Rnai preparation for inhibiting LPA gene expression and use thereof

Abstract

The present application relates to an RNA inhibitor for inhibiting LPA gene expression, which RNA inhibitor contains an antisense strand containing a complementary region that is complementary to at least a portion of an mRNA encoding LPA, wherein the complementary region is 17-23 nucleotides in length, and the antisense strand contains a nucleotide sequence of any one of SEQ ID NOs: 1-272, 542-629 and 740-760, or a sequence that differs from the nucleotide sequences by no more than three nucleotides.

Description

An RNAi agent that inhibits LPA gene expression and its application Technical Field

[0001] This invention belongs to the field of molecular biology and relates to a modified double-stranded RNAi agent and its application, specifically to a double-stranded RNAi agent that inhibits LPA gene expression and its pharmaceutical composition, as well as the application of the double-stranded RNAi agent or its pharmaceutical composition in treating diseases mediated by LPA expression. Background Technology

[0002] RNA interference (RNAi) is a widespread phenomenon in various species in nature. Andrew Fire and Craig Mello et al. first discovered RNAi in the nematode *Caenorhabditis elegans* (*C. elegans*) in 1998, and Tuschl and Phil Sharp et al. confirmed its existence in mammals in 2001. Since then, research on the mechanisms, gene functions, and clinical applications of RNAi has made significant progress. RNAi plays a crucial role in various protective mechanisms, such as defense against viral infections and transposon jumping (Hutvágner et al., 2001; Elbashir et al., 2001; Zamore 2001). Products developed based on the RNAi mechanism are promising drug candidates. Small interfering RNA (siRNA) can exert RNA interference effects and is a primary tool for achieving RNAi.

[0003] Lipoprotein(a) [Lp(a)] consists of low-density lipoprotein (LDL)-like particles and apolipoprotein a [Apo(a)], which are covalently linked by disulfide bonds (Cegla J, et al. Atherosclerosis, 2019, 291:62-70.). The LDL-like particles contain approximately 30%–46% cholesterol, apolipoprotein B100 (ApoB100), and oxidized phospholipids (OxPL), and are structurally and compositionally very similar to LDL-C (Merki et al., Circulation. 2021). Apo(a) is an Lp(a)-specific apolipoprotein, accounting for approximately 25%–40% of the total Lp(a) particles. In higher mammals, Apo(a) protein is specifically expressed in the liver by the LPA gene. The Apo(a) protein has 10 homologous kringle IV (KIV) domains, of which KIV2 has 2-40 copies, while the other KIV domains have only one copy. The polymorphism of the KIV2 domain of the Apo(a) protein determines the molecular weight of Lp(a) and the differences in plasma Lp(a) levels among individuals (Ward, et al., J. Clin. Med. 2019, 8(12), 2073). Unlike LDL-C, Lp(a) cannot be produced by the degradation and conversion of ingested chylomicrons or VLDL, nor can it be further converted into other lipoproteins; it is a completely independent liver-synthesized lipoprotein. Studies have found that the expression level of Lp(a) is almost entirely affected by genetic factors, and one-fifth of the global population has congenitally high Lp(a) expression. This has also led to the current lack of marketed targeted drugs for Lp(a).

[0004] Genomics, epidemiology, and Mendelian randomized controlled trials have all shown that elevated Lp(a) is an independent risk factor for atherosclerotic cardiovascular disease (ASCVD), including coronary artery disease, ischemic stroke, peripheral vascular disease, and calcific aortic stenosis (Kronenberg et al., European Heart Journal. 2022). Furthermore, based on relevant studies and existing phase I clinical trial results, long-term knockdown of Lp(a) does not lead to serious side effects. Therefore, developing a therapeutic agent that can effectively lower Lp(a) levels in the long term holds promising clinical potential. Summary of the Invention

[0005] The purpose of this application is to provide an LPA RNA inhibitor that interferes with LPA mRNA, disrupts its function as a translation template, prevents the synthesis of apo(a), and thus also prevents the formation of Lp(a) particles.

[0006] On the one hand, this application provides an RNA inhibitor for inhibiting LPA gene expression, comprising an antisense strand, wherein the antisense strand contains a complementary region that is complementary to at least a portion of the mRNA encoding LPA, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises any one of the following nucleotide sequences: SEQ ID NO.: 1-272, 542-629, 740-760 or a sequence differing from it by no more than 3 nucleotides.

[0007] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is characterized in that it further comprises a sense strand, wherein the sense strand and the antisense strand have at least 80% base complementarity.

[0008] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the sense and antisense strands exist on two different nucleic acid strands.

[0009] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is wherein the sense and antisense strands are 100% complementary.

[0010] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is characterized in that at least one strand has a 3' overhang of 0 to 6 nucleotides in length.

[0011] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is characterized in that both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

[0012] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is characterized in that the lengths of the sense strand and the antisense strand are 16 to 35 nucleotides, respectively.

[0013] In some embodiments, the RNA inhibitor for inhibiting LPA gene expression is characterized in that one strand of the RNA inhibitor for inhibiting LPA gene expression has at least 75% homology or complementarity with a nucleotide sequence selected from the target region location information shown in Table 1.

[0014] In some embodiments, the RNA inhibitor that inhibits LPA gene expression is characterized in that its sense strand is selected from any one of SEQ ID NO:273-541, 630-697, 734-739 or a sequence that differs from it by no more than 3 nucleotides.

[0015] In some embodiments, the RNA inhibitor that inhibits LPA gene expression includes at least one nucleotide that is a chemically modified nucleotide.

[0016] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the chemical modification is at least one of the following modifications:

[0017] (1) Modification of the phosphodiester bonds linking nucleotides in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression;

[0018] (2) Modification of the 2'-OH of the ribose in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression;

[0019] (3) Modification of the bases in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression.

[0020] In some embodiments, the RNA inhibitor that inhibits LPA gene expression wherein there are at least two consecutive phosphate thioester bonds between the nucleotides of the sense strand and / or antisense strand.

[0021] In some embodiments, the RNA inhibitor that inhibits LPA gene expression wherein there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the ends of the sense and / or antisense strands.

[0022] In some embodiments, the RNA inhibitor that inhibits LPA gene expression wherein the -OH at the 2' position of the nucleotide glycosyl group at positions 7, 9, 10, and 11, starting from the 5' end of the positive strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide glycosyl groups of the positive strand is replaced by methoxy groups.

[0023] In some embodiments, the RNA inhibitor that inhibits LPA gene expression wherein the -OH at the 2' position of the nucleotide glycosyl group at positions 2, 14, and 16, starting from the 5' end of the antisense strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide glycosyl groups of the antisense strand is replaced by methoxy groups.

[0024] In some embodiments, the RNA inhibitors that inhibit LPA gene expression include: L4230, SL0840, SL0842, SL2656, TL2547, TL3282, TL32821, TL32823, TL32826, TL32832, TL32833, TL32834, L3385, L3581, L3970, L4282, SL0284, SL0612, SL0695, SL2665, SL2995, SL4016, SL4019, TL2700, TL2702, TL2703, TL2704, TL2705, TL2542, TL2543, TL3281, TL3284, and TL4229.

[0025] In some embodiments, the RNA inhibitors that inhibit LPA gene expression include: L4230MW02, SL840MW02, SL842MW02, SL2656MW02, TL2547MW02, TL3282MW02, TL32821MW02, TL32823MW02, TL32826MW02, TL32832MW02, TL32833MW02, TL32834MW02, L3385MW02, L3581MW02, and L3970MW02. , L4282MW02, SL284MW02, SL612MW02, SL695MW02, SL2665MW02, SL2995MW02, SL4016MW02, SL4019MW02, TL2700MW02, T L2702MW02, TL2703MW02, TL2704MW02, TL2705MW02, TL2542MW02, TL2543MW02, TL3281MW02, TL3284MW02, TL4229MW02.

[0026] In some embodiments, the RNA inhibitor that inhibits LPA gene expression further comprises a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

[0027] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the ligand is conjugated to the 5' end and / or 3' end of the antisense strand.

[0028] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the ligand is conjugated to the 5' end and / or 3' end of the sense strand.

[0029] In some embodiments, the RNA inhibitor that inhibits LPA gene expression or a pharmaceutically acceptable salt thereof, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

[0030] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

[0031] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, wherein the ligand is conjugated to the 5' and 3' ends of the sense strand.

[0032] In some embodiments, the RNA inhibitor that inhibits LPA gene expression further includes a targeting unit for enhancing the uptake of the RNA inhibitor by hepatocytes.

[0033] In some embodiments, the RNA inhibitor that inhibits LPA gene expression has a targeting unit selected from monosaccharides and their derivatives.

[0034] In some embodiments, the RNA inhibitor for inhibiting LPA gene expression described herein, wherein the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose.

[0035] In some embodiments, the RNA inhibitor that inhibits LPA gene expression includes a monosaccharide derivative selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

[0036] In some embodiments, the RNA inhibitor that inhibits LPA gene expression has a targeting unit selected from galactose, galactosamine, N-acetylgalactosamine, and their derivatives.

[0037] In some embodiments, the RNA inhibitor that inhibits LPA gene expression has a targeting unit that is N-acetylgalactosamine or its derivatives.

[0038] On the other hand, this application provides a pharmaceutical composition comprising the aforementioned RNA inhibitor that inhibits LPA gene expression, and / or physiologically acceptable excipients and / or carriers and / or diluents.

[0039] In some embodiments, the pharmaceutical composition further comprises an RNA inhibitor that inhibits PCSK9 gene expression.

[0040] In some embodiments, the pharmaceutical composition wherein the RNA inhibitor that inhibits PCSK9 gene expression comprises an antisense strand, the antisense strand comprising a complementary region that is complementary to at least a portion of the mRNA encoding PCSK9, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises any one of the following nucleotide sequences: SEQ ID NO.: 700, 701, 704, 705, 707, 709, 711, 713 or a sequence differing from it by no more than 3 nucleotides.

[0041] In some embodiments, the pharmaceutical composition, wherein the RNA inhibitor that inhibits PCSK9 gene expression further comprises a sense strand selected from any one of SEQ ID NO: 698, 699, 702, 703, 706, 708, 710, 712 or a sequence differing from it by no more than 3 nucleotides.

[0042] In some embodiments, the pharmaceutical composition wherein the RNA inhibitor that inhibits PCSK9 gene expression is described is...

[0043] (a) The justice chain is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO:699), and the antisense chain is AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO:701), or

[0044] (b) The justice chain is CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmUm (SEQ ID NO:703), and the antisense chain is AmsGfsCmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO:705) or

[0045] (C) The justice chain is CmsUmsUmUmUmGmUfAmAfCfUfUmGmAmAmGmAmUmAmUmAm (SEQ ID NO:708), and the antisense chain is UmsAfsUmAmUmCmUmUmCmAmAmGmUmUfAmCfAmAmAmAmGmsAmsAm (SEQ ID NO:709) or

[0046] (D) The justice chain is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmAm(SEQ ID NO:712), and the antisense chain is UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm(SEQ ID NO:713).

[0047] In some embodiments, the pharmaceutical composition wherein the unit dose ratio of the RNA inhibitor inhibiting LPA gene expression and the RNA inhibitor inhibiting PCSK9 gene expression is 1:10-10:1, for example, 1:10-10:1, 1:9-9:1, 1:8-8:1, 1:7-7:1, 1:6-6:1, 1:5-5:1, 1:4-4:1, 1:3-3:1, 1:2-2:1, 1:10-9:1, 1 :10-8:1, 1:10-7:1, 1:10-6:1, 1:10-5:1, 1:10-4:1, 1:10-3:1, 1:10-2:1, 1:10-1:1, 1:9-10:1, 1:8-10:1, 1:7-10:1, 1:6-10:1, 1:5-10:1, 1:4-10:1, 1:3-10:1, 1:2-10:1, 1:1-10:1, preferably about 1:1.

[0048] In some embodiments, the pharmaceutical composition is wherein the pharmaceutical is prepared for injection.

[0049] In some embodiments, the pharmaceutical composition is wherein the drug is prepared for intravenous injection.

[0050] In some embodiments, the pharmaceutical composition is wherein the pharmaceutical ingredient is prepared as a solid or a liquid.

[0051] In some embodiments, the pharmaceutical composition is wherein the pharmaceutical agent is prepared as an injectable.

[0052] In some embodiments, the pharmaceutical composition wherein the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in the same container.

[0053] In some embodiments, the pharmaceutical composition wherein the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in different containers.

[0054] In some embodiments, the pharmaceutical composition includes a delivery medium.

[0055] In some embodiments, the pharmaceutical composition wherein the delivery medium comprises liposomes.

[0056] According to another aspect of this application, a kit or delivery device is provided that comprises the pharmaceutical composition described herein.

[0057] According to another aspect of this application, there is provided the use of the RNA inhibitor that inhibits LPA gene expression and / or the pharmaceutical composition thereof in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or pathology.

[0058] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated levels of Lp(a) or apo(a).

[0059] In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases.

[0060] In some embodiments, the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD).

[0061] In some embodiments, the cardiovascular and cerebrovascular diseases include coronary heart disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

[0062] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated PCSK9 levels.

[0063] In some embodiments, the disease or pathology includes hypercholesterolemia.

[0064] In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases.

[0065] In some embodiments, the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic stenosis.

[0066] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated levels of low-density lipoprotein cholesterol (LDL-C).

[0067] In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases.

[0068] In some embodiments, the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD).

[0069] In some embodiments, the cardiovascular and cerebrovascular diseases include coronary heart disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

[0070] According to another aspect of this application, a method for preventing or treating a disease, symptom, or syndrome is provided, the method comprising administering to a subject in need an effective amount of the said RNA inhibitor that inhibits LPA gene expression, a pharmaceutically acceptable salt thereof, or the said pharmaceutical composition.

[0071] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

[0072] According to another aspect of this application, a method for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects is provided, comprising administering to cells, tissues or subjects an effective amount of an RNA inhibitor that inhibits LPA gene expression, a pharmaceutically acceptable salt thereof, or the pharmaceutical composition thereof.

[0073] In some embodiments, the method is described in which the cell is a liver cell.

[0074] In some embodiments, the method is performed where the tissue is liver tissue.

[0075] In some embodiments, the method is described in which the cells and tissues are ex vivo.

[0076] According to another aspect of this application, a method for inhibiting PCSK9 expression in cells, tissues, or subjects is provided, comprising administering to the cells, tissues, or subjects an effective amount of the said RNA inhibitor for inhibiting LPA gene expression, a pharmaceutically acceptable salt thereof, or the said pharmaceutical composition.

[0077] In some embodiments, the cells are liver cells.

[0078] In some embodiments, the tissue is liver tissue.

[0079] In some embodiments, the cells and tissues are ex vivo.

[0080] According to another aspect of this application, a method for inhibiting low-density lipoprotein cholesterol expression in cells, tissues, or subjects is provided, comprising administering to the cells, tissues, or subjects an effective amount of the said RNA inhibitor for inhibiting LPA gene expression, a pharmaceutically acceptable salt thereof, or the said pharmaceutical composition.

[0081] In some embodiments, the cells are liver cells.

[0082] In some embodiments, the tissue is liver tissue.

[0083] In some embodiments, the cells and tissues are ex vivo.

[0084] According to another aspect of this application, a method is provided for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects, comprising inhibiting the expression of LPA mRNA and / or Lp(a) and inhibiting the expression of PCSK9.

[0085] According to another aspect of this application, a method for inhibiting PCSK9 expression in cells, tissues or subjects is provided, comprising inhibiting LPA mRNA and / or Lp(a) expression, and inhibiting PCSK9 expression.

[0086] According to another aspect of this application, a method for inhibiting the expression of low-density lipoprotein cholesterol in cells, tissues or subjects is provided, comprising inhibiting the expression of LPA mRNA and / or Lp(a) and inhibiting the expression of PCSK9.

[0087] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0088] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0089] Figure 1 shows the psiCHECK-2 plasmid map used in the embodiments of this application;

[0090] Figure 2 shows a schematic diagram of the conjugation method of L96 and siRNA described in this application. Detailed Implementation

[0091] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0092] Terminology Definition

[0093] In this application, the terms “iRNA,” “RNAi agent,” “iRNA agent,” and “RNA inhibitor” are used interchangeably and generally refer to an agent containing RNA as defined herein and which mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA directs sequence-specific degradation of mRNA via a process called RNA interference (RNAi). iRNA regulates (e.g., inhibits) the expression of the LPA gene (e.g., the human transcript of the LPA gene, transcript number: NM_005577.4) in cells (e.g., cells in a subject, such as a mammalian subject).

[0094] iRNA regulates (e.g., inhibits) the expression of the PCSK9 gene (e.g., NCBI Reference Sequence: NM_001407240.1, Homo sapiens PCSK9 mRNA) in cells (e.g., cells in subjects such as mammalian subjects).

[0095] In some embodiments, the RNAi agent may be a single-stranded siRNA (ssRNAi) introduced into cells or organisms to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNA is typically 15 to 30 nucleotides long and chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the full contents of which are incorporated herein by reference. Any antisense nucleotide sequence described herein may be used as a single-stranded siRNA chemically modified by the methods described herein or by methods described in Lima et al. (2012) Cell 150:883-894.

[0096] In some embodiments, the “iRNA” used in this application is double-stranded RNA, and is referred to herein as a “double-stranded RNAi agent,” “double-stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA.” The term “dsRNA” refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, described as having “sense” and “antisense” orientations relative to the target RNA (i.e., the LPA gene or the PCSK9 gene). In some embodiments of this application, double-stranded RNA (dsRNA) triggers the degradation of the target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0097] The double-stranded structure can be of any length that allows for the specific degradation of the desired target RNA via the RISC pathway, and can be in the length range of about 19 to 36 base pairs, for example, about 19-30 base pairs, for example, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. The ranges and lengths between these ranges and lengths are also included in this application. In some embodiments, the iRNA agent of this application is dsRNA containing 15-23 nucleotides per strand, which interacts with the target RNA sequence (e.g., the LPA gene or the PCSK9 gene) to guide the cleavage of the target RNA.

[0098] LPA is the name of the gene encoding apolipoprotein(a) (apo(a)), which is primarily expressed in the liver, and its expression is limited to humans and non-primates. Apolipoprotein(a) is attached to apo(B)-100 via disulfide bonds, combining with a lipid core to form lipoprotein(a) (Lp(a)) particles. Lp(a) particles are specialized large lipoprotein molecules rich in cholesterol, coated with cholesterol and phospholipids, and embedded with hydrophilic apolipoprotein components apolipoprotein(a) and apo(B)-100. Lp(a) can enter and deposit on the blood vessel wall, promoting atherosclerosis. Lp(a) is structurally homologous to plasminogen (PLG) and can compete with plasminogen for fibrin binding sites, thereby inhibiting fibrinogen hydrolysis and promoting thrombus formation. Therefore, Lp(a) is closely related to atherosclerosis and thrombosis. Studies have shown that blood Lp(a) levels are an independent risk factor for cardiovascular disease, stroke, and atherosclerotic stenosis.

[0099] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides or similar compounds) of any length. Polynucleotides can have any three-dimensional structure and can perform any function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents, and primers. Polynucleotides may be modified or substituted at one or more bases, sugars, and / or phosphate esters with any of the various modifications or substitutions described in this application or known in the art. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, the nucleotide structure may be modified before or after polymer assembly. The nucleotide sequence may be blocked by non-nucleotide components. Polynucleotides can be modified post-polymerization, for example, by coupling with a labeled component. The term can refer to both double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment of a polynucleotide in this application includes both double-stranded forms and each of two complementary single-stranded forms known or predicted to constitute a double-stranded form.

[0100] In this application, the terms "target nucleic acid" or "target sequence" generally refer to a continuous portion of the nucleotide sequence of the mRNA molecule formed during transcription of the LPA or PCSK9 gene, including mRNA that is the RNA processing product of the major transcription product. The target portion of the sequence should be at least long enough to serve as a substrate for iRNA-guided cleavage at or near the location of that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the LPA or PCSK9 gene. In one embodiment, the target sequence is located within the protein-coding region of LPA or PCSK9. The target sequence may be about 19-36 nucleotides in length, for example, preferably about 19-30 nucleotides in length. Ranges and lengths between the above ranges and lengths also include portions of this application.

[0101] In this application, the term "nucleotide sequence" generally refers to a series or sequence of nucleobases, nucleotides and / or nucleosides, whether modified or unmodified, described by a series of letters using standard nucleotide nomenclature and the symbol table of modified nucleotides described in this application.

[0102] In this application, the term "oligonucleotide" generally refers to a polymer composed of multiple nucleotide residues (deoxyribonucleotides or ribonucleotides, or their associated structural variants or synthetic analogs) linked by phosphodiester bonds (or their associated structural variants or synthetic analogs). Therefore, while the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and their linkages are naturally occurring, it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), aminophosphates, thiophosphates, methylphosphates, 2-O-methylribonucleic acid, etc. The exact size of the molecule may depend on the specific application. Oligonucleotides are generally short in length, typically containing about 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.

[0103] In some embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified oligonucleotide" generally means an oligonucleotide comprising at least one modified nucleotide and / or at least one modified nucleotide linked together.

[0104] In this application, the term "modified nucleoside" generally refers to a nucleoside that contains at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise modified sugar moieties and / or modified nucleobases.

[0105] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). Nucleotides may include modified nucleotides or nucleotide mimics, base-free sites (Ab or X), or substitute substituted portions. As used in this application, "nucleobase sequence" generally refers to a sequence of consecutive nucleobases independent of any sugar, linking, or nucleobase modification. The terms "unmodified nucleobase" or "naturally occurring nucleobase" generally refer to naturally occurring heterocyclic nucleobases in RNA or DNA: purine bases adenine (a) and guanine (g); and pyrimidine bases thymine (t), cytosine (c) (including 5-methylc), and uracil (u). "Modified nucleobase" generally refers to any nucleobase that is not naturally occurring.

[0106] In this application, the term "sugar moiety" generally means either a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means ribofuranosyl as found in naturally occurring RNA or ribofuranosyl as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or a sugar substitute.

[0107] In this application, the term "nucleoside linkage" generally refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring nucleoside linkage" refers to a 3' to 5' phosphodiester linkage. "Modified nucleoside linkage" refers to any nucleoside linkage other than a naturally occurring one.

[0108] In this application, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide molecule having a nucleobase sequence complementary to a corresponding fragment of a target nucleic acid (e.g., a target genomic sequence, a precursor mRNA, or an mRNA molecule). In some embodiments, the antisense oligonucleotide is 12 to 30 nucleobases in length. In some embodiments, the antisense oligonucleotide is an unmodified or modified nucleic acid having a nucleotide sequence complementary to the sequence of a target nucleic acid (such as LPA or PCSK9 polynucleotide).

[0109] In this application, the term "antisense strand" generally refers to a strand of an RNA inhibitor (e.g., dsRNA) that includes a region substantially complementary to the target sequence. When used herein, the term "complementary region" generally refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., the target sequence) as defined herein. When the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or in terminal regions. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0110] In this application, the term "sense strand" (S) generally refers to a strand of an RNA inhibitor that includes regions substantially complementary to the region referred to herein as the antisense strand. By means of their sequences, the antisense strand targets the desired mRNA, while the sense strand targets a different target. Thus, if the antisense strand is incorporated into a RISC, the correct target is targeted. Incorporation of the sense strand can lead to off-target effects. These off-target effects can be limited by using modifications on the sense strand or by using a 5' cap.

[0111] In this application, the term "complementary" when used to describe the first nucleotide sequence (e.g., the positive strand of an RNAi agent, or LPA or PCSK9 mRNA) in relation to the second nucleotide sequence (e.g., the antisense strand of an RNAi agent) refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize (form base pair hydrogen bonds) with an oligonucleotide or polynucleotide containing the second nucleotide sequence under certain conditions to form a double helix or double-stranded structure. Complementary sequences include Watson-Crickbase pairs or non-Watson-Crickbase pairs, and include native or modified nucleotides or nucleotide mimics, provided that the above requirements regarding their hybridization ability are met. "Complementarity" does not necessarily require nucleobase complementarity on every nucleotide. Instead, some mismatches are tolerable.

[0112] In this application, the term "fully complementary" generally means that all (100%) bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The sequential sequence may comprise all or part of the first or second nucleotide sequence. As used herein, "partially complementary" generally means that in the hybridized nucleobase sequence pair, at least about 70% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. As used herein, "substantially complementary" generally means that in the hybridized nucleobase sequence pair, at least about 90% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The terms "complementary," "fully complementary," and "substantially complementary" as used herein may be used in relation to base matching between the sense and antisense strands of the RNA inhibitor or between the antisense strand of the RNA inhibitor and the sequence of LPA or PCSK9 mRNA. Sequence identity or complementarity is independent of modification. For the purpose of determining identity or complementarity, for example, a and Af are complementary to U (or T) and are identical to A.

[0113] In this application, the terms “homological” or “homology” generally refer to the number of nucleotides in the subject nucleic acid sequence that have matched the same nucleotides of the reference nucleic acid sequence, typically determined by sequence analysis procedures (e.g., Karlin and Altschul, 1990, PNAS 87:2264-2268; Karlin and Altschul, 1993, PNAS 90:5873-5877) or by visual inspection. As used herein, the terms “complete homology” or “complete homology” generally refer to complete (100%) homology or “identity” between the reference sequence and the subject nucleic acid sequence. As used herein, the terms “substantially homologous” or “substantially homologous” generally mean that the subject sequence and the reference sequence share at least 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) homologous nucleotides at the same nucleotide positions.

[0114] In this application, the term "ligand" generally refers to any compound or molecule capable of covalently or otherwise chemically binding to a biologically active substance (such as an oligonucleotide). In some embodiments, the ligand is capable of interacting directly or indirectly with another compound, such as a receptor. The receptor interacting with the ligand may be present on the cell surface, or alternatively may be an intracellular and / or intercellular receptor. The interaction between the ligand and the receptor may result in a biochemical reaction, or may simply be a physical interaction or binding.

[0115] In this application, the terms “inducing,” “inhibiting,” “enhancing,” “increasing,” “reducing,” “lowering,” etc., generally refer to quantitative differences between two states. For example, “the amount of LPA or PCSK9 activity or expression effectively inhibited” means that the level of LPA or PCSK9 activity or expression in the treated sample will be lower than the level of LPA or PCSK9 activity or expression in the untreated sample. These terms apply, for example, to expression levels and activity levels. The terms “reducing” and “lowering” are used interchangeably and generally refer to any change less than the original. “Reducing” and “lowering” are relative terms and need to be compared between before and after measurement. “Reducing” and “lowering” include complete depletion.

[0116] In some embodiments, the term "reduction" refers to an overall reduction, detectable by standard methods known in the art (such as those described herein), of the expression level / amount of a gene, gene product (e.g., protein), or biomarker in a first sample compared to the expression level / amount of the corresponding gene, gene product (e.g., protein), or biomarker in a second sample by approximately 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the term "reduction" refers to a reduction in the expression level / amount of a gene or biomarker in the first sample, wherein the reduction is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold in the expression level / amount of the corresponding gene or biomarker in the second sample. In some embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.

[0117] In this application, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0118] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may typically contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. These pharmaceutically acceptable formulations may also typically contain compatible solid or liquid fillers, diluents, or encapsulation materials suitable for human administration. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0119] In this application, the term "lipid nanoparticle" generally refers to a vesicle containing a lipid layer encapsulating a pharmacologically active molecule, such as a nucleic acid molecule, for example, iRNA or a plasmid from which iRNA is transcribed.

[0120] In this application, the term "prevention and / or treatment" includes not only the prevention and / or treatment of disease, but also generally includes preventing the onset of disease, slowing or reversing the progression of disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated with it and / or preventing a further increase in the severity of the disease and / or any symptoms associated with it, preventing, reducing or reversing any physiological damage caused by the disease, and any pharmacological effects that are generally beneficial to the patient being treated. The RNAi agents or pharmaceutical compositions of this application do not need to achieve a complete cure or eradication of any symptom or manifestation of the disease to be considered a useful therapeutic agent. As recognized in the relevant art, a medicine used as a therapeutic agent may reduce the severity of a given disease state, but does not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a treatment administered prophylactically constitutes a viable preventive agent and does not need to completely and effectively prevent the onset of the condition. It is sufficient to simply reduce the effects of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reduce the likelihood of the disease occurring or worsening.

[0121] In this application, the terms "disease" or "symptom" are used interchangeably and generally refer to any deviation of a subject from a normal state, such as any change in the state of the body or certain organs, that impairs or disrupts the performance of function, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person who is ill or in contact with such a person. Disease or symptom may also be referred to as disorder, ailing, ailment, malady, disorder, sickness, illness, or complaint.

[0122] In this application, the term "administration" generally refers to the introduction of the pharmaceutical preparation of this application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intra-arterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal, or oral administration. The daily dose may be divided into one, two, or more doses in suitable forms to be administered at one, two, or more times during a certain time period.

[0123] In this application, the term "contact" generally refers to two or more substances of different types coming into contact with each other in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In some embodiments, it may refer to direct contact of the RNAi agent or composition of this application with cells or tissues. In other embodiments, the term refers to indirect contact of the RNA inhibitor or composition of this application with cells or tissues. For example, the method of this application includes a method in which a subject is exposed to the RNA inhibitor or composition of this application, and then the RNA inhibitor or composition contacts cells or tissues by diffusion or any other active or passive transport process known in the art (through which the compound circulates in vivo).

[0124] In this application, the terms "effective amount" or "effective dose" generally refer to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent generally refers to any amount of drug that, when used alone or in combination with another therapeutic agent, promotes disease remission (proven by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of the disease, or prevention of damage or disability due to the disease). A "preventive effective amount" or "preventive effective dose" of a drug generally refers to an amount of drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or relapse, inhibits the development or relapse of the disease. The ability of a therapeutic agent or preventive agent to promote disease remission or inhibit disease progression or relapse can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in an in vitro assay. In some embodiments, "effective amount" refers to an amount of RNA inhibitor that produces the expected pharmacological, therapeutic, or preventive outcome.

[0125] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) requiring diagnosis, prognosis, improvement, prevention, and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens and ducks, horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models.

[0126] In this application, the term "drug delivery device" generally includes: (i) an infusion module for administering to a subject a pharmaceutical composition comprising an active ingredient; (ii) a drug for infusion containing an active ingredient selected from the group consisting of: the pharmaceutical composition of this application, a drug, an RNA inhibitor that inhibits LPA gene expression, an RNA inhibitor that inhibits PCSK9 gene expression; and (iii) an optional pharmacodynamic monitoring module.

[0127] In this application, the terms “comprising,” “including,” “having,” “may,” “containing,” and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. The term “composed of” generally indicates that no other components can exist (or similarly, features, integers, steps, etc.). Unless the context clearly specifies otherwise, the singular forms such as “a,” “an,” “the” in English, and “a,” “a,” “the,” and “the” in Chinese generally include the plural form of the things referred to.

[0128] In this application, the term "about" generally means large, roughly, or around. When the term "about" is used to refer to a range of values, a cutoff value or a specific value is used to indicate that the stated value may differ from the listed value by up to 10%. Therefore, the term "about" can be used to cover variation of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a specific value.

[0129] It should be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least," and all subsequent numbers or integers logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides in a nucleic acid molecule of 21 nucleotides" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in that series or range.

[0130] It should be understood that "not more than" or "less than" as used herein refers to the logically lower value or integer adjacent to the phrase, such as zero, logically speaking, from the context. For example, a double-stranded strand with "not more than 3 nucleotides" overhangs has 3, 2, 1, or 0 nucleotide overhangs. When "not more than" appears before a series of numbers or ranges, it should be understood that "not more than" can modify each number in that series or range. Ranges used herein include both upper and lower limits.

[0131] Invention Details

[0132] Antisense Chain and Justice Chain

[0133] On the one hand, this application provides an RNA inhibitor that suppresses LPA gene expression.

[0134] In some embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of the LPA gene in cells, such as those of a subject (e.g., a mammal). The dsRNA includes an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed during LPA gene expression. This complementary region is approximately 12-30 nucleotides in length (e.g., approximately 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).

[0135] dsRNA consists of two RNA strands that can complement and hybridize under the conditions of dsRNA use to form a double-stranded structure (complementary region). One strand of the dsRNA (antisense strand) includes a complementary region that is substantially complementary to, and usually perfectly complementary to, the target sequence. The target sequence may be derived from the sequence that forms mRNA during LPA gene expression. The other strand (sense strand) includes a region complementary to the antisense strand, such that when combined under appropriate conditions, the two strands can hybridize and form a double-stranded structure. Typically, the length of the double-stranded structure is 12 to 30 base pairs. Similarly, the length of the complementary region to the target sequence is 12 to 30 nucleotides.

[0136] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the length of the dsRNA is sufficient to serve as a substrate for the Dicer enzyme. For example, it is known in the art that dsRNA longer than about 21-23 nucleotides can be used as a substrate for Dicer. Those skilled in the art also understand that the region of RNA targeted for cleavage is typically a portion of a larger RNA molecule (typically an mRNA molecule). A “portion” of the target is a continuous nucleotide sequence of the mRNA target, long enough to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0137] Those skilled in the art will also understand that the double-stranded region is the main functional part of dsRNA, for example, a double-stranded region of about 19 to about 30 base pairs, such as about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, or 19-20 base pairs. Therefore, in one embodiment, to achieve a functional double-stranded region (e.g., 15-30 base pairs) that targets the desired RNA for cleavage, an RNA molecule or a complex of RNA molecules having a double-stranded region of more than 30 base pairs is dsRNA.

[0138] In some implementations, there is at least about 80% base complementarity between the sense and antisense strands.

[0139] In some implementations, the sense strand and the antisense strand are each independently 15-30 nucleotides.

[0140] In some implementations, the sense strand and antisense strand are each independently 17-25 nucleotides.

[0141] In some implementations, the sense strand and antisense strand are each independently 19-23 nucleotides.

[0142] In some implementations, the positive strand is selected from any one of SEQ ID NO:273-541, 630-697, 734-739 or a sequence that differs from it by no more than 3 nucleotides.

[0143] In some embodiments, the sense strand of the RNA inhibitor is selected from Table 1 or sequences that differ from each of the sequences in Table 1 by one, two, or three nucleotides.

[0144] In some implementations, the antisense strand is selected from any one of SEQ ID NO:1-272, 542-629, 740-760 or a sequence that differs from it by no more than 3 nucleotides.

[0145] In some embodiments, the RNA inhibitor has a 3' overhang of 2-3 nucleotides in length on both strands, or a 3' overhang of 2-3 nucleotides in length on the sense strand, or a 3' overhang of 2-3 nucleotides in length on the antisense strand.

[0146] In some implementations, the RNA inhibitor has only a 3' overhang of 2 nucleotides in length on the antisense strand.

[0147] In some embodiments, the antisense strand of the RNA inhibitor is selected from Table 1 or sequences that differ from each of the sequences in Table 1 by one, two, or three nucleotides.

[0148] In some embodiments, one strand of the RNA inhibitor that inhibits LPA gene expression has at least 75% homology or complementarity with the nucleotide sequences selected from the target region location information shown in Table 1. The nucleotide sequences shown in Table 1 are the target sequences of the corresponding duplex or antisense strand. For example, the nucleotide sequence at positions 120-142 of NM_005577.4 is the target sequence of the L0120 antisense strand. It should be noted that the target region location information in Table 1 only represents the position of the first occurrence of the site; the same target sequence may appear multiple times within a transcript.

[0149] It is understandable that, given the large number of repetitive regions in the LPA gene, there are also many regions similar to a particular antisense strand. However, those skilled in the art should understand that only regions that are completely anti-complementary to the antisense strand can exert the greatest inhibitory effect. Those skilled in the art should also understand that a difference of 1 to 2 bases from the antisense strand and / or siRNA duplex may result in significant differences in the inhibitory function of the antisense strand and / or siRNA duplex itself.

[0150] In some embodiments, the sense and antisense strands of the RNA inhibitor are selected from the sequences in Table 1 or differ from each of the sequences in Table 1 by one, two, or three nucleotides.

[0151] Table 1

[0152] Modified nucleotides

[0153] To enhance the stability of the aforementioned RNA inhibitors in vivo, without affecting or even enhancing their activity, the sense and antisense strands of the RNA inhibitors can be modified. The nucleotides may have modifying groups, and the entire strand or parts of the strand may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.

[0154] The sense and antisense strands of the RNA inhibitor structure provided by this invention have a length of 15-30, preferably 19-23, and at least 85% base complementarity with each other. To enhance the stability of the sense and antisense strands in vivo, the sense and antisense strands of the RNA inhibitor can be modified without affecting or even enhancing activity. The nucleotides can have modifying groups, and can be modified entirely or partially, preferably completely. The modifications are techniques readily understood by researchers in the art and can be performed on the glycosyl portion, selecting one or more of the following: deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2'-modified nucleotides, 3' to 3'-linked (inverted) nucleotides, nucleotides containing non-natural bases, bridging nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me / 2'-fluorinated nucleotides, morpholinonucleotides, vinyl phosphate deoxyribonucleotides, vinyl phosphate-containing nucleotides, and cyclopropyl phosphate-containing nucleotides. The 2'-modified nucleotides include, but are not limited to: 2'-O-methylnucleotides, 2'-deoxy-2'-fluoronucleotides, 2'-deoxynucleotides, 2'-methoxyethylnucleotides, 2'-aminonucleotides, and 2'-alkylnucleotides. In the RNA inhibitors provided by this invention, neither the sense nor antisense strands of the RNA inhibitor require uniform modification; more than one modification can be incorporated into a single nucleotide. The modifications can also occur at the base moiety, and the modified nucleosides include synthetic and natural nucleosides, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 / N-6 and O-6 substituted purines, 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl of adenine and guanine, 2-alkyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, and 5-propynyluracil. , 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-uracil, 4-thiouracil, 8-halogen, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogen, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0155] The RNA inhibitor of the present invention comprises part or all of 2'-O-methyl nucleotides and / or 2'-deoxy-2'-fluoro nucleotides in its sense and antisense strands, and at least two consecutive phosphate thioester bonds exist between the nucleotides at the 5' end of its sense strand and the 3' end of its antisense strand, preferably with the phosphate ester bonds between the three consecutive terminal nucleotides being thiolated.

[0156] In some embodiments, the modified nucleotide is selected from: deoxyribonucleotides, nucleotide analogs, debased nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridging nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me / 2'-fluorinated nucleotides, morpholinonucleotides, vinyl phosphate deoxyribonucleotides, vinyl phosphate-containing nucleotides, and cyclopropyl phosphate-containing nucleotides.

[0157] In some embodiments, the 2'-modified nucleotide includes: 2'-O-methyl nucleotide, 2'-deoxy-2'-fluoro nucleotide, 2'-deoxy nucleotide, 2'-methoxyethyl nucleotide, 2'-amino nucleotide and / or 2'-alkyl nucleotide.

[0158] In some screening implementations, the sense and antisense strands of the RNAi agent are selected from the sequences in Table 1 or differ from each of the sequences in Table 1 by one, two, or three nucleotides.

[0159] In some embodiments, at least one of the -OH groups at the 2' position of the nucleotide glycosyl group at positions 2, 14, and 16, starting from the 5' end of the antisense strand, is fluorinated.

[0160] The -OH groups at the 2' positions of the nucleotide sugars at positions 2, 14, and 16, starting from the 5' end of the antisense strand, are fluorinated.

[0161] In some embodiments, except for the nucleotides at positions 2, 14, and 16 starting from the 5' end, at least one of the -OH groups at the 2' position of the remaining nucleotide sugars in the antisense strand is replaced by a methoxy group.

[0162] In some embodiments, the -OH at the 2' position of the nucleotide sugars at positions 2, 14, and 16, starting from the 5' end of the antisense strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide sugars in the antisense strand is replaced by methoxy groups.

[0163] At least one of the -OH groups at the 2' position of the nucleotide glycosyl group at positions 7, 9, 10, and 11, starting from the 5' end of the positive chain, is fluorinated.

[0164] In some embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end, at least one of the -OH groups at the 2' position of the nucleotide sugars in the positive chain is replaced by a methoxy group.

[0165] In some embodiments, the -OH at the 2' position of the nucleotide sugars at positions 7, 9, 10, and 11, starting from the 5' end of the positive chain, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide sugars in the positive chain is replaced by methoxy groups.

[0166] There are at least two consecutive phosphate thioester bonds between the nucleotides of the sense strand and / or antisense strand.

[0167] The -OH at the 2' position of the nucleotide glycosyl group at positions 2, 14, and 16, starting from the 5' end of the antisense strand, is replaced by fluorine, and the -OH at the 2' position of the nucleotide glycosyl group at the remaining positions of the antisense strand is replaced by methoxy, and there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the end of the antisense strand; the -OH at the 2' position of the nucleotide glycosyl group at positions 7, 9, 10, and 11, starting from the 5' end of the positive strand, is replaced by fluorine, and the -OH at the 2' position of the nucleotide glycosyl group at the remaining positions of the positive strand is replaced by methoxy, and there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the end of the positive strand.

[0168] Modified RNA inhibitors can include those shown in Table 2.

[0169] Table 2. Modified RNA Inhibitors

[0170] RNA inhibitors coupled with ligands

[0171] Another aspect of the RNA inhibitors in this application relates to a method of coupling interfering nucleic acids with ligands to enhance the stability, activity, cellular distribution, or cellular uptake of RNAi agents.

[0172] In some implementations, the distribution, targeting, or stability of RNA inhibitors is altered by introducing ligands for target tissue receptors. For example, specific ligands can provide enhanced affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cell or organ compartments, body tissues, organs, or regions)) compared to species where ligands are absent.

[0173] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, styrax, chitosan, chitin, inulin, cyclodextrin, N-acetylglucosamine, N-acetylglucosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, like synthetic polyamino acids.

[0174] The ligand may also include a targeting group, such as a cell or tissue target that binds to a specific cell type, such as kidney cells, for example, a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphate, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimics. In some embodiments, the ligand is a polygalactose, such as N-acetyl-galactosamine.

[0175] The sense and antisense strands contained in the RNA inhibitor of this application can be conveniently and routinely prepared using well-known solid-phase synthesis techniques. Other methods known in the art for such synthesis, such as liquid-phase synthesis or fermentation, can be used alternatively or as an alternative. The preparation of other oligonucleotides (such as phosphate thioides and alkylated derivatives) using similar techniques is also known.

[0176] In some embodiments, in addition to commercially available and standard nucleoside phosphoramide monomers and non-standard nucleoside phosphoramide monomers commonly used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of this application can be synthesized by an automated synthesizer using the phosphoramide method derived from the ligand-nucleoside phosphoramide monomer.

[0177] In some embodiments, the ligand conjugation of the present invention is coupled to the 5' end and / or 3' end of the antisense chain, and / or the 5' end and / or 3' end of the sense chain via a ligand structure.

[0178] For example, the ligand structure may be coupled to the 5' end and / or the 3' end of the sense strand; or the ligand structure may be coupled to the 5' end of the antisense strand and the ligand structure may be coupled to the 3' end of the sense strand; or the ligand structure may be coupled to the 3' end of the antisense strand and the ligand may be coupled to the 5' end of the sense strand; or the ligand structure may be coupled to both the 5' end and the 3' end of the sense strand; or the ligand may be coupled to the 3' end of the sense strand.

[0179] In some embodiments, the claimed ligand comprises an L96 structure, as shown in the following structural formula:

[0180] Pharmaceutical Composition

[0181] This application also includes pharmaceutical compositions comprising the RNA inhibitor of this application or a pharmaceutically acceptable salt thereof.

[0182] In one embodiment, this document provides pharmaceutical compositions comprising the RNA inhibitor described herein and pharmaceutically acceptable excipients. Pharmaceutical compositions comprising RNA inhibitors can be used for the prevention and / or treatment of LPA-related disorders, such as hypercholesterolemia. These pharmaceutical compositions are formulated according to a delivery mode. One example formulation is a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of this application can be administered at doses sufficient to inhibit LPA gene expression.

[0183] Pharmaceutically acceptable "excipients" or "components" are pharmaceutically acceptable solvents, suspending agents, or any other pharmaceutically inert media for delivering one or more nucleic acids to animals. Excipients may be liquids or solids and are selected with consideration for the planned administration method to provide the required volume, consistency, etc., when combined with the nucleic acid and other components in a given pharmaceutical composition. RNA inhibitors may be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0184] In some embodiments, the pharmaceutical composition further comprises a delivery medium (such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems).

[0185] In some embodiments, the delivery medium includes liposomes.

[0186] In some embodiments, the delivery medium includes nanolipids capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0187] In some embodiments, the pharmaceutical composition further comprises an RNA inhibitor that inhibits PCSK9 gene expression.

[0188] In some embodiments, the RNA inhibitor that inhibits PCSK9 gene expression comprises an antisense strand containing a complementary region that is complementary to at least a portion of the mRNA encoding PCSK9, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises any one of SEQ ID NO.: 700, 704 or a sequence differing from it by no more than 3 nucleotides.

[0189] In some embodiments, the RNA inhibitor that inhibits PCSK9 gene expression further comprises a sense strand selected from any one of SEQ ID NO:698 or 702, or a sequence differing from it by no more than 3 nucleotides.

[0190] In some embodiments, the RNA inhibitor that suppresses PCSK9 gene expression is:

[0191] (a) The justice chain is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm

[0192] (SEQ ID NO:699), the antisense chain is

[0193] AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm(SEQ

[0194] ID NO:701), or

[0195] (b) The justice chain is CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmGmCmUm(SEQ ID NO:703), and the antisense chain is AmsGfsCmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm(SEQ ID NO:705).

[0196] In some embodiments, the pharmaceutical composition wherein the unit dose ratio of the RNA inhibitor inhibiting LPA gene expression and the RNA inhibitor inhibiting PCSK9 gene expression is 1:10-10:1, for example, 1:10-10:1, 1:9-9:1, 1:8-8:1, 1:7-7:1, 1:6-6:1, 1:5-5:1, 1:4-4:1, 1:3-3:1, 1:2-2:1, 1:10-9:1. 1:10-8:1, 1:10-7:1, 1:10-6:1, 1:10-5:1, 1:10-4:1, 1:10-3:1, 1:10-2:1, 1:10-1:1, 1:9-10:1, 1:8-10:1, 1:7-10:1, 1:6-10:1, 1:5-10:1, 1:4-10:1, 1:3-10:1, 1:2-10:1, 1:1-10:1, preferably about 1:1.

[0197] The pharmaceutical composition described in this application can be administered parenterally, by injection, or orally. Injection administration may include routes such as intravenous injection, intramuscular injection, intraperitoneal injection, intradermal injection, or subcutaneous injection. The pharmaceutical composition is available in various dosage forms conventional in the art; for example, it can be in solid, semi-solid, or liquid form, i.e., it can be an aqueous solution, a non-aqueous solution, or a suspension, and can also be a tablet, capsule, granule, injection, or infusion. For example, the pharmaceutical composition can be prepared as a liquid. For example, the pharmaceutical composition can be prepared as a solid, and the solid can be dissolved into a liquid for use.

[0198] In some embodiments, the drug is prepared to be administered by injection.

[0199] In some embodiments, the drug is prepared for intravenous injection.

[0200] In some embodiments, the drug is prepared as a solid or a liquid.

[0201] In some embodiments, the drug is prepared as an injectable.

[0202] In some embodiments, the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in the same container.

[0203] In some embodiments, the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in different containers.

[0204] In some implementations, a delivery medium is included.

[0205] In some embodiments, the delivery medium includes liposomes.

[0206] In some embodiments, the delivery medium includes nanolipids capable of forming lipid nanoparticles with nucleic acid molecules (e.g., liposome-nucleic acid nanoparticles).

[0207] In some embodiments, this document provides a kit or delivery device comprising the pharmaceutical composition described herein.

[0208] use

[0209] On the other hand, this application provides the use of the aforementioned RNA inhibitor that inhibits LPA gene expression and the aforementioned pharmaceutical composition in the preparation of a drug for the prevention or treatment of a disease or pathology or to reduce the risk of a disease or pathology.

[0210] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated levels of Lp(a) or apo(a). In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases. In some embodiments, the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD). In some embodiments, the cardiovascular disease includes coronary artery disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

[0211] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated PCSK9 levels. In some embodiments, the disease or pathology includes hypercholesterolemia. In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases. In some embodiments, the cardiovascular disease includes hyperlipidemia, stroke, atherosclerosis, thrombosis, cardiovascular events, coronary artery disease, or aortic stenosis. In some embodiments, hypercholesterolemia may include familial hypercholesterolemia and / or non-familial hypercholesterolemia. Familial hypercholesterolemia may include homozygous familial hypercholesterolemia and / or heterozygous familial hypercholesterolemia. In some embodiments, cardiovascular disease further includes high Lp(a) levels or high-risk cardiovascular events in individuals with high Lp(a).

[0212] In some embodiments, the disease or pathology includes a disease or pathology associated with elevated levels of low-density lipoprotein cholesterol (LDL-C). In some embodiments, the disease or pathology includes inflammatory, cardiovascular, or metabolic diseases. In some embodiments, the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD). In some embodiments, the cardiovascular disease includes coronary artery disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

[0213] On the other hand, this application provides a method for preventing or treating a disease, symptom, or syndrome, the method comprising administering to a subject in need an effective amount of the aforementioned RNA inhibitor that inhibits LPA gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0214] In some embodiments, the RNA inhibitor that inhibits LPA gene expression, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

[0215] On the other hand, this application provides a method for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects, comprising administering to cells, tissues or subjects an effective amount of the aforementioned RNA inhibitor for inhibiting LPA gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0216] In some embodiments, the cells are liver cells.

[0217] In some embodiments, the tissue is liver tissue.

[0218] In some embodiments, the cells and tissues are isolated.

[0219] On the other hand, this application provides a method for inhibiting PCSK9 expression in cells, tissues or subjects, comprising administering to cells, tissues or subjects an effective amount of the aforementioned RNA inhibitor that inhibits LPA gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0220] In some embodiments, the cells are liver cells.

[0221] In some embodiments, the tissue is liver tissue.

[0222] In some embodiments, the cells and tissues are isolated.

[0223] On the other hand, this application provides a method for inhibiting the expression of low-density lipoprotein cholesterol in cells, tissues or subjects, comprising administering to cells, tissues or subjects an effective amount of the aforementioned RNA inhibitor that inhibits LPA gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0224] In some embodiments, the cells are liver cells.

[0225] In some embodiments, the tissue is liver tissue.

[0226] In some embodiments, the cells and tissues are isolated.

[0227] On the other hand, this application provides a method for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects, comprising inhibiting the expression of LPA mRNA and / or Lp(a) and inhibiting the expression of PCSK9.

[0228] On the other hand, this application provides a method for inhibiting PCSK9 expression in cells, tissues or subjects, which includes inhibiting LPA mRNA and / or Lp(a) expression, and inhibiting PCSK9 expression.

[0229] On the other hand, this application provides a method for inhibiting the expression of low-density lipoprotein cholesterol in cells, tissues or subjects, which includes inhibiting the expression of LPA mRNA and / or Lp(a) and inhibiting the expression of PCSK9.

[0230] The term “inhibition” as used herein may be used interchangeably with “reduction,” “lowering,” “silencing,” “downregulation,” “suppression,” and other similar terms, and includes any level of inhibition. LPA gene expression can be assessed based on the level or change in the level of any variable associated with LPA gene expression, such as LPA mRNA levels or Lp(a) protein levels. This level can be analyzed in a single cell or in a cell population (including, for example, samples derived from a subject). Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with LPA expression compared to a control level. A control level can be any type of control level used in the art, such as baseline levels before administration or levels measured in similar subjects, cells, or samples that have never been treated or have received a control (e.g., a buffer-only control or an active agent-free control).

[0231] Inhibition of LPA gene expression can be manifested by the reduction in the amount of mRNA expressed in a first cell or cell population (such cells may be present, for example, in a sample derived from a subject) where the LPA gene is transcribed and treated (e.g., by contacting one or more cells with the RNA inhibitor of this application, or by administering the RNA inhibitor of this application to a subject in which the cells are present) that inhibits LPA gene expression, compared to a second cell or cell population that is substantially the same as the first cell or cell population but not so treated (control cells not treated with the RNA inhibitor or not treated with an LPA inhibitor targeting the target gene). In a preferred embodiment, inhibition is evaluated in a cell line that highly expresses LPA using an appropriate concentration of siRNA as provided in Example 3, and the mRNA level in the intervened cells is expressed as a percentage of the mRNA level in the uninterrupted control cells.

[0232] In other embodiments, inhibition of LPA gene expression can be evaluated by a decrease in a parameter functionally associated with LPA gene expression, such as the level of Lp(a) protein in the subject's blood or serum. LPA gene silencing can be performed in any LPA-expressing cells (endogenous or exogenous from the expression construct) and by any analytical method known in the art.

[0233] Inhibition of Lp(a) protein expression can be represented by a decrease in the level of Lp(a) protein expressed in cells or cell populations or in subject samples (e.g., protein levels in blood samples derived from the subject). As described above, for the evaluation of mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can similarly be expressed as a percentage of protein levels in control cells or cell populations, or a change in protein levels in subject samples (e.g., blood or serum derived from it).

[0234] Control cells, cell populations, or subject samples that can be used to evaluate LPA gene inhibition include cells, cell populations, or subject samples that have not been exposed to the RNAi agent of this application. For example, control cells, cell populations, or subject samples may be derived from a single subject (e.g., a human or animal subject) prior to treatment with the RNAi agent or from an appropriately matched population of controls.

[0235] The level of LPA mRNA expressed in cells or cell populations can be determined using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated using any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as tissue material to monitor a decrease in LPA gene or protein expression. In other embodiments, a blood sample is used as a subject sample to monitor a decrease in Lp(a) protein expression.

[0236] Reagent test kit

[0237] On the other hand, this application provides a kit comprising the pharmaceutical composition as described above.

[0238] In some embodiments, the kit provided herein contains a pharmaceutical composition in a single container. In some embodiments, the kit provided herein includes a container containing pharmaceutically acceptable excipients. In some embodiments, the kit provided herein further includes pharmaceutically acceptable excipients, such as stabilizers or preservatives. In some embodiments, the kit provided herein includes at least one additional therapeutic agent. In some embodiments, the kit includes at least one additional therapeutic agent in a container that is different from the therapeutic agent containing the pharmaceutical composition described herein. In some embodiments, the kit includes instructions for mixing the pharmaceutical composition with pharmaceutically acceptable excipients or other ingredients (if present).

[0239] In the kits of this application, the pharmaceutical composition and / or pharmaceutically acceptable excipients may be provided in any form, such as liquid, dry, or lyophilized. In some embodiments, the pharmaceutical composition and / or pharmaceutically acceptable excipients are substantially pure and / or sterile. In some embodiments, sterile water is provided in the kits of this application.

[0240] Example

[0241] The present application will be described in detail below through examples. Unless otherwise stated, the reagents and culture media used in the following examples are commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are performed in accordance with the methods described in Molecular Cloning (Cold Spring Harbor LBboratory Press (1989)).

[0242] Example 1: Design and Synthesis of Unmodified LPA siRNA Sequence

[0243] Based on the human transcript of the LPA gene (source: NCBI website, transcript number: NM_005577.4), the full-length region of human LPA mRNA (including 5'-UTR, CDS, and 3'-UTR) was imported into a custom R and Python script to design the original siRNA sequence targeting the LPA gene. To increase the probability of obtaining highly active sequences, manual filtering was performed before the formal experiments to remove some potentially inefficient sequences. The specific designed sequences are shown in Table 1. Based on different screening criteria and manual optimization approaches, the sequences can be divided into two main categories: SL libraries and L libraries, as shown in Table 3.

[0244] The synthesis of both the sense and antisense strands of the siRNA duplex employs the classic oligonucleotide solid-phase synthesis method. Starting with the attachment of a solid-phase support, the cycle proceeds sequentially, linking nucleoside monomers one by one from the 3'-5' direction according to the nucleotide arrangement sequence. Each nucleoside attachment involves four steps: deprotection, coupling, capping, and oxidation or thiolation, ultimately yielding the sense or antisense strand of the siRNA duplex with the solid-phase support. The conditions for each reaction step are as follows:

[0245] (1) Nucleoside monomer: Dissolved in acetonitrile solution with a concentration of 0.1 mol / L.

[0246] (2) Deprotection: Add 3% dichloroacetic acid-dichloromethane solution.

[0247] (3) Coupling reaction: Add 0.3 mol / L ETT acetonitrile solution.

[0248] (4) Oxidation reaction: Add 0.05 mol / L of tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v) solution of iodine.

[0249] (5) Thio-reaction: Add 0.2 mol / L of hydrogenated xanthan pyridine solution.

[0250] (6) Capping reaction: Add 20% acetic anhydride-acetonitrile and pyridine / N-methylimidazolium / acetonitrile (10 / 14 / 76, v / v / v) solution.

[0251] The synthesized siRNA duplex with a solid-phase carrier, either the sense or antisense strand, was added to a 2 ml centrifuge tube. 25-28% ammonia solution was added, and the mixture was reacted at 55°C for 16 hours. After filtration, the mixture was washed three times with 1 mL of 50% ethanol aqueous solution to remove the solid-phase carrier. The filtrate was concentrated and dried to obtain crude siRNA duplex sense or antisense strands, awaiting purification. The crude siRNA duplex sense or antisense strands were dissolved in 1 ml of RNase-free water and purified by ion-pair reversed-phase chromatography or ion-exchange chromatography. The collected samples were analyzed, and qualified samples were combined and desalted to obtain pure siRNA duplex sense or antisense strands containing amino-modified amino groups.

[0252] The pure sense and antisense strands of the siRNA duplex were mixed in a certain molar ratio, denatured at 90 degrees Celsius for 3 minutes, cooled to room temperature, and finally lyophilized to obtain the pure siRNA duplex.

[0253] Example 2: Screening of LPA siRNA duplexes using a dual-luciferin reporter gene system

[0254] Cos-7 cells (purchased from Nanjing Kebai, from ATCC) were seeded into 96-well plates after being digested with 2.5% trypsin, at a density of 3 × 10⁶ cells per well. 4Cells were cultured overnight at 37°C for siRNA transfection. Using Lipofectamine 2000, 10 ng of the psiCHECK-2 plasmid (Promega, C8021) containing an LPA mRNA sequence fragment was transfected into each well of a plate (considering the limitations of LPA mRNA length and the insert length of the psiCHECK-2 plasmid, the full-length LPA mRNA was split into 1500 bp fragments to construct different reporter plasmids). Simultaneously, 1 μl of pre-prepared siRNA stock solutions of different concentrations were added to each well, resulting in final siRNA concentrations of 20 nM, 10 nM, and 0.1 nM, which were transfected together with the plasmid into the wells. The siRNAs to be detected included the siRNA synthesized in Example 1 as shown in Table 1, the positive control PC1, and the nonsense control (blank control). The psiCHECK-2 plasmid map is shown in Figure 1. Twenty-four hours after transfection, the culture medium was carefully aspirated from the wells of the plate, and the cells were washed with 50 μl of pre-chilled PBS. The cells were then detected using a dual-luciferase reporter assay kit (Promega, E1910). Following the kit instructions, passive lysis buffer was first prepared, and then 30 μl of the prepared buffer was added to each well. The plates were vortexed at low speed for 5 minutes to ensure complete cell lysis. After lysis, 20 μl of the lysis buffer was added to a white 96-well opaque microplate. Then, 50 μl of LAR2 solution was added to the wells, and the chemiluminescence value was read using a microplate reader; this was the fluorescence intensity of the firefly (Photinus pyralis) luciferase. Immediately after reading the value, 50 μl of Stop&Glo solution was added to the wells, and the chemiluminescence value was read again; this was the fluorescence intensity of the renal (Renilla reniformis) luciferase. The ratio of fluorescence intensity of Renalis luciferase to that of firefly luciferase was calculated and normalized to the nonsense control group to measure the knockdown level of the target gene by the siRNA to be tested. The results are shown in Tables 4 and 5, respectively.

[0255] It is worth noting that because the LPA protein contains dozens of repeating KIV domains, its mRNA also contains multiple repeating sequences. This results in some candidate sequences having multiple binding sites on LPA mRNA. Furthermore, in this embodiment, the full-length LPA mRNA was split into fragments of approximately 1500 bp and then inserted into reporter vectors. Therefore, individual candidate sequences can bind to multiple reporter plasmids, resulting in multiple inhibition rate data in Table 5. Since a single reporter vector cannot contain all the binding sites of the aforementioned sequences on LPA mRNA, the knockdown efficiency of these multiple-occurrence sequences on LPA mRNA should actually be the sum of all inhibition rates shown in Table 5, compared to candidate sequences with only one binding site.

[0256] Table 3. Double-stranded siRNA sequence information used for DLR screening.

[0257] Table 4 shows the in vitro inhibitory effect of double-stranded siRNA on DLR screening results.

[0258] Table 5 shows the in vitro inhibitory effect of double-stranded siRNA on DLR screening results.

[0259] Example 3: Verification of the inhibitory effect of chemically modified double-stranded siRNA on primary monkey liver cells (PCH).

[0260] To further confirm the high-activity siRNA molecules, the inhibitory effects of modified versions of several library sequences that performed well in the DLR experiment were tested on monkey liver primary cells (purchased from Huizhiheyuan) (Tables 6 and 7). In Table 6, sequences starting with TL are additional sequences designed based on the screening results of the SL library. In Tables 6 and 7, the uppercase letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; Am, Gm, Cm, and Tm indicate nucleotides modified with 2'-methoxy groups; Af, Gf, Cf, and Uf indicate nucleotides modified with 2'-fluorine groups; and the lowercase letter 's' indicates that the two nucleotides adjacent to 's' are linked by phosphate thioester groups.

[0261] Immediately after thawing, the primary monkey liver cells were poured into thaw medium, mixed thoroughly, centrifuged to collect the cells, and resuspended in plateable medium. The cell density was adjusted to 3.5 × 10⁶ cells per well. 5 Cells were seeded into 12-well plates. Simultaneously, different concentrations of the target siRNA and a nonsense control were added to each well using Lipofectamine RNAiMax at 1 μl per well, resulting in final siRNA concentrations of 20 nM, 10 nM, and 0.1 nM, respectively. The cells were transfected into the plates, and after 4 hours of transfection, the plates were replaced with maintenance medium. Cells were cultured for 48 hours post-transfection and lysed. Total RNA was extracted using the Trizol method for qPCR detection. The monkey GAPDH gene was used as the housekeeping gene in the qPCR assay. Real-time quantitative PCR was performed using the TaqMan probe method on a 7500 FAST fluorescence quantitative PCR instrument (ABI). Primer and probe information is shown in Table 8, where the internal control probe was labeled with VIC and the target probe was labeled with FAM. After the PCR reaction, 2... –ΔΔCt The Livak method was used to perform relative quantitative analysis using housekeeping genes as a standard and normalized to the control group to determine the knockdown level of target genes. The results are shown in Tables 9 and 10.

[0262] Table 6. Double-stranded siRNA modification sequences obtained from the SL library after screening.

[0263] Table 7. Double-stranded siRNA modified sequences obtained from the L-liquid library after screening.

[0264] Table 8. Primer sequence information for monkey LPA and GAPDH.

[0265] Table 9. Knockdown results of chemically modified double-stranded siRNA from the SL library at a concentration of 20 nM in primary monkey liver cells.

[0266] Table 10. Knockdown results of L-library chemically modified double-stranded siRNA in primary monkey liver cells.

[0267] Some sequences in this invention exhibit superior efficacy compared to PC1. The sequence information for *Gynostemma pentaphyllum* is shown below. Raw sequence of *Gynostemma pentaphyllum*: Sensitive strand: CAGCCCCUUAUUGUUAUACG (SEQ ID NO 726), Antisense strand: UCGUAUAACAAUAAGGGGCUG (SEQ ID NO 727); Modified sequence of *Gynostemma pentaphyllum*: Modified positive strand: (NAG25)s-CmsAmGmCmCmCmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGms[invdA] (SEQ ID NO 761, raw sequence as shown in SEQ ID NO 726); Modified antisense strand: UmsCfsGmUfAmUfAmAmCmAmAmUfAmAfGmGfGmGfCmsUfsGm (SEQ ID NO 762, raw sequence as shown in SEQ ID NO 727). The structure of NAG25 is as follows:

[0268] The structure of invdA is as follows:

[0269] Example 4: qPCR detection of the inhibitory effect of chemically modified double-stranded siRNA on human LPA gene overexpression Huh-7 cells.

[0270] Because the mRNA sequences of monkey LPA differ from those of human LPA, it was also desirable to use human cell lines to verify the knockdown effect of the modified sequence obtained through screening. However, since the expression level of the LPA gene is low in most cell lines, an overexpression cell line was used for testing. Huh-7 cells (purchased from Nanjing Kebai, from ATCC) were plated in 10cm culture dishes of DMEM medium containing 10% fetal bovine serum and cultured in a 5% CO2, 37°C incubator. Transfection was performed when the cells were in the logarithmic growth phase and in good condition (70% confluence). Using Lipofectamine 2000 transfection reagent, 5μg of PCDNA3.1 plasmid containing the human LPA mRNA sequence was transfected into the cells according to the manufacturer's instructions. 24 hours after transfection, the cells were digested and collected, and then divided into 3.5 × 10⁶ cells per well. 5 Cells were seeded into 12-well plates. Then, using Lipofectamine RNAiMax, different concentrations of the prepared siRNA for detection and a nonsense control were transfected into the plates at 1 μl per well (resulting in final siRNA concentrations of 10 nM and 0.1 nM, respectively). Cells were lysed 24 hours after transfection, and total RNA was extracted using a column extraction kit (Novizan, catalog number RC113-01) for qPCR detection.

[0271] qPCR detection was performed using the human GAPDH gene as the housekeeping gene. Real-time quantitative PCR was conducted using the TaqMan probe method on a 7500FAST real-time PCR instrument (ABI). Primer and probe information is shown in Table 11, where the internal control probe is labeled VIC and the target probe is labeled FAM. After the PCR reaction, 2... –ΔΔCt The Livak method was used to perform relative quantitative analysis using housekeeping genes as a standard and normalized to the control group to determine the knockdown level of target genes. The results are shown in Table 12.

[0272] Table 11 Primer sequence information for human LPA and GAPDH

[0273] Table 12 Knockdown results of L-library chemically modified double-stranded siRNA in human LPA gene-overexpressing Huh-7 cell lines

[0274] Example 5: In vivo inhibition effect of single dose of double-stranded siRNA in a mouse model with transiently transfected human LPA gene.

[0275] To further verify the knockdown effect of the siRNAs screened in vitro, 28 pairs of siRNAs (Table 13) were coupled to GalNac at the 3' end of the positive strand to test their knockdown effect in vivo. First, a mouse model transiently transfected with the human LPA gene was constructed to test changes in human LPA expression levels in mice. On day -3, NOD-SCID mice were intravenously injected with 3 mg / kg of the above siRNA solution or phosphate-buffered saline (PBFS) (control group), with an injection volume of 10 ml / kg. On day 0, mice were injected via high-pressure injection of PCDNA3.1 plasmid containing the human LPA mRNA sequence via the tail vein to construct a mouse model transiently transfected with the human LPA gene; these mice were designated hLPA-HDI mice. Twenty-four hours after plasmid injection, hLPA-HDI mice were sacrificed, and liver tissue was harvested for RNA extraction and qPCR detection of human LPA expression in the liver after modeling. After tissue lysis, total RNA was extracted using a column extraction kit (Novozymes, catalog number RC113-01). The housekeeping gene was selected from the KanR gene on the PCDNA3.1 plasmid. The primer and probe sequences are as follows: F primer sequence (5'-3'): CGTTGGCTACCCGTGATATT (SEQ ID NO 728), R primer sequence (5'-3'): CTCGTCAAGAAGGCGATAGAAG (SEQ ID NO 729), Probe sequence (5'-3'): CCGCTTCCTCGTGCTTTACGGTAT (SEQ ID NO 730).

[0276] The qPCR results (Table 14) showed that these 28 pairs of GalNac-conjugated siRNAs significantly knocked down human LPA expression in hLPA-HDI mice, with the optimal sequence achieving a knockdown effect of 76%, which was much higher than the reference sequence.

[0277] Table 13 Information on 28 pairs of double-stranded siRNA-conjugated GalNac sequences

[0278] In this context, the uppercase letters “G”, “C”, “A”, “T”, and “U” typically represent nucleotides containing guanine, cytosine, adenine, thymine, and uracil as bases, respectively; Am, Gm, Cm, and Tm indicate nucleotides modified with 2'-methoxy groups; Af, Gf, Cf, and Uf indicate nucleotides modified with 2'-fluorine groups; and the lowercase letter 's' indicates that the two nucleotides adjacent to it are linked by thiophosphate groups.

[0279] L96 is:

[0280] The conjugation pattern of L96 and siRNA is shown in Figure 2.

[0281] Table 14. Results of knockdown of human LPA expression levels in transiently transformed mice by 28 GalNac-coupled siRNAs at a dose of 3 mpk.

[0282] Example 6: Detection of the in vivo inhibitory effect of double-stranded siRNA in a humanized mouse model of the LPA gene

[0283] To further confirm the effectiveness of the screened sequences, the in vivo efficacy of 13 GalNac-conjugated siRNAs (Table 15) was tested using a humanized LPA gene mouse model (purchased from Nanmo Biotechnology, 60 mice aged 6-8 weeks, all female). After one week of acclimatization, the mice were subcutaneously injected with 3 mg / kg of the above-mentioned siRNA solution or phosphate-buffered saline (PBFS) (control group) on day 0, with an injection volume of 10 ml / kg. Serum samples were collected on days 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70. The Lp(a) protein content in the serum was detected using a human Lp(a) protein ELISA kit and normalized to the control group. Simultaneously, on day 50, three mice from each group were sacrificed, and RNA was extracted from liver tissue for qPCR detection to examine the expression of human LPA. The results are shown in Table 16. The ELISA kit was purchased from Abcam (catalog number ab212165). Total RNA was extracted after tissue lysis using a column extraction kit (purchased from Novizan, catalog number RC113-01).

[0284] The results showed that among the 13 GalNac-conjugated siRNAs tested, some siRNAs could reduce the level of Apo(a) protein in mouse serum to 0, which is the limit of detection of the kit. Some siRNAs could still significantly reduce the expression of human LPAmRNA in mouse liver and the level of serum Apo(a) protein even on day 50, and the duration of these molecules was significantly longer compared with that of Yangshen.

[0285] Table 15 Information on 13 pairs of double-stranded siRNA-conjugated GalNac sequences

[0286] Table 16 Results of knockdown of human Lp(a) protein levels by 13 GalNac-coupled siRNAs in LPA gene-humanized mice

[0287] NA indicates that the experiment was terminated early and serum protein levels were not measured.

[0288] 0 indicates that the value is below the detection limit of the experimental method.

[0289] Example 7. Determination of the single-dose inhibitory effect of double-stranded siRNA in a mouse model transiently transfected with human LPA & PCSK9 genes.

[0290] Low-density lipoprotein cholesterol (LDL-C) is causally related to atherosclerotic cardiovascular disease (ASCVD) and is therefore considered one of the major risk factors for cardiovascular disease. Lowering LDL-C is therefore the most important means of preventing high-risk cardiovascular events and is the primary target of lipid intervention recommended by guidelines. PCSK9 can bind to the low-density lipoprotein receptor (LDLR), inhibiting LDLR circulation to the plasma membrane and reducing the amount of LDLR, thereby reducing its ability to clear LDL (Chinese Journal of Biochemistry and Molecular Biology, March 2009, 25(3): 213-218). Therefore, the level of LDL-C clearance can be achieved by reducing the expression of PCSK9. Increasing new evidence shows that even with effective control of low-density lipoprotein cholesterol (LDL-C), an increase in Lp(a) can increase the risk of ASCVD events and is therefore considered an independent risk factor for cardiovascular disease (European Heart Journal (2017) 38, 1553–1560).

[0291] Some researchers, through studies on transgenic mice and subjects with high Lp(a) levels (Lp(a) concentration range of 39-320 mg / dl), have found a direct physical association between PCSK9 and Lp(a) in the plasma of mice and humans, and a significant correlation is often found between total plasma PCSK9 and Lp(a) levels. Other researchers have found that when Lp(a) levels are high, Lp(a) can assemble with PCSK9 protein in some form to form a large complex and perform corresponding functions. In addition, researchers have found that approximately 37% of PCSK9 in clinical samples exists in a form bound to apoB100, which is an important component of the Lp(a) complex (PCSK9 Association With Lipoprotein(a). Circ Res. 2016 Jun 24; 119(1):29-35.).

[0292] While the importance of LDL-C and Lp(a) in cardiovascular disease prevention is well-recognized, there are currently no drugs or regimens in clinical practice that can simultaneously and stably lower both of these indicators. Only some PCSK9 inhibitors can reduce LDL-C and slightly lower Lp(a) levels. Therefore, to cover more high-risk cardiovascular individuals and minimize the risk of high-risk cardiovascular events, a combined siRNA strategy targeting the PCSK9 and LPA genes was designed based on previous research, aiming to enable more patients to achieve greater clinical benefit through a more convenient treatment approach.

[0293] To preliminarily verify the feasibility of using a combined PCSK9 and LPA-targeting siRNA strategy, the study was first evaluated in a mouse HDI model with simultaneous transient transduction of human PCSK9 and LPA genes. For PCSK9, SP341MW02 (sense strand: CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO:699), antisense strand: AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO:701)) was selected, and for LPA, SL840MW02 was selected. SP341MW02 and SL840MW02 were simultaneously injected into double transiently transduced HDI mice, and their knockdown effect was detected. A control group received the same dose of either SP341MW02 or SL840MW02. The specific experimental procedure is as follows:

[0294] On day 3, NOD-SCID mice were intravenously injected with 3 mg / kg of the above-mentioned siRNA solution or phosphate-buffered saline (PBFS) (control group), with an injection volume of 10 ml / kg. On day 0, mice were injected via high-pressure tail vein injection with a PCDNA3.1 plasmid containing human LPA mRNA sequence and PCSK9 mRNA to construct a mouse model of transient transfection of the human LPA and PCSK9 genes. These mice were designated as hLPA&hPCSK9-HDI mice. Twenty-four hours after plasmid injection, the hLPA&hPCSK9-HDI mice were sacrificed, and liver tissue was harvested for RNA extraction. qPCR was performed to detect the expression of human PCSK9 and human LPA genes in the liver of the mice after modeling. Total RNA was extracted from the tissue using a magnetic bead RNA extraction kit (Foshan Aowei).

[0295] The housekeeping gene selected was the KanR gene on the PCDNA3.1 plasmid. The LPA gene primer and probe sequences are as follows: F primer sequence (5'-3'): CGTTGGCTACCCGTGATATT (SEQ ID NO 728), R primer sequence (5'-3'): CTCGTCAAGAAGGCGATAGAAG (SEQ ID NO 729), Probe sequence (5'-3'): CCGCTTCCTCGTGCTTTACGGTAT (SEQ ID NO 730). The PCSK9 gene probe primers are as follows: F primer sequence (5'-3'): GGGAGAGGGCCAACAACTG (SEQ ID NO 731), R primer sequence (5'-3'): AGAGGACAGACCCAAAAGATAAATGT (SEQ ID NO 732), Probe sequence (5'-3'): CCACCCAAGCAAGC (SEQ ID NO 733).

[0296] The qPCR results (Table 17) showed that the siRNA sequences of SP341MW02 and SL840MW02 conjugated with GalNac significantly knocked down the expression of human LPA and human PCSK9 in hLPA&hPCSK9-HDI mice, both when injected alone and in combination. The knockdown effect on the PCSK9 gene reached more than 85%, and the knockdown effect on the LPA gene reached more than 70%. Moreover, the co-injection did not affect the inhibitory effect of the individual genes.

[0297] Table 17 Knockdown results of SP341MW02 and SL840MW02 on human LPA and human PCSK9 in transiently metastatic mice, both by single and co-injection.

[0298] Example 8. Detection of the in vivo PCSK9 inhibitory effect of combined PCSK9 and LPA siRNA in a PCSK9 humanized mouse model.

[0299] To confirm the effectiveness of the combined method, a humanized animal model was also used for evaluation.

[0300] First, the efficacy of co-administered SP345MW02 (sense strand: CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmGmCmUm(SEQ ID NO:703), antisense strand: AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm(SEQ ID NO:705)) and L4230MW02 was tested using a single-drug control group with the same dose. A total of 30 male PCSK9 humanized mice aged 6-8 weeks (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were used in this experiment. After one week of acclimatization, the mice were divided into groups of 6 before administration. On day 0, these mice were subcutaneously injected with either 5 mg / kg of the above-mentioned siRNA solution or phosphate-buffered saline (control group), with an injection volume of 10 ml / kg. Serum samples were collected on days 7, 10, 14, 21, 28, 35, 42, and 49. The PCSK9 protein content in mouse serum was detected using a human PCSK9 protein ELISA kit and normalized to the control group. Simultaneously, on day 42, three mice from each group (except the L4230MW02 group) were sacrificed, and all animals in the L4230MW02 group were sacrificed. RNA was extracted from liver tissue for qPCR detection to examine human PCSK9 expression. The ELISA kit was purchased from Abcam (catalog number ab212165). Total RNA was extracted after tissue lysis using a column extraction kit (Novizan, catalog number RC113-01).

[0301] The results showed that the combined administration of SP345MW02 and L4230MW02 had a good inhibitory effect on human PCSK9 protein and mRNA, and the efficacy of the combined administration was not weaker than that of the SP345MW02 monotherapy group, as shown in Table 18.

[0302] Table 18. Results of knockdown of human PCSK9 protein and mRNA levels in PCSK9 gene-humanized mice using PCSK9 siRNA combined with LPA siRNA.

[0303] Example 9: Detection of the in vivo inhibitory effect of LPA siRNA combined with PCSK9 siRNA in a humanized mouse model of the LPA gene.

[0304] In this embodiment, the efficacy of co-administered SP345MW02 (sense strand: CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmGmCmUm(SEQ ID NO:703), antisense strand: AmsGfsCmAmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm(SEQ ID NO:705)) and L4230MW02 (3 mg / Kg + 3 mg / Kg) was tested using an LPA gene-humanized mouse model. Similarly, a single-drug administration group (3 mg / Kg) was also set up as a control. After one week of acclimatization, the mice were subcutaneously injected with 3 mg / Kg of the above-mentioned siRNA solution or phosphate buffer (control group) on day 0, with an injection volume of 10 ml / Kg. Serum samples were collected on days 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70. The Lp(a) protein content in the serum was detected using a human Lp(a) protein ELISA kit and normalized to the control group. Simultaneously, on day 50, three mice from each group were sacrificed, and RNA was extracted from liver tissue for qPCR detection to examine human LPA expression. The ELISA kit was purchased from Abcam (catalog number ab212165). Total RNA was extracted after tissue lysis using a column extraction kit (Novizan, catalog number RC113-01).

[0305] As shown in Table 19, the results showed that the combined administration of SP345MW02 and L4230MW02 had a good inhibitory effect on human Lp(a) protein and mRNA, which could reduce the level of human Apo(a) protein in mouse serum by more than 90%. On day 50, it could still significantly reduce the expression of human LPA mRNA in mouse liver and the level of human Apo(a) protein in serum. The duration of the effect was also significantly longer than that of Yangshen, and the efficacy of the combined administration was not weaker than that of L4230MW02 monotherapy.

[0306] Table 19 Results of LPA siRNA combined with PCSK9 siRNA knockdown of human Lp(a) protein and mRNA levels in LPA gene-humanized mice.

[0307] Example 10: Detection of the in vivo inhibitory effect of double-stranded siRNA on LPA in non-human primates

[0308] This study investigated the efficacy of the aforementioned LPA siRNA and its combination with PCSK9 siRNA in non-human primates. Fifteen male cynomolgus macaques aged 3–4 years were selected and, after acclimatization, were administered 7 mg / kg of L4230MW02, 7 mg / kg of LPC1, P345MW02, and PPC2, and 7 mg / kg + 7 mg / kg of L4230MW02 + P345MW02, with three macaques in each group. The administration volume was 1 ml / kg. Each test compound was prepared into an injection solution by adding an appropriate proportion of physiological saline and administered subcutaneously at a single point on the morning of the same day. The day of administration was defined as day 0. Blood and serum samples were collected at 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70 days after the first administration. The macaques were fasted overnight before sampling. Serum Lp(a), PCSK9 levels, and blood lipid levels were measured. As can be seen from Tables 20-22, compared with single-drug therapy, the efficacy of the combination therapy was not only unaffected, but it also achieved a greater reduction in LDLC. Tables 20-1, 21-1, and 22-1 represent the first experiment, while Tables 20-2, 21-2, and 22-2 represent the second experiment conducted by different operators. The experimental methods were the same in both experiments, and the data results were similar.

[0309] Table 20-1 Results of LPA siRNA and its combination with PCSK9 siRNA in knocking down Lp(a) protein levels in cynomolgus monkeys.

[0310] Table 20-2. Knockdown of Lp(a) protein levels in cynomolgus monkeys by LPA siRNA and its combination with PCSK9 siRNA.

[0311] * Value too low: specifically 0.004166

[0312] Table 21-1. Results of LPA siRNA and its combination with PCSK9 siRNA in knocking down PCSK9 protein levels in cynomolgus monkeys.

[0313] Table 21-2. Results of LPA siRNA and its combination with PCSK9 siRNA in knocking down PCSK9 protein levels in cynomolgus monkeys.

[0314] Table 22-1. Changes in serum LDL-C in cynomolgus monkeys after administration of LPA siRNA and its combination with PCSK9 siRNA.

[0315] Table 22-2. Changes in serum LDL-C in cynomolgus monkeys after administration of LPA siRNA and its combination with PCSK9 siRNA.

[0316] Example 11: Detection of the inhibitory effect of the combined use of LPA siRNA and PCSK9 siRNA in non-human primates.

[0317] This study investigated the efficacy of LPA siRNA and PCSK9 siRNA in combination in non-human primates. Six male cynomolgus monkeys aged 4–5 years were selected and, after acclimatization, were administered either 7 mg / kg + 7 mg / kg of SL840MW02 + SP341.8MW02 or 7 mg / kg + 7 mg / kg of TL2547MW02 + P3543.9MW02, with three monkeys in each group. The administration volume was 1 ml / kg. The sense strand of P3543.9MW02 was CmsUmsUmUmUmGmUfAmAfCfUfUmGmAmAmGmAmUmAm-L96 (SEQ ID NO 708), and the antisense strand was UmsAfsUmAmUmCmUmUmCmAmAmGmUmUfAmCfAmAmAmAmGmsAmsAm (SEQ ID NO 709). The positive strand of SP341.8MW02 is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmAm-L96 (SEQ ID NO 712), and the antisense strand is UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm (SEQ ID NO 713). Each test compound was prepared into an injection solution by adding an appropriate proportion of physiological saline and administered via single-point subcutaneous injection on the morning of the same day. The day of administration was defined as day 0. Blood samples were collected at 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70 days after the first administration. Patients had fasted overnight before sampling. Serum Lp(a), PCSK9 levels, and lipid levels were measured. As can be seen from (Tables 23-25), different combinations of drugs also showed good efficacy.

[0318] Table 23. Knockdown of Lp(a) protein levels in cynomolgus monkeys by LPA siRNA and its combination with PCSK9 siRNA.

[0319] Table 24. Results of LPA siRNA and its combination with PCSK9 siRNA in knocking down PCSK9 protein levels in cynomolgus monkeys.

[0320] Table 25. Changes in serum LDL-C in cynomolgus monkeys after administration of LPA siRNA and its combination with PCSK9 siRNA.

Claims

1. An RNA inhibitor for inhibiting LPA gene expression, comprising an antisense strand, the antisense strand including a complementary region complementary to at least a portion of an mRNA encoding LPA, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises any one of the following nucleotide sequences: SEQ ID NO.: 1-272, 542-629, 740-760 or a sequence differing from it by no more than 3 nucleotides.

2. The RNA inhibitor for inhibiting LPA gene expression according to claim 1, characterized in that: It also contains a sense chain, wherein there is at least 80% base complementarity between the sense chain and the antisense chain.

3. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-2, wherein the sense strand and antisense strand exist on two different nucleic acid strands.

4. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-2, wherein the sense strand and the antisense strand are 100% base complementary.

5. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-4, characterized in that... At least one strand has a 3' overhang of 0 to 6 nucleotides in length.

6. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-5, characterized in that... Both strands have a 3' overhang of 2-3 nucleotides in length, or the sense strand has a 3' overhang of 2-3 nucleotides in length, or the antisense strand has a 3' overhang of 2-3 nucleotides in length.

7. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-6, characterized in that... The lengths of the sense and antisense strands range from 16 to 35 nucleotides.

8. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-7, characterized in that, One strand of the RNA inhibitor that inhibits LPA gene expression has at least 75% homology or complementarity with the nucleotide sequence selected from the target region location information shown in Table 1.

9. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-8, characterized in that, Its positive strand is selected from any one of SEQ ID NO:273-541, 630-697, 734-739 or a sequence that differs from it by no more than 3 nucleotides.

10. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-9, wherein at least one nucleotide is a chemically modified nucleotide.

11. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-10, wherein the chemical modification is at least one of the following modifications: (1) Modification of the phosphodiester bonds linking nucleotides in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression; (2) Modification of the 2'-OH of the ribose in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression; (3) Modification of the bases in the nucleotide sequence of the RNA inhibitor that inhibits LPA gene expression.

12. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-11, wherein there are at least two consecutive phosphate thioester bonds between the nucleotides of the sense strand and / or antisense strand.

13. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-12, wherein there are at least two consecutive phosphate thioester bonds between the three consecutive nucleotides at the end of the sense strand and / or the end of the antisense strand.

14. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-13, wherein the -OH at the 2' position of the nucleotide glycosyl group at positions 7, 9, 10, and 11, starting from the 5' end of the positive strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide glycosyl groups of the positive strand is replaced by methoxy groups.

15. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-14, wherein the -OH at the 2' position of the nucleotide glycosyl group at positions 2, 14, and 16, starting from the 5' end of the antisense strand, is replaced by fluorine, and the -OH at the 2' position of the remaining nucleotide glycosyl group of the antisense strand is replaced by methoxy groups.

16. An RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-15, comprising: L4230, SL0840, SL0842, SL2656, TL2547, TL3282, TL32821, TL32823, TL32826, TL32832, TL32833, TL32834, L3385, L3581, L3970, L4282, SL0 284, SL0612, SL0695, SL2665, SL2995, SL4016, SL4019, TL2700, TL2702, TL2703, TL2704, TL2705, TL2542, TL2543, TL3281, TL3284, TL4229.

17. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-16, comprising: L4230MW02, SL840MW02, SL842MW02, SL2656MW02, TL2547MW02, TL3282MW02, TL32821MW02, TL32823MW02, TL 32826MW02, TL32832MW02, TL32833MW02, TL32834MW02, L3385MW02, L3581MW02, L3970MW02, L4282MW02, SL28 4MW02, SL612MW02, SL695MW02, SL2665MW02, SL2995MW02, SL4016MW02, SL4019MW02, TL2700MW02, TL2702MW0 2. TL2703MW02, TL2704MW02, TL2705MW02, TL2542MW02, TL2543MW02, TL3281MW02, TL3284MW02, TL4229MW02.

18. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-17, further comprising a ligand, wherein the ligand is conjugated to the sense strand and / or the antisense strand.

19. The RNA inhibitor for inhibiting LPA gene expression according to claim 18, wherein the ligand is conjugated to the 5' end and / or 3' end of the antisense strand.

20. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 18-19, wherein the ligand is conjugated to the 5' end and / or 3' end of the sense strand.

21. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 18-20, or a pharmaceutically acceptable salt thereof, wherein the ligand is conjugated to the 5' end of the antisense strand and the ligand is conjugated to the 3' end of the sense strand.

22. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 18-20, wherein the ligand is conjugated to the 3' end of the antisense strand and the ligand is conjugated to the 5' end of the sense strand.

23. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 18-20, wherein the ligand is conjugated to the 5' end and 3' end of the sense strand.

24. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 18-23, wherein the ligand further comprises a targeting unit for enhancing the uptake of the RNA inhibitor by hepatocytes.

25. The RNA inhibitor for inhibiting LPA gene expression according to claim 24, wherein the targeting unit is selected from monosaccharides and their derivatives.

26. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 24-25, wherein the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose.

27. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 24-26, wherein the monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

28. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 24-27, wherein the targeting unit is selected from galactose, galactosamine, N-acetylgalactosamine and its derivatives.

29. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 24-28, wherein the targeting unit is N-acetylgalactosamine and its derivatives.

30. A pharmaceutical composition comprising an RNA inhibitor for inhibiting LPA gene expression as described in any one of claims 1-29, and / or a physiologically acceptable excipient and / or carrier and / or diluent.

31. The pharmaceutical composition of claim 30, further comprising an RNA inhibitor that inhibits PCSK9 gene expression.

32. The pharmaceutical composition of claim 31, wherein the RNA inhibitor that inhibits PCSK9 gene expression comprises an antisense strand, the antisense strand comprising a complementary region complementary to at least a portion of the mRNA encoding PCSK9, the complementary region being 17-23 nucleotides in length, wherein the antisense strand comprises any one of the following nucleotide sequences: SEQ ID NO.: 700, 701, 704, 705, 707, 709, 711, 713 or a sequence differing from it by no more than 3 nucleotides.

33. The pharmaceutical composition according to any one of claims 30-32, wherein the RNA inhibitor that inhibits PCSK9 gene expression further comprises a sense strand selected from any one of SEQ ID NO: 698, 699, 702, 703, 706, 708, 710, 712 or a sequence differing from it by no more than 3 nucleotides.

34. The pharmaceutical composition according to any one of claims 30-33, wherein the RNA inhibitor that inhibits PCSK9 gene expression is: (a) The justice chain is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmUm (SEQ ID NO:699), and the antisense chain is AmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsCmsUm (SEQ ID NO:701), or (b) The justice chain is CmsUmsUmUmUmCmUfAmGfAfCfCmUmGmUmUmUmUmGmCmUm (SEQ ID NO:703), and the antisense chain is AmsGfsCmAmAmAmCmAmGmGmUmCmUfAmGfAmAmAmAmGmsUmsUm (SEQ ID NO:705) or (C) The justice chain is CmsUmsUmUmUmGmUfAmAfCfUfUmGmAmAmGmAmUmAmUmAm (SEQ ID NO:708), and the antisense chain is UmsAfsUmAmUmCmUmUmCmAmAmGmUmUfAmCfAmAmAmAmGmsAmsAm (SEQ ID NO:709) or (D) The justice chain is CmsCmsAmAmCmUmUfUmUfCfUfAmGmAmCmCmUmGmUmUmAm(SEQ ID NO:712), and the antisense chain is UmsAfsAmCmAmGmGmUmCmUmAmGmAmAfAmAfGmUmUmGmGmsUmsAm(SEQ ID NO:713).

35. The pharmaceutical composition according to any one of claims 30-34, wherein the unit dose ratio of the RNA inhibitor inhibiting LPA gene expression and the RNA inhibitor inhibiting PCSK9 gene expression is 1:10-10:1, preferably 1:

1.

36. The pharmaceutical composition according to any one of claims 30-35, wherein the pharmaceutical composition is prepared to be administered by injection.

37. The pharmaceutical composition according to any one of claims 30-36, wherein the pharmaceutical composition is prepared for intravenous injection.

38. The pharmaceutical composition according to any one of claims 30-37, wherein the pharmaceutical composition is prepared as a solid or a liquid.

39. The pharmaceutical composition according to any one of claims 30-38, wherein the pharmaceutical composition is prepared as an injection.

40. The pharmaceutical composition according to any one of claims 30-39, wherein the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in the same container.

41. The pharmaceutical composition according to any one of claims 30-40, wherein the RNA inhibitor that inhibits LPA gene expression and the RNA inhibitor that inhibits PCSK9 gene expression are present in different containers.

42. The pharmaceutical composition according to any one of claims 30-41, comprising a delivery medium.

43. The pharmaceutical composition according to any one of claims 30-42, wherein the delivery medium comprises liposomes.

44. A kit or delivery device comprising the pharmaceutical composition of any one of claims 30-43.

45. The RNA inhibitor for inhibiting LPA gene expression according to any one of claims 1-29, the pharmaceutical composition according to any one of claims 30-43, and / or the use of the kit or delivery device according to claim 44 in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or pathology.

46. ​​The use according to claim 45, wherein the disease or pathology includes a disease or pathology associated with elevated levels of Lp(a) or apo(a).

47. The use according to any one of claims 45-46, wherein the disease or pathology includes inflammatory, cardiovascular or metabolic diseases.

48. The use according to any one of claims 45-47, wherein the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD).

49. The use according to any one of claims 45-48, wherein the cardiovascular and cerebrovascular diseases include coronary heart disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

50. The use according to claim 45, wherein the disease or pathology includes a disease or pathology associated with elevated PCSK9 levels.

51. The use according to claim 50, wherein the disease or pathology includes hypercholesterolemia.

52. The use according to any one of claims 50-51, wherein the disease or pathology includes inflammatory, cardiovascular or metabolic diseases.

53. The use according to any one of claims 50-52, wherein the cardiovascular and cerebrovascular diseases include hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic stenosis.

54. The use according to claim 45, wherein the disease or pathology includes a disease or pathology associated with elevated levels of low-density lipoprotein cholesterol (LDL-C).

55. The use according to claim 54, wherein the disease or pathology includes inflammatory, cardiovascular or metabolic diseases.

56. The use according to any one of claims 54-55, wherein the cardiovascular disease is atherosclerotic cardiovascular disease (ASCVD).

57. The use according to any one of claims 54-56, wherein the cardiovascular and cerebrovascular diseases include coronary heart disease, ischemic stroke, peripheral vascular disease, or calcified aortic stenosis.

58. A method for preventing or treating a disease, symptom, or syndrome, the method comprising administering to a subject in need an effective amount of an RNA inhibitor of LPA gene expression as described in any one of claims 1-29, a pharmaceutically acceptable salt thereof, a pharmaceutical composition as described in any one of claims 30-43, and / or a kit or delivery device as described in claim 44.

59. The method of claim 58, wherein the RNA inhibitor that inhibits LPA gene expression, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via subcutaneous, intravenous, oral, rectal, or intraperitoneal administration routes.

60. A method for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects, comprising administering to cells, tissues or subjects an effective amount of an RNA inhibitor for inhibiting LPA gene expression as described in any one of claims 1-29, a pharmaceutically acceptable salt thereof, a pharmaceutical composition as described in any one of claims 30-43, and / or a kit or delivery device as described in claim 44.

61. The method of claim 60, wherein the cell is a hepatocyte.

62. The method according to any one of claims 60-61, wherein the tissue is liver tissue.

63. The method according to any one of claims 60-62, wherein the cells and tissues are ex vivo.

64. A method for inhibiting PCSK9 expression in cells, tissues or a subject, comprising administering to the cells, tissues or a subject an effective amount of an RNA inhibitor for inhibiting LPA gene expression as described in any one of claims 1-29, a pharmaceutically acceptable salt thereof, a pharmaceutical composition as described in any one of claims 30-43, and / or a kit or delivery device as described in claim 44.

65. The method of claim 64, wherein the cell is a hepatocyte.

66. The method according to any one of claims 64-65, wherein the tissue is liver tissue.

67. The method according to any one of claims 64-66, wherein the cells and tissues are ex vivo.

68. A method for inhibiting low-density lipoprotein cholesterol expression in cells, tissues or a subject, comprising administering to the cells, tissues or a subject an effective amount of an RNA inhibitor for inhibiting LPA gene expression as described in any one of claims 1-29, a pharmaceutically acceptable salt thereof, a pharmaceutical composition as described in any one of claims 30-43, and / or a kit or delivery device as described in claim 44.

69. The method of claim 68, wherein the cell is a hepatocyte.

70. The method according to any one of claims 68-69, wherein the tissue is liver tissue.

71. The method according to any one of claims 68-70, wherein the cells and tissues are ex vivo.

72. A method for inhibiting the expression of LPA mRNA and / or Lp(a) and / or apo(a) in cells, tissues or subjects, comprising inhibiting the expression of LPA mRNA and / or Lp(a) and inhibiting the expression of PCSK9.

73. A method for inhibiting PCSK9 expression in cells, tissues or subjects, comprising inhibiting LPA mRNA and / or Lp(a) expression, and inhibiting PCSK9 expression.

74. A method for inhibiting the expression of low-density lipoprotein cholesterol in cells, tissues or subjects, comprising inhibiting the expression of LPAmRNA and / or Lp(a) and inhibiting the expression of PCSK9.

Images