negative control. The positive control may be in the form of a biological sample containing the target RNA, a sensor RNA containing an edited codon (i.e., a stop codon that has been edited to be a non-stop codon or a start codon edited to be a non-start codon or a non-start codon edited to be a start codon) or a sensor RNA containing the nucleotide sequence of the target RNA. The negative control may be in the form of a biological sample that does not contain the target RNA.
[0158] A subject kit can include any combination of components for performing the methods of the present disclosure. The components of a subject kit can be present as a mixture or can be separate entities. In some cases, components are present as a lyophilized mixture. In some cases, the components are present as a liquid mixture. Components of a subject kit can be in the same or separate containers, in any combination.
[0159] The subject kits may further include (in certain embodiments) instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, and the like. Yet another form of these instructions is a computer readable medium, e.g.. diskette, compact disk (CD), flash drive, and the like, on which the information has been recorded. Yet another form of these instructions that may be present is a website address which may be used via the internet to access the information at a remote site.EXAMPLES
[0160] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have beenAttorney Docket No.: STAN-2220WOStanford No.: S24-311 made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c., subcutaneous (ly); and the like.Example 1Introduction
[0161] Epstein-Barr Virus (EBV) is closely associated with several autoimmune diseases, including multiple sclerosis (MS), systemic lupus erythematosus (SLE), and Sjogren’s syndrome (SS) (Bjomevik, K. et al. Science 375, 296-301 (2022); Harley, J. B. et al. Arthritis Rheum. 42, 1782— 1783 (1999); Fox, R. I., et al. J. Immunol. 137, 3162-3168 (1986)). A major molecular mechanism underlying this association is molecular mimicry between EBV and self proteins, and cross-reactive antibodies against the EBV transcription factor EBNA1 and the glial cellular adhesion molecule GlialCAM have been identified in MS patients (Lanz, T. V. et al. Nature 603, 321-327 (2022)). In addition, EBV infects and establishes latency in B cells, which secrete autoantibodies and orchestrate the self-reactive immune response in autoimmune patients. Latently infected EBV+ B cells in autoimmune patients show activated phenotypes and drive inflammation. Ongoing viral infection is necessary to develop molecular mimicry and to sustain activated B cell phenotypes, which promote disease flares. Broad B cell depletion with anti-CD20 and CD 19 antibodies and CAR-T cells are effective treatments for several autoimmune diseases. However, these therapies are overly broad and cause side effects including severe infections. To make matters worse, most B cell depleting approaches spare certain sub-sets of EBV+ B cells. Therefore, targeted depletion of EBV+ B cells is a promising approach to for an effective therapy of EBV-associated autoimmune diseases that will be more targeted and more effective than current approaches.
[0162] EBV infects human B cells via the complement receptor CD21 and, after a short lytic infection cycle, establishes life-long latency in B cells. In healthy infected individuals and autoimmune patients, EBV stays mainly in latencies 0 and I, during which it does not express any (latency 0) or only 1 viral protein (EBNA1, latency I). The majority of the virus’ ~90 proteins are only expressed in tumor-associated latency (type II and III) and during lytic re-activation (Fig. 1). This posesAttorney Docket No.: STAN-2220WOStanford No.: S24-311 challenges for the development of therapies against EBV that would be effective in autoimmune patients.
[0163] The short non-coding EBV-encoded RNAs EBER1 and EBER2 are expressed throughout the EBV life cycle at high copy numbers (~ 10A7 EBER1 and ~10A6 EBER2 per cell) ( Lee, N. RNA Biol. 18, 759-766 (2021)) (Fig. 1). Here we propose to utilize RADAR (RNA sensing using adenosine deaminases acting on RNA), a novel RNA sensor technology, developed in the lab of co-inventor Xiaojing Gao at Stanford (Kaseniit, K. E. et al. Nat. Biotechnol. 41, 482-487 (2023)), to target EBV+ B cells via EBER1 and 2 (Fig. 2). RADAR is an RNA molecule with two protein-coding regions, separated by a stop codon (UAG) that prohibits translation of the 3’ gene. The sequence directly 5’ and 3’ of the stop codon will be designed to be complementary to EBER1 and 2. EBER1 or 2 sensing RADAR RNA will be delivered to B cells within targeted lipid nanoparticles (LNPs). Upon annealing to either viral RNA, the double-stranded RNA region will recruit the cellular dsRNA editing enzyme ADAR, which exchanges the central adenosine in the stop codon to inosine, thereby replacing the stop codon with a Trp-coding codon and enabling translation of the 3’ gene (Fig. 2). Since its first description, the design of RADAR was further improved to increase signal and programmability, and to decrease baseline activity. While initial approaches used the technology as a fluorescent sensor (Kaseniit, K. E. et al. Nat. Biotechnol. 41, 482-487 (2023)), our constructs will encode a protein toxin to induce apoptosis in EBV+ cells upon activation of RADAR.Results
[0164] EBERl / 2-dependent induction of RADAR signal
[0165] EBER2-expressing Hek293 cells (blue) and control cells (orange) were transfected with different versions of first- generation (FIG. 3A and FIG. 3C; linear sensor) or second-generation (FIG. 3B and FIG. 3D; modulADAR sensor) RADAR sensors directed to EBER1 or EBER2. First- generation RADAR sensors showed robust fluorescent responses to EBER1 / 2 RNAs and very low background fluorescence while second-generation RADAR sensors had higher background, but also ~ 10-fold higher fluorescent signals.Attorney Docket No.: STAN-2220WOStanford No.: S24-311Attorney Docket No.: STAN-2220WOStanford No.: S24-311Attorney Docket No.: STAN-2220WOStanford No.: S24-311Attorney Docket No.: STAN-2220WOStanford No.: S24-311Table 1. Sequences used in Example 1 and Example 3Methods
[0166] WT Human Embryonic Kidney (HEK) 293 cells (ATCC, catalog no. CRL-1573) were cultured in a humidity-controlled incubator under standard culture conditions (37°C with 5% CO2) in Dulbecco's Modified Eagle Medium, supplemented with 10% fetal bovine serum (Fisher Scientific, catalog no. FB 12999102), 1 mM sodium pyruvate (EMD Millipore, catalog no. TMS-005-C), lx penicillin-streptomycin (Genesee, catalog no. 25-512), 2 mM 1-glutamine (Genesee, catalog no. 25- 509) and lx MEM non-essential amino acids (Genesee, catalog no. 25-536). HEK 293 cells were cultured in 24-well tissue culture-treated plates under standard culture conditions. When cells were 70-90% confluent, the cells were transiently transfected with plasmid constructs using the jetOPTIMUS DNA transfection Reagent (Polyplus catalog # 117-15), as per manufacturer's instructions using 0.375 uL of reagent per 50 uL of jetOPTIMUS buffer for 500 ng total DNA transfections in the 24-well format. Cells were harvested approximately 48 hours after transfection by trypsinization and resuspended in flow buffer (HBSS + 2.5 mg / mL bovine serum albumin). Post 40 um straining, cells were analyzed by flow cytometry (Biorad ZE5 Cell Analyzer), and data was processed with the cytoflow Python package. The mean output fluorescence intensity is reported in cells gated for high transfection efficiency (relative within the given experiment).
[0167] Cells were transfected with 200 ng plasmid DNA encoding the sensor sequence; 30 ng plasmid DNA encoding ADARpl50; and 270 ng plasmid DNA encoding either an unrelated transcript, EBER1, or EBER2.Attorney Docket No.: STAN-2220WOStanford No.: S24-311Example 2
[0168] Therapeutic deletion of EB V+ B cells to prevent or treat EBV-associated autoimmune disease or EBV-associated cancers. To prevent and / or treat EBV-associated autoimmune diseases and cancer, RADAR-Pseudomonas exotoxin (or other toxin, or apoptosis-inducing protein) constructs are generated and loaded into liposomes that contain a B-cell targeting scFv against CD19, CD22, CD32B, or another B cell surface marker. The B cell-targeted liposomes are delivered to the patient, and result in delivery of the RADAR-toxin construct to B cells. The RADAR-toxin construct is expressed by the B cell, and only in EBV+ B cells the RADAR mediates express the toxin which selectively kills the EBV+ B cell to prevent or treat the EBV-associated autoimmune disease.Example 3
[0169] One compelling application of RNA sensors is sensing viral infection. This would enable both therapeutic applications (e.g., elimination of infected cells via targeted delivery of cytotoxic payloads) as well as basic research through the real-time visualization of RNA expression. The high expression level of many viral transcripts (1) make them excellent candidates for detection using RNA sensors. However, these RNAs are often short and highly structured, meaning they may lack a conformationally exposed trinucleotide motif suitable for linear sensors.
[0170] An example of viral RNAs of clinical interest are the Epstein-Barr virus (EBV)-associated RNAs EBER1 and EBER2. EBV is a common herpesvirus that infects -95% of people worldwide and establishes lifelong latency in B cells. Latent EBV infection has been linked to multiple sclerosis (MS) (2, 3) and other autoimmune diseases. (4) This suggests that eliminating EBV-infected cells could be beneficial. In fact, the efficacy of anti-CD19 CAR-T cell therapy for the treatment of MS (5) and other autoimmune disorders (6, 7) may arise due to depletion of EBV+ B cells. However, these treatments result in complete B-cell loss, whereas an ideal therapy would target only EBV- infected cells. One possible strategy is to target EBV proteins, but this is limited by the absence of viral protein expression during EBV latency type 0 in resting memory B cells, where only the short noncoding RNAs EBER1 and EBER2 are expressed. (8)
[0171] It was envisioned that RADAR sensors designed to deploy a cytotoxic payload in the presence of EBER1 or EBER2 could facilitate the selective elimination of infected B cells. As the first step towards this goal, modulADAR's ability to detect EBER1 and EBER2 was evaluated. These RNAs exemplify the need for sequence-unrestricted sensors, as the two sequences contain only a total of three CCA sites. The EBER1 and EBER2 consensus sequences were tiled (GenBank:Attorney Docket No.: STAN-2220WOStanford No.: S24-311MG021311.120; 167nt and 173nt in length, respectively) with 90nt-long modulADAR sensors at approximately lOnt intervals. A 90nt-long linear sensors was designed around the two CCA sites in EBER1 and the one CCA site in EBER2. These sensors were evaluated in HEK cells by cotransfecting sensor pDNA alongside either control pDNA or pDNA expressing EBER1 / EBER2 transcripts (FIG. 5A, FIG. 5B).
[0172] Between the two EB V-associated RNAs, EBER1 represents the more attractive target due to its longer half-life and consequently higher cellular concentration (approximately 106copies per cell; 9). The assessment revealed that for EBER1, a modulADAR sensor outperformed linear sensors in both absolute signal and signal-to-baseline ratio (FIG. 5A). Conversely, for EBER2, while a linear sensor showed stronger fold-activation, it generated substantially weaker absolute signal than any modulADAR design (FIG. 5B). In the context of an in vivo gene therapy, it was expected that such low signal might be a liability as delivery efficiency would be substantially lower than in the context of transient transfection. The performance of the best performing EBER1 (modulADAR 8) and EBER2 (modulADAR 9) sensors was therefore examined across a range of transfection efficiencies (FIG. 6A and FIG. 6B). While linear sensors exhibit better fold-activation in the most highly transfected cells, they display reduced signals in less transfected cells. In contrast, although modulADAR sensors have less fold-activation in the most highly transfected cells, they outperform linear sensors as transfection efficiency decreases (FIG. 6A and FIG. 6B). The elevated signal of modulADAR is thus more suited than linear RADAR to this potential use case.Methods
[0173] Plasmid design and construction. All plasmids were constructed using standard restrictionligation cloning (Thermo Scientific FastDigest Buffer, cat. no. B64, Thermo Scientific FastDigest Enzymes, Thermo Scientific Rapid DNA Ligation Kit, cat. no. K1423).
[0174] Sensor plasmids are driven by the SFFV promoter as described in previous work. (10) Sensor insert sequences were generated by annealing and phosphorylation (NEB T4 ligation buffer, cat no. B0202S, Thermo Scientific T4 polynucleotide kinase, cat. no. EK0032) of synthetic oligonucleotides (IDT). Sensors often differ from perfect reverse-complementarity to the target RNA by a few point mutations introduced to avoid stop codons. Generally, a small number of point mutations does not appear to affect sensor performance.
[0175] Target plasmids are generally driven by the CMV promoter. EBER1 and 2 target sequences (GenBank: MG021311.120, 6632-6798 and 6959-7131) were expressed under the control of a U6Attorney Docket No.: STAN-2220WOStanford No.: S24-311 promoter, with inserts generated by annealing and phosphorylating synthetic oligonucleotides (IDT). SMN and SCNla sequences were commercially synthesized (Twist). The SMN target plasmids were based on a previously established reporter system, with a single "A" insertion at position 49 of exon 7 differentiating it from the endogenous sequence.27 SCNla sequences were obtained from published work. (11)
[0176] Tissue culture. Cell culture was performed using wild-type HEK293 cells (ATCC CRL-1573) regularly tested for mycoplasma contamination. Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. Growth medium consisted of Dulbecco's Modified Eagle Medium (DMEM, Fisher Scientific cat. no. 501015428) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific cat. no. FB 12999102), 1 mM sodium pyruvate (EMD Millipore cat. no. TMS-005- C), 2 mM L-glutamine (Genesee Scientific cat. no. 25-509), lx penicillin- streptomycin (Genesee Scientific cat. no. 25-512), and lx MEM non-essential amino acids (Genesee Scientific cat. no. 25- 536).
[0177] Transient transfection and flow cytometry. HEK.293 cells were seeded in 24- well plates and maintained until reaching 70-90% confluency. Cells were transfected with jetOPTIMUS DNA transfection reagent (Polyplus cat. no. 117-15) as per manufacturer’s instructions. Per well, 50 ul of jetOPTIMUS buffer, 0.375 pl of JetOptimus reagent, and 500 ng of pDNA was used. A typical experiment used 200 ng of sensor pDNA, 270 ng of target pDNA, and 30 ng of CAG-ADARlpl50 pDNA.
[0178] 48 hours post-transfection, cells were harvested by trypsinization and resuspended in flow buffer (Hank's Balanced Salt Solution (HBSS), IX, without calcium, magnesium, phenol red, cat. no. 95053-196, with 2.5 mg / mL bovine serum albumin). Cells were strained through a 40um nylon mesh (VWR cat. no. 75799-940). Flow cytometry was performed using a Biorad ZE5 Cell Analyzer. Data were analyzed using the cytoflow Python package. Cells were gated for cells, singlets, and highly transfected cells (99.5th to 99.9th percentile mCherry of the lowest-transfected well within an experiment). This gating strategy yields higher baseline activation and lower fold- activation than would be observed when analyzing a wider band of transfected cells (e.g., all mCherry-positive cells). Restricting analysis to highly transfected cells was chosen because it provides a more stringent test of sensor performance, enabling more effective engineering optimization. Due to variations in transfection efficiency, different experiments may be gated slightly differently, making intraexperiment comparisons more reliable than inter-experiment comparisons.Attorney Docket No.: STAN-2220WOStanford No.: S24-311References1. Tycowski, K. T.; Guo, Y. E.; Lee, N.; Moss, W. N.; Vallery, T. K.; Xie, M.; Steitz, J. A., Viral noncoding RNAs: more surprises. Genes Dev 2015, 29 (6), 567-84.2. Lanz, T. V.; Brewer, R. C.; Ho, P. P.; Moon, J. S.; Jude, K. M.; Fernandez, D.; Fernandes, R. A.; Gomez, A. M.; Nadj, G. S.; Bartley, C. M.; Schubert, R. D.; Hawes, I. A.: Vazquez, S. E.: Iyer, M.; Zuchero, J. B.; Teegen, B.; Dunn, J. E.; Lock, C. B.; Kipp, L. B.; Gotham, V. C.; Ueberheide, B. M.; Aftab, B. T.; Anderson, M. S.; DeRisi, J. L.; Wilson, M. R.; Bashf ord-Rogers, R. J. M.; Flatten, M.; Garcia, K. C.: Steinman, L.; Robinson, W. H., Clonally expanded B cells in multiple sclerosis bind EBV EBNA1 and GlialCAM. Nature 2022, 603 (7900), 321-327.3. Bjomevik, K.; Cortese, M.; Healy, B. C.; Kuhle, J.; Mina, M. J.; Leng, Y.; Elledge, S. L; Niebuhr, D. W.; Scher, A. I.; Munger, K. L.; Ascherio, A., Longitudinal analysis reveals high prevalence of Epstein-Barr virus associated with multiple sclerosis. Science 2022, 375 (6578), 296- 301.4. Robinson, W. H.; Younis, S.; Love, Z. Z.; Steinman, L.; Lanz, T. V., Epstein-Barr virus as a potentiator of autoimmune diseases. Nat Rev Rheumatol 2024, 20 (11), 729-740.5. Fischbach, F.; Richter, J.; Pfeffer, L. K.; Fehse, B.; Berger, S. C.; Reinhardt, S.; Kuhle, J.: Badbaran, A.; Rathje, K.; Gagelmann, N.; Borie, D.; Seibel, J.; Ayuk, F_; Friese, M. A.; Heesen, C.; Kroger, N„ CD19-targeted chimeric antigen receptor T cell therapy in two patients with multiple sclerosis. Med 2024, 5 (6), 550-558 e2.6. Mackensen, A.; Muller, F.; Mougiakakos, D.; Boltz, S.; Wilhelm, A.; Aigner, M.; Volkl, S.; Simon, D.; Kleyer, A.; Munoz, L.; Kretschmann, S.; Kharboutli, S.; Gary, R.; Reimann, H.; Rosier, W.; Uderhardt, S.; Bang, H.; Herrmann, M.; Ekici, A. B.; Buettner, C.; Habenicht, K. M.; Winkler, T. H.; Kronke, G.; Schett, G., Anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus. Nat Med 2022, 28 (10), 2124-2132.7. Muller, F.; Taubmann, J.; Bucci, L.; Wilhelm, A.; Bergmann, C.; Volkl, S.; Aigner, M.; Rothe, T.; Minopoulou, I.; Tur, C.; Knitza, J.; Kharboutli, S.; Kretschmann, S.; Vasova, I.; Spoerl, S.; Reimann, H.; Munoz, L.; Gerlach, R. G.; Schafer, S.; Grieshaber-Bouyer, R.; Korganow, A. S.; Farge- Bancel, D.; Mougiakakos, D.; Bozec, A.; Winkler, T.; Kronke, G.; Mackensen, A.; Schett, G., CD19 CAR T-Cell Therapy in Autoimmune Disease - A Case Series with Follow-up. New Engl J Med 2024, 390 (8), 687-700.8. Munz, C., Latency and lytic replication in Epstein-Barr virus-associated oncogenesis. Nat Rev Microbiol 2019, 17 (11), 691-700.Attorney Docket No.: STAN-2220WOStanford No.: S24-3119. Lee, N., The many ways Epstein-Barr virus takes advantage of the RNA tool kit. Rna Biol 2021, 18 (5), 759-76610. Kaseniit, K. E.; Katz, N.; Kolber, N. S.; Call, C. C.; Wengier, D. L.; Cody, W. B.; Sattely, E.S.; Gao X. J., Modular, programmable RNA sensing using ADAR editing in living cells. Nat Biotechnol 2023, 41 (4), 482-487.11. Happ, H. C.; Schneider, P. N.; Hong, J. H.; Goes, E.; Bandouil, M.; Biar, C. G.; Ramamurthy, A.; Reese, F.; Engel, K.; Weckhuysen, S.; Scheffer, I. E.; Mefford, H. C.; Calhoun, J. D.; Carvill, G. L„ Long-read sequencing and profiling of RNA-binding proteins reveals the pathogenic mechanism of aberrant splicing of an SCN1A poison exon in epilepsy. bioRxiv 2023.
[0179] In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
[0180] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and / or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean atAttorney Docket No.: STAN-2220WOStanford No.: S24-311 least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
[0181] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0182] As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
[0183] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill inAttorney Docket No.: STAN-2220WOStanford No.: S24-311 the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
[0184] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Moreover, nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims.
[0185] The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims, 35 U.S.C. § 112(f) or 35 U.S.C. § 112(6) is expressly defined as being invoked for a limitation in the claim only when the exact phrase "means for" or the exact phrase "step for" is recited at the beginning of such limitation in the claim; if such exact phrase is not used in a limitation in the claim, then 35 U.S.C. § 112 (f) or 35 U.S.C. § 112(6) is not invoked.
[0186] Notwithstanding the appended claims, the disclosure set forth herein is also described by the following clauses:
[0187] 1. A method for selectively expressing a product in an EBV-infected cell, the method comprising: contacting an EBV-infected cell with a sensor RNA comprising:(i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA wherein the sensor nucleotide sequence comprises one or more editable codons,(ii) a second nucleotide sequence encoding a first cleavage domain, and(iii) a third nucleotide sequence encoding a product.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0188] 2. The method of clause 1, wherein the target RNA is a non-coding RNA associated with EBV.
[0189] 3. The method of clause 2, wherein the non-coding RNA is associated with EBV latency 0, EBV latency I, EBV latency II, EBV latency III, EBV lytic activation, EBV abortive lytic activation, or any combination thereof.
[0190] 4. The method of clause 3, wherein the non-coding RNA is associated with latency 0 and latency I.
[0191] 5. The method of clauses 3 or 4, wherein the non-coding RNA is selected from the group consisting of: EBER1, EBER2, BART 1, BART 2, BART 3, BART 4, BART 5, BART 6, BART 7, BART 8, BART 9, BART 10, BART 11, BART 12, BART 13, BART 14, BART 15, BART 16, BART 17, BART 18, BART 19, BART 20, BART 21, BART 22, BHRF 1-1, BHRF 1-2, and BHRF 1-3.
[0192] 6. The method of clause 5, wherein the non-coding RNA is EBER1.
[0193] 7. The method of clause 6, wherein the EBER1 has a sequence that is 60% or more identical to SEQ ID NO: 01.
[0194] 8. The method of clause 5, wherein the non-coding RNA is EBER2.
[0195] 9. The method of clause 8, wherein the EBER2 has a sequence that is 60% or more identical to SEQ ID NO: 02.
[0196] 10. The method of clauses 6 or 7, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39.
[0197] 11. The method of clauses 8 or 9, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 30, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46. SEQ ID NO: 47, SEQ ID NO: 48. and SEQ ID NO: 49.
[0198] 12. The method of any of clauses 1-11, wherein the product is a detectable product.
[0199] 13. The method of clause 12, wherein the detectable product is a fluorescent protein or a luminescent proteinAttorney Docket No.: STAN-2220WOStanford No.: S24-311
[0200] 14. The method of clauses 12 or 13, further comprising detecting the detectable product.
[0201] 15. The method of clause 12, wherein the detectable product is a toxic protein or portion thereof.
[0202] 16. The method of clause 15, wherein the toxic protein is selected from the group consisting of tumor necrosis factor alpha (TNFa), Fas ligand (FasL), caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13 or a variant thereof, anthrax toxin subunit A and B, botulinum toxin subunit A and B, cholera toxin subunit A and B, diphtheria toxin subunit A and B, pertussis toxin subunit A and B, Shiga toxin subunit A and B, tetanus toxin subunit A and B; as human neutrophil peptides (HNP) 1-4, human enteric defensins (HD) 5,6; human D-defensins (HBD) 1-3; as granzyme A, granzyme B, granzyme H, granzyme K, granzyme M, hemiasterlin, Pseudomonas exotoxin. Pseudomonas endotoxin, falcarinol, fumonisin Bl, fumonisin B2, afla toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, hefutoxin, calciseptine, taicatoxin, calcicludine, geldanamycin, gelonin, lotaustralin, ocratoxin A, patulin, ricin, strychnine, trichothecene, zearlenone. tetradotoxin, Melittin, Captopril, Chlorotoxin, Conotoxin MI, Exenatide, Bivalirudin, Tirofiban, Apitoxin, Cobrotoxin, Desirudin, Enalapril, Eptifibatide, Lixisenatide, Ziconotide, Vespid chemotactic peptide T, Mastoparan, Protonectin, Hainantoxin, Batroxobin, Apamin, Arenicin-1, Aurelin, Hepcidin, Scygonadin, Hyastatin, Tauramamide, Centrocin lb, Calciseptine, p-EPTX-Nal a, crotamine, and amanitin.
[0203] 17. The method of any of clauses 1-16, wherein the EBV-infected cell is an EBV- infected B-cell or an EBV-infected epithelial cell.
[0204] 18. The method of any of clauses 1-17, wherein the EBV-infected cell is in vitro.
[0205] 19. The method of any of clause 1 -17, wherein the EBV-infected cell is in vivo.
[0206] 20. The method of clause 19, wherein the EBV-infected cell is in a mammal.
[0207] 21. The method of clause 20, wherein the mammal is a human.
[0208] 22. The method of clause 21, wherein the human has or is suspected to have an EBV- associated disease.
[0209] 23. The method of clause 22, wherein the EBV- associated disease is selected from the group consisting of: an EBV-associated autoimmune disease, infectious mononucleosis, an EBV-associated cancer, and oral hairy leukoplakia.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0210] 24. The method of clause 23, wherein the EBV-associated autoimmune disease is selected from the group consisting of multiple sclerosis (MS), systemic lupus erythematosus (SLE), Rheumatoid arthritis (RA), and Sjogren’s syndrome (SS).
[0211] 25. The method of clause 23, wherein the EBV-associated cancer is selected from the group consisting of: Burkitt lymphoma (BL), gastric carcinoma, Hodgkin’s lymphoma (HL), NK / T cell lymphoma (NKTL), nasopharyngeal cancer (NPC), diffused large B cell lymphoma (DLBCL), HIV-associated lymphomas, post-transplant lymphoproliferative disease (PTLD), breast cancer, lymphoepithelial carcinoma of the salivary glands (LECSG). lymphoepithelioma-like carcinoma of the lung (LELC), renal cell carcinoma, thyroid cancer, cervical cancer, and bladder cancer.
[0212] 26. The method of any of clauses 15-25, wherein the third nucleotide sequence comprises a first portion of the toxic protein.
[0213] 27. The method of clause 26, further comprising:(i) a fourth nucleotide sequence comprising a second cleavage domain wherein the fourth nucleotide sequence precedes the first nucleotide sequence and(ii) a fifth nucleotide sequence comprising a nucleotide sequence encoding a second portion of the toxic protein wherein the fifth nucleotide sequence precedes the fourth nucleotide sequence.
[0214] 28. The method of clause 27, wherein the first portion and the second portion of the toxic protein is the A subunit alone or the A subunit and the B subunit of an AB toxin.
[0215] 29. The method of clause 28, wherein wherein the AB toxin is selected from the group consisting of: anthrax toxin, botulinum toxin, cholera toxin, diphtheria toxin, pertussis toxin, pseudomonas endotoxin, pseudomonas exotoxin, shiga toxin, and tetanus toxin.
[0216] 30. The method of any of clauses 27-29, wherein the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, tetanus toxin subunit A, pseudomonas endotoxin subunit A, pseudomonas exotoxin subnit A, a first portion of the anthrax toxin subunit A, a first portion of the botulinum toxin subunit A, a first portion of the cholera toxin subunit A, a first portion of the diphtheria toxin subunit A, a first portion of the pseudomonas endotoxin, a first portion of the pseudomonas exotoxin, a first portion of the pertussis toxin subunit A, a first portion of the shiga toxin subunit A, and a first portion of the tetanus toxin subunit A.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0217] 31. The method of any of clauses 27-30, wherein the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, tetanus toxin subunit B, pseudomonas endotoxin subunit B, pseudomonas exotoxin subunit B, a second portion of the anthrax toxin subunit A, a second portion of the botulinum toxin subunit A, a second portion of the cholera toxin subunit A, a second portion of the diphtheria toxin subunit A, a second portion of the pseudomonas endotoxin, a second portion of the pseudomonas exotoxin, a second portion of the pertussis toxin subunit A, a second portion of the shiga toxin subunit A, and a second portion of the tetanus toxin subunit A.
[0218] 32. The method of any of clauses 27-29, wherein the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, pseudomonas endotoxin subunit B, pseudomonas exotoxin subunit B, and tetanus toxin subunit B.
[0219] 33. The method of clause 20, wherein the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, pseudomonas endotoxin subunit A, pseudomonas exotoxin subunit A, and tetanus toxin subunit A.
[0220] 34. The method of any of clauses 1-33, wherein the editable codon is a stop codon, a start codon, or an AUA codon.
[0221] 35. The method of any of clauses 1-34, wherein the first nucleotide sequence comprises a stem-loop sequence comprising the one or more editable codons and the stemloop sequence does not hybridize to the target RNA.
[0222] 36. The method of any of clauses 1-35, wherein the editable codon comprises one or more bases that are mismatched with a sequence within target RNA opposite the one or more editable codons or the a sequence in the stem-loop opposite the one or more editable codon.
[0223] 37. The method of clauses 35 or 36, wherein the sensor nucleotide sequence comprises:(a) a first region that hybridizes to the target RNA,Attorney Docket No.: STAN-2220WOStanford No.: S24-311(b) a second region comprising a stem-loop sequence comprising one or more editable codons wherein a first portion of the stem-loop sequence hybridizes to the first region or the third region in the absence of the target RNA, and(c) a third region that hybridizes to the target RNA
[0224] 38. The method of clause 37, wherein the first portion of the stem-loop sequence hybridizes to the first region.
[0225] 39. The method of clause 37, wherein the first portion of the stem-loop sequence hybridizes to the third region.
[0226] 40. The method of any of clauses 37-39, wherein the first region is 5’ of the second region and the second region is 5’ of the third region.
[0227] 41. The method of clause 40, wherein a second portion of the stem-loop sequence hybridizes to the third region in the absence of the target RNA.
[0228] 42. The method of clause 41, wherein a second portion of the stem-loop sequence hybridizes to the first region in the absence of the target RNA.
[0229] 43. The method of any of clauses 37-42, wherein the stem-loop sequence comprises a stem-sequence and a loop sequence.
[0230] 44. The method of clause 43, wherein the first portion of the stem-loop sequence is contained in the loop sequence of the stem-loop sequence.
[0231] 45. The method of clauses 43 or 44, wherein the second portion of the stem-loop sequence is contained in the loop sequence of the stem-loop sequence.
[0232] 46. The method of any of clauses 1-44, wherein the sensor RNA further comprises a5’ UTR 5’ to the first nucleotide sequence or the fifth nucleotide sequence and a 3’ UTR 3’ of the third nucleotide sequence.
[0233] 47. The method of clause 46, wherein the 5’ UTR and the 3’ UTR are selected from the group consisting of: aHs Pegl O 5’ and 3’ UTR, a mmPeglO 5’ and 3’ UTR, a HsPNMAl 5’ and 3’ UTR, a mmPNMAl 5’ and 3’ UTR, a HsPNMA3 5’ and 3’ UTR, a mmPNMA3 5’ and 3’ UTR. a HsMAOPl 5’ and 3’ UTR. a mmMAOPl 5’ and 3’ UTR, a HsPNMA5 5’ and 3’ UTR, a mmPNMA5 5’ and 3’ UTR, a HsRTLl 5’ and 3’ UTR, a mmRTLl 5’ and 3’ UTR, a HsZCCHC12 5’ and 3’ UTR, ammZCCHC125’ and 3’ UTR, a HsASPRVl 5’ and 3’ UTR, a mmADPRVl 5’ and 3’ UTR, a HsARCl 5’ and 3’ UTR, and a mmARCl 5’ and 3’ UTR..
[0234] 48. The method of any of clauses 1-47, wherein the cleavage domain is a 2 A self- cleaving domain.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0235] 49. The method of clause 48, wherein the 2A self-cleaving domain is selected from the group of T2A, P2A, E2A, and F2A.
[0236] 50. The method of any of clauses 1-49, wherein the stem-loop sequence or the first nucleotide sequence comprises one or more stop codons that are out of frame of the editable codon.
[0237] 51. The method of any of clauses 1-50, wherein the sensor RNA comprises one or more pseudouridines and the sensor nucleotide sequence does not comprise pseudouridines.
[0238] 52. The method of any of clauses 1-51, wherein contacting with the EBV-infected cell comprises contacting the EBV-infected cell with a lipid nanoparticle comprising the sensor RNA.
[0239] 53. The method of clause 52, wherein the lipid nanoparticle comprises a targeting moiety.
[0240] 54. The method of clause 53, wherein the targeting moiety is selected from the group consisting of: an antibody or fragment thereof, a nanobody, an scFv, a protein, an aptmer, a nucleic acid, a lipid, and a small molecule.
[0241] 55. The method of clause 54, wherein the targeting moiety binds to a surface antigen selected from the group consisting of: CD19, CD20, CD22, CD27, CD30, CD32B, CD40, CD45, CD52 CD80, CD86, CD69, CD95, CD267, CD269, CD268, A33, ACE / CD143, ALCAM / CD166, Aminopeptidase B / RNPEP, Aminopeptidase Inhibitors, Aminopeptidase N / CD13, Amnionless, B7-H2, B7-H3, CA125 / MUC16, CA15-3 / MUC-1, E-Cadherin, CDla, CDld, CDldl, CD46, CD74, CEACAM-l / CD66a, CEACAM-3 / CD66d, CEACAM-4, CEACAM-5 / CD66e, CEACAM-6 / CD66c, CEACAM-7, Collagen I, CTRP5 / ClqTNF5, Cubilin, DDR1, DDR1 / DDR2, beta-Defensin 2, beta-Defensin 3, alpha-Defensin 1, alpha- Defensin 5, Endorepellin / Perlecan, EpCAM / TROPl, Fas Ligand / TNFSF6, Gastrokine 1, HIN-1 / SCGB3A1 , Hyaluronan, IGSF4C / SynCAM4, Integrin alpha 4 / CD49d, Tntegrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-l, JAM- A, JAM-B / VE-JAM, JAM-C, L1CAM, Laminin-1, MFG-E8. MSPR / Ron, MUC-1, MUC-19, MUC-4, Nectin-1. Nectin-2 / CD112. Nectin-3, Nectin-4, Nidogen-l / Entactin, Occludin, PD-L1 / B7-H1, PLET-1, P1GF, Prostasin / Prss8, SLURP2, TfR (Transferrin R), and UGRP1 / SCGB3A2.
[0242] 56. The method of clauses 1-55, wherein contacting with the EBV-infected cell comprises contacting the EBV-infected cell with an adeno-associated virus (AAV) comprising the sensor RNA wherein the sensor RNA is contained in an AAV vector.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0243] 57. The method of any of clauses 1-55, wherein contacting with the EBV-infected cell comprises transfecting the EBV-infected cell with a recombinant vector comprising the sensor RNA.
[0244] 58. The method of clause 57, wherein the recombinant vector is selected from the group of a plasmid, a viral vector, a cosmid, and an artificial chromosome.
[0245] 59. The method of any of clauses 1-58, further comprising contacting the EBV- infected cell with an adenosine deaminase acting on RNA (ADAR) protein or a coding sequence thereof.
[0246] 60. The method of any of clauses 1-59, wherein the sensor nucleotide sequence hybridizes to two or more non-contiguous sequences within a single target RNA.
[0247] 61. The method of any of clauses 1-59, wherein the sensor nucleotide sequence hybridizes to two or more distinct target RNAs.
[0248] 62. The method of any of clauses 1-61, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that hybridizes to a second target RNA wherein the sequences of the first and second target RNAs are different.
[0249] 63. The method of clause 62, wherein the first and second target RNAs are EBER1 and EBER2.
[0250] 64. A method for treating a subject suffering from or suspected to suffer from anEpstein-Barr Virus (EBV)-associated disease, the method comprising: administering to the subject an effective dose a sensor RNA comprising:(i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA wherein the sensor nucleotide sequence comprises one or more editable codons,(ii) a second nucleotide sequence encoding a first cleavage domain, and(iii) a third nucleotide sequence encoding a toxic protein or portion thereof.
[0251] 65. The method of clause 64, wherein the subject is a mammal.
[0252] 66. The method of clause 65, wherein the mammal is a human.
[0253] 67. The method of any of clauses 64-66, wherein the EBV-associated disease is selected from the group consisting of: an EBV-associated autoimmune disease, infectious mononucleosis, an EBV-associated cancer, and oral hairy leukoplakia.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0254] 68. The method of clause 67, wherein the EBV-associated autoimmune disease is selected from the group consisting of multiple sclerosis (MS), systemic lupus erythematosus (SLE), Rheumatoid arthritis (RA), and Sjogren’s syndrome (SS).
[0255] 69. The method of clause 67, wherein the EBV-associated cancer is selected from the group consisting of: Burkitt lymphoma (BL), gastric carcinoma, Hodgkin’s lymphoma (HL), NK / T cell lymphoma (NKTL), nasopharyngeal cancer (NPC), diffused large B cell lymphoma (DLBCL), HIV-associated lymphomas, post-transplant lymphoproliferative disease (PTLD), breast cancer, lymphoepithelial carcinoma of the salivary glands (LECSG). lymphoepithelioma-like carcinoma of the lung (LELC), renal cell carcinoma, thyroid cancer, cervical cancer, and bladder cancer.
[0256] 70. The method of any of clauses 64-69, further comprising screening the subject forEBV-infected cells prior to the administering.
[0257] 71. The method of clause 70. wherein the subject is determined to have EBV-infected cells wherein the EBV-infected cells contain the target RNA.
[0258] 72. The method of clause 70, wherein the EBV-infected cells are selected from the group consisting of: EBV-infected B-cells, EBV-infected epithelial cells, and a combination thereof.
[0259] 73. The method of clauses 71 or 72, wherein the administering results in a reduction in the number of EBV-infected cells.
[0260] 74. The method of any of clauses 64-73, wherein the administering results in a delay, arrest, or regression of symptoms associated with the EBV-associated disease.
[0261] 75. The method of any of clauses 64-74, wherein the target RNA is a non-coding RNA associated with EBV.
[0262] 76. The method any of clauses 64-75, wherein the non-coding RNA is associated withEBV latency 0, EBV latency T, EBV latency II, EBV latency III, EBV lytic activation, EBV abortive lytic activation, or any combination thereof.
[0263] 77. The method of clause 76, wherein the non-coding RNA is associated with latency0 and latency I.
[0264] 78. The method of any of clauses 75-77, wherein the non-coding RNA is selected from the group consisting of: EBERL EBER2, BART 1, BART 2, BART 3, BART 4, BART 5, BART 6, BART 7, BART 8, BART 9, BART 10, BART 11, BART 12, BART 13, BARTAttorney Docket No.: STAN-2220WOStanford No.: S24-31114, BART 15, BART 16, BART 17, BART 18, BART 19, BART 20, BART 21, BART 22, BHRF 1-1, BHRF 1-2, and BHRF 1-3.
[0265] 79. The method of clause 78, wherein the non-coding RNA is EBERL
[0266] 80. The method of clause 79, wherein the EBER1 has a sequence that is 60% or more identical to SEQ ID NO: 01.
[0267] 81. The method of clause 78, wherein the non-coding RNA is EBER2.
[0268] 82. The method of clause 81, wherein the EBER2 has a sequence that is 60% or more identical to SEQ ID NO: 02.
[0269] 83. The method of clauses 79 or 80, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39.
[0270] 84. The method of clauses 81 or 82, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 30, SEQ ID NO: 40. SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43. SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49
[0271] 85. The method of any of clauses 64-84, wherein the toxic protein is selected from the group consisting of tumor necrosis factor alpha (TNFa), Fas ligand (FasL), caspase 1, caspase 2. caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13 or a variant thereof, anthrax toxin subunit A and B, botulinum toxin subunit A and B, cholera toxin subunit A and B, diphtheria toxin subunit A and B, pertussis toxin subunit A and B, Shiga toxin subunit A and B, tetanus toxin subunit A and B; as human neutrophil peptides (HNP) 1-4, human enteric defensins (HD) 5,6; human [3- defensins (HBD) 1-3; as granzyme A, granzyme B, granzyme H, granzyme K, granzyme M, hemiasterlin, Pseudomonas exotoxin, Pseudomonas endotoxin, falcarinol, fumonisin Bl, fumonisin B2, afla toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, hefutoxin, calciseptine, taicatoxin, calcicludine, geldanamycin, gelonin, lotaustralin, ocratoxin A, patulin, ricin, strychnine, trichothecene, zearlenone, tetradotoxin, Melittin, Captopril, Chlorotoxin, Conotoxin MI, Exenatide, Bivalirudin, Tirofiban, Apitoxin, Cobrotoxin, Desirudin, Enalapril, Eptifibatide, Lixisenatide, Ziconotide, Vespid chemotacticAttorney Docket No.: STAN-2220WOStanford No.: S24-311 peptide T, Mastoparan, Protonectin, Hainantoxin, Batroxobin, Apamin, Arenicin-1, Aurelin, Hepcidin, Scygonadin, Hyastatin, Tauramamide, Centrocin lb, Calciseptine, p-EPTX-Nala. crotamine, and amanitin.
[0272] 86. The method of any of clauses 64-85, wherein the third nucleotide sequence comprises a first portion of the toxic protein.
[0273] 87. The method of clause 86, further comprising:(i) a fourth nucleotide sequence comprising a second cleavage domain wherein the fourth nucleotide sequence precedes the first nucleotide sequence and(ii) a fifth nucleotide sequence comprising a nucleotide sequence encoding a second portion of the toxic protein wherein the fifth nucleotide sequence precedes the fourth nucleotide sequence.
[0274] 88. The method of clause 87, wherein the first portion and the second portion of the toxic protein is the A subunit alone or the A subunit and the B subunit of an AB toxin.
[0275] 89. The method of clause 88, wherein the AB toxin is selected from the group consisting of: anthrax toxin, botulinum toxin, cholera toxin, diphtheria toxin, pertussis toxin, pseudomonas endotoxin, pseudomonas exotoxin, shiga toxin, and tetanus toxin.
[0276] 90. The method of any of clauses 87-89, wherein the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, tetanus toxin subunit A, pseudomonas endotoxin subunit A, pseudomonas exotoxin A, a first portion of the anthrax toxin subunit A, a first portion of the botulinum toxin subunit A, a first portion of the cholera toxin subunit A, a first portion of the diphtheria toxin subunitA, a first portion of the pseudomonas endotoxin, a first portion of the pseudomonas exotoxin, a first portion of the pertussis toxin subunit A, a first portion of the shiga toxin subunit A, and a first portion of the tetanus toxin subunit A.
[0277] 91. The method of any of clauses 87-90, wherein the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, tetanus toxin subunit B, pseudomonas endotoxin subunit B, pseudomonas exotoxinB, a second portion of the anthrax toxin subunit A, a second portion of the botulinum toxin subunit A, a second portion of the cholera toxin subunit A, a second portion of the diphtheria toxin subunit A, a second portion of the pseudomonas endotoxin, a second portion of theAttorney Docket No.: STAN-2220WOStanford No.: S24-311 pseudomonas exotoxin, a second portion of the pertussis toxin subunit A, a second portion of the shiga toxin subunit A, and a second portion of the tetanus toxin subunit A.
[0278] 92. The method of any of clauses 87-91, wherein the first portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit B, botulinum toxin subunit B, cholera toxin subunit B, diphtheria toxin subunit B, pertussis toxin subunit B, shiga toxin subunit B, pseudomonas endotoxin subunit B, pseudomonas exotoxin B, and tetanus toxin subunit B.
[0279] 93. The method of clause 92, wherein the second portion of the toxic protein is selected from the group consisting of: anthrax toxin subunit A, botulinum toxin subunit A, cholera toxin subunit A, diphtheria toxin subunit A, pertussis toxin subunit A, shiga toxin subunit A, pseudomonas endotoxin subunit A, pseudomonas exotoxin A, and tetanus toxin subunit A.
[0280] 94. The method of any of clauses 64-93, wherein the editable codon is a stop codon, a start codon, or an AUA codon.
[0281] 95. The method of any of clauses 64-94, wherein the first nucleotide sequence comprises a stem-loop sequence comprising the one or more editable codons and the stemloop sequence does not hybridize to the target RNA.
[0282] 96. The method of any of clauses 64-95, wherein the editable codon comprises one or more bases that are mismatched with a sequence within target RNA opposite the one or more editable codons or the a sequence in the stem-loop opposite the one or more editable codon.
[0283] 97. The method of clauses 95 or 96, wherein the sensor nucleotide sequence comprises:(a) a first region that hybridizes to the target RNA,(b) a second region comprising a stem-loop sequence comprising one or more editable codons wherein a first portion of the stem-loop sequence hybridizes to the first region or the third region in the absence of the target RNA, and(c) a third region that hybridizes to the target RNA.
[0284] 98. The method of clause 97, wherein the first portion of the stem-loop sequence hybridizes to the first region.
[0285] 99. The method of clause 97, wherein the first portion of the stem-loop sequence hybridizes to the third region.
[0286] 100. The method of any of clauses 97-99, wherein the first region is 5’ of the second region and the second region is 5’ of the third region.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0287] 101. The method of clause 98, wherein a second portion of the stem-loop sequence hybridizes to the third region in the absence of the target RNA.
[0288] 102. The method of clause 99, wherein a second portion of the stem-loop sequence hybridizes to the first region in the absence of the target RNA.
[0289] 103. The method of any of clauses 97-102, wherein the stem-loop sequence comprises a stem-sequence and a loop sequence.
[0290] 104. The method of clause 103, wherein the first portion of the stem-loop sequence is contained in the loop sequence of the stem-loop sequence.
[0291] 105. The method of clauses 103 or 104, wherein the second portion of the stem-loop sequence is contained in the loop sequence of the stem-loop sequence.
[0292] 106. The method of any of clauses 64-105, wherein the sensor RNA further comprises a 5’ UTR 5’ to the first nucleotide sequence or the fifth nucleotide sequence and a 3’ UTR 3’ of the third nucleotide sequence.
[0293] 107. The method of clause 106, wherein the 5’ UTR and the 3’ UTR are selected from the group consisting of: a Els PeglO 5’ and 3’ UTR, a mmPeglO 5’ and 3’ UTR, a HsPNMAl 5’ and 3’ UTR, a mmPNMAl 5’ and 3’ UTR, a HsPNMA3 5’ and 3’ UTR, a mmPNMA3 5’ and 3’ UTR, a HsMAOPl 5’ and 3’ UTR, a mmMAOPl 5’ and 3’ UTR, a HsPNMA5 5’ and 3’ UTR, a mmPNMA5 5’ and 3’ UTR, a HsRTLl 5’ and 3’ UTR, a mmRTLl 5’ and 3’ UTR, a HsZCCHC12 5’ and 3’ UTR. a mmZCCHC125’ and 3’ UTR, a HsASPRVl 5’ and 3’ UTR. a mmADPRVl 5’ and 3’ UTR, a HsARCl 5’ and 3’ UTR, and a mmARCl 5’ and 3’ UTR..
[0294] 108. The method of any of clauses 64-107, wherein the cleavage domain is a 2A selfcleaving domain.
[0295] 109. The method of clause 108, wherein the 2A self-cleaving domain is selected from the group of T2A, P2A. E2A, and F2A.
[0296] 1 10. The method of any of clauses 64- 109, wherein the stem-loop sequence or the first nucleotide sequence comprises one or more stop codons that are out of frame of the editable codon.
[0297] 111. The method of any of clauses 64- 110, wherein the sensor RNA comprises one or more pseudouridines and the sensor nucleotide sequence does not comprise pseudouridines.
[0298] 112. The method of any of clauses 64-111, wherein the administering comprises contacting the EBV-infected cell with a lipid nanoparticle comprising the sensor RNA.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0299] 113. The method of clause 112, wherein the lipid nanoparticle comprises a targeting moiety.
[0300] 114. The method of clause 113, wherein the targeting moiety is selected from the group consisting of: an antibody or fragment thereof, a nanobody, an scFv, a protein, an aptmer, a nucleic acid, a lipid, and a small molecule.
[0301] 115. The method of clause 114, wherein the targeting moiety binds to a surface antigen selected from the group consisting of: CD19, CD20, CD22, CD27, CD30, CD32B, CD40, CD45, CD52 CD80. CD86. CD69, CD95, CD267, CD269, CD268, A33, ACE / CD143, ALCAM / CD166, Aminopeptidase B / RNPEP, Aminopeptidase Inhibitors, Aminopeptidase N / CD13, Amnionless, B7-H2, B7-H3, CA125 / MUC16, CA15-3 / MUC-1, E-Cadherin, CDla, CDld, CDldl, CD46, CD74, CEACAM-l / CD66a, CEACAM-3 / CD66d, CEACAM-4, CEACAM-5 / CD66e, CEACAM-6 / CD66c, CEACAM-7, Collagen I, CTRP5 / ClqTNF5, Cubilin, DDR1, DDR1 / DDR2, beta-Defensin 2, beta-Defensin 3, alpha-Defensin 1, alpha- Defensin 5, Endorepellin / Perlecan, EpCAM / TROPl, Fas Ligand / TNFSF6, Gastrokine 1, HIN-1 / SCGB3A1, Hyaluronan, IGSF4C / SynCAM4, Integrin alpha 4 / CD49d, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-l, J AM- A. JAM-B / VE-JAM, JAM-C, LI CAM. Laminin-1, MFG-E8, MSPR / Ron, MUC-1, MUC-19, MUC-4, Nectin-1, Nectin-2 / CD112, Nectin-3, Nectin-4, Nidogen-l / Entactin, Occludin, PD-L1 / B7-H1, PLET-1, P1GF, Prostasin / Prss8, SLURP2, TfR (Transferrin R). and UGRP1 / SCGB3A2.
[0302] 116. The method of clauses 64-115, wherein the administering comprises contacting the EBV-infected cell with an adeno-associated virus (AAV) comprising the sensor RNA wherein the sensor RNA is contained in an AAV vector.
[0303] 117. The method of any of clauses 64-115, wherein the administering comprises transfecting the EBV-infected cell with a recombinant vector comprising the sensor RNA.
[0304] 1 18. The method of clause 117, wherein the recombinant vector is selected from the group of a plasmid, a viral vector, a cosmid, and an artificial chromosome.
[0305] 119. The method of any of clauses 64-118, further comprising combining the EBV- infected cell with an adenosine deaminase acting on RNA (ADAR) protein or a coding sequence thereof.
[0306] 120. The method of any of clauses 64-119, wherein the sensor nucleotide sequence hybridizes to two or more non-contiguous sequences within a single target RNA.Attorney Docket No.: STAN-2220WOStanford No.: S24-311
[0307] 121. The method of any of clauses 64-120, wherein the sensor nucleotide sequence is hybridizes to two or more distinct target RNAs.
[0308] 122. The method of any of clauses 64-121, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that hybridizes to a second target RNA wherein the sequences of the first and second target RNAs are different.
[0309] 123. The method of clause 122, wherein the first and second target RNAs are EBER1 and EBER2.
[0310] 124. A nucleic acid comprising the sensor RNA of any of clauses 1-123.
[0311] 125. A recombinant expression vector comprising the sensor RNA of any of clauses1-123.
[0312] 126. The recombinant expression vector of clause 125, wherein the wherein the recombinant vector is selected from the group of a plasmid, a viral vector, a cosmid, and an artificial chromosome.
[0313] 127. The recombinant expression vector of clause 126, wherein the viral vector is anAAV vector.
[0314] 128. The recombinant expression vector of any of clauses 125-127, further comprising a sequence encoding an ADAR protein.
[0315] 129. A kit comprising the sensor RNA of any of clauses 1-123.
[0316] 130. The kit of clause 129, further comprising an ADAR protein or a coding sequence thereof.
[0317] 131. The kit of clauses 129 or 130, further comprising a biological sample with the target RNA and a biological sample without the target RNA.
[0318] 132. The kit of any of clauses 129-131, wherein the sensor RNA is contained in a lipid nanoparticle.
[0319] 133. The kit of any of clauses 129-132, wherein the ADAR protein or coding sequence thereof is contained in a lipid nanoparticle.
Claims
Attorney Docket No.: STAN-2220WO Stanford No.: S24-311WHAT IS CLAIMED IS:
1. A method for selectively expressing a product in an EBV-infected cell, the method comprising: contacting an EBV-infected cell with a sensor RNA comprising:(i) a first nucleotide sequence comprising a sensor nucleotide sequence that hybridizes to a target RNA wherein the sensor nucleotide sequence comprises one or more editable codons,(ii) a second nucleotide sequence encoding a first cleavage domain, and(iii) a third nucleotide sequence encoding a product.
2. The method of claim 1, wherein the target RNA is a non-coding RNA associated with EBV and the non-coding RNA is associated with EBV latency 0, EBV latency I, EBV latency II, EBV latency III, EBV lytic activation, EBV abortive lytic activation, or any combination thereof.
3. The method of claim 2, wherein the non-coding RNA is selected from the group consisting of: EBER1, EBER2, BART 1, BART 2, BART 3, BART 4, BART 5, BART 6, BART 7, BART 8, BART 9, BART 10, BART 11, BART 12, BART 13, BART 14, BART 15, BART 16, BART 17, BART 18, BART 19, BART 20, BART 21. BART 22. BHRF 1-1, BHRF 1-2, and BHRF 1-3.
4. The method of claim 3, wherein the non-coding RNA is EBER1.
5. The method of claim 3, wherein the non-coding RNA is EBER2.
6. The method of claim 4, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:
31. SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO:
35. SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39.
7. The method of claim 5, wherein the sensor nucleotide sequence comprises a sequence that is at least 60% identical to a sequence selected from the group consisting of: SEQ ID NO: 30, SEQAttorney Docket No.: STAN-2220WOStanford No.: S24-311ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49.
8. The method of any of claims 1-7, wherein the product is a toxic protein or portion thereof.
9. The method of claim 8, wherein the toxic protein is selected from the group consisting of tumor necrosis factor alpha (TNFa), Fas ligand (FasL), caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9. caspase 10, caspase 11, caspase 12, caspase 13 or a variant thereof, anthrax toxin subunit A and B, botulinum toxin subunit A and B, cholera toxin subunit A and B, diphtheria toxin subunit A and B, pertussis toxin subunit A and B, Shiga toxin subunit A and B, tetanus toxin subunit A and B; as human neutrophil peptides (HNP) 1-4, human enteric defensins (HD) 5,6; human P-defensins (HBD) 1-3; as granzyme A, granzyme B, granzyme H, granzyme K, granzyme M, hemiasterlin. Pseudomonas exotoxin. Pseudomonas endotoxin, falcarinol, fumonisin Bl, fumonisin B2, afla toxin, maurotoxin, agitoxin, charybdotoxin, margatoxin, slotoxin, scyllatoxin, hefutoxin, calciseptine, taicatoxin, calcicludine, geldanamycin, gelonin, lotaustralin, ocratoxin A, patulin, ricin, strychnine, trichothecene. zearlenone, tetradotoxin, Melittin, Captopril, Chlorotoxin, Conotoxin MI, Exenatide, Bivalirudin, Tirofiban, Apitoxin, Cobrotoxin, Desirudin, Enalapril, Eptifibatide, Lixisenatide, Ziconotide, Vespid chemotactic peptide T, Mastoparan, Protonectin, Hainantoxin, Batroxobin, Apamin, Arenicin-1, Aurelin, Hepcidin, Scygonadin, Hyastatin, Tauramamide, Centrocin lb, Calciseptine, p-EPTX-Nala, crotamine, and amanitin.
10. The method of any of claims 1-9, wherein the EBV-infected cell is in vitro.
11. The method of any of claim 1-9, wherein the EBV-infected cell is in vivo.
12. The method of any of claims 1- 11, wherein the subject is a human who has or is suspected to have an EBV-associated disease.
13. The method of claim 12, wherein the EBV-associated disease is selected from the group consisting of: an EBV-associated autoimmune disease, infectious mononucleosis, an EBV-associated cancer, and oral hairy leukoplakia.Attorney Docket No.: STAN-2220WOStanford No.: S24-31114. The method of any of claims 8-13, wherein the third nucleotide sequence comprises a first portion of the toxic protein.
15. The method of claim 14, further comprising:(i) a fourth nucleotide sequence comprising a second cleavage domain wherein the fourth nucleotide sequence precedes the first nucleotide sequence and(ii) a fifth nucleotide sequence comprising a nucleotide sequence encoding a second portion of the toxic protein wherein the fifth nucleotide sequence precedes the fourth nucleotide sequence.
16. The method of claim 15, wherein the first portion and the second portion of the toxic protein is the A subunit alone or the A subunit and the B subunit of an AB toxin and the AB toxin is selected from the group consisting of: anthrax toxin, botulinum toxin, cholera toxin, diphtheria toxin, pertussis toxin, pseudomonas endotoxin, pseudomonas exotoxin, shiga toxin, and tetanus toxin.
17. The method of any of claims 1-16, wherein the first nucleotide sequence comprises a stemloop sequence comprising the one or more editable codons and the stem-loop sequence does not hybridize to the target RNA.
18. The method of any of claims 1-17, wherein contacting with the EBV-infected cell comprises contacting the EBV-infected cell with a lipid nanoparticle comprising the sensor RNA.
19. The method of claim 18, wherein the lipid nanoparticle comprises a targeting moiety and the targeting moiety is selected from the group consisting of: an antibody or fragment thereof, a nanobody, an scFv, a protein, an aptmer, a nucleic acid, a lipid, and a small molecule.
20. The method of claim 19, wherein the targeting moiety binds to a surface antigen selected from the group consisting of: CD19, CD20, CD22, CD27, CD30, CD32B, CD40, CD45, CD52 CD80, CD86, CD69, CD95, CD267, CD269, CD268. A33. ACE / CD143. ALCAM / CD166. Aminopeptidase B / RNPEP, Aminopeptidase Inhibitors, Aminopeptidase N / CD13, Amnionless, B7- H2, B7-H3, CA125 / MUC16, CA15-3 / MUC-1, E-Cadherin, CDla, CDld, CDldl, CD46, CD74.Attorney Docket No.: STAN-2220WOStanford No.: S24-311CEACAM-l / CD66a, CEACAM-3 / CD66d, CEACAM-4, CEACAM-5 / CD66e, CEACAM-6 / CD66c, CEACAM-7, Collagen I, CTRP5 / ClqTNF5, Cubilin, DDR1, DDR1 / DDR2, beta-Defensin 2, beta- Defensin 3, alpha-Defensin 1, alpha-Defensin 5, Endorepellin / Perlecan, EpCAM / TROPl, Fas Ligand / TNFSF6, Gastrokine 1, HIN-1 / SCGB3A1, Hyaluronan, IGSF4C / SynCAM4, Integrin alpha 4 / CD49d, Integrin alpha 4 beta 1, Integrin alpha 4 beta 7 / LPAM-l, JAM-A, JAM-B / VE-JAM, JAM- C, L1CAM, Laminin-1, MFG-E8, MSPR / Ron, MUC-1, MUC-19, MUC-4, Nectin-1, Nectin- 2 / CD112, Nectin-3, Nectin-4, Nidogen-l / Entactin, Occludin, PD-L1 / B7-H1, PLET-1, P1GF, Prostasin / Prss8, SLURP2, TfR (Transferrin R), and UGRP1 / SCGB3A2.
Citation Information
Patent Citations
EBV markers and systemic lupus erythematosus
WO2014025254A1
RNA sensors in living cells utilizing ADAR editing for sense-response applications
WO2023164630A1