Nucleic acid regulatory elements and methods of using

Nucleic acid regulatory elements (NAREs) with tailored sequences address gene therapy challenges by enhancing expression control, reducing immune responses, and enabling efficient packaging, thus improving gene therapy safety and efficacy.

WO2026087411A1PCT designated stage Publication Date: 2026-04-30MEIRAGTX GENE REGULATION LTD
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MEIRAGTX GENE REGULATION LTD
Filing Date
2025-10-20
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Existing gene therapies face challenges in achieving tailored gene expression levels, tissue-specific expression, reducing immune responses, efficient packaging of larger transgene cargo, and controlling the kinetics of gene expression, which are not adequately addressed by current nucleic acid regulatory elements (NAREs).

Method used

Development of nucleic acid regulatory elements (NAREs) with specific sequences and modifications that enhance expression in tissues like muscle, neurons, and liver, allowing for tailored expression levels, tissue-specific targeting, reduced vector amounts, and controlled kinetics, while enabling efficient packaging into viral vectors.

Benefits of technology

The NAREs provide enhanced gene expression control, reduce immune responses, and facilitate persistent expression in target tissues, thereby improving the safety and efficacy of gene therapy by optimizing vector use and minimizing unwanted expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025080161_30042026_PF_FP_ABST
    Figure EP2025080161_30042026_PF_FP_ABST
Patent Text Reader

Abstract

The application relates to nucleic acid regulatory elements (NAREs) that are able to enhance expression of operably linked genes. The application further relates to methods employing NAREs and uses of the NAREs. Expression cassettes and vectors containing NAREs are also disclosed. These are particularly useful for applications using gene therapy.
Need to check novelty before this filing date? Find Prior Art

Description

NUCLEIC ACID REGULATORY ELEMENTS AND METHODS OF USINGCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This International Patent Application claims priority to U.S. Provisional Application No. 63 / 709,893, filed on October 21, 2024, which is hereby incorporated by reference in its entirety.REFERENCE TO A SEQUENCE LISTING

[0002] This application contains a Sequence Listing, which has been submitted electronically in xml format and is hereby incorporated by reference in its entirety. Said xml copy, created on October 14, 2025, is named SeqList-162027-54676.xml and is 174,837 bytes in size.FIELD

[0003] The application relates to nucleic acid regulatory elements that are able to enhance expression of genes in a variety of tissues. The application further relates to methods employing these regulatory elements and uses of these elements. Expression cassettes and vectors containing these nucleic acid regulatory elements are also disclosed. These are particularly useful for applications using gene therapy.BACKGROUND

[0004] A promoter is a DNA region at which transcription of a gene is initiated. Since the promoter region controls when and where a gene of interest is expressed in an organism, promoters are important elements for regulating the level and specificity of transgene expression, particularly in the context of gene therapy.

[0005] The use of engineered nucleic acid regulatory elements (NAREs) (that may include various components, including promoters, enhancers, etc.) that are particularly tailored to a given gene therapy provides a variety of benefits. To start, an optimized NARE allows tailoring levels of gene expression for a specific therapeutic gene. Second, engineered NAREs with increased potency allow administration of smaller amounts of gene therapy vector, thus decreasing immune responses and associated safety risks. Third, for some gene therapies, it is desirable that gene expression is limited to a specific tissue or tissues. Accordingly, use of nucleic acid regulatory elements with tissue-specific expression can restrict unwanted transgene expression as well as facilitate persistent transgene expression in the tissue(s) or interest. Such tissue-specific NAREs can also be used to eliminate the need for tissue-specificviral capsids used for gene delivery (or can be used in combination with tissue-specific viral capsids). Fourth, choosing an appropriate NARE can also provide control of the kinetics of gene expression, which in turn impact durability of gene therapy. Finally, it can be desirable to engineer NAREs with a reduced size (without sacrificing strength or specificity) to allow for efficient packaging of larger transgene cargo into viral vectors.

[0006] Accordingly, new NAREs for the expression of transgenes, particularly in the muscle, neurons, and / or liver, are urgently needed.SUMMARY

[0007] Provided herein are nucleic acid regulatory elements (NAREs) for the expression of transgenes in a cell, tissue, and / or organism. Also provided are nucleic acid constructs, vectors, pharmaceutical compositions, and cells comprising such NAREs as well as methods of using said, NAREs, nucleic acid constructs, vectors, pharmaceutical compositions, and cells.

[0008] Provided is a NARE comprising:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146; (b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 and a sequence that is at least 80% identical, at least85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11 ;(h) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:40 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11 ;(y) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55 and a sequence that is at least 80% identical, at least85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0009] In some embodiments, the NARE comprises:(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to one any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO: 1 and a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO:3 and a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO:5 and a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO:4 and a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO:8 and a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 13;(i) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 15 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0010] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) SEQ ID NO:1 and SEQ ID NO:2;(c) SEQ ID NO:3 and SEQ ID NO:4;(d) SEQ ID NO:5 and SEQ ID NO:6;(e) SEQ ID NO:4 and SEQ ID NO:6;(f) SEQ ID NO:8 and SEQ ID NO:9;(g) SEQ ID NQ:10 and SEQ ID NO:11;(h) SEQ ID NO:12 and SEQ ID NO:13;(i) SEQ ID NO:15 and SEQ ID NO:2;G) SEQ ID NO:16 and SEQ ID NO:17;(k) SEQ ID NO:24 and SEQ ID NO:17;(l) SEQ ID NO:26 and SEQ ID NO:27;(m) SEQ ID NO:28 and SEQ ID NO:29;(n) SEQ ID NQ:30 and SEQ ID NO:31 ;(o) SEQ ID NO:32 and SEQ ID NO:33;(p) SEQ ID NO:34 and SEQ ID NO:17;(q) SEQ ID NO:35 and SEQ ID NO:36;(r) SEQ ID NO:37 and SEQ ID NO:17;(s) SEQ ID NO:39 and SEQ ID NO:33;(t) SEQ ID NQ:40 and SEQ ID NO:36;(u) SEQ ID NO:41 and SEQ ID NO:17;(v) SEQ ID NO:42 and SEQ ID NO:43;(w) SEQ ID NO:48 and SEQ ID NO:33;(x) SEQ ID NO:49 and SEQ ID NO:11;(y) SEQ ID NO:53 and SEQ ID NO:17;(z) SEQ ID NO:54 and SEQ ID NO:36; or(aa) SEQ ID NO:55 and SEQ ID NO:11.

[0011] In some embodiments, the NARE comprises one or more of (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to a sequence comprising consecutive nucleotides of SEQ ID NQ:160, or (iii) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:147, 156, or 158.

[0012] In some embodiments, the NARE comprises one or more of (i) any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence comprising consecutive nucleotides of SEQ ID NQ:160, (iii) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:147, 156, or 158.

[0013] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146; (b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98%identical, orat least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;G) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(k) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(q) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(s) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii)a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(v) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(y) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to anyone of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(z) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0014] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146; (b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, orat least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) (i) a sequence that is at least 80% identical to TAGGCTG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11 ;(h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) a sequence that is at least 80% identical to SEQ ID NO: 150, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 152, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 153, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 154, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 155, (ii) a sequence that is at least 80% identical, at least 85%identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 , and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) (i) a sequence that is at least 80% identical to SEQ ID NO: 156, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 157, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) (i) a sequence that is at least 80% identical to SEQ ID NO: 158, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11 ;(y) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 159, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) (i) a sequence that is at least 80% identical to SEQ ID NO: 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0015] In some embodiments, the NARE comprises:(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(k) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(q) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(s) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 , and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(v) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii)a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID N0s:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(z) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0016] In some embodiments, the NARE comprises:(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) a sequence that has 1, 2, 3, 4, 5, 6, or 7 nucleic acid substitutions as compared to TAGGCTG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ I D NO: 10, and (iii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(k) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 150, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleicacid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 152, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 153, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 154, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 155, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 156, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 157, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 158, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11 ;(y) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 159, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleicacid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0017] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;(j) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m) (i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31 ;(o) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID N0s:150-160, (ii) SEQ ID NO:40, and (iii) SEQ ID NO:36;(u) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:49, and (iii) SEQ ID NO:11;(y) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:53, and (iii) SEQ ID NO:17;(z) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0018] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) TAGGCTG, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11 ;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;G) (i) TAGGCTGT, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) TAGGCTGT, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m) (i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31 ;(o) (i) SEQ ID NQ:150, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) SEQ ID NO:151, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) SEQ ID NO:151, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) SEQ ID NO:152, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) SEQ ID NO:153, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) SEQ ID NO:154, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) SEQ ID NO:155, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) SEQ ID NO:156, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) SEQ ID NO:157, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) SEQ ID NO:158, (ii) SEQ ID NO:49, and (iii) SEQ ID N0:11;(y) (i) SEQ ID NO:159, (ii) SEQ ID NO:53, and (iii) SEQ ID N0:17;(z) (i) SEQ ID NQ:160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0019] In some embodiments, the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NQs:100-143.

[0020] In some embodiments, the NARE comprises any one of SEQ ID NQs:100-143.

[0021] In some embodiments, the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:56-99.

[0022] In some embodiments, the NARE comprises any one of SEQ ID NOs:56-99.

[0023] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs: 7, 146, 14, 19-21, 38, 44-47;(b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(d) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequencethat is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(e) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 152, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17; or(f) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 153, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33.

[0024] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs: 7, 146, 14, 19-21, 38, 44-47;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) TAGGCTGT, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(d) (i) SEQ ID NO:151, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(e) (i) SEQ ID NO:152, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17; or(f) (i) SEQ ID NO:153, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33.

[0025] In some embodiments, the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs: 100, 103, 105, 109, 113-115, 118, 124, 126-128, and 132-135.

[0026] In some embodiments, the NARE comprises any one of SEQ ID NOs: 100, 103, 105, 109, 113-115, 118, 124, 126-128, and 132-135.

[0027] Provided is an expression construct comprising a NARE disclosed herein and an operatively linked transgene. In some embodiments, the expression construct further comprises a polyadenylation sequence and / or a post-transcriptional regulatory element.

[0028] Provided is a vector comprising an expression construct disclosed herein. In one embodiment, the vector is a non-viral vector. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is an adeno-associated virus (AAV) vector. In oneembodiment, the AAV vector comprises a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITR). In one embodiment, the nucleic acid sequence comprises a 5' ITR and a 3' ITR. In one embodiment, the 5' ITR and a 3' ITR are derived from AAV serotype AAV2.

[0029] Provided is a cell comprising an expression construct of disclosed herein or a vector disclosed herein. In some embodiments, the cell is a liver cell, muscle cell, or neuronal cell.

[0030] Provided is a pharmaceutical composition comprising: (i) an expression construct disclosed herein, or a vector disclosed herein and (ii) a pharmaceutically acceptable excipient.

[0031] Provided is a method for expressing a transgene in a cell comprising an expression construct disclosed herein, or a vector disclosed herein. In some embodiments, the cell is a liver cell, muscle cell, or neuronal cell. In one embodiment, the cell is a human cell. In some embodiments, the method is performed in vitro or ex vivo.BRIEF DESCRIPTION OF THE FIGURES

[0032] Figs. 1A and 1B. Dual reporter assay. Fig. 1A illustrates the design of the dual reporter construct. Candidate NAREs were cloned upstream (5') of the mClover3 coding sequence. Each construct contains a constant region that includes a tdTomato transgene that is used as a normalization control. The candidate NARE is referred to as a “test promoter” in the figure. Fig. 1B provides an example of flow cytometry data obtained with the dual reporter system, in which mClover3 expression in tdTomato+ cells reflects the level of NARE activity.

[0033] Figs. 2A and 2B. Analysis of barcode-based expression. Fig. 2A. Analysis of barcode-based expression in N2A cells. Two strategies were concurrently employed to summarize the multiplicity of barcodes reporting the activity of distinct NAREs and to calculate expression ratios: Sum of ratios and ratio of sums. A strong positive correlation between the two approaches was observed. Candidate NAREs were selected using this analysis and are highlighted on the scatterplot. Control liver promoters, ALB and TTR, are included as reference to approximate the low expression threshold. Fig. 2B. NARE selection in primary human myotubes. Candidate NAREs were selected using a comparison of the Ratio of Sums and Sum of Ratios for barcoded sequences. NAREs are highlighted on the scatterplot. Muscle reference promoters, CKM1 and mCK, are included to approximate potency of NAREs in this NGS-based screen. ML80 = ME6626; ML81 = ME61573; ML82 = ME81860; ML83 = ME94282; ML84 = ME100511 ; ML85 = ME118641 ; ML86 = ME141530; ML87 = ME230725.

[0034] Fig. 3. Specificity of expression for selected NAREs. Expression is shown as a normalized z-score to compare across screens in different cell lines and tissues. Labels onthe left: Cells used for screen that led to the identification of the indicated NARE. Labels on the bottom: Expression of NAREs in indicated cells / tissues (h: human, m: mouse).

[0035] Figs. 4A, 4B, 4C, and 4D. Gene expression driven by NAREs in different cell types. Fig. 4A. Gene expression in N2A cells (relative to control promoter CAG) as determined using the dual reporter assay. The transgene was under control of the indicated NARE. Fig. 4B. Gene expression in Huh7 cells (relative to control promoter CAG) as determined using the dual reporter assay. The transgene was under control of the indicated NARE. Fig. 4C. Gene expression in C2C12 cells (relative to control promoter CAG) as determined using the dual reporter assay. The transgene was under control of the indicated NARE. Fig. 4D. Strong correlation of NGS expression (barcodes) and independent assay expression (protein fluorescence) in N2A cells shows high confidence in the predictive power of high-throughput screening and bioinformatic hit selection.

[0036] Figs. 5A and 5B. Gene expression driven by NAREs in primary neurons. Fig.5A. On day 4 in vitro, primary mouse cortical neurons were transduced at 50,000 multiplicity of infection with AAV9-miRFP713 driven by candidate NAREs. After 7 days, neurons were imaged to assess miRFP713 expression. Scale bar: 300 pm. Fig. 5B. Image quantification at 7 days post infection shows that ML44 and ML50 express equal to or stronger than JeT and hSyn despite their small size.

[0037] Figs. 6A and 6B. NARE activity in vivo. Fig. 6A. NARE activity was assessed in vivo by bioimaging the mlRFP713 reporter gene 4 weeks after systemic (brain (top left), liver (top right)) or direct injection (gastrocnemius muscle (bottom)). Fig. 6B. Quantification of promoter expression in the mouse brain (left), liver (middle) and muscle (right).

[0038] Figs. 7A, 7B, and 7C. NARE activity in hIPSCs. Fig. 7A. Experimental paradigm to test promoter expression in human induced pluripotent stem cell (hIPSC) derived myotubes. hIPSC-derived myoblasts are differentiated for 8 days. Cultures are then transduced with 200,000 multiplicity of infection with AAV9-mlRFP713 driven by candidate promoters. Cells were imaged and quantified 11 days after infection. Fig. 7B. Representative images of transduced myotubes showing higher expression driven by NAREs compared to gene expression driven by control promoter Ck8e. Fig. 7C. NAREs identified from the mouse muscle barcode screen are equal to or stronger than Ck8e while being 60% smaller in size (bp).DETAILED DESCRIPTION

[0039] Nucleic acid regulatory elements (NAREs), including promoters, are important components of a gene therapy that control the expression level and durability of a therapeutic gene. NAREs can drive cell-specific expression of transgenes independent of, for example,capsid choice. Incorporation of stronger NAREs can increase potency and efficacy at lower viral vector doses, thereby potentially decreasing safety risks and immune responses. This reduction in dose may prevent serious adverse events such as Dorsal Root Ganglion toxicity. If the NARE leads to a more potent vector, it may also lower the cost of manufacturing. Moreover, reducing NARE size while maintaining strength and specificity allows efficient packaging of larger transgenes or expression cassettes into AAV. The present application provides NAREs that can improve the safety, efficacy, and durability of therapeutic transgene expression.

[0040] NAREs

[0041] Traditionally, “promoters” are defined as DNA regions where transcription is initiated. Promoters include specific DNA motifs that transcription factors (TFs) and their complexes can access. On the other hand, “enhancers” are defined as DNA regions that amplify transcription initiation by directly interplaying with their target promoters. Likewise, the enhancer sequences, distal from their target promoters, contain DNA motifs that act as binding sites for TFs and cofactors. At times, the term promoter may be used as a shorthand to refer to a nucleic acid sequence that comprises multiple regulatory elements. The promoter CAG, for example, contains a CMV enhancer, actin promoter region and intron, but may be referred to as a promoter. Specifically, the CAG promoter consists of (1) the cytomegalovirus (CMV) early enhancer element, (2) the promoter, the first exon and the first intron of chicken beta-actin gene, and (3) the splice acceptor of the rabbit beta-globin gene.

[0042] As used herein, the term “nucleic acid regulatory element” or “NARE” can refer to a promoter defined in the traditional sense as well as a combination of elements that comprises a promoter and / or other nucleic acid regulatory elements that modulate the expression of a gene that is operably linked to the element(s). A nucleic acid regulatory element may be, or include one or more of, e.g., promoters, enhancers, translation initiation signals, introns, and / or splicing enhancers.

[0043] Provided herein is a NARE operatively linked to a transgene.

[0044] As used herein, “transgene” refers to a gene (in particular the coding sequence of the gene) that is transferred into one or more cells of an organism, for example using a vector described herein. A transgene can encode a protein or RNA that is normally expressed in cells of the target organism or may encode a protein or RNA from a different organism. The transgene may be integrated into the genome of the target cell or may exist as part of an extrachromosomal expression construct.

[0045] As used herein, “operatively linked” refers to a first molecule joined to a second molecule, wherein the molecules are so arranged that the first molecule affects the function ofthe second molecule. The two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent. For example, a NARE is operatively linked to a transcribable polynucleotide molecule if the NARE modulates transcription of the transcribable polynucleotide molecule of interest in a cell. Additionally, two portions of a transcription regulatory element are operatively linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion. Two transcription regulatory elements may be operatively linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid comprising one or more nucleotides) or may be operatively linked to one another with no intervening nucleotides present.

[0046] Provided herein are NAREs particularly suitable for driving expression in the CNS, including in neuronal cells. CNS NAREs can be CNS-specific, meaning that they show significantly increased, or preferential, expression of an operably linked transgene in the CNS as compared to expression in other tissues. Even though a specific NARE might be particularly suitable for driving gene expression in the CNS, including in neuronal cells, this does not mean that said NARE is unsuitable for driving gene expression in other tissues, depending on the gene expression needs of the person skilled in the art.

[0047] Provided herein are NAREs particularly suitable for driving expression in muscle cells. Muscle NAREs can be muscle-specific, meaning that they show significantly increased, or preferential, expression of an operably linked transgene in muscle cells as compared to expression in other tissues. Even though a specific NARE might be particularly suitable for driving gene expression in the muscle, this does not mean that said NARE is unsuitable for driving gene expression in other tissues, depending on the gene expression needs of the person skilled in the art.

[0048] Provided herein are NAREs particularly suitable for driving expression in liver cells. Liver NAREs can be liver-specific, meaning that they show significantly increased, or preferential, expression of an operably linked transgene in liver cells as compared to expression in other tissues. Even though a specific NARE might be particularly suitable for driving gene expression in the liver, this does not mean that said NARE is unsuitable for driving gene expression in other tissues, depending on the gene expression needs of the person skilled in the art.

[0049] Of note, these three categories are not mutually exclusive. For example, some NAREs might be particularly suitable for driving expression in the muscle, neurons, and / or liver.

[0050] Also provided herein are NAREs and promoters used as references or controls. Control NAREs and promoters include the ones listed in Table 1.Table 1. Control NAREs and promoters.Name AlternaSpeciSEQ Sequencetive ficity IDname NOB4 hSynl Neuron 161 AGTGCAAGTGGG I I I I AGGACCAGGATGAGGC s GGGGTGGGGGTGCCTACCTGACGACCGACCC CGACCCACTGGACAAGCACCCAACCCCCATTC CCCAAATTGCGCATCCCCTATCAGAGAGGGGG AGGGGAAACAGGATGCGGCGAGGCGCGTGCG CACTGCCAGCTTCAGCACCGCGGACAGTGCCT TCGCCCCCGCCTGGCGGCGCGCGCCACCGCC GCCTCAGCACTGAAGGCGCGCTGACGTCACTC GCCGGTCCCCCGCAAACTCCCCTTCCCGGCCA CCTTGGTCGCGTCCGCGCCGCCGCCGGCCCA GCCGGACCGCACCACGCGAGGCGCGAGATAG GGGGGCACGGGCGCGACCATCTGCGCTGCGG CGCCGGCGACTCAGCGCTGCCTCAGTCTGCG GTGGGCAGCGGAGGAGTCGTGTCGTGCCTGA GAGCGCAGTCGAGAAGGTACCGGATCCCCGG GTGGATCCGCCACC01 CMV Ubiquit 162 GACATTGATTATTGACTAGTTATTAATAGTAATC ous AATTACGGGGTCATTAGTTCATAGCCCATATAT GGAGTTCCGCGTTACATAACTTACGGTAAATGG CCCGCCTGGCTGACCGCCCAACGACCCCCGC CCATTGACGTCAATAATGACGTATGTTCCCATA GTAACGCCAATAGGGACTTTCCATTGACGTCAA TGGGTGGACTATTTACGGTAAACTGCCCACTTG GCAGTACATCAAGTGTATCATATGCCAAGTACG CCCCCTATTGACGTCAATGACGGTAAATGGCC CGCCTGGCATTATGCCCAGTACATGACCTTATG GGACTTTCCTACTTGGCAGTACATCTACGTATT AGTCATCGCTATTACCATGGTGATGCGG I I I I G GCAGTACATCAATGGGCGTGGATAGCGGTTTG ACTCACGGGGATTTCCAAGTCTCCACCCCATT GACGTCAATGGGAGTTTG I l l i GGCACCAAAAT CAACGGGACTTTCCAAAATGTCGTAACAACTCC GCCCCATTGACGCAAATGGGCGGTAGGCGTGT ACGGTGGGAGGTCTATATAAGCAGAGCTCGTT TAGTGAACCGTCAGATCGCCTGGAGACGCCAT CCACGCTGTTTTGACCTCCATAGAATAATACGA CTCACTATAGGGAAGCTTGGCATTCCGGTACT GTTGGATCCGCCACCC19 CAG 163 ACATTGATTATTGACTAGTTATTAATAGTAATCA ATTACGGGGTCATTAGTTCATAGCCCATATATG GAGTTCCGCGTTACATAACTTACGGTAAATGGC CCGCCTGGCTGACCGCCCAACGACCCCCGCC CATTGACGTCAATAATGACGTATGTTCCCATAG TAACGCCAATAGGGACTTTCCATTGACGTCAAT GGGTGGACTATTTACGGTAAACTGCCCACTTG GCAGTACATCAAGTGTATCATATGCCAAGTACG CCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGName AlternaSpeciSEQ Sequencetive ficity IDname NO GGACTTTCCTACTTGGCAGTACATCTACGTATT AGTCATCGCTATTACCATGGGTCGAGGTGAGC CCCACGTTCTGCTTCACTCTCCCCATCTCCCCC CCCTCCCCACCCCCAA I l l i GTATTTATTTATTT TTTAATTA I l l i GTGCAGCGATGGGGGCGGGG GGGGGGGGGGCGCGCGCCAGGCGGGGCGGG GCGGGGCGAGGGGCGGGGCGGGGCGAGGCG GAGAGGTGCGGCGGCAGCCAATCAGAGCGGC GCGCTCCGAAAGTTTCC I I I IATGGCGAGGCG GCGGCGGCGGCGGCCCTATAAAAAGCGAAGC GCGCGGCGGGCGGGAGTCGCTGCGTTGCCTT CGCCCCGTGCCCCGCTCCGCGCCGCCTCGCG CCGCCCGCCCCGGCTCTGACTGACCGCGTTAC TCCCACAGGTGAGCGGGCGGGACGGCCCTTC TCCTCCGGGCTGTAATTAGCGCTTGGTTTAATG ACGGCTCGTTTC I l l i CTGTGGCTGCGTGAAAG CCTTAAAGGGCTCCGGGAGGGCCCTTTGTGCG GGGGGGAGCGGCTCGGGGGGTGCGTGCGTG TGTGTGTGCGTGGGGAGCGCCGCGTGCGGCC CGCGCTGCCCGGCGGCTGTGAGCGCTGCGGG CGCGGCGCGGGGCTTTGTGCGCTCCGCGTGT GCGCGAGGGGAGCGCGGCCGGGGGCGGTGC CCCGCGGTGCGGGGGGGCTGCGAGGGGAAC AAAGGCTGCGTGCGGGGTGTGTGCGTGGGGG GGTGAGCAGGGGGTGTGGGCGCGGCGGTCG GGCTGTAACCCCCCCCTGCACCCCCCTCCCCG AGTTGCTGAGCACGGCCCGGCTTCGGGTGCG GGGCTCCGTACGGGGCGTGGCGCGGGGCTCG CCGTGCCGGGCGGGGGGTGGCGGCAGGTGG GGGTGCCGGGCGGGGCGGGGCCGCCTCGGG CCGGGGAGGGCTCGGGGGAGGGGCGCGGCG GCCCCCGGAGCGCCGGCGGCTGTCGAGGCGC GGCGAGCCGCAGCCATTGCCTTTTATGGTAAT CGTGCGAGAGGGCGCAGGGACTTCCTTTGTGC CAAATCTGTGCGGAGCCGAAATCTGGGAGGCG CCGCCGCACCCCCTCTAGCGGGCGCGGGGCG AAGCGGTGCGGCGCCGGCAGGAAGGAAATGG GCGGGGAGGGCCTTCGTGCGTCGCCGCGCCG CCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCT GTCCGCGGGGGGACGGCTGCCTTCGGGGGG GACGGGGCAGGGCGGGGTTCGGCTTCTGGCG TGTGACCGGCGGCTCTAGAGCCTCTGCTAACC ATGTTCATGCCTTCTTC I I I I I CCTACAGCTCCT GGGCAACGTGCTGGTTATTGTGCTGTCTCATC A I I I I GGCAAAGAATTCGAGGTGGAAATTAATA CGACGTGGCGGATCCGCCACC06 JeTmd Neuron 164 GAATTCGGGCGGAGTTAGGGCGGAGCCAATCA s GCGTGCGCCGTTCCGAAAGTTGCC I l l i ATGG CTGGGCGGAGAATGGGCGGTGAACGCCGATG ATTATATAAGGACGCGCCGGGTGTGGCACAGCTAGTTCCGTCGCAGCCGGCTCGAGCCGAGTGName AlternaSpeciSEQ Sequencetive ficity IDname NO GTCGTCTTGTTTGTGGATCCCTGTGATCGTCAC TTGACAGGATCCGCCACCM31 creatine Muscle 165 TGCCCATGTAAGGAGGCAAGGCCTGGGGACA kinase 8 CCCGAGATGCCTGGTTATAATTAACCCAGACAT promote GTGGCTGCCCCCCCCCCCCAACACCTGCTGCC r (CK8e) CTCTAAAAATAACCCTGCATTCCATGTTCCCGG CGAAGGGCCAGCTGTCCCCCGCCAGCTAGACT CAGCACTTAGTTTAGGAACCAGTGAGCAAGTC AGCCCTTGGGGCAGCCCATACAAGGCCATGG GGCTGGGCAAGCTGCACGCCTGGGTCCGGGG TGGGCACGGTGCCCGGGCAACGAGCTGAAAG CTCATCTACTCTCAGGGGCCCCTCCCTGGGGA CAGCCCCTCCTGGCTAGTCACACCCTGTAGGC TCCTCTATATAACCCAGGGGCACAGGGGCTGC CCTCATTCTACCACCACCTCCACAGCACAGACA GACACTCAGGAGCCAGCCAGCCGCCACCalbumin Liver 166 GCAGAGATCCAGTTTATCGATAAGCTCAGTTCC (ALB) AGATGGTAAATATACACAAGGGATTTAGTCAAA promote CAAI I l l i IGGCAAGAAIAI IA IGAAI I I I GTAA r TCGGTTGGCAGCCAATGAAATACAAAGATGAG TCTAGTTAATAATCTACAATTATTGGTTAAAGAA GTATATTAGTGCTAATTTCCCTCCGTTTGTCCTA GO I I I I CTGGCCGCTGAGGGATCCGCCACCCloning arms underlinedtransthyr Liver 167 GCAGAGATCCAGTTTATCGATAAGCTTCCGATG etin CTCTAATCTCTCTAGACAAGGTTCATATTTGTAT (TTR) GGGTTACTTATTCTCTCTTTGTTGACTAAGTCAA promote TAATCAGAATCAGCAGGTTTGCAGTCAGATTGG r CAGGGATAAGCAGCCTAGCTCAGGAGAAGTGA GTATAAAAGCCCCAGGCTGGGAGCAGCCATCA CAGAAGTCCAGGCCGCTGAGGGATCCGCCAC0Cloning arms underlinedM24 Muscle 168 CCACTACGGGTCTAGGCTGCCCATGTAAGGAG GCAAGGCCTGGGGACACCCGAGATGCCTGGT TATAATTAACCCAGACATGTGGCTGCCCCCCC CCCCCAACACCTGCTGCCTGAGCCTCACCCCC ACCCCGGTGCCTGGGTCTTAGGCTCTGTACAC CATGGAGGAGAAGCTCGCTCTAAAAATAACCC TGTCCCTGGTGGATCCCCACTACGGGTCTAGG CTGCCCATGTAAGGAGGCAAGGCCTGGGGAC ACCCGAGATGCCTGGTTATAATTAACCCAGACA TGTGGCTGCCCCCCCCCCCCAACACCTGCTGC CTGAGCCTCACCCCCACCCCGGTGCCTGGGTC TTAGGCTCTGTACACCATGGAGGAGAAGCTCG CTCTAAAAATAACCCTGTCCCTGGTGGATCCCC ACTACGGGTCTAGGCTGCCCATGTAAGGAGGC AAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCName AlternaSpeciSEQ Sequencetive ficity IDname NOCCAACACCTGCTGCCTGAGCCTCACCCCCACC CCGGTGCCTGGGTCTTAGGCTCTGTACACCAT GGAGGAGAAGCTCGCTCTAAAAATAACCCTGT CCCTGGTGGATCCCTCCCTGGGGACAGCCCCT CCTGGCTAGTCACACCCTGTAGGCTCCTCTATA TAACCCAGGGGCACAGGGGCTGCCCTCAGTC CGCCTGGAGACCTCGAGCCGAGTGGTCGTCTC AGGAGCCGGGCAGGTTGGTATCAAGGTTACAA GCAGCCCACCTGTCCCAGTGCTGACTTAGTGC AAGGCGAGCCAGCAAGGAGGGAGGACAGGTG GCAGTGGGGGGTGAGGAGCATCTAAAAATAGC CACCCATGCCTCCTCAGGTACCCCCTGCCCCC CACAGCTCCTCTCCTGTGCCTTGTTTCCCAGCC ATGCGTTCTCCTCTATAAATACCCGCTCTGGTA TTTGGGGTTGGCAGCTGTTGCTGCCAGGGAGA TGGTTGGGTTGACATGCGGCTCCTGACAAAAC ACAAACCCCTGGTGTGTGTGGGCGTGGGTGGT GTGAGTAGGGGGATGAATCAGGGAGGGGGCG GGGGACCCAGGGGGCAGGAGCCACACAAAGT CTGTGCGGGGGTGGGAGCGCACATAGCAATT GGAAACTGAAAGCTTATCAGACCCTTTCTGGAA ATCAGCCCACTGTTTATAAACTTGAGGCCCCAC CCTCGACGGAGATAACCAGGGCTGAAAGAGGC CCGCCTGGGGGCTGCAGACATGCTTGCTGCCT GCCCTGGCGAAGGATTGGCAGGCTTGCCCGT CACAGGACCCCCGCTGGCTGACTCAGGGGCG CAGGCCTCTTGCGGGGGAGCTGGCCTCCCCG CCCCCACGGCCACGGGCCGCCCTTTCCTGGC AGGACAGCGGGATCTTGCAGCTGTCAGGGGA GGGGAGGCGGGGGCTGATGTCAGGAGGGATA TATAAAGTGCCGACGGCTGGGGGCCCTTCAGT CCGCCTGGAGACCTCGAGCCGAGTGGTCGTA CTCTTGGGTTTCTGATAGGCACTGACTCTCTCT GCCTATTGGTCTA I l l i CCCACCCTTAGGCTGCTAAAGGCCGCCACC

[0051] In some embodiments, the NARE comprises cloning sequences that are not expected to alter, add or detract from NARE function. In one embodiment, the NARE comprises a 5' cloning arm comprising SEQ ID NO:144 (GCAGAGATCCAGTTTATCGATAAGCT). In one embodiment, the NARE comprises a 3' cloning arm comprising SEQ ID NO:145 (GGCCGCTGAGGGATCCGCCACC).

[0052] In some embodiments, the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 56-99. In some embodiments, the NARE comprises any one of SEQ ID NOs: 56-99. See Table 2.

[0053] In some embodiments, the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 100-143. In some embodiments, the NARE comprises any one of SEQ ID NOs: 100-143. See Table 2.Table 2. NARE sequences and components. *Entire NARE sequence, including cloning arms (5' cloning arm: SEQ ID NO: 144; 3' cloning arm: SEQ ID NO:145) and spacer sequences.$NARE sequences with spacer sequences, but without cloning arms.NARE ID SEQ ID NO* SEQ ID NO$NARE component 1 NARE component 2 ML10 56 100 1 2ML36 57 101 3 4ML40 58 102 5 6ML44 59 103 7ML45 60 104 4 6ML50 61 105 146ML52 62 106 8 9ML54 63 107 10 11ML67 64 108 12 13ML70 65 109 14ML71 66 110 15 2ML72 67 111 16 17ML73 68 112 18ML75 69 113 19ML76 70 114 20ML77 71 115 21ML78 72 116 22ML79 73 117 23ML80 74 118 24 17ML81 75 119 25ML82 76 120 26 27ML83 77 121 28 29ML84 78 122 30 31ML85 79 123 32 33ML86 80 124 34 17ML87 81 125 35 36ML88 82 126 37 17ML89 83 127 38ML90 84 128 39 33ML91 85 129 40 36ML92 86 130 41 17ML93 87 131 42 43ML94 88 132 44ML95 89 133 45ML96 90 134 46ML97 91 135 47ML98 92 136 48 33ML99 93 137 49 11ML100 94 138 50NARE ID SEQ ID NO* SEQ ID NO$NARE component 1 NARE component 2 ML101 95 139 51ML102 96 140 52ML103 97 141 53 17ML104 98 142 54 36ML105 99 143 55 11

[0054] In some embodiments, the NARE comprises one or more sequences that are at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:1-55 or 146.

[0055] In some embodiments, the NARE comprises one or more sequences that that have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:1-55 or 146.

[0056] In some embodiments, the NARE comprises one or more sequences selected from SEQ ID NOs:1-55 or 146.

[0057] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:6;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(h) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:12 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:17;(q) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(y) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11.

[0058] In some embodiments, the NARE comprises from 5' to 3':(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(h) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:12 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:30 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:40 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(y) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11.

[0059] To illustrate, if, for example, “sequence C comprises sequence A and sequence B from 5' to 3',” this means that sequence A is located 5' with respect to sequence B. In one embodiment, sequence A is located directly 5' with respect to sequence B, without any intervening sequence. In another embodiment, sequence A is located 5' with respect to sequence B, but there is an intervening sequence between sequences A and B.

[0060] In some embodiments, the NARE comprises from 5' to 3':(a) SEQ ID NO:1 and SEQ ID NO:2;(b) SEQ ID NO:3 and SEQ ID NO:4;(c) SEQ ID NO:5 and SEQ ID NO:6;(d) SEQ ID NO:4 and SEQ ID NO:6;(e) SEQ ID NO:8 and SEQ ID NO:9;(f) SEQ ID NQ:10 and SEQ ID NO:11;(g) SEQ ID NO:12 and SEQ ID NO:13;(h) SEQ ID NO:15 and SEQ ID NO:2;(i) SEQ ID NO:16 and SEQ ID NO:17;G) SEQ ID NO:24 and SEQ ID NO:17;(k) SEQ ID NO:26 and SEQ ID NO:27;(l) SEQ ID NO:28 and SEQ ID NO:29;(m)SEQ ID NQ:30 and SEQ ID NO:31;(n) SEQ ID NO:32 and SEQ ID NO:33;(o) SEQ ID NO:34 and SEQ ID NO:17;(p) SEQ ID NO:35 and SEQ ID NO:36;(q) SEQ ID NO:37 and SEQ ID NO:17;(r) SEQ ID NO:39 and SEQ ID NO:33;(s) SEQ ID NQ:40 and SEQ ID NO:36;(t) SEQ ID NO:41 and SEQ ID NO:17;(u) SEQ ID NO:42 and SEQ ID NO:43;(v) SEQ ID NO:48 and SEQ ID NO:33;(w) SEQ I D NO:49 and SEQ I D NO: 11 ;(x) SEQ ID NO:53 and SEQ ID N0:17;(y) SEQ ID NO:54 and SEQ ID NO:36; or(z) SEQ ID NO:55 and SEQ ID N0:11.

[0061] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146; (b) SEQ ID NO:1 and SEQ ID NO:2;(c) SEQ ID NO:3 and SEQ ID NO:4;(d) SEQ ID NO:5 and SEQ ID NO:6;(e) SEQ ID NO:4 and SEQ ID NO:6;(f) SEQ ID NO:8 and SEQ ID NO:9;(g) SEQ ID NQ:10 and SEQ ID NO:11;(h) SEQ ID NO:12 and SEQ ID NO:13;(i) SEQ ID NO:15 and SEQ ID NO:2;G) SEQ ID NO:16 and SEQ ID NO:17;(k) SEQ ID NO:24 and SEQ ID NO:17;(l) SEQ ID NO:26 and SEQ ID NO:27;(m)SEQ ID NO:28 and SEQ ID NO:29;(n) SEQ ID NQ:30 and SEQ ID NO:31;(o) SEQ ID NO:32 and SEQ ID NO:33;(p) SEQ ID NO:34 and SEQ ID NO:17;(q) SEQ ID NO:35 and SEQ ID NO:36;(r) SEQ ID NO:37 and SEQ ID NO:17;(s) SEQ ID NO:39 and SEQ ID NO:33;(t) SEQ ID NQ:40 and SEQ ID NO:36;(u) SEQ ID NO:41 and SEQ ID NO:17;(v) SEQ ID NO:42 and SEQ ID NO:43;(w) SEQ ID NO:48 and SEQ ID NO:33;(x) SEQ I D NO:49 and SEQ I D NO: 11 ;(y) SEQ ID NO:53 and SEQ ID NO:17;(z) SEQ ID NO:54 and SEQ ID NO:36; or(aa) SEQ ID NO:55 and SEQ ID NO:11.

[0062] In some embodiments, the NARE comprises:(a) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 or SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(b) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 3 or SEQ ID NO:6 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 or SEQ ID NO:5 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to (i) SEQ ID NQs:10, 49, or 55 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to (i) SEQ ID NOs:16, 24, 34, 37, or 53 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to (i) SEQ ID NOs:35, 40, or 54 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to (i) SEQ ID NOs:32, 39, or 48 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33.

[0063] In some embodiments, the NARE comprises:(a) (i) SEQ ID NO:1 or SEQ ID NO:15 and (ii) SEQ ID NO:2;(b) (i) SEQ ID NO: 3 or SEQ ID NO:6 and (ii) SEQ ID NO:4(c) (i) SEQ ID NO:4 or SEQ ID NO:5 and (ii) SEQ ID NO:6;(d) (i) SEQ ID NQs:10, 49, or 55 and (ii) SEQ ID NO:11;(e) (i) SEQ ID NOs:16, 24, 34, 37, or 53 and (ii) SEQ ID NO:17;(f) (i) SEQ ID NOs:35, 40, or 54 and (ii) SEQ ID NO:36; or(g) (i) SEQ ID NOs:32, 39, or 48 and (ii) SEQ ID NO:33.

[0064] In some embodiments, the NARE comprises from 5' to 3':(a) (i) SEQ ID NO:1 or SEQ ID NO:15 and (ii) SEQ ID NO:2;(b) (i) SEQ ID NO:4 or SEQ ID NO:5 and (ii) SEQ ID NO:6;(c) (i) SEQ ID NQs:10, 49, or 55 and (ii) SEQ ID NO:11;(d) (i) SEQ ID NOs:16, 24, 34, 37, or 53 and (ii) SEQ ID NO:17;(e) (i) SEQ ID NOs:35, 40, or 54 and (ii) SEQ ID NO:36; or(f) (i) SEQ ID NOs:32, 39, or 48 and (ii) SEQ ID NO:33.

[0065] In some embodiments, the NARE comprises:(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to one any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 12 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 13;(i) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 15 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 16 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0066] In some embodiments, provided is a NARE that comprises one or more components (or sequence variants thereof) of a NARE provided in Tables 2 or 3, whereby the components (or sequence variants thereof) are arranged from 5' to 3' as presented as shown in Tables 2 or 3. In embodiments, provided is a NARE that comprises one or more components (or sequence variants thereof) of a NARE provided in Tables 2 or 3, whereby the components (or sequence variants thereof) are not arranged from 5' to 3' as presented as in Tables 2 or 3, but in a different order.

[0067] Contemplated herein are NARE variants that include sequence in addition (e.g., added at either end or inserted within the NARE sequence) to the elements of a NARE disclosed herein, including, but not limited to the NARE components disclosed in Tables 2 or 3. Likewise, provided are NARE variants in which certain sequence has been removed from NAREs disclosed herein (e.g., as a terminal or internal deletion).

[0068] In embodiments, provided are NAREs comprising one or more components disclosed herein without any additional nucleic acid sequence(s) joining the NARE’s components.

[0069] In some embodiments, provided are NAREs comprising one or more components, whereby the individual components are connected by additional nucleic acid sequences. These additional nucleic acid sequences may or may not be relevant for expression of an operatively linked transgene. In embodiments, some of the components are directly linked, while other components are linked to other components via an intervening sequence. As such, contemplated are variants of the NAREs disclosed in Tables 2 or 3, wherein additional sequence has been added between the different components. Further contemplated are variants of the NAREs disclosed in Tables 2 or 3, which disclose the same components of a given NARE in Tables 2 or 3, but differ in the sequence(s) connecting the individual components.Table 3. NARE sequences and components (including spacers). No SEQ ID NO was assigned to nucleic acid sequences with less than 10 nucleotides.NARE ID SEQ ID NO SEQ ID NO SEQ ID NO SEQ ID NOSpacer 1 Component 1 Spacer 2 Component 2 ML10 T 1 2ML36 3 147 4ML40 5 147 6ML44 7ML45 4 147 6ML50 146ML52 8 147 9ML54 TAGGCTG 10 11ML67 12 147 13ML70 14ML71 15 2ML72 TAGGCTGT 16 17ML73 18ML75 19ML76 20ML77 21ML78 22ML79 23ML80 TAGGCTGT 24 17ML81 25ML82 26 147 27NARE ID SEQ ID NO SEQ ID NO SEQ ID NO SEQ ID NO Spacer 1 Component 1 Spacer 2 Component 2 ML83 28 147 29ML84 30 147 31ML85 150 32 33ML86 151 34 17ML87 151 35 36ML88 152 37 17ML89 38ML90 153 39 33ML91 154 40 36ML92 155 41 17ML93 156 42 43ML94 44ML95 45ML96 46ML97 47ML98 157 48 33ML99 158 49 11ML100 50ML101 51ML102 52ML103 159 53 17ML104 160 54 36ML105 TAG 55 11

[0070] In embodiments, the NARE comprises any of the spacer sequences disclosed in Tables 3 or 4 (or variants thereof).

[0071] In one embodiment, the NARE comprises one or more spacer sequences, wherein the spacer sequences comprise consecutive nucleotides of SEQ ID NO: 160. In some embodiments, the one or more spacer sequences comprise at least 10 consecutive nucleotides, at least 15 consecutive nucleotides, at least 20 consecutive nucleotides, at least 25 consecutive nucleotides, at least 30 consecutive nucleotides, at least 35 consecutive nucleotides, at least 40 consecutive nucleotides, at least 45 consecutive nucleotides, or at least 50 consecutive nucleotides of SEQ ID NO: 160.

[0072] In some embodiments, the NARE comprises T and / or TAG as a spacer sequence.

[0073] In some embodiments, the NARE comprises one or more sequences that are at least 80% identical to any one of TAGGCTG, TAGGCTGT, or any one of SEQ ID NOs:147, 156, or 158. In some embodiments, the NARE comprises one or more sequences that are at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160. See Table 4.

[0074] In some embodiments, the NARE comprises one or more sequences that have 1, 2, 3, 4, 5, 6, or 7 nucleic acid substitutions as compared to TAGGCTG or TAGGCTGT.

[0075] In some embodiments, the NARE comprises one or more sequences that have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:147 and 150-160. See Table 4.

[0076] In some embodiments, the NARE comprises one or more sequences selected from T, TA, TAGGCTG, TAGGCTGT, SEQ ID NOs:147 and 150-160. See Table 4.Table 4. Spacer sequences. No SEQ ID NO was assigned to nucleic acid sequences with less than 10 nucleotides.SEQ SequenceID NOn / a Tn / a TAGn / a TAGGCTGn / a TAGGCTGT147 TAGGCTGTCC158 TAGGCTGTCCT156 TAGGCTGTCCTA155 TAGGCTGTCCTAGGCTGTCCTAGGC157 TAGGCTGTCCTAGGCTGTCCTAGGCTGT152 TAGGCTGTCCTAGGCTGTCCTAGGCTGTC153 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCC150 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCT151 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAG154 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGC159 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCT160 TAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGG

[0077] In some embodiments, the NARE comprises one or more of (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160; (ii) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to a sequence comprising consecutive nucleotides of SEQ ID NQ:160; or (iii) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:147, 156, or 158; and:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:2;(c) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(h) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:12 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:31;(o) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(y) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11.

[0078] In some embodiments, the NARE comprises one or more of (i) any one of SEQ ID NQs:150-155, 157, 159, or 160; (ii) a sequence comprising consecutive nucleotides of SEQ ID NQ:160; (iii) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:147, 156, or 158,; and:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) SEQ ID NO:1 and SEQ ID NO:2;(c) SEQ ID NO:3 and SEQ ID NO:4;(d) SEQ ID NO:5 and SEQ ID NO:6;(e) SEQ ID NO:4 and SEQ ID NO:6;(f) SEQ ID NO:8 and SEQ ID NO:9;(g) SEQ ID NQ:10 and SEQ ID NO:11;(h) SEQ ID NO:12 and SEQ ID NO:13;(i) SEQ ID NO:15 and SEQ ID NO:2;G) SEQ ID NO:16 and SEQ ID NO:17;(k) SEQ ID NO:24 and SEQ ID NO:17;(l) SEQ ID NO:26 and SEQ ID NO:27;(m)SEQ ID NO:28 and SEQ ID NO:29;(n) SEQ ID NQ:30 and SEQ ID NO:31;(o) SEQ ID NO:32 and SEQ ID NO:33;(p) SEQ ID NO:34 and SEQ ID NO:17;(q) SEQ ID NO:35 and SEQ ID NO:36;(r) SEQ ID NO:37 and SEQ ID NO:17;(s) SEQ ID NO:39 and SEQ ID NO:33;(t) SEQ ID NQ:40 and SEQ ID NO:36;(u) SEQ ID NO:41 and SEQ ID NO:17;(v) SEQ ID NO:42 and SEQ ID NO:43;(w) SEQ ID NO:48 and SEQ ID NO:33;(x) SEQ I D NO:49 and SEQ I D NO: 11 ;(y) SEQ ID NO:53 and SEQ ID NO:17;(z) SEQ ID NO:54 and SEQ ID NO:36; or(aa) SEQ ID NO:55 and SEQ ID NO:11.

[0079] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9;(g) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;G) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (p) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(q) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (r) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (s) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (t) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (u) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99%identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (v) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43; (w) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (x) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (y) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (z) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identicalto any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0080] In some embodiments, the NARE comprises from 5' to 3':(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9; (g) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;G) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (p) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (q) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (r) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (s) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (u) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (v) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43; (w) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (x) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99%identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (y) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (z) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0081] In some embodiments, the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9; (g) (i) a sequence that is at least 80% identical to TAGGCTG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:31;(o) (i) a sequence that is at least 80% identical to SEQ ID NO: 150, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 152, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 153, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 154, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 155, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) (i) a sequence that is at least 80% identical to SEQ ID NO: 156, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 157, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) (i) a sequence that is at least 80% identical to SEQ ID NO: 158, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(y) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 159, (ii) a sequence that is at least 80% identical, at least 85%identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) (i) a sequence that is at least 80% identical to SEQ ID NO: 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0082] In some embodiments, the NARE comprises from 5' to 3':(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44- 47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9; (g) (i) a sequence that is at least 80% identical to TAGGCTG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical,at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) a sequence that is at least 80% identical to SEQ ID NO: 150, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96%identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 152, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 153, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 154, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 155, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) (i) a sequence that is at least 80% identical to SEQ ID NO: 156, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 157, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) (i) a sequence that is at least 80% identical to SEQ ID NO: 158, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(y) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 159, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) (i) a sequence that is at least 80% identical to SEQ ID NO: 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95%identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

[0083] In some embodiments, the NARE comprises:(a) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQID NO:10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequencethat has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID N0s:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0084] In some embodiments, the NARE comprises from 5' to 3':(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleicacid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence thathas 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID N0s:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0085] In some embodiments, the NARE comprises:(a) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) a sequence that has 1, 2, 3, 4, 5, 6, or 7 nucleic acid substitutions as compared to TAGGCTG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(k) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 150, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (p) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (q) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (r) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 152, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (s) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 153, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (t) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 154, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (u) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 155, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 , and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (v) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 156, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43; (w) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 157, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (x) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 158, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11 ; (y) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 159, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (z) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0086] In some embodiments, the NARE comprises from 5' to 3':(a) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(c) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) a sequence that has 1, 2, 3, 4, 5, 6, or 7 nucleic acid substitutions as compared to TAGGCTG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(k) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 150, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (p) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (q) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (r) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 152, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (s) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 153, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (t) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 154, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (u) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 155, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 , and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (v) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 156, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43; (w) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 157, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (x) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 158, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11 ; (y) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 159, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (z) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

[0087] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;(j) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31;(o) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID N0s:150-160, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:49, and (iii) SEQ ID NO:11;(y) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:53, and (iii) SEQ ID NO:17;(z) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0088] In some embodiments, the NARE comprises from 5' to 3':(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;(j) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31;(o) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID N0s:150-160, (ii) SEQ ID NO:40, and (iii) SEQ ID NO:36;(u) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:49, and (iii) SEQ ID NO:11;(y) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:53, and (iii) SEQ ID NO:17;(z) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0089] In some embodiments, the NARE comprises:(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) TAGGCTG, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;G) (i) TAGGCTGT, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) TAGGCTGT, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31;(o) (i) SEQ ID NQ:150, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) SEQ ID NO:151, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) SEQ ID NO:151, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) SEQ ID NO:152, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) SEQ ID NO:153, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) SEQ ID NO:154, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) SEQ ID NO:155, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) SEQ ID NO:156, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) SEQ ID NO:157, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) SEQ ID NO:158, (ii) SEQ ID NO:49, and (iii) SEQ ID N0:11;(y) (i) SEQ ID NO:159, (ii) SEQ ID NO:53, and (iii) SEQ ID N0:17;(z) (i) SEQ ID NQ:160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0090] In some embodiments, the NARE comprises from 5' to 3':(a) any one of SEQ ID NOs:7, 14, 18-23, 25, 38, 44-47, 50-52, and 146;(b) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(c) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(d) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) TAGGCTG, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;G) (i) TAGGCTGT, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) TAGGCTGT, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31;(o) (i) SEQ ID NQ:150, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) SEQ ID NO:151, (ii) SEQ ID NO:34, and (iii) SEQ ID NO:17;(q) (i) SEQ ID NO:151, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) SEQ ID NO:152, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) SEQ ID NO:153, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) SEQ ID NO:154, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) SEQ ID NO:155, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) SEQ ID NO:156, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) SEQ ID NO:157, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) SEQ ID NO:158, (ii) SEQ ID NO:49, and (iii) SEQ ID NO:11;(y) (i) SEQ ID NO:159, (ii) SEQ ID NO:53, and (iii) SEQ ID NO:17;(z) (i) SEQ ID NQ:160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

[0091] Provided herein are NAREs that are not naturally occurring, i.e., that are recombinant.

[0092] NARE Modifications

[0093] A person skilled in the art will appreciate that certain modifications can be made to the NAREs disclosed herein without eliminating the ability of the NARE to drive gene expression in the desired tissue / cell type. Various in vitro and in vivo methods of confirming that a modified NARE is still capable of driving gene expression are known in the art, including, but not limited to, the methods used herein. For example, the strength of a NARE may be assessed by operatively linking the promoter to a transgene encoding a protein and measuring transgene expression, for example by detecting the mRNA encoding the protein, or by measuring presence or activity of the protein, e.g., by ELISA, Western Blot, fluorescence, enzymatic activity of the protein, etc., or by any methods described in the Examples.

[0094] In some embodiments, the NARE comprises a NARE component that has the reverse complement sequence of a NARE component disclosed herein. In some embodiments, the NARE comprises a NARE component that has the reverse sequence of a NARE component disclosed herein.

[0095] Provided herein are NAREs comprising one or more components. Provided herein are NAREs comprising one or more sequence components (or sequence variants thereof) listed in one or more of Tables 2-4. Provided herein are NAREs comprising one or more sequence components (or sequence variants thereof) listed in Tables 2-4.

[0096] In some embodiments, the NARE comprises one or more of the components provided for any one of ML10, ML44, ML50, ML70, ML75-ML77, ML80, ML86, ML88-ML90, ML94-ML97 in Tables 2-4.

[0097] In some embodiments, provided are NAREs that are particularly (not but necessarily exclusively) suitable for driving gene expression in the CNS, including in neurons. These NAREs include: ML10, ML36, ML40, ML44, ML45, ML50, ML52, ML54, ML67, ML70, ML71, ML72, ML73, ML75, ML76, ML94-ML105, and variants thereof. In a preferred embodiment, these NAREs include ML10, ML44, ML50, ML70, ML75, ML76, ML94-ML97, and variants thereof.

[0098] In some embodiments, provided are NAREs that are particularly (not but necessarily exclusively) suitable for driving gene expression in the liver. These NAREs include: ML10, ML44, ML50, ML70, and variants thereof.

[0099] In some embodiments, provided are NAREs that are particularly (not but necessarily exclusively) suitable for driving gene expression in the muscle. These NAREs include: ML44, ML50, ML70, ML75, ML77-ML93, and variants thereof. In a preferred embodiment, these NAREs include: ML44, ML50, ML70, ML75, ML77, ML80, ML86, ML88-ML90, and variants thereof.

[0100] When the term “comprises” is used herein, the term “comprises or essentially consists of” can be used in the alternative.

[0101] Nucleic Acid Constructs and Vectors

[0102] In one aspect, provided are nucleic acid constructs and vectors and their use for the introduction of a transgene or an expression construct into a cell. Nucleic acid constructs include expression constructs including plasmids. The term “expression construct” refers to a recombinant polynucleotide construct that includes a nucleic acid coding for an RNA capable of being transcribed in a cell. Methods for constructing expression constructs and plasmids through standard recombinant techniques are known in the art. Provided herein is an expression construct comprising a transgene, operatively linked to one or more NAREs disclosed herein. Provided herein is a vector comprising a nucleic acid construct, including an expression construct, disclosed herein.

[0103] “Vector,” as used herein, means a vehicle that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle, or a virus (including virus derived sequences). A vector may also refer to a virion comprising a nucleic acid to be delivered into a host cell, either in vitro or in vivo. In some embodiments, a vector refers to a virion comprising a recombinant viral genome, wherein the viral genome comprises one or more ITRs and a transgene. In one embodiment, the vector is a viral vector or a combination of multiple viral vectors.

[0104] Provided herein are vectors that comprise recombinant DNA constructs that include additional DNA elements, including DNA segments that provide for the replication of the DNA in a host cell and expression of the target gene in target cells at appropriate levels. Provided herein are expression constructs and vectors comprising a NARE disclosed herein operatively linked to a transgene. In embodiments, the nucleic acid constructs or vectors disclosed herein comprise additional regulatory elements, including, but not limited to, promoters, enhancers, translation initiation signals, introns, and / or splicing enhancers. In embodiments, the nucleic acid constructs or vectors disclosed herein comprise a polyadenylation sequence. In embodiments, the nucleic acid constructs or vectors disclosed herein comprise an internal ribosome entry site (IRES). An IRES sequence may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell. An illustrative IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells. In one embodiment, the IRES is located 3' of the transgene. In embodiments, the nucleicacid constructs or vectors disclosed herein comprise a post transcriptional regulatory sequence, such as a woodchuck post-transcriptional regulatory element.

[0105] Viral Vectors

[0106] Viral vectors for the expression of a target gene in a target cell, tissue, or organism are known in the art and include, for example, an AAV vector, adenovirus vector, lentivirus vector, retrovirus vector, poxvirus vector, baculovirus vector, herpes simplex virus vector, vaccinia virus vector, or a synthetic virus vector (e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule).

[0107] AA V Vectors

[0108] Adeno-associated viruses (AAV) are small, single-stranded DNA viruses which require helper virus to facilitate efficient replication. The 4.7 kb genome of AAV is characterized by two inverted terminal repeats (ITR) and two open reading frames which encode the Rep proteins and Cap proteins, respectively. The Rep reading frame encodes four proteins of molecular weight 78 kD, 68 kD, 52 kD, and 40 kD. These proteins function mainly in regulating AAV replication and rescue and integration of the AAV into a host cell's chromosomes. The Cap reading frame encodes three structural proteins of molecular weight 85 kD (VP 1), 72 kD (VP2), and 61 kD (VP3), which form the virion capsid. More than 80% of total proteins in AAV virion comprise VP3. Flanking the rep and cap open reading frames at the 5' and 3' ends are about 145 bp long inverted terminal repeats (ITRs). The two ITRs are the only cis elements essential for AAV replication, rescue, packaging, and integration of the AAV genome. The entire rep and cap domains can be excised and replaced with a therapeutic or reporter transgene.

[0109] Recombinant adeno-associated virus “rAAV” vectors include any vector derived from any adeno-associated virus serotype. rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and / or Cap genes, but retain functional flanking ITR sequences.

[0110] In some embodiments, the viral vector is an rAAV virion, which comprises an rAAV genome and one or more capsid proteins. In some embodiments, the rAAV genome comprises a nucleic acid construct disclosed herein.

[0111] In some embodiments, the viral vector disclosed herein comprises a nucleic acid comprising an AAV 5' ITR and 3' ITR located 5' and 3' of the sequence encoding a transgene, respectively. However, in certain embodiments, it may be desirable for the nucleic acid to contain the 5' ITR and 3' ITR sequences arranged in tandem, e.g., 5' to 3' or a head-to-tail, or in another alternative configuration. In still other embodiments, it may be desirable for the nucleic acid to contain multiple copies of the ITRs or to have 5' ITRs (or conversely, 3' ITRs)located both 5' and 3' to transgene. The ITRs sequences may be located immediately upstream and / or downstream of the heterologous molecule, or there may be intervening sequences. The ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion, or substitution of nucleotides) so long as the sequences provide for functional rescue, replication, and packaging. The ITRs may be selected from AAV2, or from among the other AAV serotypes, as described herein.

[0112] In some embodiments, provided is a vector comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITR). In one embodiment, the nucleic acid sequence comprises a 5' ITR and a 3' ITR. In one embodiment, the 5' ITR and a 3' ITR are derived from adeno-associated virus (AAV) serotype AAV2.

[0113] In some embodiments, the viral vector is an AAV vector, such as an AAV1 ( / .e., an AAV containing AAV1 ITRs and AAV1 capsid proteins), AAV2 ( / .e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 ( / .e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 ( / .e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 ( / .e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 ( / .e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 ( / .e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 ( / .e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV9 ( / .e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh74 ( / .e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 ( / .e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), or AAVrh.10 ( / .e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins).

[0114] In some embodiments, the viral vector is a pseudotyped AAV vector, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 ( / .e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 10 ( / .e., an AAV containing AAV2 ITRs and AAV10 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 7m8 ( / .e., an AAV containing AAV2 ITRs and AAV7m8 capsid proteins).

[0115] In some embodiments, the AAV vector contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10. In embodiments, the capsid is a variant AAV capsid such as the AAV2 variant rAAV2-retro (SEQ ID NO:44 from WO 2017 / 218842, incorporated herein by reference).

[0116] Specific capsid proteins are particularly useful for delivering transgenes to a specific tissue. See, e.g., Issa et al., Various AAV Serotypes and Their Applications in Gene Therapy: An Overview, Cells 2023 Mar 1 ; 12(5). For example, AAV1, AAV2, AAV6, AAV7, AAV8, AAV9,and AAV12 capsids are useful for transfecting skeletal muscle cells. AAV1, AAV2, AAV4, AAV5, AAV7, AAV9, AAV10, and AAV11 capsids are useful for transfecting cells of the CNS. AAV2, AAV3, AAV5, AAV7, AAV8, AAV9, AAV10, and AAV10 are useful for transfecting hepatocytes.

[0117] In some embodiments, the AAV vector contains two or more capsid proteins selected from different serotypes. In some embodiments, the AAV vector contains an rAAV2-retro and an AAVrh.10 capsid protein. In some embodiments, the AAV vector contains rAAV2-retro and AAVrh.10 capsid proteins respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50. In some embodiments, the AAV vector contains AAVrh.10 and rAAV2-retro capsid proteins, respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50.

[0118] In some embodiments, a mixture of (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10 is used. In some embodiments, a ratio of the (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used. In some embodiments, a ratio of the (1) AAV vectors comprising AAVrh.10 and (2) AAV vectors comprising rAAV2-retro, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used.

[0119] Other Viral Vectors

[0120] Examples of viral vectors include, but are not limited to, retrovirus, adenovirus, parvovirus, coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and doublestranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses may include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, and spumavirus.

[0121] Viral vectors include adenoviral (AV) vectors, for example, those based on human adenovirus type 2 and human adenovirus type 5 that have been made replication defective through deletions in the E1 and E3 regions. The transcriptional cassette can be inserted into the E1 region, yielding a recombinant E1 / E3-deleted AV vector. Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also known as high-capacity, “gutless” or “gutted” vectors), which do not contain viral coding sequences. These vectors contain the cis-acting elements needed for viral DNA replication and packaging, mainly theinverted terminal repeat sequences (ITR) and the packaging signal (CY). These helperdependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA.

[0122] Alternatively, other systems such as lentiviral vectors can be used. Lentiviral-based systems can transduce nondividing as well as dividing cells making them useful for applications targeting, for example, the nondividing cells of the CNS. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome providing the potential for very long-term gene expression.

[0123] Non-viral vectors

[0124] Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying the target gene containing the expression cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells. Other methods for delivering the vector to cells include hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery systems for gene delivery see Nayerossadat et al., Viral and nonviral delivery systems for gene delivery, Adv Biomed Res. 2012;1:27, incorporated herein by reference. Non-viral delivery systems include using a colloidal dispersion system such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0125] rAA V Virion Production

[0126] The rAAV virions disclosed herein may be constructed and produced using the materials and methods described herein, as well as those known to those of skill in the art. Such engineering methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). Further, methods suitable for producing a rAAV cassette in an adenoviral capsid have been described in U.S. Pat. No. 5,856,152 (entitled Hybrid adenovirus-AAV vector and methods of use therefor) and U.S. Pat. No. 5,871,982 (entitled Hybrid adenovirus-AAV virus and methods of use thereof), both of which are incorporated herein in their entireties. See also Asaad Wet al., AAV genome modification for efficient AAV production, Heliyon. 2023 Apr 1;9(4):e15071.

[0127] Briefly, in order to package the rAAV genome into a rAAV virion, a host cell is used that contains sequences important for expressing AAV rep and AAV cap or functionalfragments thereof as well as helper genes important for AAV production. The AAV rep and cap sequences are obtained from an AAV source as identified herein. The AAV rep and cap sequences may be introduced into the host cell in any manner known to one in the art, including, without limitation, transfection, infection, calcium phosphate precipitation, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection, and protoplast fusion. In one embodiment, the rep and cap sequences may be transfected into the host cell by one or more nucleic acid molecules and exist stably in the cell as an episome. In another embodiment, the rep and cap sequences are stably integrated into the genome of the cell. Another embodiment has the rep and cap sequences transiently expressed in the host cell. For example, a useful nucleic acid molecule for such transfection comprises, from 5' to 3', a NARE, an optional spacer interposed between the NARE and the start site of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence. Alternatively, infection of proviral cell lines with adenovirus or herpes simplex virus vector carrying a Rep and Cap expression cassette can be used. Further, baculovirus expression vector systems for rAAV vector production in insect SF9 cells have been developed.

[0128] The rep and cap sequences, along with their expression control sequences, may be supplied on a single vector, or each sequence may be supplied on its own vector. Preferably, the rep and cap sequences are supplied on the same vector. Alternatively, the rep and cap sequences may be supplied on a vector that contains other DNA sequences that are to be introduced into the host cells. Preferably, the promoter used in this construct may be any suitable constitutive, inducible or native promoters known to one of skill in the art. The molecule providing the rep and cap proteins may be in any form which transfers these components to the host cell. Desirably, this molecule is in the form of a plasmid, which may contain other non-viral sequences, such as those for marker genes. This molecule does not contain the AAV ITRs and generally does not contain the AAV packaging sequences. To avoid the occurrence of homologous recombination, other virus sequences, particularly those of adenovirus, are avoided in this plasmid. This plasmid is desirably constructed so that it may be stably transfected into a cell.

[0129] Although the molecule providing rep and cap may be transiently transfected into the host cell, it is preferred that the host cell be stably transformed with sequences important for expressing functional rep / cap proteins in the host cell, e.g., as an episome or by integration into the chromosome of the host cell. Depending upon the promoter controlling expression of such stably transfected host cell, the rep / cap proteins may be transiently expressed (e.g., through use of an inducible promoter).

[0130] The methods employed for constructing embodiments of this disclosure are conventional genetic engineering or recombinant engineering techniques such as those described in the references above. For example, the rAAV may be produced utilizing a triple transfection method using either the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.), according to manufacturer’s instructions. See, also, Herzog et al., Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector, Nat Med. 1999 Jan;5(1):56-63, employing the plasmid with the transgene, a helper plasmid containing AAV rep and cap, and a plasmid supplying adenovirus helper functions of E2A, E40rf6 and VA. While this specification provides illustrative examples of specific constructs, using the information provided herein, one of skill in the art may select and design other suitable constructs, using a choice of spacers, promoters, and other elements, including at least one translational start and stop signal, and the optional addition of polyadenylation sites.

[0131] The rAAV virions can be produced by culturing a host cell containing a rAAV virus as described herein which contains a rAAV genome to be packaged into a rAAV virion, an AAV rep sequence and an AAV cap sequence under the control of regulatory sequences directing expression thereof. Suitable viral helper genes, e.g., adenovirus E2A, E40rf6 and VA, among other possible helper genes, may be provided to the culture in a variety of ways known to the art, preferably on a separate plasmid. Thereafter, the recombinant AAV virion which directs expression of the transgene is isolated from the cell or cell culture in the absence of contaminating helper virus or wildtype AAV.

[0132] rAAV purification processes can include one or more of the following phases: (i) harvest of the producer cells, occasionally with the supernatant, (ii) chemical (e.g., detergent and ion containing lysis buffers) and / or mechanical (e.g., freeze-thaw, microfluidization) cell lysis to liberate AAV particles, (iii) cellular and viral nucleic acid removal, e.g., by enzymatic digestion (Benzonase), (iv) one to three step particle separation by chromatography and optionally density gradients, and (v) concentration, formulation, and sterile filtration.

[0133] Purification methods for rAAV virions are known in the art and include density gradient ultracentrifugation, gradient sedimentation, nonionic iodixanol gradients followed by ion-exchange or heparin-affinity column chromatography, ion-exchange chromatography, mucin columns, tangential flow filtration, etc.

[0134] Expression of a transgene may be measured in ways known in the art. For example, a target cell may be infected in vitro, and the number of copies of the transgene in the cell monitored by Southern blotting or quantitative polymerase chain reaction (PCR). The level of RNA expression may be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and the level of protein expression may be monitored by Western blotting,immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or by the specific methods detailed below in the Examples.

[0135] Cells

[0136] In embodiments, the nucleic acid constructs, including expression constructs, and vectors disclosed herein are used to deliver a NARE operatively linked to a transgene to a cell. Provided herein are cells comprising a NARE, an expression acid construct, or a vector disclosed herein. In embodiments, the cell is a liver cell, a muscle cell, or a neuron. The cell may be a mammalian cell. The cell may be a human cell. The cell may be isolated.

[0137] Pharmaceutical Compositions

[0138] Provided herein are pharmaceutical compositions comprising a nucleic acid construct or vector disclosed herein and a pharmaceutically acceptable excipient.

[0139] The expression construct or vector disclosed herein is preferably assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0140] Formulations of the nucleic acid constructs or vectors disclosed herein disclosed herein involve the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly one suitable for injection, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels. The nucleic acid constructs or vectors disclosed herein can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to the vector, a pharmaceutically and / or physiologically acceptable excipient, carrier, buffer, stabilizer, antioxidants, preservative, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration. The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, incorporated herein by reference. Physiological saline solution, magnesium chloride, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. In some cases, a surfactant, such as pluronic acid (PF68) 0.001 % may be used. In some cases, Ringer's Injection, Lactated Ringer's Injection, or Hartmann's solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included, as required.

[0141] Pharmaceutical compositions comprising a nucleic acid construct or vector disclosed herein may formulated with one or more pharmaceutically-acceptable excipients, which can be a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent or encapsulating material, involved in carrying or transporting the therapeutic compound for administration to the subject, bulking agent, salt, surfactant and / or a preservative. Some examples of materials which can serve as pharmaceutically-acceptable excipients include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0142] A bulking agent is a compound which adds mass to a pharmaceutical formulation and contributes to the physical structure of the formulation in lyophilized form. Suitable bulking agents according to the present disclosure include mannitol, glycine, polyethylene glycol and sorbitol.

[0143] The use of a surfactant can reduce aggregation and / or reduce the formation of particulates in the reconstituted formulation. The amount of surfactant added is such that it reduces aggregation of the reconstituted protein and minimizes the formation of particulates after reconstitution. Suitable surfactants according to the present disclosure include polysorbates (e.g. polysorbates 20 or 80); poloxamers (e.g. poloxamer 188); Triton; sodium dodecyl sulfate (SDS); sodium laurel sulfate; sodium octyl glycoside; lauryl-, myristyl-, linoleyl-, or stearyl-sulfobetaine; lauryl-, myristyl-, linoleyl-or stearyl-sarcosine; linoleyl-, myristyl-, or cetyl-betaine; lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-betaine (e.g. lauroamidopropyl); myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-dimethylamine; sodium methyl cocoyl-, or disodium methyl oleyl-taurate; and polyethyl glycol, polypropyl glycol, and copolymers of ethylene and propylene glycol (e.g. Pluronics, PF68, etc.).

[0144] Preservatives may be used in formulations of disclosure . Suitable preservatives for use in the formulation of the disclosure include octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyl-dimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other types of preservatives include aromatic alcohols such as phenol, butyl and benzylalcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol. Other suitable excipients can be found in standard pharmaceutical texts, e.g., in "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th Ed. Mack Publishing Company, Easton, Pa., (1995).

[0145] For delayed release, nucleic acid construct or vector disclosed herein may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.

[0146] If a vector is to be stored long-term, it may be frozen in the presence of a cryoprotectant, such as glycerol.

[0147] Methods

[0148] Provided herein are methods for inducing expression of a transgene in a cell and / or a tissue. Provided herein is a method of inducing the expression of transgene, the method comprising providing a cell comprising a nucleic acid construct comprising a NARE disclosed herein operatively linked to a transgene and cultivating the cells under conditions allowing for the expression of the transgene. In some embodiments, the cell is a liver cell, a muscle cell, or a neuron. The cell may be a mammalian cell. The cell may be a human cell. The cell may be isolated. Provided herein is a method for inducing expression of a transgene in vivo. Provided herein is a method for inducing expression of a transgene in vitro. Provided herein is a method for inducing expression of a transgene ex vivo.

[0149] It is to be understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention. It is further to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments of the invention, and in the invention generally.

[0150] Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which ar...

Claims

CLAIMSWe claim:

1. A nucleic acid regulatory element (NARE) comprising:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(c) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(d) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4;(e) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6;(f) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:9;(g) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(h) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:12 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 13;(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 15 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:16 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(k) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(l) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(q) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:17;(s) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, atleast 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11 ;(y) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55 and a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ I D NO: 11.

2. A NARE comprising:(a) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to one any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47 and 50-52;(b) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(c) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(d) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(e) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 12 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 13;(i) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 15 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 16 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) a sequence that has 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55 and a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

3. The NARE of claim 1 , wherein the NARE comprises:(a) any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) SEQ ID NO:5 and SEQ ID NO:6;(c) SEQ ID NO:1 and SEQ ID NO:2;(d) SEQ ID NO:3 and SEQ ID NO:4;(e) SEQ ID NO:4 and SEQ ID NO:6;(f) SEQ ID N0:8 and SEQ ID N0:9;(g) SEQ ID NO:10 and SEQ ID N0:11;(h) SEQ ID N0:12 and SEQ ID N0:13;(i) SEQ ID N0:15 and SEQ ID N0:2;G) SEQ ID N0:16 and SEQ ID N0:17;(k) SEQ ID NO:24 and SEQ ID N0:17;(l) SEQ ID NO:26 and SEQ ID NO:27;(m)SEQ ID NO:28 and SEQ ID NO:29;(n) SEQ ID NQ:30 and SEQ ID N0:31;(o) SEQ ID NO:32 and SEQ ID NO:33;(p) SEQ ID NO:34 and SEQ ID N0:17;(q) SEQ ID NO:35 and SEQ ID NO:36;(r) SEQ ID NO:37 and SEQ ID N0:17;(s) SEQ ID NO:39 and SEQ ID NO:33;(t) SEQ ID NQ:40 and SEQ ID NO:36;(u) SEQ ID N0:41 and SEQ ID N0:17;(v) SEQ ID NO:42 and SEQ ID NO:43;(w) SEQ ID NO:48 and SEQ ID NO:33;(x) SEQ I D NO:49 and SEQ I D NO: 11 ;(y) SEQ ID NO:53 and SEQ ID N0:17;(z) SEQ ID NO:54 and SEQ ID NO:36; or(aa) SEQ ID NO:55 and SEQ ID N0:11.

4. The NARE of any one of claims 1-3, wherein the NARE further comprises one or more of (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to a sequence comprising consecutive nucleotides of SEQ ID NQ:160, or (iii) T, TAG, TAGGCTG, TAGGCTGT, or any one of SEQ ID NOs:147, 156, or 158.

5. The NARE of claim 4, wherein the NARE further comprises one or more of (i) any one of SEQ ID NOs: 150-155, 157, 159, or 160, (ii) a sequence comprising consecutive nucleotides of SEQ ID NQ:160, (iii) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:147, 156, or 158,.

6. The NARE of claim 1 or 4, wherein the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (c) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9; (g) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;G) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is atleast 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (p) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (q) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (r) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (s) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (t) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; (u) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17;(v) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NOs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43; (w) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33; (x) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (y) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (z) (i) T, TAG, TAGGCTG, TAGGCTGT, any one of SEQ ID NOs:156 or 158, or a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to any one of SEQ ID NQs:150-155, 157, 159, or 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99%identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

7. The NARE of claim 6, wherein the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (c) (i) optionally T, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:1, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(d) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:3, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4; (e) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:4, (ii) a sequence that is at least80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6; (f) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:8, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:9; (g) (i) a sequence that is at least 80% identical to TAGGCTG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 10, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11; (h) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 12, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:13;(i) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:15 and (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:2;(j) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 16, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (k) (i) a sequence that is at least 80% identical to TAGGCTGT, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99%identical to SEQ ID NO:24, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO: 17; (l) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:26, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:27;(m)(i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:28, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:29;(n) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:30, (ii) a sequence that is at least 80% identical to SEQ ID NO:147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:31;(o) (i) a sequence that is at least 80% identical to SEQ ID NO: 150, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:32, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(p) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:34, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90%identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID N0:17;(q) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 151, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:35, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(r) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 152, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:37, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(s) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 153, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:39, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(t) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 154, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NQ:40, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36;(u) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 155, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:41, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(v) (i) a sequence that is at least 80% identical to SEQ ID NO: 156, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:42, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:43;(w) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 157, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:48, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:33;(x) (i) a sequence that is at least 80% identical to SEQ ID NO: 158, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:49, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11;(y) (i) a sequence that is at least 80% identical, at least 90% identical, or at least 95% identical to SEQ ID NO: 159, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:53, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:17;(z) (i) a sequence that is at least 80% identical to SEQ ID NO: 160, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:54, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:55, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:11.

8. The NARE of claim 2, wherein the NARE comprises:(a) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(c) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(k) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(p) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(q) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID N0s:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(r) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(s) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(t) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36;(u) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(v) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43;(w) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33;(x) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID N0s:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(y) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 17;(z) (i) TAGGCTG, TAGGCTGT, ora sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NQs:150-160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

9. The NARE of claim 8, wherein the NARE comprises:(a) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:5, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(c) (i) optionally T, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:1, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(d) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:3, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4;(e) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:4, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:6;(f) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:8, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:9;(g) (i) a sequence that has 1, 2, 3, 4, 5, 6, or 7 nucleic acid substitutions as compared to TAGGCTG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 10, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11;(h) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:12, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:13;(i) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:15 and (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:2;(j) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:16, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(k) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7 or, 8 nucleic acid substitutions as compared to TAGGCTGT, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:24, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17;(l) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:26, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:27;(m)(i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:28, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:29;(n) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:30, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 147, and (iii) a sequence thathas 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:31;(o) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 150, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:32, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (p) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:34, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (q) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 151, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:35, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (r) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 152, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:37, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (s) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 153, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:39, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (t) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 154, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NQ:40, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; (u) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 155, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:41 , and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (v) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 156, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:42, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:43; (w) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 157, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10nucleic acid substitutions as compared to SEQ ID NO:48, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:33; (x) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 158, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:49, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11 ; (y) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 159, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:53, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:17; (z) (i) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO: 160, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:54, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:55, and (iii) a sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid substitutions as compared to SEQ ID NO:11.

10. The NARE of claim 6 or 8, wherein the NARE comprises:(a) any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(c) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(d) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;G) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:24, and (iii) SEQ ID NO:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:31;(o) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID N0s:150-160, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:34, and (iii) SEQ ID N0:17;(q) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:37, and (iii) SEQ ID NO:17;(s) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:41, and (iii) SEQ ID NO:17;(v) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:49, and (iii) SEQ ID NO:11;(y) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:53, and (iii) SEQ ID NO:17;(z) (i) any one of TAGGCTG, TAGGCTGT, and SEQ ID NQs:150-160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

11. The NARE of claim 10, wherein the NARE comprises:(a) any one of SEQ ID NOs:146, 7, 14, 18-23, 25, 38, 44-47, and 50-52;(b) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(c) (i) optionally T, (ii) SEQ ID NO:1, and (iii) SEQ ID NO:2;(d) (i) SEQ ID NO:3, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:4;(e) (i) SEQ ID NO:4, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6;(f) (i) SEQ ID NO:8, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:9;(g) (i) TAGGCTG, (ii) SEQ ID NQ:10, and (iii) SEQ ID NO:11;(h) (i) SEQ ID NO:12, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:13;(i) (i) SEQ ID NO:15 and (ii) SEQ ID NO:2;G) (i) TAGGCTGT, (ii) SEQ ID NO:16, and (iii) SEQ ID NO:17;(k) (i) TAGGCTGT, (ii) SEQ ID NO:24, and (iii) SEQ ID N0:17;(l) (i) SEQ ID NO:26, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:27;(m)(i) SEQ ID NO:28, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:29;(n) (i) SEQ ID NQ:30, (ii) SEQ ID NO:147, and (iii) SEQ ID N0:31;(o) (i) SEQ ID NQ:150, (ii) SEQ ID NO:32, and (iii) SEQ ID NO:33;(p) (i) SEQ ID N0:151, (ii) SEQ ID NO:34, and (iii) SEQ ID N0:17;(q) (i) SEQ ID N0:151, (ii) SEQ ID NO:35, and (iii) SEQ ID NO:36;(r) (i) SEQ ID NO:152, (ii) SEQ ID NO:37, and (iii) SEQ ID N0:17;(s) (i) SEQ ID NO:153, (ii) SEQ ID NO:39, and (iii) SEQ ID NO:33;(t) (i) SEQ ID NO:154, (ii) SEQ ID NQ:40, and (iii) SEQ ID NO:36;(u) (i) SEQ ID NO:155, (ii) SEQ ID N0:41, and (iii) SEQ ID N0:17;(v) (i) SEQ ID NO:156, (ii) SEQ ID NO:42, and (iii) SEQ ID NO:43;(w) (i) SEQ ID NO:157, (ii) SEQ ID NO:48, and (iii) SEQ ID NO:33;(x) (i) SEQ ID NO:158, (ii) SEQ ID NO:49, and (iii) SEQ ID N0:11;(y) (i) SEQ ID NO:159, (ii) SEQ ID NO:53, and (iii) SEQ ID N0:17;(z) (i) SEQ ID NQ:160, (ii) SEQ ID NO:54, and (iii) SEQ ID NO:36; or(aa) (i) optionally TAG, (ii) SEQ ID NO:55, and (iii) SEQ ID NO:11.

12. The NARE of claim 1, wherein the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NQs:100-143.

13. The NARE of claim 12, wherein the NARE comprises any one of SEQ ID NQs:100-143.

14. The NARE of claim 12, wherein the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs:56-99.

15. The NARE of claim 14, wherein the NARE comprises any one of SEQ ID NOs:56-99.

16. The NARE of claim 7, wherein the NARE comprises:(a) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NO: 146;(b) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NO:7; or(c) (i) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:5, (ii) a sequence that is at least 80% identical to SEQ ID NO: 147, and (iii) a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to SEQ ID NO:6.

17. The NARE of claim 16, wherein the NARE comprises:(a) SEQ ID NO:146;(b) SEQ ID NO:7; or(c) (i) SEQ ID NO:5, (ii) SEQ ID NO:147, and (iii) SEQ ID NO:6.

18. The NARE of claim 7, wherein the NARE comprises a sequence that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to any one of SEQ ID NOs: 105, 103, or 102.

19. The NARE of claim 18, wherein the NARE comprises any one of SEQ ID NOs: 105, 103, or 102.

20. An expression construct comprising the NARE of any one of claims 1-19, wherein the NARE is operatively linked to a transgene.

21. The expression construct of claim 20, further comprising a polyadenylation sequence and / or a post-transcriptional regulatory element.

22. A vector comprising the expression construct of claims 20 or 21.

23. The vector of claim 22, wherein the vector is a non-viral vector.

24. The vector of claim 22, wherein the vector is a viral vector.

25. The vector of claim 24, wherein the viral vector is an adeno-associated virus (AAV) vector.

26. The AAV vector of claim 25, wherein the AAV vector comprises a nucleic acid sequence comprising (i) the expression construct and (ii) one or more inverted terminal repeats (ITR).

27. The vector of claim 26, wherein the nucleic acid sequence comprises a 5' ITR and a 3' ITR.

28. The vector of claim 27, wherein the 5' ITR and a 3' ITR are derived from AAV serotype AAV2.

29. A cell comprising the expression construct of claims 20 or 21 or the vector of any one of claims 24-28.

30. The cell of claim 29, wherein the cell is a liver cell, muscle cell, or neuronal cell.

31. The cell of claim 29 or 30, wherein the cell is a human cell.

32. A pharmaceutical composition comprising: (i) the expression construct of claims 20 or 21 or the vector of any one of claims 24-28 and (ii) a pharmaceutically acceptable excipient.

33. A method for expressing a transgene in a cell comprising the expression construct of claims 20 or 21 or the vector of any one of claims 24-28.

34. The method of claim 33, wherein the cell is a liver cell, muscle cell, or neuronal cell.

35. The method of claim 33 or 34, wherein the cell is a human cell.

36. The method of any one of claims 33-35, wherein the method is performed in vitro or ex vivo.

Citation Information

Patent Citations

  • Hybrid adenovirus-AAV vector and methods of use therefor

    US5856152A

  • Hybrid adenovirus-AAV virus and methods of use thereof

    US5871982A

  • Methods for treatment of degenerative retinal diseases

    WO2000015822A1

  • Transcriptional regulatory elements of biological pathways, tools, and methods

    WO2008073303A2

  • Synthetic enhancers and promoters based on concatenated palindromic subsequences

    WO2023155020A1