Novel targets for the modulation of ageing

Abstract

The present invention relates to age-modulation methods comprising modulating the expression and / or activity of a gene or combination of genes identified by a screening method. The screening method comprises introducing into or exposing to one or more ageing-inducing factor an induced pluripotent stem cell (iPSC) for a period of time, and performing a loss-of- function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen. Modulation of the expression and / or activity of the identified gene or combination of genes may be reduction / inhibition or increase / promotion. Particular examples of genes and combinations of genes are provided. Also provided are methods of modulating ageing in vivo and treating diseases or disorders associated with ageing, said methods comprising the age-modulating method described herein, such as by administering a modulator of the expression and / or activity of the identified gene or combination of genes described herein.

Description

[0001] CLO-C-P3828PCT

[0002] NOVEL TARGETS FOR THE MODULATION OF AGEING

[0003] FIELD OF THE INVENTION

[0004] The present invention relates to age-modulation methods comprising modulating the expression and / or activity of a gene or combination of genes identified by a screening method. The screening method comprises introducing into or exposing to one or more ageing-inducing factor an induced pluripotent stem cell (iPSC) for a period of time, and performing a loss-of- function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen. Modulation of the expression and / or activity of the identified gene or combination of genes may be reduction / inhibition or increase / promotion. Particular examples of genes and combinations of genes are provided. Also provided are methods of modulating ageing in vivo and treating diseases or disorders associated with ageing, said methods comprising the agemodulating method described herein, such as by administering a modulator of the expression and / or activity of the identified gene or combination of genes described herein.

[0005] BACKGROUND OF THE INVENTION

[0006] Ageing is the shared risk factor of a multitude of diseases, ranging from cancer to dementia (Niccoli and Partridge (2012) Curr. Biol.). However, a number of findings demonstrated that the ageing trajectory can be modulated, e.g. by dietary interventions (Longo and Mattson (2014) Cell Metab. -, Longo et al. (2021) Nat. Ageing), drugs (Kennedy and Pennypacker (2014) Trani. Res.; Guilbert et al. (2021) Methods), and genetic manipulation (Simpson et al. (2021) Clin Epigenetics; Zhang et al. (2020) Nat Rev Mol Cell Biol). Most importantly, reprogramming of somatic cells into induced pluripotent stem cells is able to reverse many hallmarks of ageing (Lapasset et al. (2011) Genes Dev.). Hence, there exist mechanisms that are able to modulate ageing, which deserve further investigation.

[0007] Whilst the process of ageing is still poorly understood, it affects cells in multiple ways. Otin et al. (2013) Cell have provided a comprehensive review of “The Hallmarks of Aging”, which include mitochondrial changes, senescence, altered intracellular communication, genomic instability, telomere shortening, epigenetic changes, and deregulation of nutrient pathways. These may lead to changes in cellular function, such as a reduced ability of immune cells to survey cancerogenic events, which ultimately contribute to the plethora of age-related diseases.

[0008] Stem cells provide scalable model systems to study the biology of a species. However, modelling late-onset disorders using pluripotent stem cells (PSCs) such as embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC) technology holds a challenge due to the CLO-C-P3828PCT embryonic nature of pluripotent stem cells and in particular the cellular rejuvenation during iPSC reprogramming (Lapasset et al. (2011) Genes Dev.', Maherali et al. (2007) Cell Stem Cell', Studer et al. (2015) Stem Cell, 16(6): 591-600).

[0009] Moreover, hallmarks of aging are often related to disease-associated degenerative processes. Independently, they have been associated with a gradual deterioration in structure and function. Some of these hallmarks have been identified as nuclear blebbing and folding, shortening of dendrite length (in the case of neurons), telomere attrition, reduced proteostasis and the accumulation of DNA damage and mitochondrial reactive oxygen species (ROS) (Lopez-Otin et al. (2013) Cell', Miller et al. (2013) Cell Stem Cell', Studer et al. (2015) Stem Cell). In addition, changes in the gene expression profile have been observed in neurons (Arancio (2019) GeroScience' Mertens et al. (2015) Cell Stem Cell, 17(6): 705-718) and in the human brain in general (Dillman et al. (2017) Sci. Rep.).

[0010] These findings further corroborate the need for generating faithful iPSC models of human disease and have therefore inspired two main strategies to induce cellular aging. The first approach involves manipulating the cellular environment by introducing toxic stressors such as reactive oxygen species (Davalli et al. (2016) Oxid. Med. Cell. Longev.), or by inflammatory cytokines to mimic the general overall inflammatory state associated with aging. The second approach involves introducing intrinsic changes to the cells to induce aging. That was accomplished by promoting telomere shortening through pharmacological inhibition of telomerase, the enzyme involved in maintaining telomere length (Vera et al. (2016) Cell Rep.). In this study, similar age- and disease-related phenotype changes such as an increase in mitochondrial ROS production, DNA damage and loss tyrosine hydroxylase expression were reported in Parkinsonian midbrain dopaminergic neurons. However, the study remains preliminary, as the effect on other cellular processes was not looked at.

[0011] There is therefore a need to develop systematic methods to faithfully identify genes and regulatory networks that contribute to ageing and the reversal of ageing in iPSCs, the activity and / or expression of which can subsequently be modulated to modulate ageing.

[0012] SUMMARY OF THE INVENTION

[0013] According to a first aspect of the invention, there is provided a method of modulating ageing, said age-modulating method comprising modulating the expression and / or activity of a gene or combination of genes identified by a screening method, said screening method comprising the steps of: CLO-C-P3828PCT

[0014] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0015] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC; and

[0016] (iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

[0017] In certain embodiments, the age-modulating method is for use in a method of treating a disease or disorder associated with ageing in a subject.

[0018] In further embodiments, ageing is reduced and / or slowed upon modulating the expression and / or activity of the identified gene or combination of genes, such as wherein the agemodulating method reduces and / or slows the progression of an ageing phenotype in a cell. In one embodiment, the expression and / or activity of the identified gene or combination of genes is reduced and / or inhibited in the age-modulating method. In an alternative embodiment, the expression and / or activity of the identified gene or combination of genes is increased and / or promoted in the age-modulating method.

[0019] In yet further embodiments, the ageing-inducing factor is an alternative splice form of Lamin A, such as progerin.

[0020] According to a further aspect of the invention, there is provided a method of modulating or treating ageing in vivo, said method comprising the age-modulating method as described herein.

[0021] According to a further aspect of the invention, there is provided a method of modulating ageing in vivo, said method comprising the age-modulating method as described herein.

[0022] In a yet further aspect, there is provided a method of treating a disease or disorder associated with ageing, said method comprising the age-modulating method as described herein.

[0023] In certain embodiments, the age-modulating method or the method of treating a disease or disorder comprises administering a modulator of the expression and / or activity of a gene or combination of genes identified by the screening method as described herein. CLO-C-P3828PCT

[0024] BRIEF DESCRIPTION OF THE FIGURES

[0025] Figure 1 : Microscopic analysis of iPSCs treated with varying concentrations of doxycycline to induce progerin expression. Left-hand column: brightfield analysis. Right-hand column: GFP fluorescence of GFP-progerin.

[0026] Figure 2: Immunofluorescence analysis of iPSCs treated with doxycycline to induce Progerin expression. Left panel: nuclei stained with DAPI. Right panel: immunofluorescence staining of progerin.

[0027] Figure 3: Flow cytometric analysis of the activity of Cas9 in engineered iPSCs demonstrated by the knockout of B2M (Example 2).

[0028] Figure 4: Single-cell gene expression data of aged or non-aged cells from Example 3 visualized on a UMAP plot using either the whole transcriptome (A) or the ageing signature (B).

[0029] Figure 5: A) Heatmap showing the expression of the genes of the ageing signature which are down-regulated upon ageing in cells harbouring respective gene knockouts (Example 4). B) Heatmap showing the expression of the genes of the ageing signature which are up-regulated upon ageing in cells harbouring respective gene knockouts (Example 4).

[0030] Figure 6: Heatmaps showing the expression of the genes of the ageing signature in cells harbouring respective gene knockouts (Example 5). A) Genes of ageing signature, which are down-regulated upon ageing. B) Genes of the ageing signature, which are up-regulated upon ageing.

[0031] Figure 7: Human iPSCs model of aged iNeurons. A) Scheme of the experimental procedure to generate non-aged or chronically aged cortical glutamatergic neurons. Human iPSCs are treated with 2pg / mL doxycycline for a week to overexpress NGN2. For drug validation of targets, non-aged and aged iNeurons are being treated with different drugs from day 15 until day 21 post induction. iNeurons induction is based on a previous protocol by Pawlowski et al. (2017). B) Scheme of the two different conditions tested, non-aged iNeurons (left) and chronically aged iNeurons (right).

[0032] Figure 8: Active mitochondrial mass marker assay following drug treatment. Chronically aged N2P iNs (‘untreated’) were treated with different drugs to test their effect on the density of active mitochondria, when compared to the control NGN2 iNs (‘non-aged’). Data is presented as mean ± SEM. One-way Anova. *p<0.05, ** p<0.01 , ****p<0.0001.

[0033] Figure 9: Mitochondrial ROS production following drug treatment. Chronically aged N2P iNs (‘untreated’) were treated with different drugs to test their effect on the production of superoxide by mitochondria, when compared to the control NGN2 iNs (‘nonaged’). Data is presented as mean ± SEM. One-way Anova. *p<0.05, ** p<0.01 , ****p<0.0001. CLO-C-P3828PCT

[0034] Figure 10: Mito Stress mitochondrial function assay following drug treatment. A) Control NGN2 iNs treated with different drugs and their effects on mitochondrial function. B-D) Chronically aged N2P iNs treated with different drugs, showing drugs that had no effect (B), a negative effect (C), or a positive effect (D) on the mitochondrial function of the cells.

[0035] Figure 11 : Basal respiration levels based on Mito Stress mitochondrial function assay following drug treatment. Chronically aged N2P iNs (‘Aged’) were treated with different drugs to test their effect on the mitochondrial activity, when compared to the control NGN2 iNs (‘Non-aged’). Data is presented as mean ± SEM. One-way Anova. **p<0.01, *** p<0.001, ****p<0.0001.

[0036] Figure 12: Epigenetic alteration in aged iNeurons following drug treatment. Immunocytochemistry staining for the heterochromatin marker H3K9me3 (red, left panels) in chronically aged iNeurons untreated and treated with the various drugs. GFP-progerin expression (green, middle panels) and the nuclear DNA marker DAPI (blue) are also presented. Scale bars: 25pm.

[0037] Figure 13: Epigenetic alteration in aged iNeurons following drug treatment. Quantitative measurement of H3K9me3 expression based on Immunocytochemistry staining demonstrating an increase in expression for some of the drugs. Data is presented as mean ± SEM. One-way Anova with Tukey’s multiple comparisons test. *p<0.05, **p<0.01, *** p<0.001, ****p<0.0001.

[0038] Figure 14: Genomic stability in aged iNeurons following drug treatment. Immunocytochemistry staining for the DNA damage marker yH2AX (grey, left panels) in chronically aged iNeurons untreated and treated with the various drugs. The nuclear DNA marker DAPI (blue) is also presented. Scale bar: 10pm.

[0039] Figure 15: Genomic stability in aged iNeurons following drug treatment. Quantitative measurement of the percentage of yH2AX foci based on Immunocytochemistry staining demonstrating a reduction in DNA damage for some of the drugs (% foci < 5).

[0040] Figure 16: A) Heatmap showing the expression of the genes of the ageing signature which are down-regulated upon ageing in cells harbouring respective gene knockouts based on the first genome-wide screen (Example 8). B) Heatmap showing the expression of the genes of the ageing signature which are up-regulated upon ageing in cells harbouring respective gene knockouts based on the first genome-wide screen (Example 8).

[0041] Figure 17: A) Heatmap showing the expression of the genes of the ageing signature which are down-regulated upon ageing in cells harbouring respective gene knockouts based on the second genome-wide screen (Example 9). B) Heatmap showing the expression of the genes of the ageing signature which are up-regulated upon ageing in cells harbouring respective gene knockouts based on the second genome-wide screen (Example 9). CLO-C-P3828PCT

[0042] Figure 18: Cell line engineering strategy. Knock-in of CAG driven rtTA into the ROSA26 locus, doxycycline-inducible GFP-Progerin expression cassette into the AAVS1 locus and CAG driven dCas9-VPR cassette into the CLYBL locus (Example 10).

[0043] Figure 19: Flow cytometry readout to confirm dCas9-VPR functionality in iPSCs. The figure shows CRISPR activation of CD274 in iPSCs. Guide RNA targeting CD274 was delivered by lentiviral transduction. Cells were stained with CD274 antibody and gene activation efficiency was assessed by flow cytometry (97.8%; gated on GFP positive population). A non-targeting guide serves as a control, offering a comparative baseline for the efficiency of the targeted modifications (Example 10).

[0044] Figure 20: Microscopy images confirm GFP-Progerin expression. Imaging of iPSCs treated with varying concentrations of doxycycline (0, 0.065, 0.075, 0.085 pg / mL) to induce progerin expression. Left-hand column: GFP fluorescence of GFP-Progerin. Righthand column: Brightfield images (Example 10).

[0045] Figure 21 : Heatmap of ageing signature genes. A) Heatmap showing the expression of the genes of the ageing signature which are down-regulated upon ageing in cells harbouring respective gene activation (Example 11). B) Heatmap showing the expression of the genes of the ageing signature which are up-regulated upon ageing in cells harbouring respective gene activation (Example 12).

[0046] Figure 22: Principal component analysis (PCA) of aged hiPSCs treated with small molecules against distinct target genes from the CRISPR screens.

[0047] Figure 23: Linear discriminant analysis (LDA) based on all differentially expressed genes for aged hiPSCs treated with small molecules against distinct target genes from the CRISPR screens.

[0048] Figure 24: Linear discriminant analysis (LDA) based on a subset of genes (ageing signature genes) for aged hiPSCs treated with small molecules against distinct target genes from the CRISPR screens.

[0049] Figure 25: Association between target genes identified in the CRISPR screens and age-related disorders.

[0050] DETAILED DESCRIPTION OF THE INVENTION

[0051] The present invention is based on the novel identification of genes and combinations of genes involved in ageing processes (e.g. in the reversal of ageing or in the maintenance of a nonaged phenotype) and the modulation of their expression and / or activity to modulate ageing. As will be readily appreciated, said age-modulation will be useful in treating diseases and disorders associated with ageing. CLO-C-P3828PCT

[0052] Thus, according to a first aspect of the invention there is provided a method of modulating ageing, said age-modulating method comprising modulating the expression and / or activity of a gene or combination of genes identified by a screening method, said screening method comprising the steps of:

[0053] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0054] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC; and

[0055] (iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

[0056] Ageing & Ageing Phenotypes

[0057] The terms “age” and “ageing” as used herein refer to the phenotypic changes associated with age which restrict functionality and can be considered to be a consequence of ageing. These can be distinct from ageing DNA correlates such as epigenetic changes and double strand breaks for which the causality with ageing has not yet been established and reversal of which may not lead to a reversal of ageing or maintenance of a non-aged phenotype. However, it will be appreciated that these correlates may be measured in the methods described herein as alternative / further ageing phenotypes. Examples of cellular phenotypes associated with ageing are: mitochondrial dysfunction, senescence, altered intracellular communication, genomic instability, telomere shortening, epigenetic changes, and deregulation of nutrient pathways (Otin et al. (2013) Cell, 153(6): 1194-1217 doi: https: / / oi.org / 10.1016% 2Fi.cell.2013.05.039). Other ageing phenotypes include: reduced proliferation, changes in cell and / or nuclear morphology, changes in gene expression, and upregulation of Lamin-A and / or Lamin-C nuclear protein. Thus, “age” and “ageing” may refer to any ageing phenotype herein and in certain embodiments refer to the phenotype of the cell (e.g. the ageing phenotype), such as the phenotype of the cell measured as part of a method of identifying a gene or combination of genes involved in the reversal or maintenance of a non-aged phenotype as described herein.

[0058] References to “modulating ageing” and “age-modulating / modulation methods” are used interchangeably herein and refer to the alteration (e.g. reversal) or maintenance of an ageing phenotype, such as any of those described herein. Said modulating and methods may also refer to “rejuvenation”. Therefore, the age-modulating methods described herein may maintain a cell in a younger or non-aged state compared to a cell not subjected to the present CLO-C-P3828PCT methods or non-rejuvenated, or will alter the age of a cell so that it is younger or in a less- aged state than prior to being subjected to the present methods or prior to rejuvenation.

[0059] Whether a cell is “younger”, “non-aged” or “less-aged” may be determined using any ageing phenotype described herein, in particular using an epigenetic and / or transcriptomic clock. For example, an age-modulated cell may display fewer alterations in cellular and / or nuclear morphology compared to a non-modulated cell or a cell in a non-rejuvenated state. In certain embodiments, age is determined using a transcriptome signature. In a further embodiment, age is determined using a whole-transcriptome signature. In a particular embodiment, age is determined using a transcriptome signature of genes differentially expressed in iPSCs into which an ageing-inducing factor has been introduced as described herein. In further embodiments, age is determined measuring epigenetic changes, such as changes in chromatin accessibility as measured by ATAC-seq or changes in DNA methylation as measured by bisulfite sequencing.

[0060] In one embodiment, the ageing phenotype may be selected from one or more of: proliferation, senescence, loss of proteostasis, changes in cell and / or nuclear morphology, mitochondrial function, changes in gene expression, altered expression of Lamin-A and / or Lamin-C nuclear protein, in particular upregulation, epigenetic marks associated with ageing, altered DNA or histone methylation, altered methylation entropy, DNA double strand breaks, telomere length, and a transcriptomic and / or epigenetic clock. In a yet further embodiment, the ageing phenotype is reduced proliferation and / or increased senescence. In another embodiment, the changes in nuclear morphology are folding abnormalities, blebbing and / or loss of nuclear circularity. In a further embodiment, the mitochondrial function is reduced oxygen consumption and / or increased mitochondrial reactive oxygen species (ROS). In a yet further embodiment, the changes in gene expression are selected from one or more of: differential expression of somatic cell lineage identity genes, differential expression of mitochondrial genes, differential expression of apoptosis- and / or senescence-related genes, differential expression of autophagy-associated genes, differential expression of inflammation response- related genes, differential expression of altered intracellular communication-related genes, deregulated nutrient-sensing-related genes, and differential expression of DNA damage- related genes. In a still further embodiment, the changes in gene expression are selected from one or more of: downregulation of somatic cell lineage identity genes, downregulation of mitochondrial genes, upregulation of apoptosis- and / or senescence-related genes, downregulation / upregulation of autophagy-associated genes, differential expression of inflammation response-related genes, differential expression of altered intracellular communication-related genes, deregulated nutrient-sensing-related genes, and upregulation CLO-C-P3828PCT of DNA damage-related genes. In another embodiment, the epigenetic marks associated with ageing are selected from one or more of: reduced heterochromatin trimethylated H3K9 (H3K9me3), reduced heterochromatin trimethylated H3K27 (H3K27me3), reduced HP1y, and increased yH2AX. In a further embodiment, the telomere length is shortened. In a yet further embodiment, the transcriptom ic and / or epigenetic clock is a single cell transcriptomic and / or epigenetic clock. In a certain embodiment, the ageing phenotype is a transcriptomic clock, such as a transcriptomic signature associated with an aged phenotype. In a further embodiment, the ageing phenotype is a single cell transcriptomic clock, such as a transcriptomic signature associated with an aged phenotype. In a still further embodiment, the ageing phenotype, such as the ageing phenotype of the cell, is a combination of one or more of the ageing phenotypes described herein.

[0061] In one embodiment, the “age” of the cell or whether the cell is “aged” may be determined using an epigenetic clock, such as the Horvath epigenetic clock (Horvath, S (2013) Genome Biol., doi: https: / / doj.org / 10 1186 / qb-2013--14-10-r115), i.e. in some embodiments the ageing phenotype is age as determined using the Horvath epigenetic clock. Thus, in a further embodiment measuring an ageing phenotype comprises measuring the age of the cell according to an epigenetic clock, such as the Horvath epigenetic clock. The Horvath epigenetic clock can be used as an age estimation method based on DNA methylation at CpG dinucleotide motifs in the DNA. DNA methylation age (further known as a “predicted age”) is characterised by the following properties: it is close to zero for ES and iPS cells; it correlates with cell passage number; it gives rise to a highly heritable measure of age acceleration; and it is applicable to chimpanzee tissues. The DNA methylation age of blood has been shown to predict all-cause mortality in later life, even after adjusting for known risk factors, suggesting that it is related to processes that cause ageing. Similarly, markers of physical and mental fitness have been associated with the epigenetic clock. One particular feature of the Horvath epigenetic clock is its high accuracy and applicability to a broad spectrum of tissues and cell types. Since it allows one to contrast the ages of different tissues and cells from the same subject (including a forward programmed somatic cell with a non-iPSC derived somatic cell of the same lineage or a pluripotent cell, such as an iPSC), it can be used to identify tissues and cells that show evidence of accelerated age due to disease. Furthermore, the Horvath epigenetic clock may be used to identify any change in DNA methylation age caused by treatment, such as reprogramming or forward programming.

[0062] In another embodiment, “age” is determined using a transcriptomic clock, such as a single cell transcriptomic clock, i.e. in some embodiments the ageing phenotype is age as determined using a transcriptomic clock. Thus, in a further embodiment measuring an ageing phenotype CLO-C-P3828PCT comprises measuring the age of the cell according to a transcriptomic clock. In some embodiments, the transcriptomic clock comprises a transcriptomic signature associated with an aged phenotype of the cell. One example of transcriptomic clocks is described in Fleischer et al. (2018) Genome Biol. 19, 221 (doi: ht ps: / / doj org / 10 1186 / S13059-018-1599-6). Previously known ageing clocks trained on single cell RNA sequencing signatures typically suffer from: i) restriction to particular cell types; ii) lower accuracy than epigenetic-based ageing clocks; and iii) high variance of age measurements. However, these may be overcome using the transcriptomic clock described herein, using a novel bioinformatic approach which yields single cell transcriptomic clocks that: i) are cell type independent; ii) exhibit accuracy rivalling epigenetic ageing clocks; and iii) have minimal variance in age measurements. Said bioinformatic approach may also be applied to multiomic data where data sets such as genomic, proteomic and epigenomic data sets are combined. In a further embodiment, a transcriptomic clock, such as a single cell transcriptomic clock, may be combined with any ageing phenotype described herein. For example, in some embodiments age is determined using a combination of a single cell transcriptomic clock with changes in cell and / or nuclear morphology, epigenetic clock measurements, mitochondrial function, epigenetic marks associated with ageing, altered methylation entropy, gene expression or any combination thereof.

[0063] Measuring an ageing phenotype that is an epigenetic and / or transcriptomic clock as described herein comprises determining age using said epigenetic and / or transcriptomic clock as being “older” (i.e. a quantifiable change is detected) upon introducing one or more ageing-inducing factor into the iPSC or exposing the iPSC to one or more exogenous ageing-inducing factor, compared to the cell prior to said introduction of or exposure to the ageing-inducing factor (i.e. the methylation and / or transcriptomic age is older than a non-treated cell). Additionally or alternatively, the epigenetic and / or transcriptomic clock ageing phenotype may be changed compared to an iPSC in which the one or more ageing-inducing factor has not been introduced or an iPSC which has not been exposed to the one or more exogenous ageing-inducing factor, i.e. a control cell. In particular, measuring the expression level of the gene expression signature / gene list identifies differential expression of said genes in the cell compared to a control cell. For example, when the cell is aged the gene list will be differentially expressed compared to a non-aged control cell. Thus, in one embodiment the gene list is differentially expressed when the cell is aged compared to a control cell. Non-limiting examples of control cells include cells into which no ageing-inducing factor has been introduced or which have not been exposed to an exogenous ageing-inducing factor, and cells obtained from aged tissues or organs of a subject which are different to the tissue or organ from which the cell being determined is obtained or cells which are obtained from the same tissue or organ of the subject CLO-C-P3828PCT from an earlier point in the life cycle of said tissue, organ or subject (e.g. a control cell collected earlier in the life of the subject). Thus, in one embodiment the iPSC may be aged by introduction of one or more ageing-inducing factor into the cell or by exposing the iPSC to one or more exogenous ageing-inducing factor, and the control cell is an iPSC into which no ageing-inducing factor is introduced or which has not been exposed to an exogenous ageinginducing factor. In another embodiment, the aged cells may be obtained from an aged tissue or organ of a subject or from a tissue or organ of an aged subject, and the control cell is a cell obtained from a different tissue or organ of the subject or is obtained from the same tissue or organ of the subject from an earlier point in the life cycle of said tissue or organ. As such, determining age as described herein comprises determining the gene expression signature as being “older” (i.e. a quantifiable change is detected) in the cell compared to a control cell.

[0064] In further embodiments, the ageing phenotype may be any suitable molecular signature, including those suitable for use as a biological clock. Such biological clocks may therefore be used to determine biological age. Further examples of biological clocks to those mentioned herein are known in the art and include the measurement of telomere length, the proteomic clock, the metabolomic clock and the ribosomal clock which measures the methylation status of CpG sites within ribosomal DNA (rDNA; Wang & Lemos (2019) Genome Res, doi: http: / / wwwqenome.org / cqj / doj / 10.1101 / r.241745.118). It will be readily appreciated that any of these and other molecular signatures / biological clocks may be used independently or in combination (e.g. the epigenetic and transcriptomic clocks may be measured together in combination as the ageing phenotype, or either / both the epigenetic and transcriptomic clocks may be measured together with a further biological clock, such as the ribosomal clock). In the context of biological clocks, making a cell “older” will therefore comprise a detectable and quantifiable change in the age determined by these clocks, such as an rDNA methylation (rDNAm) age which is older, upon introducing one or more ageing-inducing factor into the cell or exposing the cell to one or more exogenous ageing-inducing factor, compared to the cell prior to said introduction of or exposure to the ageing-inducing factor. Additionally or alternatively, the biological clock (e.g. the rDNAm age) ageing phenotype may be changed compared to an iPSC in which the one or more ageing-inducing factor has not been introduced or an iPSC which has not been exposed to the one or more exogenous ageing-inducing factor.

[0065] Introduction of one or more ageing-inducing factor into an iPSC or exposing an iPSC to one or more ageing-inducing factor as part of the screening method described herein thus results in a change in the age of a cell as described herein, in particular making the cell “older”. Such changes in the age of the cell comprise a change of an ageing phenotype, epigenetic clock (i.e. methylation age) and / or transcriptomic clock (i.e. transcriptomic age) which may then be CLO-C-P3828PCT measured as described herein. Thus, in some embodiments any one or more of the ageing phenotypes described herein is induced in the iPSC as part of the screening method. In one embodiment, a measurable change in an epigenetic clock and / or a transcriptomic clock, in particular a transcriptomic clock (i.e. the transcriptomic age) is induced. In a particular embodiment, a measurable change in the transcriptome signature as described herein is induced. It will be appreciated that the screening method as described herein forces ageing upon the iPSC by introduction of or exposure to the one or more ageing-inducing factor and therefore may be referred to as “artificially ageing” the iPSC. Thus, in some embodiments the screen comprises accelerated ageing compared to the normal ageing of an iPSC, such as the same type of cell subjected to the screen, that is the ageing of the cell when no artificial ageing has been induced. In further embodiments, the screen comprises artificially inducing ageing in the iPSC compared to an iPSC not subjected to the introduction / exposure of the ageinginducing factor which, due to the self-renewal properties of such cells, does not otherwise display an ageing phenotype or an “old” ageing phenotype.

[0066] The terms “induce ageing”, “inducing ageing”, “induced ageing” and “ageing-inducing” are used herein to indicate the active induction of ageing in the screening method described herein. Such induction may be temporal or transient, i.e. for a defined period of time, and not permanent. Methods of inducing ageing are described in GB2206113.9 and PCT / GB2023 / 051123, the contents and methods of ageing disclosed therein are hereby specifically incorporated in their entirety. For example, the screening method described herein induces ageing in an iPSC for a period of time (i.e. transiently) while the one or more ageinginducing factor is introduced into or exogenously exposed to the cell. Following the defined “period of time” the one or more ageing-inducing factor may be removed or reduced, thereby removing the induction of ageing if desired. Thus, in one embodiment ageing is induced in the iPSC in the screening method for a period of time, and optionally followed by removal of the one or more ageing-inducing factor. Said removal is referred to herein as optional step (iic) of the screening method. In some embodiments, removing or reducing the one or more ageing-inducing factor comprises active removal or reduction, thereby leading to the reversal of one or more ageing phenotype in the cell. For example, in one embodiment optional step (iic) comprises removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression of the one or more ageing-inducing factor. Reversal of the ageing phenotype may be useful, for example, in validating the gene / combination of genes identified by the screen. Alternatively, reversal of the ageing phenotype is useful to identify genes or combinations of genes involved in the rejuvenation of a cell (in particular an iPSC) or the reversal of age, whereby the ability of the cell to rejuvenate or reverse an ageing phenotype following removal or reduction of the one or more ageing- CLO-C-P3828PCT inducing factors may be affected by the loss-of-function, inhibitory, knock-out, activatory, gain- of-function, combinatorial or perturbation screen performed in step (ii). Active removal or reduction of the one or more ageing-inducing factor may include removal of the exogenously provided ageing-inducing factor, inhibition of the activity of the ageing-inducing factor and / or reduction / inactivation of the expression of a sequence encoding the ageing-inducing factor. For example, wherein introducing the one or more ageing-inducing factor comprises one or more expression cassette comprising a sequence encoding the one or more ageing-inducing factor, active removal or reduction may comprise reduction and / or inhibition of the expression of said sequence. As will be readily appreciated by a normal interpretation of the term “active”, such active removal or reduction does not include the natural turnover of an ageing-inducing factor which has been introduced into the cell e.g. by transient transfection. Thus, reduction and / or inhibition of the expression of a sequence encoding the one or more ageing-inducing factor may not comprise passaging the cell following transient transfection of a sequence encoding the one or more ageing-inducing factor. Reduction and / or inhibition of the expression of the sequence encoding the one or more ageing-inducing factor can comprise active regulation (i.e. reduction / inhibition) of said expression by a transcriptional regulator protein which binds to and controls expression at an inducible promoter. Thus, wherein the expression cassette further comprises an inducible promoter which is regulated by a transcriptional regulator protein, expression of the sequence encoding the one or more ageinginducing factor may be reduced and / or inhibited by regulating the activity of the transcriptional regulator protein, in particular actively regulating said activity of the transcriptional regulator protein. For example, wherein the transcriptional regulator protein is a transcriptional activator protein, expression of the sequence encoding the one or more ageing-inducing factors is reduced / inhibited by removal from the cell of an exogenous substance (e.g. tetracycline and derivatives thereof or cumate) which activates the transcriptional activator protein. Alternatively, wherein the transcriptional regulator protein is a transcriptional repressor protein, expression is reduced / inhibited by addition of an exogenous substance (e.g. tetracycline and derivatives thereof or cumate) which deactivates the transcriptional repressor protein. Therefore, expression of the sequence encoding the ageing-inducing factor or the activity of the transcriptional regulator protein may be reduced and / or inactivated by the removal an exogenously supplied substance, such as tetracycline and derivatives thereof or cumate. Thus, in a further embodiment expression of the one or more ageing-inducing factor in the iPSC is reduced by removing the exogenous substance (in a step referred to as step (iic) herein). Optionally, the iPSC may be cultured following removal of the exogenous substance. In a yet further embodiment, introducing one or more ageing-inducing factor into the iPSC or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time comprises introducing one or more expression cassette into the cell, said expression cassette CLO-C-P3828PCT comprising a sequence encoding the one or more ageing-inducing factor under the control of an inducible promoter which is regulated by a transcriptional regulator protein, wherein expression of the sequence encoding the ageing-inducing factor or the activity of the transcriptional regulator protein is controlled by an exogenously supplied substance, such as tetracycline and derivatives thereof or cumate.

[0067] The period of time for which ageing is induced and the one or more ageing-inducing factor is introduced into the iPSC / exposed to the iPSC in step (i) or optionally in step (iib) of the screening method will be appreciated to depend on the ageing-inducing factor and / or the amount of ageing-inducing factor introduced into the cell or to which the cell is exposed. The identity of the iPSC may also determine the period of time for which ageing is induced. For example, a proliferating stem cell may be induced for a shorter period of time than a non- or more slowly proliferating cell. Alternatively, a stem cell with regenerative capacity which reverses an ageing phenotype (a particular characteristic of iPSCs) may be induced for a longer period of time than a cell which does not comprise regenerative capacity. Thus, in some embodiments ageing is induced in step (i) or optionally in step (iib) of the screening method for a period of time for the iPSC to develop and / or display one or more ageing phenotype as described herein, such as until an ageing phenotype is developed and / or displayed. In further embodiments, ageing is induced in step (i) or optionally in step (iib) for a period of time for one or more ageing phenotype as described herein to be measured and / or observed in the iPSC, such as until an ageing phenotype is measured and / or observed. Thus, in some embodiments an ageing phenotype is induced in step (i) or optionally in step (iib) of the screening method for a period of time. In one embodiment, ageing is induced in step (i) or optionally in step (iib) for a period of time of 5 days or more. Thus, in a further embodiment the one or more ageing-inducing factor is introduced into the iPSC or the iPSC is exposed to the one or more ageing-inducing factor for 5 days or more. In a yet further embodiment, ageing is induced in step (i) or optionally in step (iib) for a period of time of 7 days or less. Thus, in one embodiment the one or more ageing-inducing factor is introduced into the iPSC or the iPSC is exposed to the one or more ageing-inducing factor for 7 days or less. In a still further embodiment, ageing is induced in step (i) or optionally in step (iib) for a period of time of between 5 and 7 days. Thus, in one embodiment the one or more ageing-inducing factor is introduced into the iPSC or the iPSC is exposed to the one or more ageing-inducing factor for between 5 and 7 days. In one embodiment, ageing is induced for a period of time of 5 days. Thus, in one embodiment the one or more ageing-inducing factor is introduced into the iPSC or the iPSC is exposed to the one or more ageing-inducing factor for 5 days. In another embodiment, ageing is induced in step (i) or optionally in step (iib) for a period of time of 7 days. Thus, in one embodiment the one or more ageing-inducing factor is introduced into the CLO-C-P3828PCT iPSC or the iPSC is exposed to the one or more ageing-inducing factor for 7 days. References herein to “ageing is induced for a period of time” also apply to introducing one or more ageing inducing factor or exposing a cell to one or more exogenous ageing-inducing factor for a period of time in step (i) or optionally in step (iib). After removal or reduction of the one or more in optional step (iic), such as active removal or reduction of the ageing-inducing factor as described hereinbefore, it has previously been observed by the inventors that stem cells (e.g. pluripotent stem cells and iPSCs) reverse the changes in ageing phenotypes seen upon introduction of the ageing-inducing factor and that this reversal is quicker than can be explained by changes in the level of the ageing-inducing factor in the cell (e.g. through protein turnover). Therefore, it is hypothesised that the unique regenerative capacity of stem cells actively reverses transiently induced ageing phenotypes and by performing screens on said aged iPSCs, genes or combinations of genes involved in this regenerative capacity can be identified. As such, in certain embodiments ageing is induced in step (i) in the iPSC for a period of time, followed by removal or reduction (e.g. active removal or reduction) of the one or more ageing-inducing factor in optional step (iic), thereby leading to a reversal of one or more ageing phenotype in the cell. The ageing of the iPSC upon introduction of the ageinginducing factor and / or the reversal following removal may be affected by the screen performed in step (ii). In one embodiment, the one or more ageing phenotype induced in step (i) is the same ageing phenotype reversed upon removal or reduction of the ageing-inducing factor in step (iic). In an alternative embodiment, the one or more ageing phenotype induced in step (i) is a different ageing phenotype to that reversed in step (iic). In certain embodiments following the screen of step (ii), there is no reversal of the ageing phenotype upon removal / reduction of the ageing-inducing factor, due to the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen performed in the iPSC.

[0068] Prior to the disclosures of GB2206113.9 and PCT / GB2023 / 051123, methods of transiently ageing a cell (e.g. a stem cell or a somatic cell derived from an iPSC by forward programming) comprising a first step of introducing one or more ageing-inducing factor into the cell or exposing the cell to said ageing-inducing factor, followed by a second step of removing or reducing the ageing-inducing factor, in particular actively removing or reducing the ageinginducing factor, had not previously been described in the art. For example, LIS2016 / 0115444 discloses the ability to accelerate the “maturation” of cells using progerin, and Chojnowski et al. (2020) Aging Cell, 19(3):e13108 (doi: htps: / / doi.Org / 10.1111 %2Facel. 3108) discloses the effect on the cell cycle and heterochromatin loss upon progerin expression in cells. However, both US2016 / 0115444 and Chojnowski et al. (2020) use the transient expression of progerin in cells, and thus neither disclose the reversal of ageing in stem cells or iPSC-derived somatic cells following the removal or reduction of an ageing-inducing factor according to present CLO-C-P3828PCT optional step (iic). In particular, the active removal or reduction of the one or more ageinginducing factor, thereby leading to the reversal of one or more ageing phenotype in the cell, is not disclosed. Furthermore, Miller et al. (2013) Cell Stem Cell, 13(6):691-705 (doi: https: / / dQs.Org / 10.1016 / s.ste .2013 11.006) discloses the induction of multiple ageing-related markers and characteristics in fibroblasts and neurons following transient / short-term expression of progerin. However, there is no disclosure therein of the removal / reduction of progerin or of a reversal of ageing following the transient expression of progerin, possibly implying that the transient expression of progerin is sufficient to irreversibly induce ageing phenotypes, contrary to the previous and current findings of the present inventors. Furthermore, other than the screening methods disclosed in GB2206113.9 and PCT / GB2023 / 051123, no methods such as those described herein for the identification of cellular processes or genes involved in the regenerative capacity of stem cells or in the reversal of an ageing phenotype / maintenance of a non-aged phenotype and the subsequent modulation of their activity and / or expression in modulating ageing are known in the art.

[0069] Ageing-Inducing Factors

[0070] It will be appreciated that the term “ageing-inducing factor” as used herein may include any condition, agent, compound, gene / gene expression or cellular condition that can induce and / or alter any of the ageing phenotypes described herein, including age as determined using an epigenetic and / or transcriptomic clock or other biological clock / combination of biological clocks. For example, the ageing-inducing factor may be an alternative splice form of Lamin A, such as progerin or a progerin-like truncated form of Lamin A, which alters nuclear morphology, in particular loss of nuclear circularity. Progerin is a nuclear lamina protein associated with Hutchinson-Gilford Progeria Syndrome (HGPS) and is a mutant form of Lamin A lacking 50 amino acids of the C-terminus which prevents removal of a farnesyl group and leads to accumulation of the protein at the nuclear rim / lamina. In another example, the ageing-inducing factor may be a physical stressor. Physical stressors include radiation, such as X-ray radiation, and other inducers of DNA damage which lead to DNA double stand breaks. Thus, in one embodiment the one or more ageing-inducing factor is an alternative splice form of Lamin A. In a particular embodiment, the alternative splice form of Lamin A is progerin. In a further embodiment, the one or more ageing-inducing factor is a progerin-like protein, such as a truncated form of Lamin A which may comprise a deletion of the C-terminal truncation site leading to the improper processing of the protein failure to integrate into the nuclear lamina, causing morphological alterations in the cell which are similar to those caused by progerin. In another embodiment, the one or more ageing-inducing factor is a mitochondrial DNA mutation, such as deletion of DNA polymerase subunit gamma (POLG). In a further embodiment, the one or more ageing-inducing factor is an ageing-inducing compound, such CLO-C-P3828PCT as a telomerase inhibitor (e.g. BIBR1532), reactive oxygen species (ROS) or a compound that disrupts mitochondria function, such as 6-hydroxydopamine (6-OHDA), valinomycin, CCCP, rotenone or hydrogen peroxide. In a yet further embodiment, the ageing-inducing factor is a physical stressor. In a still further embodiment, the ageing-inducing factor is an inducer of DNA damage, such as ionizing radiation (e.g. X-ray radiation), platinum-containing drugs (e.g. cisplatin, oxaliplatin or carboplatin), cyclophosphamide, chlorambucil or temozolomide. In one embodiment, the one or more ageing-inducing factor is radiation, such as X-ray radiation.

[0071] In certain embodiments, the ageing phenotype is specific to the cell, such as to the cell type and / or lineage. For example, and without limitation, wherein the cell is a stem cell, such as a pluripotent stem cell, an induced pluripotent stem cell (iPSC), a germline stem cell, a multipotent stem cell, an oligopotent stem cell, a unipotent stem cell or a tissue-specific / tissue- resident stem cell, the ageing phenotype may be reduced proliferation. Alternatively or in addition, wherein the cell is a stem cell (i.e. an iPSC), the ageing phenotype may be increased senescence. If the cell is an immune cell, such as a T cell, the ageing phenotype may be increased senescence. If the cell is a cell of the nervous system, such as a neuron or a glia cell, the ageing phenotype may be a phenotype of a neurological degenerative disease, such as reduced process density and / or connectivity, reduced average dendritic length, reduced neurite diameter, downregulation of neuronal marker genes or reduced electrophysiological activity. If the cell is a muscle cell, such as a myocyte in the heart, the ageing phenotype may be reduced electrophysiological activity or reduced mitochondrial function.

[0072] Cells in which the Screening & Age-Modulating Methods are Performed

[0073] In particular embodiments, the screening method is performed in an iPSC as described herein. In further embodiments, the age-modulating method is performed in a cell. Cells in which the age-modulating method is performed may be any cell in vitro, in vivo or ex vivo. Examples of cells in vitro include those in culture, such as in an in vitro cell culture of, for example primary cells obtained from a subject or cell lines ay may be known in the art. Thus, in some embodiments the age-modulating method may be performed in vitro, in vivo or ex vivo.

[0074] In one embodiment the cell subjected to the age-modulating method is a pluripotent stem cell, an induced pluripotent stem cell (iPSC), a germline stem cell, a multipotent stem cell, an oligopotent stem cell, a unipotent stem cell or a tissue-specific / tissue-resident stem cell. Thus, it will be appreciated that cells suitable for the age-modulating methods and uses described herein may include any type of stem cell. For example, the stem cells may be pluripotent stem cells, for example iPSCs, embryonic stem cells or pluripotent stem cells derived by nuclear transfer or cell fusion. It may be preferred that the embryonic stem cell is derived without CLO-C-P3828PCT destruction of the embryo, particularly where the cells are human. In some embodiments, the stem cells are not derived from human or animal embryos, i.e. the invention does not extend to any methods or uses which involve the destruction of human or animal embryos. The stem cells may also include multipotent stem cells, oligopotent stem cells or unipotent stem cells. The stem cells may also include foetal stem cells or adult stem cells, such as hematopoietic stem cells, mesenchymal stem cells, neural stem cells, epithelial stem cells or skin stem cells. In certain aspects, the stem cells may be isolated from umbilical, placenta, amniotic fluid, chorion villi, blastocysts, bone marrow, adipose tissue, brain, peripheral blood, cord blood, menstrual blood, blood vessels, skeletal muscle, skin and liver.

[0075] References herein to “pluripotent” refer to cells which have the potential to differentiate into all types / lineages of cell found in an organism. Multipotent stem cells are able to differentiate into a smaller number of cell types than pluripotent cells, such as only those of closely related cell lineages. Oligopotent stem cells can differentiate into only a few cell types, such as lymphoid or myeloid stem cells. Unipotent cells can produce only one cell type and are thus- lineage-specific but have the ability to self-renew which distinguishes them from non-stem cells (e.g. progenitor cells, which cannot self-renew). One form of pluripotent stem cell, known as induced pluripotent stem cells, are of particular interest to the present invention. “Induced pluripotent stem cells” (iPSCs) are cells that have been reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells. In 2006, it was shown that overexpression of four specific transcription factors could convert adult cells into pluripotent stem cells. Oct-3 / 4 and certain members of the Sox gene family have been identified as potentially crucial transcriptional regulators involved in the induction process. Additional genes including certain members of the Klf family, the Myc family, Nanog, and Lin28, may increase the induction efficiency. Examples of the genes which may be used as reprogramming factors to generate iPSCs include Oct3 / 4, Sox2, Sox1 , Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tell , beta-catenin, Lin28b, Sall4, Esrrb, Tbx3 and Glisl , GATA3, GATA6 and these reprogramming factors may be used singly, or in combination of two or more kinds thereof. In particular, the reprogramming factors may comprise at least the Yamanaka factors, i.e. Oct3 / 4, Sox2, Klf4 and c-Myc.

[0076] In an alternative embodiment, the cell subjected to the age-modulating method is a somatic cell, such as a somatic cell derived from a reprogrammed / differentiated iPSC. Such derivation of the somatic cell may be by forward programming or directed differentiation of the iPSC using methods known in the art and as described herein. The iPSC may be as defined herein. The CLO-C-P3828PCT somatic cell may be derived from an iPSC by forward programming or by directed differentiation.

[0077] In one embodiment, the somatic cell subjected to the age-modulating method is a neuron (e.g. motor neuron, sensory neuron, GABAergic neuron, glutamatergic neuron or dopaminergic neuron), glia cell, blood cell (e.g. erythrocyte), immune cell (e.g. T cell, B cell, Macrophage, NK cell, neutrophil or granulocyte), liver cell (e.g. hepatocyte, Kupffer cell or stromal cell), muscle cell (e.g. smooth muscle cell), myocyte (e.g. cardiomyocyte), fibroblast, skin cell (e.g. keratinocyte), bone cell, cartilage cell, epithelial cell, endothelial cell or adipocyte. In a further embodiment the cell, such as the somatic cell, is a neuron derived from an iPSC by forward programming.

[0078] The term “somatic cell” as used herein includes any type (i.e. lineage) of cell that makes up the body of an organism, excluding germ cells and undifferentiated stem cells. Somatic cells may therefore include, for example and without limitation, neurons, glia cells, blood cells (e.g. leucocytes), liver cells (e.g. hepatocytes), muscle cells (e.g. myocytes) or fibroblasts. The somatic cell may be an adult cell or a cell derived from an adult which displays one or more detectable characteristics of an adult or non-embryonic cell. References herein to a somatic cell “derived from an iPSC by forward programming or directed differentiation” refer to cells which comprise the phenotype and / or characteristics of a somatic cell as defined herein (e.g. the surface phenotype and / or functional characteristics associated with a particular lineage) and have been forward programmed or differentiated from a pluripotent stem cell which has previously been reprogrammed as described herein, i.e. an iPSC. Forward programming of an iPSC to a somatic cell comprises the introduction of lineage-specific factors, such as transcription factors, or nucleic acids which encode said lineage-specific factors, for example in the form of mRNA or expression cassettes. Alternatively, forward programming may comprise increasing the expression of lineage-specific factors (e.g. lineage-specific transcription factors), such as by increasing the expression of said lineage-specific factor genes and / or their protein expression. The expression of an exogenous or endogenous (in particular an exogenous) transcription factor may be increased. In one embodiment, forward programming comprises introducing into the iPSC a nucleic acid or protein preparation which encodes or provides a lineage-specific transcription factor or combinations thereof, and culturing the cell under conditions suitable for reprogramming the cell into a somatic cell. Directed differentiation comprises culturing the iPSC in conditions to direct differentiation towards a particular somatic cell fate, such as by using exogenous factors to mimic developmental signals which would be encountered by the cell during physiological development. Directed differentiation factors may include signalling molecules and / or CLO-C-P3828PCT extracellular structures, scaffolds and / or matrices which promote cell adhesion and tissue-like structures. Such factors may be altered over time (e.g. in their type or structure, or in their dose / amount) to mimic the changing environment seen by the cell during development.

[0079] In one embodiment, the iPSC or somatic cell is from a mammal. In a further embodiment, the mammal is a human. Thus, in a particular embodiment the iPSC or somatic cell is from a human and is a human iPSC or a human somatic cell, such as a somatic cell forward programmed or differentiated from a re-programmed human iPSC. In an alternative embodiment, the mammal is a mouse, optionally such that the iPSC or somatic cell is a mouse iPSC or a mouse somatic cell, such as a somatic cell forward programmed or differentiated from a re-programmed mouse iPSC.

[0080] It will be understood that increasing the expression of lineage-specific factors, such as transcription factors, in the iPSCs to be forward programmed into somatic cells may include any method known in the art, for example, by induction of expression of one or more expression cassettes coding for said linage-specific factors previously introduced into the cells, or by introduction of nucleic acids (such as DNA or RNA), polypeptides or small molecules to the cells. Increasing the expression of certain endogenous but transcriptionally repressed genes may also reverse the silencing or inhibitory effect on the expression of these genes by regulating the upstream transcription factor expression or epigenetic modulation. Therefore, the invention may involve culturing the cell population under conditions to artificially increase the expression level of one or more lineage-specific transcription factors.

[0081] In particular embodiments, the lineage-specific transcription factors are provided by an expression cassette. Thus, in certain embodiments the cell comprises a further expression cassette comprising one or more coding sequences for one or more lineage-specific transcription factors operably linked to an inducible promoter. According to these embodiments, the cell comprising this further expression cassette may be forward programmed by inducing expression of the one or more lineage-specific transcription factors. Suitable inducible promoters are known in the art and include, without limitation the Tet system. However, as will be readily appreciated by the presence of a CuO sequence in the expression cassette encoding the Lamin A alternative splice form, any further expression cassette (including comprising lineage-specific transcription factor coding sequences) will not use a cumate inducible promoter. Thus, in certain embodiments the inducible promoter comprised in the further expression cassette is different to that in the expression cassette encoding the Lamin A alternative splice form. This inducible promoter imparts the ability to control expression of the one or more lineage-specific transcription factors. CLO-C-P3828PCT

[0082] In particular, the “inducible promoter” herein comprises an operator sequence for the transcriptional regulator protein (e.g. a tetracycline operator (TetO) sequence) and a constitutive promoter. In this system, the activity of the constitutive promoter is supressed until transcription is allowed / activated from the operator sequence.

[0083] Methods of Introducing Ageing-Inducing Factors into iPSCs & of Exposing iPSCs to Ageing-Inducing Factors

[0084] It will be further understood that methods of increasing expression, such as by induction of expression of one or more expression cassettes or by introduction of nucleic acids, polypeptides or small molecules as described herein, may also be utilised to introduce one or more ageing-inducing factor into the iPSC or to expose the iPSC to one or more exogenous ageing-inducting factor in the screening methods herein, as well as to alter the expression and / or activity of one or more identified gene or combination of genes in the age-modulating methods described herein. Thus, references herein to methods of modulating the expression and / or activity of the one or more ageing-inducing factor also apply to the modulation of the expression and / or activity of one or more gene or combination of genes identified by the screening methods and vice versa. Related methods of controlling expression may also be used to actively remove / reduce the one or more ageing-inducing factor, by reducing / inhibiting the expression of a sequence encoding said one or more ageing-inducing factor.

[0085] Thus, in one embodiment, in particular of the screening method herein, the one or more ageing-inducing factor is introduced by contacting the stem cell or somatic cell with said ageing-inducing factor. Delivery may occur using direct electroporation of one or more ageinginducing factors to the cells. Alternatively, delivery may be by direct treatment or administration to the cell, such as wherein the ageing-inducing factor is an ageing inducing compound, and / or by exposing cells to physical stressors, such as radiation. As will be understood by the methods and embodiments described herein, the ageing-inducing factor may be introduced prior to performing the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen of step (ii) in the iPSC as described herein, or may be introduced after said screen. Thus, in one embodiment step (i) of the screening method is performed prior to step (ii). In another embodiment, step (i) is performed prior to step (ii). In an alternative embodiment, the screen of step (ii) is performed prior to introducing the ageing-inducing factor into the iPSC or exposing the iPSC to the exogenous ageing-inducing factor in step (i). In a yet other embodiment, the screening method comprises optional step (iib) which is performed after step (ii). CLO-C-P3828PCT

[0086] Thus, in one embodiment the screening method comprises the steps of:

[0087] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0088] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC; and

[0089] (iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

[0090] As described hereinbefore, step (iv) may comprise comparing the cell in which the screen has been performed to a cell not subjected to the screen (a control cell). Thus, in one embodiment step (ii) is optional (i.e. it is performed in one cell and not in another, control, cell).

[0091] In another embodiment, the screening method comprises the steps of: performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in an induced pluripotent stem cell (iPSC); introducing one or more ageing-inducing factor into the iPSC or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time; and measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen.

[0092] In a yet other embodiment, the screening method comprises the steps of:

[0093] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC);

[0094] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC;

[0095] (iib) adding an exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time; and

[0096] (iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

[0097] In an alternative embodiment, the one or more ageing-inducing factor is introduced by contacting the iPSC and / or somatic cell with one or more agents that activate or increase the expression of said ageing-inducing factor. Expression of the ageing-inducing factor may be CLO-C-P3828PCT activated or increased prior to performing the screen, or may be activated or increased after performing the screen. Thus, in one embodiment the iPSC is first contacted with one or more agents that activate or increase the expression of one or more ageing-inducing factor and is followed by contacting the iPSC with one or more agents required for the screen. In an alternative embodiment, the iPSC is first contacted with one or more agents required for the screen and is followed by contacting the iPSC with one or more agents that activate or increase the expression of one or more ageing-inducing factor.

[0098] In one embodiment, the agent is selected from the group consisting of: a nucleic acid (i.e. a polynucleotide, such as a messenger RNA (mRNA) or coding DNA sequence); a protein (e.g. an antibody); an aptamer and small molecule; ribosome; RNAi agent; guide RNA (gRNA); and peptide nucleic acid (PNA) and analogues or variants thereof. In one embodiment, the agent is a transcriptional activation system (e.g. a gRNA for use in a gene activation system such as CRISPR / Cas9 or TALEN fused to a transcriptional activator) for increasing the expression of the one or more endogenous lineage-specific transcription factors and / or ageing-inducing factor.

[0099] Introduction of one or more ageing-inducing factor may comprise delivering to the cells a nucleic acid comprising an open reading frame encoding the ageing-inducing factor (e.g. in an expression cassette), the ageing-inducing factor protein, or an activator of transcription of the open reading frame encoding the ageing-inducing factor. This results in the amount of the ageing-inducing factor in the cells being increased. Said open reading frame may be part of a recombinant expression cassette. As will be readily appreciated, all references herein to the introduction of ageing-inducing factors may be applied to the introduction of, for example transcription factors into iPSCs for the purposes of forward programming where relevant.

[0100] In one embodiment, the nucleic acid comprises a recombinant or exogenous expression cassette comprising the one or more ageing-inducing factor sequences (e.g. a sequence encoding the ageing-inducing factor) in a sufficient number to induce ageing of the cell as described herein, such as by inducing an ageing phenotype. The exogenous expression cassette may comprise an externally inducible transcriptional regulatory element for inducible expression of the one or more ageing-inducing factor, such as an inducible promoter, e.g. comprising a tetracycline response element or variant thereof. In a yet further embodiment, the nucleic acid comprises a recombinant or exogenous expression cassette comprising the one or more ageing-inducing factor and any factors required for forward programming (e.g. sequences encoding the transcription and ageing-inducing factors), such that forward programming of an iPSC to a somatic cell and ageing of the cell are induced. Thus, the CLO-C-P3828PCT exogenous expression cassette may comprise two or more externally inducible transcriptional regulatory elements for inducible expression of one or more forward programming factors and ageing-inducing factor, such as two or more different inducible transcriptional regulatory elements (e.g. inducible promoters), for inducible expression of the one or more forward programming factors and ageing-inducing factor either concurrently or independently. The two inducible expression cassettes may be provided to the cell in a transient fashion and they may be stably integrated into the cell. In either case, the two expression cassettes may be physically linked, e.g. by residing on the same plasmid (such as are operably linked), or may be disjointed. If integrated in the genome, the two expression cassettes may reside in the same genomic locus or in two distinct genomic loci.

[0101] If expression of the one or more ageing-inducing factor is increased by introducing an exogenous sequence encoding the ageing-inducing factor (e.g. the ageing-inducing factor gene), then it would be understood that any suitable system for delivering the sequence may be used. The gene delivery system may be a transposon system; a viral gene delivery system; an episomal gene delivery system; or a homologous recombination system such as utilising a zinc finger nuclease, a transcription activator-like effector nuclease (TALENs), or a meganuclease, or a CRISPR / Cas9, or the like, alongside with a suitable homology donor.

[0102] Alternatively, introduction of a nucleic acid, such as DNA or RNA, into cells may use any suitable methods for nucleic acid delivery for transformation of a cell, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection, by injection (including microinjection), by electroporation, by calcium phosphate precipitation, by using DEAE- dextran followed by polyethylene glycol, by direct sonic loading, by liposome mediated transfection, by receptor-mediated transfection, by microprojectile bombardment, by agitation with silicon carbide fibers, by Agrobacterium-mediated transformation, and any combination of such methods. Through the application of these techniques, cells may be stably or transiently transformed. For example, transient transfection of a nucleic acid encoding the one or more ageing-inducing factor may find utility in the present methods for introducing one or more ageing-inducing factor into the cell or exposing the cell to one or more exogenous ageing-inducing factor for a period of time in step (i). Thus, step (i) of the screening method herein may comprise transient transfection. Furthermore, the one or more expression cassette may be transiently transfected into the cell. Thus, in a further embodiment the one or more expression cassette is transiently transfected into the iPSC. Still further, removing or reducing the one or more ageing-inducing factor in step (iic) may also comprise transient transfection, since such transfection introduces the one or more ageing-inducing factor into CLO-C-P3828PCT the cell for a period of time, after which the nucleic acid encoding the one or more ageinginducing factor is cleared by, no longer expressed in or expression of which is reduced in the cell. Thus, step (iic) may comprise culturing the cell, i.e. to effectively reduce or remove the one or more ageing-inducing factor in said cell. In one embodiment, step (iic) comprises culturing the iPSC, i.e. to effectively reduce or remove the one or more ageing-inducing factor in said cell. Additionally and / or alternatively, step (iic) may comprise passaging the cell in culture. Thus, in a further embodiment step (iic) comprises passaging the iPSC in culture. However, as will be appreciated by the disclosures herein, wherein the introduction / expression of one or more ageing-inducing factor is by controlled expression of a sequence encoding said ageing-inducing factor (e.g. using an exogenously supplied substance), transient transfection of a nucleic acid encoding the one or more ageing-inducing factor is not performed to introduce said ageing-inducing factor for a period of time in step (i). Thus, in certain embodiments step (i) does not comprise transient transfection. In a particular embodiment (such as wherein the cell is a somatic cell derived from an iPSC by forward programming), step (i) does not comprise transient transfection. In a further embodiment, the one or more expression cassette is not transiently transfected into the iPSC, i.e. it is stably introduced into the cell as described herein and / or using methods known in the art. According to these embodiments, removing or reducing the one or more ageing-inducing factor in step (iic) also does not comprise transient transfection. For example, removing or reducing the one or more ageing-inducing factor is active removal / reduction which does not rely on the clearing of the nucleic acid by the cell. In one embodiment, step (iic) does not comprise passaging the cell in culture. In another embodiment, step (iic) does not comprise passaging iPSC in culture.

[0103] Further, the expression cassette (e.g. an inducible recombinant expression cassette comprising sequences encoding one or more ageing-inducing factor) may include cleavable sequences. Such sequences are sequences that are recognised by an entity capable of specifically cutting DNA, and include restriction sites, which are the target sequences for restriction enzymes or sequences for recognition by other DNA cleaving entities, such as nucleases, recombinases, ribozymes or artificial constructs. At least one cleavable sequence may be included, but preferably two or more are present. These cleavable sequences may be at any suitable point in the cassette, such that a selected portion of the cassette, or the entire cassette, can be selectively removed if desired. The cleavable sites may thus flank the part / all of the genetic sequence that it may be desired to remove. The method may therefore also comprise removal of the expression cassette and / or the genetic material. CLO-C-P3828PCT

[0104] Vectors

[0105] In one embodiment, the one or more ageing-inducing factor are introduced into the cell population using a vector. One of skill in the art would be well equipped to construct a vector through standard recombinant techniques. Vectors include but are not limited to plasmids, cosmids, viruses (bacteriophage, animal viruses and plant viruses) and artificial chromosomes (e.g. YACs).

[0106] In one embodiment, the vector is a viral vector. The viral gene delivery system may be an RNA-based or DNA-based viral vector. Viral vectors include retroviral vectors, lentiviral vectors (e.g. derived from HIV-1 , HIV-2, SIV, BIV, FIV etc.), gammaretroviral vectors, adenoviral (Ad) vectors (including replication competent, replication deficient and gutless forms thereof), adeno-associated virus-derived (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus vectors, herpes virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, murine mammary tumour virus vectors, Rous sarcoma virus vectors and Sendai virus vectors. In a further embodiment, the viral vector is selected from: a lentiviral vector, an adeno-associated virus vector or a Sendai virus vector. In a yet further embodiment, the viral vector is a lentiviral vector.

[0107] Lentiviral vectors are well known in the art. Lentiviral vectors are complex retroviruses capable of integrating randomly into the host cell genome, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function (e.g. accessory genes Vif, Nef, Vpu, Vpr). Lentiviral vectors have the advantage of being able to infect non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentiviral vector capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat.

[0108] In one embodiment, a nucleic acid sequence encoding the one or more ageing-inducing factor is introduced into a cell by a plasmid (e.g. where transient transfection is used). In one embodiment, at least one nucleic acid sequence encoding forward programming factors (where relevant) and the one or more ageing-inducing factor is introduced into the cell on a single plasmid. In an alternative embodiment, the sequences encoding the forward programming factors (where relevant) and the one or more ageing-inducing factor are introduced into the cell on separate plasmids.

[0109] In one embodiment, the plasmid is episomal. Episomal vectors are able to introduce large fragments of DNA into a cell but are maintained extra-chromosomally, replicated once per cell CLO-C-P3828PCT cycle, partitioned to daughter cells efficiently, and elicit substantially no immune response. In alternative embodiments, an Epstein-Barr virus (EBV)-based episomal vector, a yeast-based vector, an adenovirus-based vector, a simian virus 40 (SV40)-based episomal vector, or a bovine papilloma virus (BPV)-based vector may be used.

[0110] Site-Specific Delivery and Targeting

[0111] Any suitable technique for insertion of a nucleic acid sequence into a specific sequence may be used, and several are described in the art. Suitable techniques include any method which introduces a DNA double-strand break at the desired location and permits recombination of the vector at the break point. Thus, a crucial first step for targeted site-specific genomic modification is the creation of a double-strand DNA break (DSB) at the genomic locus to be modified. Distinct cellular repair mechanisms can be exploited to repair the DSB and to introduce the desired sequence, and these are non-homologous end joining repair (NHEJ), which is more prone to error; and homologous recombination repair (HR) mediated by a donor DNA template, that can be used to insert inducible cassettes.

[0112] Several techniques exist to allow customised site-specific generation of DSB in the genome. Many of these involve the use of customized endonucleases, such as zinc finger nucleases, TALENs or the clustered regularly interspaced short palindromic repeats / CRISPR associated protein (CRISPR / Cas9) system.

[0113] Zinc finger nucleases are artificial enzymes which are generated by fusion of a zinc-finger DNA-binding domain to the nuclease domain of the restriction enzyme Fokl. The latter has a non-specific cleavage domain which must dimerise in order to cleave DNA. This means that two zinc finger nuclease monomers are required to allow dimerisation of the Fokl domains and to cleave the DNA. The DNA binding domain may be designed to target any genomic sequence of interest, and is a tandem array of Cys2His2 zinc fingers, each of which recognises three contiguous nucleotides in the target sequence. The two binding sites are separated by 5-7bp to allow optimal dimerization of the Fokl domains. The enzyme thus is able to cleave DNA at a specific site, and target specificity is increased by ensuring that two proximal DNA- binding events must occur to achieve a double-strand break.

[0114] Transcription activator-like effector nucleases, or TALENs, are dimeric transcription factor / nucl eases. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease). Transcription activator-like effectors (TALEs) can be engineered to bind practically any desired DNA sequence, so when combined with a nuclease, DNA can be cut at specific locations. TAL effectors are proteins that are secreted by CLO-C-P3828PCT

[0115] Xanthomonas bacteria, the DNA binding domain of which contains a repeated highly conserved 33-34 amino acid sequence with divergent 12th and 13th amino acids. These two positions are highly variable and show a strong correlation with specific nucleotide recognition. This straightforward relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA-binding domains by selecting a combination of repeat segments containing appropriate residues at the two variable positions. TALENs are thus built from arrays of 33 to 35 amino acid modules, each of which targets a single nucleotide. By selecting the array of the modules, almost any sequence may be targeted. Again, the nuclease used may be Fokl or a derivative thereof.

[0116] Three types of CRISPR mechanisms have been identified, of which type II is the most studied. The CRISPR / Cas9 system (type II) utilises the Cas9 nuclease to make a double-stranded break in DNA at a site determined by a short guide RNA. The CRISPR / Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements. CRISPR are segments of prokaryotic DNA containing short repetitions of base sequences. Each repetition is followed by short segments of “protospacer DNA” from previous exposures to foreign genetic elements. CRISPR spacers recognise and cut the foreign genetic elements. The CRISPR immune response occurs through two steps: CRISPR-RNA (crRNA) biogenesis and crRNA-guided interference. CrRNA molecules are composed of a variable sequence transcribed from the protospacer DNA and a CRISPR repeat. Each crRNA molecule then hybridizes with a second RNA, known as the trans-activating CRISPR RNA (tracrRNA) and together these two eventually form a complex with the nuclease Cas9. The protospacer DNA- encoded section of the crRNA directs Cas9 to cleave complementary target DNA sequences, if they are adjacent to short sequences known as protospacer adjacent motifs (PAMs). This natural system has been engineered and exploited to introduce DSB breaks in specific sites in genomic DNA, amongst many other applications. In particular, the CRISPR type II system from Streptococcus pyogenes may be used. At its simplest, the CRISPR / Cas9 system comprises two components that are delivered to the cell to provide genome editing: the Cas9 nuclease itself and a guide RNA (gRNA). The gRNA is a fusion of a customised, site-specific crRNA (directed to the target sequence) and a standardised tracrRNA.

[0117] Once a DSB has been made, a donor template with homology to the targeted locus is supplied; the DSB may be repaired by the homology-directed repair (HDR) pathway allowing for precise insertions to be made. Alternatively, an exogenous sequence may also be integrated at the site of the DSB exploiting non-homologous end joining. CLO-C-P3828PCT

[0118] Derivatives of this system are also possible. Mutant forms of Cas9 are available, such as Cas9 D10A with only nickase activity. This means it cleaves only one DNA strand and does not activate NHEJ. Instead, when provided with a homologous repair template, DNA repairs are conducted via the high-fidelity HDR pathway only. Cas9 D10A may be used in paired Cas9 complexes designed to generate adjacent DNA nicks in conjunction with two sgRNAs complementary to the adjacent area on opposite strands of the target site, which may be particularly advantageous.

[0119] Other CRISPR nucleases have been discovered and have been described here (reviewed in Anzalone et al. (2020) Nat. Biotechnol., 38(7): 824-844, doi: h psj / ^

[0120] 020-0561-9) and Nihi et a / . (2021) In. J. Mol. Sci., 22(7):3327, doi: htps: / / doi.org / 10.3390 / ijms22073327). Prominent examples include Cas9 from other species (such as from Staphylococcus aureus) or Cas12a.

[0121] The elements for making the double-strand DNA break may be introduced in one or more vectors, such as plasmids, for expression in the stem or somatic cell described herein.

[0122] Thus, any method of making specific, targeted double strand breaks in the genome in order to affect the insertion of a gene / inducible cassette may be used in the method of the invention. It may be preferred that the method for inserting the gene / inducible cassette utilises any one or more of zinc finger nucleases, TALENs and / or CRISPR / Cas9 systems or any derivative thereof.

[0123] Once the DSB has been made by any appropriate means, the gene / inducible cassette for insertion may be supplied in any suitable fashion as described herein. The gene / inducible cassette and associated genetic material form the donor DNA for repair of the DNA at the DSB are inserted using standard cellular repair machinery / pathways. How the break is initiated will alter which pathway is used to repair the damage, as noted above.

[0124] Controlled Expression

[0125] In one embodiment, expression of the one or more ageing-inducing factors is under controlled transcription. In this aspect of the invention, the transcription and translation (expression) of the ageing-inducing factors may be controlled within the cell. This permits overexpression if required. Thus, in a certain embodiment the one or more ageing-inducing factor is introduced into the cell using one or more expression cassettes comprising a sequence encoding the one or more ageing-inducing factor, i.e. introducing one or more ageing-inducing factor in step (i) CLO-C-P3828PCT comprises one or more expression cassette comprising a sequence encoding the one or more ageing-inducing factor.

[0126] An exogenous expression cassette carrying the one or more ageing-inducing factor may comprise an externally inducible transcriptional regulatory element (i.e. an inducible promoter) for inducible expression of the transcription and / or ageing-inducing factors. Said inducible expression cassette may be controlled by addition of an exogenous substance. Whatever culturing conditions are used, the exogenous substance will control expression of the genetic sequence within the inducible expression cassette; and may either be supplied continuously and then withdrawn in order to induce transcription or supplied as transcription is required, dependent upon its mode of action.

[0127] Expression of the lineage-specific transcription factors and / or one or more ageing-inducing factor described herein may be increased using the dual cassette expression system described in WO2018096343, which is specifically incorporated herein by reference. This system targets genetic safe harbour (GSH) sites which provides a reduced risk of epigenetic silencing of the inserted genetic material.

[0128] Therefore, in one embodiment a sequence encoding one or more ageing-inducing factors as described herein is introduced into the iPSC in the screening method herein using a method comprising:

[0129] - targeted insertion of a gene encoding a transcriptional regulator protein into a first genetic safe harbour site of the cell; and

[0130] - targeted insertion of an inducible cassette into a second genetic safe harbour site of the cell, wherein said inducible cassette comprises said one or more ageing-inducing factor sequences operably linked to an inducible promoter, and said promoter is regulated by the transcriptional regulator protein.

[0131] The use of the terms “first”, “second”, “third” and the like herein are merely for ease of distinction and are intended solely to distinguish one potential GSH site or expression cassette from another, wherein a “first” GSH differs from a “second” GSH and a “first” expression cassette differs from a “second” expression cassette, and so on. The use of these numerical terms is not intended to be limiting or an indication as to the order of insertion, expression or use.

[0132] These embodiments of the invention provide a dual expression cassette system. The insertion of the gene encoding a transcriptional regulator protein into the first genetic safe harbour CLO-C-P3828PCT

[0133] (GSH) provides the control mechanism for the expression of the inducible cassette which is operably linked to the inducible promoter and inserted into a second GSH site. In one embodiment, the first and second GSH are different. In a further embodiment, the second and third GSH herein are different. In a yet further embodiment, the first and third GSH herein are different. In a still further embodiment, the first, second and third GSH are each different.

[0134] In a particular embodiment of the screening method herein, the one or more ageing-inducing factor is introduced into the iPSC using a first expression cassette comprising a sequence coding for the one or more ageing-inducing factor operably linked to an inducible promoter. In a further particular embodiment, the promoter is a doxycycline-responsive promoter. In a yet further embodiment, the first expression cassette is integrated into the genome of the iPSC at a first genome safe-harbour (GSH) site. In one embodiment, the first GSH is the AAVS1 locus. Thus, in a still further embodiment the first expression cassette is integrated into the genome of the iPSC at the AAVS1 locus (the first GSH as referred to herein).

[0135] In another embodiment, a second expression cassette is integrated into the genome of the iPSC at a second GSH site, said second expression cassette comprising a sequence coding for the transcriptional regulator protein. In a particular embodiment, the transcription regulator protein-coding sequence is operably linked to a ubiquitous promoter. Such ubiquitous promoters are known in the art, and include without limitation the CAG, p-actin, EF1 , GAPDH, PGK and ROSA promoters. In a particular embodiment, the ubiquitous promoter is the CAG promoter operably linked to the sequence coding for the transcriptional regulator protein. In a further embodiment, the second GSH is the ROSA26 locus. Thus, in a yet further embodiment, the second expression cassette is integrated into the genome of the iPSC at the ROSA26 locus (the second GSH as referred to herein).

[0136] In an alternative embodiment, the expression cassette coding for the one or more ageinginducing factor and a gene encoding a transcriptional regulator protein are inserted into a genetic safe harbour site, such as a single genetic safe harbour site, wherein the expression cassette further comprises an inducible promoter which is regulated by the transcriptional regulator protein.

[0137] A GSH site is a locus within the genome wherein a gene or other genetic material may be inserted without any deleterious effects on the cell or on the inserted genetic material. Most beneficial is a GSH site in which expression of the inserted gene sequence is not perturbed by any read-through expression from neighbouring genes and expression of the inducible cassette minimises interference with the endogenous transcription programme. More formal CLO-C-P3828PCT criteria have been proposed that assist in the determination of whether a particular locus is a GSH site in future (Papapetrou et al. (2011)). These criteria include a site that is: (i) 50 kb or more from the 5’ end of any gene; (ii) 300 kb or more from any gene related to cancer; (iii) 300 kb or more from any microRNA (miRNA); (iv) located outside a transcription unit; and (v) located outside ultraconserved regions (UCR). It may not be necessary to satisfy all of these proposed criteria, since GSH already identified do not fulfil all of the criteria. It is thought that a suitable GSH will satisfy at least 2, 3, 4 or all of these criteria. Any suitable GSH site may be used in the method of the invention, on the basis that the site allows insertion of genetic material without deleterious effects to the cell and permits transcription of the inserted genetic material. Those skilled in the art may use these simplified criteria to identify a suitable GSH, and / or the more formal criteria set out above.

[0138] In one embodiment, the first and second genetic safe harbour sites (GSHs) are selected from (in particular any two) of the hROSA26 locus, the AAVS1 locus, the CLYBL gene, the CCR5 gene or the HPRT gene. Insertions specifically within genetic safe harbour sites is preferred over random genome integration, since this is expected to be a safer modification of the genome, and is less likely to lead to unwanted side effects such as silencing natural gene expression or causing mutations that lead to cancerous cell types. In another embodiment, the single genetic safe harbour site is selected from any GSH described herein.

[0139] The adeno-associated virus integration site 1 locus (AAVS1) is located within the protein phosphatase 1 , regulatory subunit 12C (PPP1 R12C) gene on human chromosome 19, which is expressed uniformly and ubiquitously in human tissues. AAVS1 has been shown to be a favourable environment for transcription, since it comprises an open chromatin structure and native chromosomal insulators that enable resistance of the inducible cassettes against silencing. There are no known adverse effects on the cell resulting from disruption of the PPP1 R12C gene. Moreover, an inducible cassette inserted into this site remains transcriptionally active in many diverse cell types.

[0140] The hROSA26 site has been identified on the basis of sequence analogy with a GSH from mice (ROSA26 - reverse oriented splice acceptor site #26). The hROSA26 locus is on chromosome 3 (3p25.3) and can be found within the Ensembl database (GenBank: CR624523). The integration site lies within the open reading frame (ORF) of the THUMPD3 long non-coding RNA (reverse strand). Since the hROSA26 and AAVS1 sites have endogenous promoters, the inserted genetic material may take advantage of that endogenous promoter (the ROSA promoter), or alternatively may be inserted operably linked to a promoter. CLO-C-P3828PCT

[0141] Intron 2 of the Citrate Lyase Beta-like (CLYBL) gene, on the long arm of Chromosome 13, was identified as a suitable GSH since it is one of the identified integration hot-spots of the phage derived phiC31 integrase. Studies have demonstrated that randomly inserted inducible cassettes into this locus are stable and expressed. It has been shown that insertion of inducible cassettes at this GSH do not perturb local gene expression (Cerbini et al. (2015)). CL.YBL thus provides a GSH which may be suitable for use in the present invention.

[0142] CCR5, which is located on chromosome 3 (position 3p21.31) is a gene which codes for HIV-1 major co-receptor. Interest in the use of this site as a GSH arises from the null mutation in this gene that appears to have no adverse effects, but predisposes to HIV-1 infection resistance. Zinc-finger nucleases that target the third exon have been developed, thus allowing for insertion of genetic material at this locus.

[0143] The hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene encodes a transferase enzyme that plays a central role in the generation of purine nucleotides through the purine salvage pathway. It has been used frequently because loss of HPRT can be selected for using 6-thioguanine.

[0144] GSH in other organisms have been identified and include ROSA26, HRPT and Hipp11 (H11) loci in mice. Mammalian genomes may include GSH sites based upon pseudo attP sites. For such sites, hiC31 integrase, the Streptomyces phage-derived recombinase, has been developed as a non-viral insertion tool, because it has the ability to integrate an inducible cassette-containing plasmid carrying an attB site into pseudo attP sites.

[0145] Technically, the insertions into the GSH sites may occur on one chromosome, or on both chromosomes. The GSH exists at the same genetic loci on both chromosomes of diploid organisms. Insertion within both chromosomes is advantageous since it may enable an increase in the level of transcription from the inserted genetic material within the inducible cassette, thus achieving particularly high levels of transcription.

[0146] Specific insertion of genetic material into the particular GSH based upon customised sitespecific generation of DNA double-strand breaks at the GSH may be achieved. The genetic material may then be introduced using any suitable mechanism, such as homologous recombination. Any method of making a specific double-strand break in the genome may be used, but preferred systems include CRISPR / Cas9 and modified versions thereof, zinc finger nucleases and the TALEN system. CLO-C-P3828PCT

[0147] One or more genetic sequences may be controllably transcribed from within a GSH (e.g. between GSH sites) or from within a single GSH. Indeed, the inducible cassette may contain 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 genetic sequences (e.g. ageing-inducing factor sequences) which it is desired to insert into the GSH and the transcription of which be controllably induced. Therefore, if several ageing-inducing factors are introduced into the iPSC, the coding sequences may be included within the same cassette introduced into the GSH. For example, the one or more ageing-inducing factors may be included in several mono-cistronic constructs or one or more bi-cistronic or tri-cistronic construct as required. It will be understood that similar combinations of constructs may be used to achieve higher orders of expression. In one embodiment, the one or more ageing-inducing factor are included in one bi-cistronic construct.

[0148] Alternatively, in instances where sequences encoding one or more ageing-inducing factors are used, the sequence(s) encoding each ageing-inducing factor may be introduced into separate GSHs and / or under the control of different inducible promoters. This may be achieved by utilising two or more different GSH sites or by utilising the fact that a GSH exists at the same genetic locus on both chromosomes of diploid organisms, e.g. introducing one ageing-inducing factor coding sequence into the GSH on one allele and another into the same GSH on the other allele. This embodiment is advantageous if different expression levels or timing of expression of each ageing-inducing factor is desired. In an alternative embodiment, the sequences encoding the one or more ageing-inducing factor are introduced into the same GSH but are under the control of different inducible promoters. The use of different inducible promoters also achieves different expression levels or timing of expression of each ageinginducing factor.

[0149] A transcriptional regulator protein is a protein that binds to DNA, preferably sequence- specifically to a DNA site located in or near a promoter, and either facilitating the binding of the transcription machinery to the promoter, and thus transcription of the DNA sequence (a transcriptional activator) or blocks this process (a transcriptional repressor).

[0150] The DNA sequence that a transcriptional regulator protein binds to is called a transcription factor-binding site or response element, and these are found in or near the promoter of the regulated DNA sequence. Transcriptional activator proteins bind to the response element and promote gene expression. Such activator proteins are preferred in the methods of the present invention for controlling inducible cassette expression. Transcriptional repressor proteins bind to the response element and prevent gene expression. CLO-C-P3828PCT

[0151] T ranscriptional regulator proteins may be activated or deactivated by a number of mechanisms including binding of a substance, interaction with other transcription factors (e.g. homo- or hetero-dimerisation) or coregulatory proteins, phosphorylation, and / or methylation. The transcriptional regulator protein may be controlled by activation or deactivation.

[0152] If the transcriptional regulator protein is a transcriptional activator protein, it is preferred that the transcriptional activator protein requires activation. This activation may be through any suitable means, but it is preferred that the transcriptional regulator protein is activated through the addition of an exogenous substance to the cell. The supply of an exogenous substance to the cell can be controlled, and thus the activation of the transcriptional regulator protein can be controlled. Alternatively, an exogenous substance can be supplied in order to deactivate a transcriptional regulator protein, and then supply withdrawn in order to activate the transcriptional regulator protein.

[0153] Thus, in certain embodiments introducing / exposing step (i) of the screening method herein additionally comprises adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC. In alternative embodiments, the screening method additionally comprises a step (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time.

[0154] If the transcriptional regulator protein is a transcriptional repressor protein, it is preferred that the transcriptional repressor protein requires deactivation. Thus, a substance is supplied to prevent the transcriptional repressor protein repressing transcription, and thus transcription is permitted.

[0155] Any suitable transcriptional regulator protein may be used, preferably one that may be activated or deactivated. It is preferred that an exogenous substance may be supplied to control the transcriptional regulator protein. Such transcriptional regulator proteins are also called inducible transcriptional regulator proteins.

[0156] Tetracycline-Controlled Transcriptional Activation is a method of inducible gene expression where transcription is reversibly turned on or off in the presence of the antibiotic tetracycline or one of its derivatives (e.g. doxycycline which is more stable). In this system, the transcriptional activator protein is tetracycline-responsive transcriptional activator protein (rtTa) or a derivative thereof. The rtTA protein is able to bind to DNA at specific TetO operator sequences. Several repeats of such TetO sequences are placed upstream of a minimal CLO-C-P3828PCT promoter (such as the CMV promoter), which together form a tetracycline response element (TRE). There are two forms of this system, depending on whether the addition of tetracycline or a derivative activates (Tet-On) or deactivates (Tet-Off) the rtTA protein. In one embodiment, the second expression cassette comprises a sequence coding for a reverse Tet transactivator (rtTA) operably linked to a ubiquitous promoter, such as the CAG promoter.

[0157] In a Tet-Off system, tetracycline or a derivative thereof binds rtTA and deactivates the rtTA, rendering it incapable of binding to TRE sequences, thereby preventing transcription of TRE- controlled genes. This system was first described in Gossen et al. (1992).

[0158] The Tet-On system is composed of two components; (1) the constitutively expressed tetracycline-responsive transcriptional activator protein (rtTa) and the rtTa-sensitive inducible promoter (Tet Responsive Element, TRE). The rtTA may be bound by tetracycline or its more stable derivatives, including doxycycline (dox), resulting in activation of rtTa, allowing it to bind to TRE sequences and inducing expression of TRE-controlled genes. The use of this may be preferred in the method of the invention.

[0159] Thus, the transcriptional regulator protein may be a tetracycline-responsive transcriptional activator (rtTa) protein, which can be activated or deactivated by tetracycline or one of its derivatives, which are supplied exogenously. If the transcriptional regulator protein is rtTA, then the inducible promoter inserted into the first GSH site includes the tetracycline response element (TRE). The exogenously supplied substance is tetracycline or one of its derivatives. Variants and modified rtTa proteins may also be used in the methods of the invention, these include Tet-On Advanced transactivator (also known as rtTA2S-M2) and Tet-On 3G (also known as rtTA-V16, derived from rtTA2S-S2).

[0160] Thus, in particular embodiments introducing / exposing step (i) of the screening method herein comprises adding tetracycline or a derivative thereof to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC. In alternative particular embodiments, the screening method additionally comprises a step (iib) of adding tetracycline or a derivative thereof to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time.

[0161] The tetracycline response element (TRE) generally consists of 7 repeats of the 19bp bacterial TetO sequence separated by spacer sequences, together with a minimal promoter. Variants and modifications of the TRE sequence are possible, since the minimal promoter can be any suitable promoter. Preferably the minimal promoter shows no or minimal expression levels in CLO-C-P3828PCT the absence of rtTa binding. The inducible promoter inserted into the second GSH may thus comprise a TRE.

[0162] A modified system based upon tetracycline control is the T-REX System (Thermo-Fisher Scientific), in which the transcriptional regulator protein is a transcriptional repressor protein, TetR. The components of this system include an inducible promoter comprising a strong human cytomegalovirus immediate-early (CMV) promoter and two tetracycline operator 2 (TetO2) sites, and a Tet repressor (TetR). In the absence of tetracycline, the Tet repressor forms a homodimer that binds with extremely high affinity to each TetO2 sequence in the inducible promoter, and prevents transcription from the promoter. Once added, tetracycline binds with high affinity to each Tet repressor homodimer rendering it unable to bind to the Tet operator. The Tet repressortetracycline complex then dissociates from the Tet operator and allows induction of expression. In this instance, the transcriptional regulator protein is TetR and the inducible promoter comprises two TetO2 sites. The exogenously supplied substance is tetracycline or a derivative thereof.

[0163] The cumate switch is another method of inducible gene expression where transcription is reversibly turned on or off in the presence of the cumate. This system is available in both activator and repressor configurations, where the presence of cumate leads to the repression of transcription or activation of transcription, respectively. In the repressor configuration, regulation is mediated by the binding of the repressor (CymR) to the operator site (CuO), placed downstream of a constitutive promoter. Addition of cumate, a small molecule, relieves the repression and allows transcription to proceed. In the activator configuration, a chimeric transactivator (cTA) protein, formed by the fusion of CymR with the activation domain of VP16, is able to activate transcription when bound to the CuO operator site, placed upstream of the constitutive promoter. Cumate addition abrogates DNA binding and therefore transactivation by cTA, stopping transcription.

[0164] Thus, in some embodiments the transcriptional regulator protein may be a Tet-responsive transcriptional activator protein (rtTa) and / or a cumate repressor (CymR). In one embodiment, expression of the one or more ageing-inducing factors is under the control of a Tet-responsive element. Thus in a further embodiment, the sequence encoding the one or more ageinginducing factors comprises a Tet-response element (TRE). In a yet further embodiment, expression of the sequence encoding the one or more ageing-inducing factors is controlled, such as induced, by exogenous addition of tetracycline or a derivative thereof (e.g. doxycycline). In alternative embodiments, expression of the one or more ageing-inducing factor is under the control of a cumate switch. Thus, in a yet further embodiment, the sequence CLO-C-P3828PCT encoding the one or more ageing-inducing factors comprises a CuO site. In a still further embodiment, expression of the sequence encoding the ageing-inducing factor or the activity of the transcriptional regulator protein is controlled by an exogenously supplied substance, such as tetracycline and derivatives thereof or cumate. In a particular embodiment, expression of the ageing-inducing factor is controlled, such as induced, by exogenous addition of cumate.

[0165] Other inducible expression systems are known and can be used in the method of the invention. These include the Complete Control Inducible system from Agilent Technologies. This is based upon the insect hormone ecdysone or its analogue ponasterone A (ponA) which can activate transcription in mammalian cells which are transfected with both the gene for the Drosophila melanogaster ecdysone receptor (EcR) and an inducible promoter comprising a binding site for the ecdysone receptor. The EcR is a member of the retinoid-X-receptor (RXR) family of nuclear receptors. In humans, EcR forms a heterodimer with RXR that binds to the ecdysone-responsive element (EcRE). In the absence of PonA, transcription is repressed by the heterodimer.

[0166] Thus, the transcriptional regulator protein can be a repressor protein, such as CymR, an ecdysone receptor or a derivative thereof. Examples of the latter include the VgEcR synthetic receptor from Agilent technologies which is a fusion of EcR, the DNA binding domain of the glucocorticoid receptor and the transcriptional activation domain of Herpes Simplex Virus VP16. The inducible promoter comprises the EcRE sequence or modified versions thereof together with a minimal promoter. Modified versions include the E / GRE recognition sequence of Agilent Technologies, in which mutations to the sequence have been made. The E / GRE recognition sequence comprises inverted half-site recognition elements for the retinoid-X- receptor (RXR) and GR binding domains. In all permutations, the exogenously supplied substance is ponasterone A, which removes the repressive effect of EcR or derivatives thereof on the inducible promoter, and allows transcription to take place.

[0167] In one embodiment, the cell (e.g the iPSC used in the screening method herein) is from a mammal. In a further embodiment, the cell in which the age-modulating method is performed is from a mammal. In a yet further embodiment, the mammal is a human. Thus, in a particular embodiment the cell is from a human and is a human iPSC or a human somatic cell, such as a somatic cell derived from a re-programmed human iPSC (i.e. is a forward programmed human cell) or a cell obtained from a human iPSC by directed differentiation. In an alternative embodiment, the mammal is a mouse, optionally such that the iPSC or somatic cell is a mouse CLO-C-P3828PCT stem cell or a mouse somatic cell, such as a somatic cell derived from a re-programmed mouse iPSC (i.e. is a forward programmed mouse cell).

[0168] In other aspects, there is provided herein an artificially aged cell produced by the screening methods described herein. In one aspect, there is provided an artificially aged iPSC produced by the screening methods described herein. Thus, in one embodiment there is provided an artificially aged iPSC.

[0169] Screening Methods

[0170] Such artificially aged cells and the screening methods described herein are used for identifying a gene ora combination of genes, wherein said genes / combination are involved in the reversal of an ageing phenotype or in the maintenance of a non-aged phenotype in the iPSC. In some embodiments, the artificially aged iPSC as described herein may be used in the screening method of identifying a gene or a combination of genes involved in the reversal of an ageing phenotype or in the maintenance of a non-aged phenotype in the cell. In one embodiment, the use comprises use of an artificially aged stem cell as described herein.

[0171] The screening method is based on the observation described herein and previously by the inventors that after removal or reduction of one or more ageing-inducing factor, stem cells reverse the changes in ageing phenotypes seen upon the induction of ageing. Therefore, the unique regenerative capacity of stem cells which actively reverses induced ageing phenotypes may be used to screen genes and combinations of genes involved in the reversal of an ageing phenotype or the maintenance of a non-aged phenotype. In other words, by selectively targeting and either inactivating / inhibiting / knocking-out or activating / enhancing / gaining function in a gene suspected to be involved in the reversal of an ageing phenotype or in the maintenance of a non-aged phenotype in a stem cell, the effect of said targeting on the induction of ageing or on the reversal of the ageing phenotype by the methods herein may be observed. Such effects may be seen either by a change in the development of an ageing phenotype following induction of ageing in a cell subjected to the screen, or by a change in reversal of ageing following the introduction of / exposure to an ageing inducing factor and subsequent removal / reduction in a cell subjected to the screen.

[0172] Identification of genes and combinations of genes may be by sequencing. For example, genes or combinations of genes involved in reversal of an ageing phenotype or maintenance of a non-aged phenotype which have been targeted may be identified by transcriptome sequencing to determine the expression, such as the expression level, following targeting. Alternatively, said genes or combinations of genes may be identified by detecting the agent CLO-C-P3828PCT used to target said gene(s), e.g. the guide RNA that was present in said cell in which the aging phenotypes has been reversed. In one embodiment, identification of genes or combinations of genes involved in reversal of an ageing phenotype or maintenance of a non-aged phenotype is by detection of the guide RNA used to target said gene or detection of the multiple guide RNAs used to target said combination of genes. In a further embodiment, the detection of the guide RNA is by sequencing. In a yet further embodiment, the guide RNA comprises a barcode sequence and detection of the guide RNA is by sequencing using said barcode sequence.

[0173] Thus, according to the present invention the screening method comprises the steps of:

[0174] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0175] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC; and

[0176] (iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

[0177] In some embodiments, the gene / combination of genes are involved in the ageing process such that their activity and / or expression may be considered “pro-ageing” (i.e. “nonrejuvenating”). Pro-ageing genes may also be known as “non-rejuvenation” or “nonrejuvenating” genes. The inhibition or knock-out of such genes / combinations in the screening methods herein will therefore lead to a reduction in the development of an ageing phenotype in the iPSC following the induction of ageing or an increase in the reversal of an ageing phenotype following the induction of ageing and subsequent reversal of said ageing phenotype. In order to reduce and / or slow ageing, the activity and / or expression of such “proageing” genes / combinations of genes will therefore be reduced and / or inhibited. Thus, in one embodiment the expression and / or activity of the identified gene or combination of genes is reduced and / or inhibited in the age-modulating method. Said embodiment will be readily appreciated to apply to embodiments wherein the age-modulating method reduces and / or slows ageing, such as of the progression of an ageing phenotype in a cell. Conversely, in order to increase / accelerate ageing, the activity and / or expression of “pro-ageing” genes / combinations will be promoted and / or increased. Thus, in an alternative embodiment the expression and / or activity of the identified gene or combination of genes may be promoted and / or increased, in particular wherein the age-modulating method increases and / or accelerates ageing, such as the progression of an ageing phenotype. In further alternatives, genes and combinations of genes identified as pro-ageing herein may have the reverse effects CLO-C-P3828PCT in somatic cells, e.g. pro-ageing genes identified in iPSCs / stem cells may have anti-ageing effects in somatic cells. Thus, according to this alternative in order to reduce and / or slow ageing in somatic cells, the activity and / or expression of pro-ageing genes / combinations identified herein may be increased and / or enhanced to reduce and / or slow ageing in somatic cells (due to their possible reverse effects in somatic cells). Examples of pro-ageing genes identified by the methods presented herein include: AXL, CTNND2, DZIP3, EIF4B, EZH2, FOXO4, HCK, HELLS, HLA-DQB1, IQCG, KRAS, LRIG1, MAPK1, PAPPA, PHYHIP, PLAU, PTEN, SHOC2, SINHCAF, SNAI1, SNCA, STAM, TBC1D1, TRPV1, UBE4B, ULK1 and ZC4H2 (see Examples 4 and 5). Further examples of pro-ageing genes identified by the methods presented herein include: BCOR, CECR2, CHD2, CTNNBIP1, DOT1L, ETS1, FOXD3, GZF1, MAZ, NF2, NR6A1, NRBP1, PCGF1, PMAIP1, RAF1, RARA, RBM15, RSAD1, SOS1, SOX11, SOX4, TCF12, TCF7L2, TDG, TFE3, WNK1 and ZNF532 (see Example 9). Further examples of pro-ageing genes identified by the methods presented herein include: AP3M2, CHST8, CRTC1, CTTNBP2, DENND2A, DENND2D, E2F6, EEIG2, FANCA, FLCN, FRMD6, FTCD, GEN1, GJB3, HEBP1, IFT122, IKBKB, KDM2B, KRTAP21-1, LAMC2, MRPL42, PABIR1, PANK1, PRICKLE3, RUFY2, RYBP, SCN4A, SKAP2, SLC26A10P, SLC66A2, SPICE1, SUZ12, SYTL1, TIMM9, TMCC2, TMEM191B, TULP4, UHRF2, URB1, VCPKMT, WDR45, ZC3HAV1L and ZNF480 (see Example 10). Further examples of pro-ageing genes identified by the methods presented herein include: ALAS2, AMBN, CRX, DLL4, ESRRB, FAM186A, FAM83A, FAS, FLVCR2, FOXQ1, GDF6, ICAM2, ITIH5, LGR6, LHX8, METTL24, NME5, OPCML, OR12D3, P2RX3, PIGZ, POTEE, PSTPIP2, PTPRH, RAX, RFX6, SEMA5A, SH3BGR, SLC6A5, SNAP25, SPMIP1 and WNT8A (see Example 12). Thus, in particular embodiments the identified gene or combination of genes is selected from one or more of: ALAS2, AMBN, AP3M2, AXL, BCOR, CECR2, CHD2, CHST8, CRTC1, CRX, CTNNBIP1, CTNND2, CTTNBP2, DENND2A, DENND2D, DLL4, DOT1L, DZIP3, E2F6, EEIG2, EIF4B, ESRRB, ETS1, EZH2, FAM186A, FAM83A, FANCA, FAS, FLCN, FLVCR2, FOXD3, FOXO4, FOXQ1, FRMD6, FTCD, GDF6, GEN1, GJB3, GZF1, HCK, HEBP1, HELLS, HLA-DQB1, ICAM2, IFT122, IKBKB, IQCG, ITIH5, KDM2B, KRAS, KRTAP21-1, LAMC2, LGR6, LHX8, LRIG1, MAPK1, MAZ, METTL24, MRPL42, NF2, NME5, NR6A1, NRBP1, OPCML, OR12D3, P2RX3, PABIR1, PANK1, PAPPA, PCGF1, PHYHIP, PIGZ, PLAU, PMAIP1, POTEE, PRICKLE3, PSTPIP2, PTEN, PTPRH, RAF1, RARA, RAX, RBM15, RFX6, RSAD1, RUFY2, RYBP, SCN4A, SEMA5A, SH3BGR, SHOC2, SINHCAF, SKAP2, SLC26A10P, SLC66A2, SLC6A5, SNAI1, SNAP25, SNCA, SOS1, SOX11, SOX4, SPICE1, SPMIP1, STAM, SUZ12, SYTL1, TBC1D1, TCF12, TCF7L2, TDG, TFE3, TIMM9, TMCC2, TMEM191B, TRPV1, TULP4, UBE4B, UHRF2, ULK1, URB1, VCPKMT, WDR45, WNK1, WNT8A, ZC3HAV1L, ZC4H2, ZNF480, and ZNF532. CLO-C-P3828PCT

[0178] Any method, compound or substance known in the art may be used to reduce and / or inhibit the activity / expression of pro-ageing genes as described herein. For example, wherein the activity of said gene / combination is to be reduced and / or inhibited, any one or more of an inhibitor (e.g. a small molecule inhibitor), an antagonist or a blocking agent may be used. Several examples of inhibitors as known for the genes identified herein and their products, such as: 3-Deazaneplanocin A hydrochloride, GSK 126, GSK 343, JQEZ5, PF 06726304 acetate, UNC 1999 and ZLD 1039 for EZH2; Nef Hck Activation Inhibitor, B9 for HCK; AX 15836, BIX 02189, ERK5-IN-1, FR 180204, TCS ERK 11e, XMD 8-92 and ZM 241385 for MAPK1 ; and SBI-0206965, MRT67307, ULK-101 , SBP-7455, ULK1-IN-2, XST-14 and MRT67307 hydrochloride for LILK1. Additionally or alternatively, wherein the expression is to be reduced / inhibited, negative post-transcriptional regulation, such as RNA interference (RNAi) may be used. Thus, in one embodiment the expression and / or activity of the identified gene or combination of genes is reduced and / or inhibited using an inhibitor, an antagonist, a blocking agent and / or negative post-transcriptional regulation, such as RNA interference (RNAi). In a further embodiment, any combination of an inhibitor, an antagonist, a blocking agent and / or negative post-transcriptional regulation may be used, in particular wherein the activity / expression of a combination of genes is reduced / inhibited. In further alternative embodiments, the activity / expression of genes identified as pro-ageing herein may be increased / enhanced in somatic cells when said genes may have the reverse effects in somatic cells. Said increase / enhancement may be by any method, such as using an activator, an agonist, a trans-activator and / or post-transcriptional enhancement as described herein.

[0179] In other embodiments, the gene / combination of genes are involved in the ageing process such that their activity and / or expression may be considered “anti-ageing” (i.e. “rejuvenating”). Antiageing genes may also be known as “rejuvenating” or “pro-rejuvenation” genes. The inhibition or knock-out of such genes / combinations in the screening methods herein will therefore lead to an increase in the development of an ageing phenotype in the iPSC following the induction of ageing or a reduction in the reversal of an ageing phenotype following the induction of ageing and subsequent reversal of said ageing phenotype. To reduce and / or slow ageing, the activity and / or expression of such “anti-ageing” genes / combinations of genes will therefore be promoted and / or increased. Thus, in one embodiment the expression and / or activity of the identified gene or combination of genes is promoted and / or increased in the age-modulating method. Said embodiment will be readily appreciated to apply to embodiments wherein the age-modulating method reduces and / or slows ageing, such as of the progression of an ageing phenotype in a cell. Conversely, in order to increase / accelerate ageing, the activity and / or expression of “anti-ageing” genes / combinations will be reduced and / or inhibited. Thus, in an alternative embodiment the expression and / or activity of the identified gene or combination of CLO-C-P3828PCT genes may be reduced and / or inhibited, in particular wherein the age-modulating method increases and / or accelerates ageing, such as the progression of an ageing phenotype. In further alternatives, genes and combinations of genes identified as anti-ageing herein may have the reverse effects in somatic cells, e.g. anti-ageing genes identified in iPSCs / stem cells may have pro-ageing effects in somatic cells. Thus, according to this alternative in order to reduce and / or slow ageing in somatic cells, the activity and / or expression of anti-ageing genes / combinations identified herein may be reduced and / or inhibited to reduce and / or slow ageing in somatic cells (due to their possible reverse effects in somatic cells). Examples of anti-ageing genes identified by the methods presented herein include: ATG2B, ATXN7L3B, CAPZA1 , CCDC120, CCDC18, CEBPA, CFLAR, CHEK2, CHUK, CREBBP, CYP1B1, DNMT3B, EIF4EBP1 , EP300, FAM98C, GSK3A, GTF2H2, HCST, IGFBP3, KAT6A, LINS1 , LYPLAL1 , MTA1 , OLA1 , PHF20L1 , PICALM, PJA2, PLCG1 , PODXL2, RAB14, RAP2C, RGN, ROCK1 , SPAG7, TFAP2A, TOP3B, TP53, TP53BP1 , TRAF1 , TSC1 , TTR, YTHDF2, YWHAZ and ZNF326 (see Examples 4 and 5). Further examples of anti-ageing genes identified by the methods presented herein include: AFF1 , C1GALT1C1 , DAPK3, DIABLO, EBP, ELAVL1 , ELOA, MED12, MYL6, RALGAPB, RBM47, SCRIB and TRIM71 (see Example 9). Further examples of anti-ageing genes identified by the methods presented herein include: BICRA, C9orf85 and NHLRC2 (see Example 10). Further examples of anti-ageing genes identified by the methods presented herein include: ARRDC5, CHRNA7, DLX5, FBP1 , FDCSP, FYB2, HIVEP3, HNF4A, INS, MAP2K5, MITF, MYZAP, NR5A1 , PAX2, PAX5, PMFBP1 , PTBRB, SLC27A2, SYN3, TNFAIP8L3 and UPK1 B (see Example 12). Thus, in particular embodiments the identified gene or combination of genes is selected from one or more of: AFF1 , ARRDC5, ATG2B, ATXN7L3B, BICRA, C1GALT1C1 , C9orf85, CAPZA1 , CCDC120, CCDC18, CEBPA, CFLAR, CHEK2, CHRNA7, CHUK, CREBBP, CYP1 B1 , DAPK3, DLX5, DIABLO, DNMT3B, EBP, EIF4EBP1 , ELAVL1 , ELOA, EP300, FAM98C, FBP1 , FDCSP, FYB2, GSK3A, GTF2H2, HCST, HIVEP3, HNF4A, IGFBP3, INS, KAT6A, LINS1 , LYPLAL1 , MAP2K5, MED12, MITF, MTA1 , MYL6, MYZAP, NHLRC2, NR5A1 , OLA1 , PAX2, PAX5, PHF20L1 , PICALM, PJA2, PLCG1 , PODXL2, PMFBP1 , PTBRB, RAB14, RALGAPB, RAP2C, RBM47, RGN, ROCK1 , SCRIB, SLC27A2, SPAG7, SYN3, TFAP2A, TNFAIP8L3, TOP3B, TP53, TP53BP1 , TRAF1 , TRIM71 , TSC1 , TTR, UPK1 B, YTHDF2, YWHAZ and ZNF326.

[0180] Any method, compound or substance known in the art may be used to increase and / or promote the activity / expression of anti-ageing genes as described herein. For example, wherein the activity of said gene / combination is to be increased and / or promoted, any one or more of an activator (e.g. a small molecule activator), an agonist or a trans-activator (e.g. a co-factor) may be used. Additionally or alternatively, wherein the expression is to be increased / promoted, post-transcriptional enhancement (e.g. using small activating RNA CLO-C-P3828PCT

[0181] (saRNA)) may be used. Thus, in one embodiment the expression and / or activity of the identified gene or combination of genes is increased and / or promoted using an activator, an agonist, a trans-activator and / or post-transcriptional enhancement. In a further embodiment, any combination of an activator, an agonist, a trans-activator and / or post-transcriptional enhancement may be used, in particular wherein the activity / expression of a combination of genes is increased / promoted. In further alternative embodiments, the activity / expression of genes identified as anti-ageing herein may be decreased / inhibited in somatic cells when said genes may have the reverse effects in somatic cells. Said decrease / inhibition may be by any method, such as using an inhibitor, an antagonist, a blocking agent and / or negative post- transcriptional regulation as described herein.

[0182] Other methods known in the art for modulating and / or altering the expression and / or activity of one or more gene or combination of genes identified by the methods described herein may be used. For example, wherein expression and / or activity is to be increased and / or promoted, induction of expression / activity using one or more expression cassettes, sequences encoding the gene or combination of genes and / or open reading frames (ORFs) for said gene(s) or by introduction of nucleic acids (e.g. DNA, plasmid DNA, RNA, including mRNA encoding the product of said gene(s)), polypeptides or small molecules (e.g. activatory / agonist polypeptides or small molecules) as described herein may be utilised. Alternatively, wherein expression and / or activity is to be reduced and / or inhibited, any inhibitory small molecule, antagonist polypeptide, interference nucleic acids or interference / knock-out gene editing methods may be used. Such methods and approaches are known in the art and described herein. In particular embodiments, the expression of one or more gene or combination of genes identified by the methods described herein is altered using CRISPR, such as by CRISPR-ko, CRISPRi and / or CRISPRa as appropriate. It will be appreciated that, in the context of a combination of genes, expression of one gene or set of genes may be increased / promoted while expression of another gene or set of genes is inhibited / reduced.

[0183] In certain embodiments, the ageing phenotype is as described herein. In one embodiment, the ageing phenotype measured in the screening method is the transcriptomic clock of the cell, optionally in combination with one or more further biological clock as described herein (e.g. the epigenetic clock and / or the ribosome clock). In a further embodiment, the gene or combination of genes involved in the reversal of an ageing phenotype or in the maintenance of a non-aged phenotype is identified as described herein. In a particular embodiment, the gene or combination of genes is identified by sequencing, such as described herein. CLO-C-P3828PCT

[0184] In one embodiment, the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen comprises nucleic acids, polypeptides (e.g. proteins, such as antibodies), aptamers and / or small molecules (e.g. small molecule compounds). Such nucleic acids, polypeptides, aptamers and small molecules include those which act as activators / agonists as well as those which act as inhibitors / antagonists. Thus, it will be appreciated that the methods described herein find utility in screening any modulator (e.g. modulators of expression or activity) of a gene or a combination of genes involved in the reversal of an ageing phenotype or in the maintenance of a non-aged phenotype in a cell.

[0185] In another embodiment, the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen comprises a whole-genome screen. Such wholegenome screens, also known as genome-wide screens, aim to elucidate the relationship between genotype and phenotype by altering the expression or activity of a gene or gene product on a genome-wide scale and studying the resulting phenotypic alterations, such as in steps (ii) and (iii) of the method described herein. As their name suggests, loss-of-function, inhibitory or knock-out screens perturb the expression of genes, preventing them from functioning as normal. Thus, when loss-of-function, inhibitory or knock-out screens are performed, a gene or combination of genes will be identified as being involved in the reversal of an ageing-phenotype when said ageing-phenotype persists for longer or is not reversed in an artificially aged cell following induction of ageing compared to an artificially aged cell in which no loss-of-function, inhibition or knock-out of the gene or combination of genes has occurred. Alternatively, when loss-of-function, inhibitory or knock-out screens are performed, a gene or combination of genes will be identified as being involved in the maintenance of a non-aged phenotype when said phenotype is lost in an artificially aged cell, i.e. the cell displays an aged-phenotype, following induction of ageing compared to an artificially aged cell in which no loss-of-function, inhibition or knock-out of the gene or combination of genes has occurred. Gain-of-function screens enhance the activity or expression of a gene or gene product. If gain-of-function screens are used, a gene or combination of genes may be identified as being involved in the reversal of an ageing-phenotype when said ageingphenotype is reversed more quickly or persists for a shorter period of time in an artificially aged cell following induction of ageing compared to an artificially aged cell in which no gain- of-function of the gene or combination of genes has occurred. Alternatively, a gene or combination of genes may be identified as being involved in the maintenance of a non-aged phenotype when said phenotype persists in an artificially aged cell, i.e. the cell does not display an aged phenotype, following induction of ageing compared to an artificially aged cell in which no gain-of-function of the gene or combination of genes has occurred. A combinatorial screen comprises a combination of one or more of loss-of-function, inhibitory CLO-C-P3828PCT and knock-out as described herein. Such combinatorial screens allow the accurate identification of combinations of genes involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype. In another embodiment, a combinatorial screen may also comprise a combination of a loss-of-function / inhibitory and an activatory / gain-of-function screen, e.g. by combining CRISPR-ko or CRISPRi with CRISPRa.

[0186] In a specific embodiment, a CRISPR screen is combined with single-cell RNA sequencing to read out an mRNA signature that captures ageing or age reversal. Several approaches are known to the skilled person, e.g. CROP-seq which reads out the sgRNA directly (Datlinger et al. (2017) Nat. Methods, 14(3):297-301 , doi: https: / / doLorg / 10 038 / meth;4177) or Perturb- seq (Dixit et al. (2016) Cell, 167(7):1853-1866.e17, doi: htps: / / doi.org / 10.1016 / i.cell.2016.11.038) which reads out the sgRNA indirectly via a barcode. In a particular embodiment, the 5’ chemistry of 10X Genomics may be used as published previously (Replogle et al. (2020) Nat. Biotechnol., 38(8):954-961 , doi:

[0187] 020-0470-y) to capture sgRNAs during a template switch reaction.

[0188] Methods of performing whole-genome screens are known in the art and any such method will be appreciated to find utility in the methods described herein. However, of particular utility are screens performed using CRISPR as described herein. Thus, in one embodiment, the loss- of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed using CRISPR. In a further embodiment, wherein the screen is a loss-of- function or inhibitory screen the CRISPR is CRISPRi. CRISPRi can sterically repress transcription by blocking either transcriptional initiation or elongation. This is accomplished by designing single guide RNA (sgRNA) complementary to the promoter or the transcriptional start site (TSS) or exonic sequences of the gene to be transcriptionally inhibited or repressed. Depending on the nature of the CRISPR effector, targeting either the template or non-template strand leads to stronger repression. For example, with dCas9, repression is stronger when the guide RNA (gRNA) is complementary to the non-template strand. Unlike transcription elongation block, inhibition / repression by CRISPRi is independent of the targeted DNA strand when targeting the transcriptional start site. In some embodiments, the dCas9 may be fused to a transcriptional repressor, such as a KRAB domain. Multiple KRAB domains have been used in the published literature (Alerasool et al. (2020) Nat. Methods, 17(11):1093-1096, doi: https: / / doi.Qrg / 10.1038 / s41592-020-0966-x). In a yet further embodiment, wherein the screen is a knock-out screen the CRISPR is the active Cas9 nuclease. CRISPR-ko involves the introduction of a DSB at the target site and the subsequent insertion or deletion of bases upon repair of double stand DNA breaks created by the Cas9 nuclease in genes to which it has been targeted by a gRNA. Following creation of the double strand break, the imprecise non- CLO-C-P3828PCT homologous end joining repair (NHEJ) pathway is used but results in inserted or deleted bases, thus creating indels or producing gene knockouts. Gain-of-function screens may use CRISPR activation. CRISPR activation (CRISPRa) uses modified versions of CRISPR effectors which do not have endonuclease activity but comprise added transcriptional activators, such as VP64 or VPR, on dCas9 and / or the gRNAs. The transcriptional activators fused to the CRISPRa components therefore increase expression of genes of interest following targeting to the gene by the gRNA. In a still further embodiment, wherein the screen is a combinatorial screen the CRISPR is a combination of: CRISPRi, and CRISPR-ko, i.e. a combination of two or more of any of the above mentioned CRISPR techniques.

[0189] According to these embodiments, Cas9 protein may be used in the CRISPR methods. Thus, in one embodiment Cas9 protein is introduced into the iPSC using an expression cassette comprising a sequence coding for the Cas9 protein. The expression cassette may be as described hereinbefore, and when other expression cassettes are used for integration of the ageing-inducing factor and / or the transcriptional regulator, may be referred to as a third expression cassette. In a further embodiment the Cas9 coding sequence is operably linked to a ubiquitous promoter. In a certain embodiment, the promoter is the CAG promoter as described hereinbefore. In a yet further embodiment, the expression cassette is integrated into the genome of the iPSC at a GSH site, examples of which are described herein. In certain embodiments, the expression cassette comprising the Cas9 coding sequence is integrated at a third GSH site. As described hereinbefore, the use of the term “third” is not intended to be limiting but merely to distinguish the GSH site for integration of the Cas9 coding expression cassette from the GSH sites optionally used for integration of the ageing-inducing factor coding expression cassette and / or the transcriptional regulator coding expression cassette, as well as from said expression cassettes. In a still further embodiment, the third GSH is the CYBL locus. Thus, in one embodiment the expression cassette comprising the Cas9 coding sequence is integrated into the CYBL locus.

[0190] In some embodiments, the use to identify genes / combinations of genes involved in ageing comprises forward programming or directed differentiation of the iPSC to a somatic cell. Such forward programming or directed differentiation may be performed as described hereinbefore, e.g. using lineage-specific transcription factors. In one embodiment, said forward programming or directed differentiation is performed before identification of the gene or combination of genes. In another embodiment, forward programming or directed differentiation is performed after identification. For example, forward programming or directed differentiation may be performed in introducing / exposing step (i) and / or may be performed CLO-C-P3828PCT after the screen of step (ii). Additionally or alternatively, forward programming or directed differentiation can be performed concurrently with measuring step (iii).

[0191] Thus, in one embodiment the identification of the gene / combination of genes comprises the steps of:

[0192] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0193] (ii) performing a a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0194] (iii) measuring an ageing phenotype in the cell; and

[0195] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0196] In an alternative embodiment, the identification of the gene / combination of genes comprises the steps of:

[0197] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0198] (ii) performing a a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0199] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time;

[0200] (iii) measuring an ageing phenotype in the cell; and

[0201] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0202] In a further embodiment, identification comprises the steps of:

[0203] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time; CLO-C-P3828PCT

[0204] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell, followed by forward programming or differentiating the iPSC to a somatic cell;

[0205] (iii) measuring an ageing phenotype in the cell; and

[0206] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0207] In another alternative embodiment, identification comprises the steps of:

[0208] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0209] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell, followed by forward programming or differentiating the iPSC to a somatic cell;

[0210] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time;

[0211] (iii) measuring an ageing phenotype in the cell; and

[0212] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0213] In a yet further embodiment, identification comprises the steps of:

[0214] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0215] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0216] (iii) forward programming or differentiating the iPSC to a somatic cell and measuring an ageing phenotype in the cell; and

[0217] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed. CLO-C-P3828PCT

[0218] In an alternative embodiment, identification comprises the steps of:

[0219] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0220] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0221] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time;

[0222] (iii) forward programming or differentiating the iPSC to a somatic cell and measuring an ageing phenotype in the cell; and

[0223] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0224] In another embodiment, identification comprises the steps of:

[0225] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time, and forward programming or differentiating said iPSC to a somatic cell;

[0226] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0227] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC;

[0228] (iii) measuring an ageing phenotype in the cell; and

[0229] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0230] In an alternative embodiment, identification comprises the steps of:

[0231] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time, and forward programming or differentiating said iPSC to a somatic cell;

[0232] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell; CLO-C-P3828PCT

[0233] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time;

[0234] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC;

[0235] (iii) measuring an ageing phenotype in the cell; and

[0236] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0237] In a still further embodiment, identification comprises the steps of:

[0238] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0239] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell, followed by forward programming or differentiating the iPSC to a somatic cell;

[0240] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC;

[0241] (iii) measuring an ageing phenotype in the cell; and

[0242] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0243] In another alternative embodiment, identification comprises the steps of:

[0244] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0245] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell, followed by forward programming or differentiating the iPSC to a somatic cell;

[0246] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time; CLO-C-P3828PCT

[0247] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC;

[0248] (iii) measuring an ageing phenotype in the cell; and

[0249] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0250] In a yet further embodiment, identification comprises the steps of:

[0251] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0252] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0253] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC;

[0254] (iii) forward programming or differentiating the iPSC to a somatic cell and measuring an ageing phenotype in the cell; and

[0255] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0256] In a further alternative embodiment, identification comprises the steps of:

[0257] (i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;

[0258] (ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the cell;

[0259] (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC for a period of time;

[0260] (iic) removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression or the amount of the one or more ageing-inducing factor in the iPSC; CLO-C-P3828PCT

[0261] (iii) forward programming or differentiating the iPSC to a somatic cell and measuring an ageing phenotype in the cell; and

[0262] (iv) identifying a gene or combination of genes as being involved in the reversal of an ageing phenotype or maintenance of a non-aged phenotype when the ageing phenotype is altered when the loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen is performed.

[0263] Uses, Therapeutic Uses & Methods of Treatment

[0264] The age-modulating methods described herein will be appreciated to find particular utility in the reduction and / or slowing of ageing in a subject, in particular an aged subject, wherein the age-modulating method reduces and / or slows the progression of ageing, such as of an ageing phenotype in a cell. Subjects suffering from age-related diseases or disorders will also benefit from said methods since it would be expected that by reducing and / or slowing ageing, the disease or disorder, its effects and / or its progression would also be reduced and / or slowed.

[0265] Thus, in certain embodiments the age-modulating method is for use in a method of treating a disease or disorder associated with ageing in a subject. The term “in a subject” herein may be used interchangeably with or in addition to “in vivo".

[0266] According to a further aspect of the invention, there is provided a method of modulating or treating ageing in vivo, said method comprising the age-modulating method as described herein. In another aspect of the invention, there is provided a method of modulating ageing in vivo, said method comprising the age-modulating method described herein. In a further aspect, there is provided a method of treating a disease or disorder associated with ageing, said method comprising the age-modulating method described herein.

[0267] As will be readily appreciated, the in vivo age-modulating methods and methods of treatment herein may comprise administration of a modulator of the activity and / or expression of a gene or combination of genes identified as being involved in ageing, as described herein. For example, wherein ageing (or a disease / disorder associated with ageing) is to be reduced and / or slowed in a subject, an inhibitor, an antagonist, a blocking agent and / or negative post- transcriptional regulator of a pro-ageing gene or combination of pro-ageing genes may be administered. Alternatively or additionally, an agonist, a trans-activator and / or a post- transcriptional enhancer of an anti-ageing gene or combination of anti-ageing genes may be administered. Such administration may be systemically, e.g. enteral or parenteral, such as via intravenous infusion, or locally, such as directly into the tissue or organ to be treated / CLO-C-P3828PCT rejuvenated, e.g. by topical administration. An inhibitor may include a small-molecule inhibitor, an siRNA or an antibody targeting the gene of interest.

[0268] In some embodiments, the modulator of the activity and / or expression of a gene or combination of genes identified as described herein is comprised in a pharmaceutical composition, optionally further comprising one or more pharmaceutically acceptable carriers, diluents and / or excipients. Thus, according to a further aspect there is provided a pharmaceutical composition comprising the modulator of the activity and / or expression of a gene or combination of genes identified as described herein for use in the age-modulating methods and / or in a method of treating a disease or disorder associated with ageing in a subject.

[0269] In one embodiment, the disease or disorder associated with ageing includes, but is not limited to, cardiovascular disorders, neurodegenerative disorders, metabolic and endocrine disorders, respiratory disorders, musculoskeletal disorders, renal disorders, sensory organ disorders, gastrointestinal disorders, haematological disorders, reproductive disorders, genitourinary disorders, oral health disorders, immune system decline and inflammation, skin ageing, and cancer.

[0270] The disease or disorder associated with ageing may be a degenerative disease or disorder, including without limitation of the pancreas (e.g. type 2 diabetes), of the blood and / or bone marrow, of the heart (e.g. cardiovascular disease, cardiomyopathy, ischaemic heart disease, cardiac arrhythmia or heart failure), of the skin, or a neurological disease or disorder (e.g. a neurodegenerative disease / disorder). Examples of neurodegenerative diseases and disorders include, without limitation amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), Parkinson's disease, Alzheimer's disease, Huntington's disease, multiple system atrophy and prion diseases. Thus, in some embodiments the age-modulating method is performed in the skin, liver, pancreas, heart, brain, central nervous system, peripheral nervous system, blood and / or bone marrow, such as in a cell comprised in any of said tissues or organs. In further embodiments, the age-modulating method can be considered to rejuvenate said tissue, organ and / or cell in which the method is performed.

[0271] In another aspect of the invention, there is provided a method of rejuvenating a cell comprising altering the expression and / or activity of one or more gene or combination of genes identified as described herein. In one embodiment, the cell to be rejuvenated is a somatic cell. In a further embodiment, the cell is a tissue-specific stem cell. In some embodiments, the cell may be in vitro, ex vivo or in vivo. It will be appreciated that references herein to “a” or “the” cell, CLO-C-P3828PCT such as a or the somatic cell, include a single or small number of cells, as well as to a population of cells, which may be large in number. Thus, it will be appreciated that any references herein, including any aspect or embodiment, to singular include plural and vice versa, unless explicitly stated otherwise.

[0272] The term “rejuvenating” as used herein refers to the reversal or maintenance of an ageing phenotype, such as those described herein. Such rejuvenation will therefore be appreciated to maintain a cell in a younger or non-aged stated compared to a cell in a non-rejuvenated state, or will alter the age of a cell so that it is younger or in a less-aged state than prior to rejuvenation. Rejuvenation will also or alternatively reduce and / or slow the progression or development of an ageing phenotype. Thus, in one embodiment the rejuvenated cell comprises a reduced and / or slowed ageing phenotype, such as reduced and / or slowed progression of the ageing phenotype. Whether a cell is “younger”, “non-aged” “less-aged” or “rejuvenated” may be determined using any ageing phenotype described herein, in particular using an epigenetic and / or transcriptomic clock. For example, a rejuvenated cell may display fewer alterations in cellular and / or nuclear morphology compared to cell in a non-rejuvenated state. Therefore, in one embodiment the rejuvenated cell comprises a methylation age (e.g. as determined using an epigenetic clock) of younger or less than prior to rejuvenation or than a cell in a non-rejuvenated state (i.e. a non-rejuvenated cell). In a further embodiment, the rejuvenated cell comprises a transcriptomic age (e.g. as determined using a transcriptomic clock) of younger or less than prior to rejuvenation or than a non-rejuvenated cell. In another embodiment, the younger or less-aged methylation age corresponds to that of a cell from an earlier point in the life cycle of the tissue or organism from which the cell was obtained. In a further embodiment, the younger or less-aged transcriptomic age corresponds to that of a cell from an earlier point in the life cycle of the tissue or organism from which the cell was obtained. In yet further embodiments, the rejuvenated cell comprises, with respect to an ageing phenotype as described herein, the phenotype of a reprogrammed stem cell, such as a pluripotent stem cell and / or an iPSC. In some embodiments, the rejuvenated cell comprises a methylation age or a transcriptomic age corresponding to that of a reprogrammed stem cell, such as a pluripotent stem cell and / or an iPSC. Thus, in one embodiment the rejuvenated cell comprises a methylation age or a transcriptomic age of a pluripotent stem cell. In a further embodiment, the rejuvenated cell comprises a methylation age or a transcriptomic age of an iPSC. In a yet further embodiment, the rejuvenated cell comprises a methylation age and a transcriptomic age of pluripotent stem cell. In a still further embodiment, the rejuvenated cell comprises a methylation age and a transcriptomic age of an iPSC. CLO-C-P3828PCT

[0273] Any method of altering the activity and / or expression of identified genes as described hereinbefore may be used in the rejuvenation methods. In particular, in order to reduce and / or slow ageing, the activity and / or expression of pro-ageing genes / combinations can be reduced and / or inhibited. Alternatively or in addition / combination, the activity and / or expression of antiageing genes / combinations can be increased and / or enhanced to reduce and / or slow ageing. In further alternatives, genes and combinations of genes identified in iPSCs as pro- or antiageing using the methods described herein, may have the reverse effects in somatic cells, such as pro-ageing genes identified in iPSCs may have anti-ageing effects in somatic cells and / or anti-ageing genes identified in iPSCs may have pro-ageing effects in somatic cells. According to this alternative, in order to reduce and / or slow ageing in somatic cells, the activity and / or expression of pro-ageing genes / combinations may be reduced and / or inhibited, while the activity and / or expression of anti-ageing genes / combinations may be increased and / or enhanced to reduce and / or slow ageing in somatic cells. Any method, compound or substance known in the art and as described hereinbefore may be used to alter the activity and / or expression of the identified pro- or anti-ageing genes / combinations described herein.

[0274] The rejuvenation methods and methods of altering the activity and / or expression of the identified genes / combinations of genes as described herein will be appreciated to find utility in the reduction and / or slowing of ageing, such as in an age-modulating method as described herein, in particular the slowing and / or reduction of ageing in a subject (e.g. an aged subject).

[0275] The terms “modulating ageing”, “age-modulating / modulation methods” and “rejuvenation” may therefore be interchangeably and refer to the alteration (e.g. reversal) or maintenance of an ageing phenotype, such as any of those described herein. In the context of rejuvenation, agemodulating methods may maintain a cell in a younger or non-aged state compared to a nonrejuvenated cell, or will alter the age of a cell so that it is younger or in a less-aged state than prior to rejuvenation.

[0276] It will be appreciated that references herein to a patient or subject relate equally to animals and humans and that the invention finds particular utility in veterinary treatment of any of the above mentioned diseases, disorders and conditions which are also present in said animals.

[0277] It will be appreciated that references herein to “treatment” include such terms as “amelioration”, “prevention”, “reversal”, “suppression” and the like. Furthermore, such references include administration of the modulator of the activity and / or expression of a gene or combination of genes as described herein or composition comprising the modulator as defined herein prior to the onset of the disease or disorder. Administration may also be CLO-C-P3828PCT anticipated after the induction event of the disease or disorder, either before clinical presentation of said disease or disorder, or after symptoms manifest.

[0278] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. As used herein, the term “about” when used herein includes up to and including 10% greater and up to and including 10% lower than the value specified, suitably up to and including 5% greater and up to and including 5% lower than the value specified, especially the value specified. The term “between” as used herein includes the values of the specified boundaries.

[0279] Throughout the specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations thereof such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer, step, group of integers or group of steps but not to the exclusion of any other integer, step, group of integers or group of steps.

[0280] In addition, as used herein and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example reference to “a modulator of the activity / expression of the identified gene / combination of genes” includes two or more such modulators.

[0281] It will be understood that all embodiments described herein may be applied to all aspects of the invention and vice versa, and such combinations would be readily apparent from the description provided herein and to those skilled in the art.

[0282] Other features and advantages of the present invention will be apparent from the description provided herein. It should be understood, however, that the description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications will become apparent to those skilled in the art. The invention will now be described using the following, non-limiting examples:

[0283] EXAMPLES

[0284] Example 1: A Model for Controlled Expression of Progerin

[0285] Methods

[0286] Progerin is a mutant form of Lamin A, which is a key component of the nuclear matrix. Its overexpression is the trigger that, in the model presented here, elicits ageing of human iPSCs. To assess the effect of progerin on the morphology of stem cells, iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-progerin under the control of a Tet- CLO-C-P3828PCT responsive promoter, were treated with varying concentrations of doxycycline to induce overexpression of Progerin.

[0287] Experimental Outline iPSCs were plated and cultured in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Two days after seeding the expression of progerin was induced by the daily addition of doxycycline (0, 0.05, 0.075 or 0.1 g / mL doxycycline). After 7 days of culture, iPSCs were analysed by microscopy (brightfield and GFP) or immunofluorescence (DAPI and staining for Progerin).

[0288] Results

[0289] Figure 1 shows the morphology of treated iPSCs and their expression of GFP-progerin. Increased concentrations of doxycycline lead to high levels of GFP fluorescence. The GFP signal clearly displays a nuclear morphology, as indicated by the accompanying DAPI staining and in line with the subcellular localisation of progerin in the nuclear matrix (Figure 2).

[0290] Overexpression of progerin leads to ageing of cells, as evidenced by changes in transcriptomics and other changes described previously (Miller et al. (2013); and Carmon et al. (2019)). In addition, elevated and prolonged expression can lead to cell death as a consequence of the ageing phenotype induced by progerin. Here, it was observed that, at lower doxycycline concentrations, cells displayed no noticeable changes in morphology. At higher concentrations, progerin expression led to cell death. Note that the screens described in Examples 4 and 5 were conducted at sub-lethal progerin concentrations.

[0291] Example 2: Benchmarking of Cas9 Expression and Activity

[0292] Methods

[0293] To measure activity of Cas9, a guide RNA targeting the p2 microglobulin (B2M) gene (GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 1)), which is expressed on all nucleated cells, was cloned into a lentiviral vector. The used vector encodes a puromycin-resistance cassette for the selection of cells with successful genomic integration. In addition, the vector contains GFP which is used to estimate the multiplicity of infection.

[0294] The lentiviral vector was used to transduce iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-progerin under the control of a Tet-responsive promoter. CLO-C-P3828PCT

[0295] Experimental Outline

[0296] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with the lentiviral vector targeting B2M. Following transduction, cells were cultured as above for three days, harvested and stained for expression of B2M to verify presence of insertion and deletions (indels) and thus disruption of the open reading-frame of B2M.

[0297] Results

[0298] Figure 3 shows the loss of B2M protein expression upon delivery of the specific sgRNA (red) compared to an untreated control (grey). Loss was quite pronounced and observed in the majority of the cells that received a B2M-specific guide RNA (>90% B2M-negative cells). This confirms that Cas9 is active and activity is homogenous across the individual cells in the experiment.

[0299] Example 3: Initial Validation of the Progerin-lnduced Transcriptom ic Phenotype Methods

[0300] To benchmark the transcriptomic phenotype of iPSCs expressing progerin, iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-progerin under the control of a Tet-responsive promoter, were treated with doxycycline to induce overexpression of progerin and analysed using scRNA-seq.

[0301] Screening Outline iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). To determine the transcriptomic effect of progerin overexpression, transduced iPSCs were plated and cultured as described above. Two days later, the expression of progerin was induced by the daily addition of doxycycline (0.075|jg / mL final concentration). iPSCs which were left untreated served as a control. After 7 days of culture, iPSCs were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine.

[0302] Single-Cell Transcriptomics

[0303] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. 12,800 cells were retrieved from the 10x Genomics Chromium X machine. After the cDNA amplification step, gene expression and cell hashing were prepared and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 50,000 reads per cell. CLO-C-P3828PCT

[0304] Data Analysis

[0305] Single-cell gene expression data based on whole transcriptome analysis (WTA) were pre- processed with STARsolo (Kaminow et al., bioRxiv, 2021) and further analysed in Seurat v4 (Hao et al. (2021) Cell). Results were visualized on uniform manifold approximation and projection (LIMAP) plots (Becht (2019) Nature Biotech. . As seen in Figure 4A, LIMAP plots obtained from WTA analysis could separate non-aged from aged cells to some extent, but the separation was far from perfect.

[0306] In previous experiments, a transcriptional signature had been derived for progerin-induced ageing. Thereto, bulk RNA-seq experiments were performed to decipher the difference in gene expression between engineered iPSCs that were treated for 5 days with doxycycline to induce progerin overexpression compared to the same cells that were left untreated. Markers of ageing were chosen from the bulk RNA-seq data by identifying genes that consistently showed differential expression with age across various clones, laboratories, and doxycycline concentrations. The derived gene signature consisting of 60 or 101 genes can be used to distinguish aged (i.e. cells treated with doxycycline) from non-aged cells.

[0307] As a next step, it was assessed whether non-aged cells could be separated from aged cells based on a transcriptomic clock signature. To this end, the LIMAP plot was re-constructed based on this sub-set of genes (Figure 4B). Of note, separation of non-aged from aged cells was much more pronounced, confirming the validity of the ageing signature that had been previously derived.

[0308] Example 4: Identification of Genes Involved in the Ageing and / or Rejuvenation of iPSCs Methods

[0309] It is known that induced pluripotent stem cells (iPSCs) have the capacity to rejuvenate (Lapasset et al. (2011); and Horvath (2013)). To study the effect of modulators of ageing / rejuvenation, a platform for transient ageing was used in which progerin is transiently overexpressed to induce ageing. The aim of this experimental system was to identify gene knockouts that influence the rejuvenation of iPSCs following removal of progerin. Thereto, three transgenes were integrated into genome safe-harbour sites (GSH) by genome engineering. Firstly, a CAG promoter-driven reverse Tet transactivator (rtTA) cassette was integrated into the ROSA26 locus. Secondly, a fusion protein of GFP and progerin under the control of a doxycycline-responsive promoter was integrated into the AAVS1 locus. Lastly, the CAG promoter-driven full-length Cas9 protein was integrated into the CLYBL locus, upstream of a P2A ribosomal-skipping sequence and the fluorescent protein mCherry for CLO-C-P3828PCT verification of integration. In this model, ageing can be induced by adding doxycycline, which will lead to the upregulation of progerin which is under the control of a doxycycline-dependent promoter.

[0310] Potential modulators of ageing / rejuvenation were shortlisted from selected multi-omics datasets by scientific curation. For the CRISPR screen presented here, 995 candidate genes were selected to be disrupted by CRISPR / Cas9-induced gene knockout.

[0311] For each candidate gene, four guide RNAs were designed and synthesised including nontargeting and gene desert controls. These typically target coding exons of the target genes and their targeting with CRISPR / Cas9 leads to the formation of indels which disrupt the coding sequence of the gene. The guide RNAs were cloned in a pooled fashion into a lentiviral vector. The vector used encodes a puromycin-resistance cassette for the selection of cells with successful genomic integration. In addition, the vector contains GFP which is used to estimate the multiplicity of infection. The representation of each sgRNA in the library was assessed using next generation sequencing.

[0312] The plasmid library containing -4.000 sgRNAs targeting 995 genes, was used to generate lentiviral particles which were employed to transduce iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-Progerin under the control of a Tet-responsive promoter. Expression of GFP-progerin and thus ageing was induced by doxycycline treatment.

[0313] Screening Outline

[0314] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with a low MOI aiming for a single guide RNA integration per cell on average. Following transduction, cells were cultured as above and selected for successful transduction with the guide RNA expression vector by puromycin selection. Once selection had been completed, iPSCs were plated and cultured as described above. Two days later, the expression of progerin was induced by the daily addition of doxycycline (0.05pg / mL final concentration). After 7 days of culture, iPSCs were harvested, plated and cultured as above for 14 days in the absence of doxycycline to allow for rejuvenation. At all stages, 500 cells per sgRNA were maintained in culture to ensure adequate coverage for each gene knockout. After rejuvenation, cells were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine. CLO-C-P3828PCT

[0315] Single-Cell Transcriptomics and sqRNA Capture

[0316] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. Guide RNAs were captured by spiking in a guide capture oligo as described in Replogle etal. ((2020) Nat. Biotechnol.). 280,000 cells were retrieved from the 10x Genomics Chromium X machine. After the cDNA amplification step, gene expression, cell hashing and guide RNA libraries were prepared and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 50,000 reads per cell.

[0317] Data Analysis

[0318] Single-cell gene expression data based on whole transcriptome analysis (WTA) were preprocessed with STARsolo (Kaminow et al., bioRxiv, 2021) and further analysed in Seurat v4 (Hao et al. (2021) Cell). Results were visualized on uniform manifold approximation and projection (LIMAP) plots (Becht (2019) Nature Biotech.).

[0319] Using the expression levels of the chosen markers of ageing (see Example 3), a subset of cells was identified that closely resembled aged and rejuvenated states. Subsequently, singlecell transcriptomes were projected onto a space of lower dimension using scvi (Gayoso et al. (2022)), and cells from the aged and rejuvenated states were utilised to build a Linear Discriminant Analysis (LDA) model, to produce an ageing score for each of the single-cell transcriptomes in the experiment. To detect significant pro- and anti-ageing effects, a Wilcoxon Rank Sum test was conducted, comparing the ageing scores of perturbed cells to those of cells without any gene perturbations.

[0320] Results

[0321] Several knockouts were identified that had an influence on ageing / rejuvenation states of iPSC. These effects were either (i) pro-ageing (i.e. cells bearing single-gene knockouts displayed a more aged / less rejuvenated phenotype) or (ii) anti-ageing (i.e. cells bearing single-gene knockouts displayed a less aged / more rejuvenated phenotype). Pro-ageing genes are those corresponding to knockouts with an anti-ageing effect. Conversely, anti-ageing genes are those corresponding to knockouts with a pro-ageing effect.

[0322] Potential modulators of ageing / rejuvenation were visualized on a heatmap showing the expression of the transcriptomic clock signature (Figure 5). iPSCs which were transduced with a non-targeting guide served as a control. Several knockouts revealed a pro-ageing effect, namely knockouts of ATG2B, ATXN7L3B, CAPZA1 , CCDC120, CCDC18, CEBPA, CFLAR, CHEK2, CHUK, CYP1 B1 , DNMT3B, EIF4EBP1 , EP300, FAM98C, GSK3A, GTF2H2, HCST, IGFBP3, KAT6A, LINS1 , LYPLAL1 , MTA1 , OLA1 , PHF20L1 , PICALM, PJA2, PLCG1 , CLO-C-P3828PCT

[0323] PODXL2, RAB14, RAP2C, RGN, ROCK1 , SPAG7, TFAP2A, TOP3B, TP53, TP53BP1 , TRAF1 , TSC1 , TTR, YTHDF2, YWHAZ and ZNF326. Conversely, the following knockouts had an anti-ageing effect: CTNND2, DZIP3, EIF4B, EZH2, FOXO4, HCK, HLA-DQB1 , IQCG, KRAS, LRIG1 , MAPK1 , PAPPA, PHYHIP, PLAU, SHOC2, SINHCAF, SNAI1 , SNCA, STAM, TBC1 D1 , TRPV1 , UBE4B, ULK1 and ZC4H2.

[0324] According to this example, a knockout having a pro-ageing effect corresponds with the gene itself having probable anti-ageing activity. Conversely, a knockout having an anti-ageing effect corresponds with the gene itself having probably pro-ageing activity.

[0325] Example 5: Further Identification of Genes Involved in the Ageing and / or Rejuvenation of iPSCs

[0326] Following the first CRISPR knockout screen (see Example 4), a second CRISPR knockout screen was performed. Thereto, the same guide RNA library pool was used as in Example 4. The overexpression of progerin was induced by a higher doxycycline concentration as compared to Example 4 (0.05 vs. 0.075pg / mL), to observe a stronger ageing phenotype.

[0327] The plasmid library was used to generate lentiviral particles which were used to transduce iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-progerin under the control of a Tet-responsive promoter. Expression of GFP-progerin and thus ageing was induced by doxycycline treatment.

[0328] Screening Outline

[0329] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with a low MOI aiming for a single guide RNA integration per cell on average. Following transduction, cells were cultured as above and selected for successful transduction with the guide RNA expression vector by puromycin selection. Once selection had been completed, iPSCs were plated and cultured as above and two days later the expression of progerin was induced by the daily addition of doxycycline (0.075pg / mL doxycycline). After 7 days of culture, iPSCs were harvested, plated and cultured as above for 14 days in the absence of doxycycline to allow for rejuvenation. At all stages, 500 cells per sgRNA were maintained in culture to ensure adequate coverage for each gene knockout. After rejuvenation, cells were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine. CLO-C-P3828PCT

[0330] Single-Cell Transcriptomics and sqRNA Capture

[0331] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. Guide RNAs were captured by spiking in a guide capture oligo as described in Replogle etal. ((2020) Nat. Biotechnol.). 470,000 cells were retrieved from the 10x Genomics Chromium X machine. Libraries were processed using the CRISPRclean Single Cell RNA Boost Kit (Jumpcode Genomics) to enhance sensitivity. After the cDNA amplification step, gene expression, cell hashing and guide RNA libraries were created and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 25,000 reads per cell.

[0332] Data Analysis

[0333] Data analysis was performed as outlined above (see Example 4).

[0334] Results

[0335] Several knockouts were identified that had an influence on ageing / rejuvenation states of iPSC. These effects were either (i) pro-ageing (i.e. cells bearing single-gene knockouts displayed a more aged / less rejuvenated phenotype) or (ii) anti-ageing (i.e. cells bearing single-gene knockouts displayed a less aged / more rejuvenated phenotype). Pro-ageing genes are those corresponding to knockouts with an anti-ageing effect. Conversely, anti-ageing genes are those corresponding to knockouts with a pro-ageing effect.

[0336] Potential modulators of ageing / rejuvenation were visualized on a heatmap showing the expression of the transcriptomic clock signature (Figure 6). iPSCs which were transduced with a non-targeting guide served as a control. Two knockouts were identified showing a proageing effect, namely knockouts of CREBBP, and YWHAZ. Conversely, the following knockouts had an anti-ageing effect: AXL, EIF4B, EZH2, FOXO4, HELLS, MAPK1 , PTEN, SHOC2 and SINHCAF.

[0337] According to this example, a knockout having a pro-ageing effect corresponds with the gene itself having probable anti-ageing activity. Conversely, a knockout having an anti-ageing effect corresponds with the gene itself having probably pro-ageing activity.

[0338] Example 6: Validation of Identified Genes using Drug Treatment in Aged iNeurons Methods

[0339] Generation of iNeurons from hiPSCs

[0340] Targeted iPSCs were dissociated into single cells and plated onto Geltrex coated dishes at a density of 50,000 cells per cm2. Forward programming was initiated 24 hours post splitting. CLO-C-P3828PCT

[0341] The induction was performed in DMEM / F-12 supplemented with Glutamax (100x), Non- Essential Amino Acids (100x), 50pM 2-Mercaptoethanol (Gibco), 1 % Penicillin / Streptomycin, 1 g / mL Doxycycline. After 2 days of induction, the medium was switched to Neurobasal- medium supplemented with Glutamax (100x), B27 (50x), 10ng / mL BDNF (Peprotech), 10ng / mL NT3 (R&D Systems), 1 % Penicillin / Streptomycin, and 1 g / mL Doxycycline. On day 3 post induction, cells were dissociated into single cells and plated onto PDL / Geltrex coated plates at a density of 30,000 cells per cm2for final plating in the above Neurobasal medium. Doxycycline was withdrawn at day 7.

[0342] Mitochondrial Assays

[0343] Measurement of cellular oxygen consumption rate (OCR): Cellular oxygen consumption rate was measured using a XF24 extracellular flux analyser (Seahorse Biosciences, Denmark). Human iPSCs were seeded at a density of 2,000 cells / well in XFp miniplates (Agilent Technologies) and were cultured under the conditions described above for ageing or non-ageing conditions. Cells were incubated in assay medium (DMEM without sodium bicarbonate and phenol red) for at least 30 min prior to the assay. OCR was measured every 5 minutes for three times under basal conditions and then after the sequential injection of 0.5 pM oligomycin (inhibitor of ATP synthase), 8.1 pM carbonyl cyanide p- (trifluoromethoxy)phenylhydrazone (FCCP; uncoupler of mitochondrial inner membrane allowing maximum electron flux through the ETC), and 10 pM rotenone + 10 pM antimycin A (inhibitors of mitochondrial complex I and III, respectively). Cells were stained with Hoechst for cell density normalization, according to the manufacturer’s instructions. Fluorescence was measured using the CLARIOstar microplate reader at 510 / 610nm and 644 / 665nm, and the DAPI filter at 340 / 480nm. At least 3 biological replicates were performed, with at least 3 technical replicates per sample. Basal respiration was measured by subtracting non- mitochondrial respiration from the last rate measurement before Oligomycin injection. Maximal respiration was measured by subtracting the non-mitochondrial respiration from the maximum rate measurement after FCCP injection. ATP production was measured by the minimum rate measurement after Olygomycin injection from the last rate measurement before Oligomycin injection.

[0344] MitoTracker and MitoSOX assays: Mitochondrial presence and reactive oxygen species (ROS) production were assessed on day 21 iNeurons. Briefly, day 3 iNeurons were plated onto PDL / Geltrex-coated black clear and flat bottom 96-well plates at a density of 50,000 cells per well. Treatment with drugs started on day 15. On day 21 , live cells were stained with MitoTracker Deep Red and MitoSOX Red dyes (ThermoFisher Scientific). The mitochondrial staining dyes rapidly and passively diffuse across the plasma membrane and selectively target CLO-C-P3828PCT the mitochondria, where they accumulate. MitoTracker Deep Red dyes stain active mitochondria in live cells for mitochondrial labelling and localization. MitoSOX Red dye is highly specific for mitochondrial-produced ROS, being readily oxidized by superoxide but not by other ROS- or reactive nitrogen species (RNS)-generating systems, with the oxidized product being highly fluorescent. Cells were stained with Hoechst for cell density normalization, according to the manufacturer’s instructions. Fluorescence was measured using the CLARIOstar microplate reader at 510 / 610nm and 644 / 665nm, and the DAPI filter at 340 / 480nm. At least 3 biological replicates were performed, with at least 3 technical replicates per sample. Data analysis was performed by division of the dye signal by Hoechst signal of each well, to normalise to cell count. Afterwards, the dye signal / DAPI ratio of all samples was divided by the average of the untreated group, to normalise samples against it. Data were exported to GraphPad Prism and plotted.

[0345] Statistical Analysis

[0346] Statistical analysis was performed with GraphPad Prism (v10). The number of replicates, the statistical test used, and the test results are described in the figure legends. Unless stated otherwise data is presented as mean ± SD. For comparisons between two groups, the unpaired student t-test was used. For multiple comparisons, the one-way analysis of variance (ANOVA) was used with Dunnett’s or Tukey’s multiple comparisons test.

[0347] Results

[0348] Drugs and small molecules were chosen for validation based on genes that had emerged from the unbiased CRISPR screen of Examples 4 and 5. Several drugs that have been reported to trigger / facilitate rejuvenation were included for reference (Table 1). Drugs that exhibited inhibitory effects were selected to emulate the gene knockout effect, with the aim of promoting rejuvenation. The main direct target genes chosen from the initial screen were EZH2, MAPK, PTEN and GSK3A / B. In addition, a set of genes were chosen that were indirectly connected to the hits that emerged from the CRISPR screen. Those include: SIRT1 , AKT, mTOR and MYC. Additionally, several other drugs and small molecules were chosen for the validation, i.e. the known drug, resveratrol, which also acts as a SIRT1 inhibitor. Two other drugs known to target progerin were chosen, Lonafarnib and Ghrelin. Finally, drugs known to either reduce oxidative stress, N-acetylcysteine (NAC), or to promote rejuvenation, rDM (growth hormone / DHEA / Metformin), were included for the validation.

[0349] Table 1 : List of Drugs and Small Molecules chosen for Validation of Gene Target Hits CLO-C-P3828PCT

[0350] *Based on Fahy et al. (2019) Aging Cell.

[0351] Non-aged iNeurons and aged iNeurons (constitutively aged as described in PCT / GB2024 / 052741) were induced from iPSCs according to standard induction protocol described above and were allowed to mature until day 15 post induction, when the drug treatment was started (Figure 7). Drugs were supplemented until day 21 post induction following with live mitochondrial viability and functional assays.

[0352] Aged iNeurons showed a decrease in mitochondrial mass as judged from the intensity of MitoTracker dye used, when compared to non-aged cells, which might indicate a degradation in mitochondria or a decrease in its activity (Figure 8). Several drugs prompted a rescue of this dysfunction showing an increase in active mitochondrial density, when compared to untreated cells. Of note, resveratrol and ibudilast showed a clear and significant effect on induction of active mitochondria. Moreover, the utilization of the MitoSOX probe, a fluorescent marker designed to detect superoxide production within the inner mitochondrial compartment, reveals a reduction in superoxide levels during the aging process, potentially as a protective response. Interestingly, the effects of various drugs on aged iNeurons appear to vary when assessed using this probe (Figure 9). While several drugs did not show any effect compared to untreated aged iNeurons (i.e. GSK126, EPZ-6438, CHIR99021 , Phen, 10058-F4, CLO-C-P3828PCT resveratrol and ibudilast), others seemed to increase superoxide levels (i.e. Lonafarnib, rDM, rapamycin and LY344864).

[0353] Subsequently, non-aged and aged iNeurons exposed to the 15 drugs and small molecules underwent a mitochondrial function assay measuring their oxygen consumption rates. Nonaged iNeurons displayed varying responses in mitochondrial function, with most drugs showing no impact, while a select few had a detrimental effect, i.e. iAKT, rDM and NAC (Figure 10A). Within the aged iNeurons group, several drugs exhibited no discernible impact on the OCR levels (Figure 10B), while others had a detrimental effect, i.e. Phen, rDM and NAC (Figure 10C). Interestingly, the latter two drugs also reduced OCR levels in non-aged iNeurons, indicating a potential general adverse effect on mitochondrial function. Notably, 10058-F4 and EPZ-6438, along with resveratrol, were among the compounds that enhanced OCR levels (Figure 10D). It's worth noting that the basal respiration levels of both 10058-F4 and resveratrol closely resembled those observed in non-aged iNeurons, while those of rDM and NAC were significantly reduced (Figure 11).

[0354] Overall, 10058-F4, a drug targeting MYC, seemed to be the most effective in improving mitochondrial function. Other drugs with a potential anti-aging effect include iAKT, ibudilast and resveratrol. However, it is important to note that not all drugs necessarily impact mitochondrial function, and additional hallmarks of ageing should also be validated.

[0355] Example 7: Further Validation of Identified Genes using Drug Treatment in Aged iNeurons

[0356] Immunocytochemistry Methods

[0357] Cells were fixed in 4% paraformaldehyde (Alfa Aesar) for 15 minutes at room temperature and subsequently washed three times with PBS. The cells were then permeabilized with 0.1% Triton-X-100 for 15 minutes at room temperature. Then, blocked with 10% goat or donkey serum (abeam) and 0.3% T riton X-100 (diluted in PBS) for 30-45 minutes at room temperature. Subsequently, cells were incubated with appropriately diluted primary antibodies (Table 2) in 2% goat or donkey serum and 0.1% Triton X-100 (diluted in PBS) at 4°C overnight. After three washes with PBS, the cells were incubated for 1 hour at room temperature with corresponding secondary antibodies in PBS supplemented with 1% goat or donkey serum. Nuclei were visualized with 4',6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific). Images were acquired using a Zeiss LSM 710 confocal microscope (Leica).

[0358] To quantify cellular fluorescence intensity (based on H3K9me3 expression), images were processed using Imaged software (version 2.00, NIH). Corrected total cell fluorescence CLO-C-P3828PCT

[0359] (CTCF), normalized to background intensity, was assessed from cells from each of the drug treatments, and presented in bar graphs. Number of yH2Ax foci per cell was calculated manually and was plotted into a bar graph.

[0360] Table 2: List of Primary Antibodies used in the Study

[0361] Results

[0362] Additional assessments of ageing-related traits were conducted to confirm the impact of the various drugs on different aspects of ageing. Specifically, two key markers were evaluated: H3K9me3, an indicator of epigenetic changes known to decrease in aged neurons, and yH2AX, a marker for DNA damage that tends to increase with age.

[0363] The data presented in Figures 12 and 13 demonstrate that, for the majority of drugs, there was no significant improvement in H3K9me3 expression. However, several drugs demonstrated the ability to not only restore H3K9me3 expression to normal levels but also elevate it, i.e. Ghrelin, resveratrol, 10058F-F4, and LY344864.

[0364] To assess genomic stability, double-strand DNA breaks were quantified by counting the number of yH2AX foci per nuclei (Figure 14). Most of the drugs led to a reduced number of these foci, indicating a positive effect on genomic stability. Remarkably, Lonafarnib stood out by completely reversing the DNA damage, as illustrated in Figure 15.

[0365] Overall, a subset of drugs that demonstrated enhancements in mitochondrial function (i.e. 10058-F4 and resveratrol) also exhibited the capacity to enhance both epigenetic and genomic stability. Furthermore, we identified additional drugs (i.e. Lonafarnib) that, although they did not improve mitochondrial function, have shown promise in this context. These drugs hold potential for combinatorial testing to target multiple aging hallmarks simultaneously. CLO-C-P3828PCT

[0366] Example 8: Identification of Further Genes Involved in the Ageing and / or Rejuvenation of iPSCs

[0367] Following the earlier CRISPR knockout screens (see Examples 4 and 5), further CRISPR knockout screens were performed. Thereto, a CRISPR screen was conducted in which a total of 6,500 human genes were targeted using suitable guide RNAs and CRISPR / Cas9.

[0368] The plasmid library containing 25,998 sgRNAs targeting 6,498 genes, was used to generate lentiviral particles which were employed to transduce iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-Progerin under the control of a Tet-responsive promoter. Expression of GFP-progerin and thus ageing was induced by doxycycline treatment.

[0369] Screening Outline

[0370] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with a low MOI aiming for a single guide RNA integration per cell on average. Following transduction, cells were cultured as above and selected for successful transduction with the guide RNA expression vector by puromycin selection. Once selection had been completed, iPSCs were plated and cultured as described above. Two days later, the expression of progerin was induced by the daily addition of doxycycline (0.065pg / mL final concentration). After 7 days of culture, iPSCs were harvested, plated and cultured as above for 14 days in the absence of doxycycline to allow for rejuvenation. At all stages, 500 cells per sgRNA were maintained in culture to ensure adequate coverage for each gene knockout. After rejuvenation, cells were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine.

[0371] Single-Cell Transcriptomics and sgRNA Capture

[0372] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. Guide RNAs were captured by spiking in a guide RNA capture oligo as described in Replogle et al. ((2020) Nat. Biotechnol.). -800,000 cells were retrieved from the 10x Genomics Chromium X machine. After the cDNA amplification step, gene expression, cell hashing and guide RNA libraries were prepared and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 50,000 reads per cell.

[0373] Data Analysis

[0374] Data analysis was performed as outlined above (see Example 4). CLO-C-P3828PCT

[0375] Results

[0376] Several knockouts were identified that had an influence on ageing / rejuvenation states of iPSC. These effects were either (i) pro-ageing (i.e. cells bearing single-gene knockouts displayed a more aged / less rejuvenated phenotype) or (ii) anti-ageing (i.e. cells bearing single-gene knockouts displayed a less aged / more rejuvenated phenotype). Pro-ageing genes are those corresponding to knockouts with an anti-ageing effect. Conversely, anti-ageing genes are those corresponding to knockouts with a pro-ageing effect.

[0377] Potential modulators of ageing / rejuvenation were visualized on a heatmap showing the expression of the transcriptomic clock signature (Figure 16). iPSCs which were transduced with a non-targeting guide served as a control. Several knockouts revealed a pro-ageing effect, namely knockouts of AFF1 , C1GALT1C1 , DAPK3, DIABLO, EBP, ELAVL1 , ELOA, MED12, MYL6, RALGAPB, RBM47, SORI B and TRI M71 . Conversely, the following knockouts had an anti-ageing effect: BCOR, CECR2, CHD2, CTNNBIP1 , DOT1 L, ETS1 , FOXD3, GZF1 , MAZ, NF2, NR6A1 , NRBP1 , PCGF1 , PMAIP1 , RAF1 , RARA, RBM15, RSAD1 , SOS1 , SOX11 , SOX4, TCF12, TCF7L2, TDG, TFE3, WNK1 and ZNF532.

[0378] According to this example, a knockout having a pro-ageing effect corresponds with the gene itself likely counteracting ageing. Conversely, a knockout having an anti-ageing effect corresponds with the gene itself having probable pro-ageing activity.

[0379] Example 9: Identification of Yet Further Genes Involved in the Ageing and / or Rejuvenation of iPSCs

[0380] Following the earlier CRISPR knockout screens (see Examples 4 and 5), and the first genomewide screen (see Example 8), further CRISPR knockout screens were performed. Thereto, a second CRISPR screen was conducted in which a total of 6,500 human genes were targeted using suitable guide RNAs and CRISPR / Cas9.

[0381] The plasmid library containing 25,767 sgRNAs targeting 6,499 genes, was used to generate lentiviral particles which were employed to transduce iPSCs harbouring an rtTA transactivator, constitutive full-length Cas9 and GFP-Progerin under the control of a Tet-responsive promoter. Expression of GFP-progerin and thus ageing was induced by doxycycline treatment.

[0382] Screening Outline

[0383] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with a low MOI aiming for a single guide RNA integration per cell on CLO-C-P3828PCT average. Following transduction, cells were cultured as above and selected for successful transduction with the guide RNA expression vector by puromycin selection. Once selection had been completed, iPSCs were plated and cultured as described above. Two days later, the expression of progerin was induced by the daily addition of doxycycline (0.065pg / mL final concentration). After 7 days of culture, iPSCs were harvested, plated and cultured as above for 14 days in the absence of doxycycline to allow for rejuvenation. At all stages, 500 cells per sgRNA were maintained in culture to ensure adequate coverage for each gene knockout. After rejuvenation, cells were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine.

[0384] Single-Cell Transcriptomics and sgRNA Capture

[0385] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. Guide RNAs were captured by spiking in a guide RNA capture oligo as described in Replogle et al. ((2020) Nat. Biotechnol.). ~1 ,200,000 cells were retrieved from the 10x Genomics Chromium X machine. After the cDNA amplification step, gene expression, cell hashing and guide RNA libraries were prepared and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 50,000 reads per cell.

[0386] Data Analysis

[0387] Data analysis was performed as outlined above (see Example 4).

[0388] Results

[0389] Several knockouts were identified that had an influence on ageing / rejuvenation states of iPSC. These effects were either (i) pro-ageing (i.e. cells bearing single-gene knockouts displayed a more aged / less rejuvenated phenotype) or (ii) anti-ageing (i.e. cells bearing single-gene knockouts displayed a less aged / more rejuvenated phenotype). Pro-ageing genes are those corresponding to knockouts with an anti-ageing effect. Conversely, anti-ageing genes are those corresponding to knockouts with a pro-ageing effect.

[0390] Potential modulators of ageing / rejuvenation were visualized on a heatmap showing the expression of the transcriptomic clock signature (Figure 17). iPSCs which were transduced with a non-targeting guide served as a control. Several knockouts revealed a pro-ageing effect, namely knockouts of BICRA, C9orf85, and NHLRC2. Conversely, the following knockouts had an anti-ageing effect: AP3M2, CHST8, CRTC1 , CTTNBP2, DENND2A, DENND2D, E2F6, EEIG2, FANCA, FLCN, FRMD6, FTCD, GEN1 , GJB3, HEBP1 , IFT122, IKBKB, KDM2B, KRTAP21-1 , LAMC2, MRPL42, PABIR1 , PANK1 , PRICKLE3, RUFY2, RYBP, CLO-C-P3828PCT

[0391] SCN4A, SKAP2, SLC26A10P, SLC66A2, SPICE1 , SUZ12, SYTL1 , TIMM9, TMCC2, TMEM191 B, TULP4, UHRF2, URB1 , VCPKMT, WDR45, ZC3HAV1 L and ZNF480.

[0392] According to this example, a knockout having a pro-ageing effect corresponds with the gene itself likely counteracting ageing. Conversely, a knockout having an anti-ageing effect corresponds with the gene itself having probable pro-ageing activity.

[0393] Example 10: Engineering and Functionality Testing of CRISPR Activation (CRISPRa) Screening Line

[0394] The aim of this experiment was to create a human iPSC line that can be artificially aged by the overexpression of Progerin and can express the dCas9-VPR protein in a constitutive manner to enable the usage of this line in CRISPR activation screens.

[0395] Experimental Outline

[0396] Three transgenes were integrated into genome safe-harbor sites (GSH) by genome engineering. Firstly, a CAG promoter-driven reverse Tet transactivator (rtTA) cassette for doxycycline-controlled transactivation of a second recombinant transgene was integrated into the ROSA26 locus. Secondly, a fusion protein of GFP and Progerin under the control of doxycycline-responsive promoter was integrated into the AAVS1 locus. Lastly, the CAG promoter-driven dCas9-VPR protein was integrated into the CLYBL locus (Figure 18).

[0397] Results

[0398] To benchmark the expression and activity of dCas9-VPR, the engineered iPSC line was transduced with a lentiviral vector encoding a single guide RNA (sgRNA) targeting the CD274 gene (GTCAGGAAAGTCCAACGCC (SEQ ID NO: 2)) which is lowly expressed in iPSCs. The complex of dCas9-VPR and sgRNA will activate the expression of the CD274 by binding upstream of the transcription start site and recruiting the cell’s transcription machinery to enhance the transcription of the targeted gene. Figure 19 shows the activation of CD274 expression upon delivery of the specific sgRNA compared to a non-transduced and nontargeting sgRNA control, thus confirming dCas9-VPR functionality in this cell line.

[0399] Expression of the GFP-Progerin and dCas9-VPR cassette were confirmed by analysis of GFP and dCas9-VPR functionality, respectively. In case of GFP overexpression (and thus Progerin), cells were treated for 5 days with different concentrations of doxycycline (0, 0.065, 0.075, 0.085 pg / mL) to ensure stable expression of the transgene, and expression of GFP- Progerin was confirmed by fluorescence microscopy (Figure 20). CLO-C-P3828PCT

[0400] Example 11: Further Identification of Genes Involved in the Ageing and / or Rejuvenation of iPSCs

[0401] Following the earlier CRISPR knockout screens (See Examples 4 and 5), and the two parts of the genome-wide screen (see Examples 8 and 9), a CRISPRa screen was performed for lowly expressed genes (TPM value lower than 1.81).

[0402] The plasmid library containing 25,975 guides targeting 6,500 human genes, was used to generate lentiviral particles which were employed to transduce iPSCs harbouring an rtTA transactivator, constitutive dCas9-VPR and GFP-Progerin under the control of a Tet- responsive promoter. Expression of GFP-Progerin and thus ageing was induced by doxycycline treatment.

[0403] Screening Outline

[0404] Prior to lentiviral transduction, iPSCs were expanded in StemFlex medium (ThermoFisher Scientific) on standard tissue culture plates coated with Vitronectin (StemCell Technologies). Cells were transduced with a low multiplicity of infection (MOI) aiming for a single guide RNA integration per cell on average. Following transduction, cells were cultured as above and selected for successful transduction with the guide RNA expression vector by puromycin selection. Once selection had been completed, iPSCs were plated and cultured as described above. Two days later, the expression of progerin was induced by the daily addition of doxycycline (0.075pg / mL final concentration). After 7 days of culture, iPSCs were harvested, plated and cultured as above for 14 days in the absence of doxycycline to allow for rejuvenation. At all stages, a coverage of 500 cells per sgRNA were maintained in culture to ensure adequate coverage for each gene activation. After rejuvenation, cells were harvested, hashed using barcoded Total-Seq antibodies (BioLegend) and processed on a 10x Genomics Chromium X machine.

[0405] Single-Cell Transcriptomics and sgRNA Capture

[0406] Enriched cells were analysed by scRNA-seq using 10x Genomics Chromium Single Cell 5' Reagent Kits v2 following manufacturer’s instructions. Guide RNAs were captured by spiking in a guide RNA capture oligo as described in Replogle et al. ((2020) Nat. Biotechnol.). ~1 ,200,000 cells were retrieved from the 10x Genomics Chromium X machine. After the cDNA amplification step, gene expression, cell hashing, and guide RNA libraries were prepared and sequenced on a NovaSeq sequencer (Illumina) aiming for at least 50,000 reads per cell. CLO-C-P3828PCT

[0407] Data Analysis

[0408] The analysis was conducted as similarly to the analysis of the CRISPR KO screen described above (see Example 4). In the CRISPR activation screen, since correlation between the activation of guide RNAs with the upregulation of their target genes can be established, the analysis was conducted in two ways: (i) an analysis considering all cells per activation, and (ii) an analysis focusing only on cells where we observed the target gene upregulated. The results from both approaches were combined and are shown below.

[0409] Results

[0410] Several perturbations (activations) were identified that had an influence on ageing / rejuvenation states of iPSC. These effects were either (i) pro-ageing (i.e. cells bearing single-gene activations displayed a more aged / less rejuvenated phenotype) or (ii) anti-ageing (i.e. cells bearing single-gene activations displayed a less aged / more rejuvenated phenotype). Pro-ageing genes are those corresponding to activators with a pro-ageing effect. Conversely, anti-ageing genes are those corresponding to activators with an anti-ageing effect.

[0411] Potential modulators of ageing were visualized on a heatmap showing the expression of the transcriptomic clock signature (Figure 21). iPSCs which were transduced with a non-targeting guide served as a control. Several activations revealed an anti-ageing effect, namely the activations of ARRDC5, CHRNA7, DLX5, FBP1 , FDCSP, FYB2, HIVEP3, HNF4A, INS, MAP2K5, MITF, MYZAP, NR5A1 , PAX2, PAX5, PMFBP1 , PTBRB, SLC27A2, SYN3, TNFAIP8L3 and LIPK1 B. Conversely, the following activations had a pro-ageing effect: ALAS2, AMBN, CRX, DLL4, ESRRB, FAM186A, FAM83A, FAS, FLVCR2, FOXQ1, GDF6, ICAM2, ITIH5, LGR6, LHX8, METTL24, NME5, OPCML, OR12D3, P2RX3, PIGZ, POTEE, PSTPIP2, PTPRH, RAX, RFX6, SEMA5A, SH3BGR, SLC6A5, SNAP25, SPMIP1 and WNT8A.

[0412] According to this example, an activation having a pro-ageing effect corresponds with the gene itself having a probable pro-ageing activity. Conversely, an activation having an anti-ageing effect correspond with the gene itself likely counteracting ageing.

[0413] Example 12: Drug validation of selected target genes identified in the CRISPR screens To validate a selected subset of gene targets identified in the CRISPR screens (see Examples 4, 5, 8, 9, and 11), small molecules targeting eight of those genes were used to treat aged hiPSCs. Reversal of ageing (rejuvenation) was assessed through transcriptomic analysis of the treated cells. CLO-C-P3828PCT

[0414] Experimental outline

[0415] Human iPSCs were cultured as previously described. Two days after plating, progerin expression was induced by daily addition of doxycycline (final concentration 0.075|jg / mL). Small molecules (Table 3) were administrated concurrently with doxycycline. After seven days of cell culture, iPSCs were collected for RNA extraction (Day 7) or replated and cultured for an additional 14 days in doxycycline-free medium to allow rejuvenation, while continuing small molecule treatment. Cells were then collected for RNA analysis on Day 21 post-plating.

[0416] Table 3: List of small molecules used to treat aged hiPSCs

[0417] Results

[0418] Principal component analysis (PCA) showed a clear separation between untreated aged and non-aged cells, consistent with the expected force-ageing phenotype (Figure 22). However, aged iPSCs treated with small molecules did not exhibit an obvious rejuvenation effect in the PCA. Similarly, linear discriminant analysis (LDA) of all differentially expressed genes did not reveal a distinct separation (Figure 23). By contrast, refined analysis focusing on the defined ageing gene signature demonstrated a marked rejuvenation effect in all drug-treated samples compare with untreated aged controls (Figure 24). Notably, this effect was not consistent between Day 7 and Day 21 samples: withdrawal of doxycycline at Day 7 produced a stronger rejuvenation response than that observed with the continued small molecule treatment.

[0419] Example 13: Association between target genes identified in the CRISPR screens and age-related disorders

[0420] To assess the link between the target genes identified in the CRISPR screens with age-related disorders, the identified targets were mapped against data from the Open Targets database, a large, open-access resource that integrates diverse biological and clinical data to help CLO-C-P3828PCT scientists identify and prioritize potential drug targets (htps: / / w^Mopente^^ Using the Open Targets Association Score, a composite score that combines evidence from multiple data sources and data types, the strength of evidence linking a target gene to a disease or phenotype was quantified. Each target-disease pair has an overall Association Score ranging from 0 to 1 , with 0 showing no evidence of association, and 1 showing strongest possible evidence across all data sources. We plotted the data from the top 5 age-related disorders, we identified that, from the target genes identified in the CRISPR screens, 81 genes are associated with neurological disorders, 11 are related with skin ageing, 18 with endocrine and metabolic disorders, 39 with cancer, and 11 with cardiovascular disorders (Figure 25).

Claims

CLO-C-P3828PCTCLAIMS1. A method of modulating ageing, said age-modulating method comprising modulating the expression and / or activity of a gene or combination of genes identified by a screening method, said screening method comprising the steps of:(i) introducing one or more ageing-inducing factor into an induced pluripotent stem cell (iPSC) or exposing the iPSC to one or more exogenous ageing-inducing factor for a period of time;(ii) performing a loss-of-function, inhibitory, knock-out, activatory, gain-of-function, combinatorial or perturbation screen in the iPSC; and(iii) measuring an ageing phenotype of the iPSC to identify the gene / combination of genes, wherein the gene / combination of genes is identified when the ageing phenotype is altered and / or its progression is altered in the iPSC following the screen of step (ii).

2. The method of claim 1 , wherein the age-modulating method is performed in vitro, in vivo or ex vivo.

3. The method of claim 1 or claim 2, wherein the age-modulating method is performed in a cell, optionally wherein the cell is a stem cell, such as an iPSC, or is a somatic cell, such as a somatic derived from an iPSC by forward programming.

4. The method of any one of claims 1 to 3, wherein the age-modulating method is for use in a method of treating a disease or disorder associated with ageing in a subject.

5. The method of any one of claims 1 to 4, wherein ageing is reduced and / or slowed upon modulating the expression and / or activity of the identified gene or combination of genes, such as wherein the age-modulating method reduces and / or slows the progression of an ageing phenotype in a cell.

6. The method of claim 5, wherein the expression and / or activity of the identified gene or combination of genes is reduced and / or inhibited in the age-modulating method.

7. The method of claim 6, wherein the identified gene or combination of genes is selected from one or more of: ALAS2, AMBN, AP3M2, AXL, BCOR, CECR2, CHD2, CHST8, CRTC1 , CRX, CTNNBIP1 , CTNND2, CTTNBP2, DENND2A, DENND2D, DLL4, DOT1 L, DZIP3, E2F6, EEIG2, EIF4B, ESRRB, ETS1 , EZH2, FAM186A, FAM83A, FANCA, FAS, FLCN, FLVCR2, FOXD3, FOXO4, FOXQ1 , FRMD6, FTCD, GDF6, GEN1 , GJB3, GZF1 , HCK, HEBP1 , HELLS,CLO-C-P3828PCTHLA-DQB1, ICAM2, IFT122, IKBKB, IQCG, ITIH5, KDM2B, KRAS, KRTAP21-1 , LAMC2, LGR6, LHX8, LRIG1 , MAPK1 , MAZ, METTL24, MRPL42, NF2, NME5, NR6A1 , NRBP1 , OPCML, OR12D3, P2RX3, PABIR1, PANK1 , PAPPA, PCGF1 , PHYHIP, PIGZ, PLAU, PMAIP1 , POTEE, PRICKLE3, PSTPIP2, PTEN, PTPRH, RAF1 , RARA, RAX, RBM15, RFX6, RSAD1 , RUFY2, RYBP, SCN4A, SEMA5A, SH3BGR, SHOC2, SINHCAF, SKAP2, SLC26A10P, SLC66A2, SLC6A5, SNAI1 , SNAP25, SNCA, SOS1 , SOX11 , SOX4, SPICE1 , SPMIP1 , STAM, SUZ12, SYTL1 , TBC1D1, TCF12, TCF7L2, TDG, TFE3, TIMM9, TMCC2, TMEM191 B, TRPV1 , TULP4, UBE4B, UHRF2, ULK1 , URB1 , VCPKMT, WDR45, WNK1 , WNT8A, ZC3HAV1 L, ZC4H2, ZNF480, and ZNF532.

8. The method of claim 6 or claim 7, wherein the expression and / or activity of the identified gene or combination of genes is reduced and / or inhibited using an inhibitor, an antagonist, a blocking agent and / or negative post-transcriptional regulation, such as RNA interference (RNAi).

9. The method of claim 5, wherein the expression and / or activity of the identified gene or combination of genes is increased and / or promoted in the age-modulating method.

10. The method of claim 9, wherein the identified gene or combination of genes is selected from one or more of: AFF1 , ARRDC5, ATG2B, ATXN7L3B, BICRA, C1GALT1C1 , C9orf85, CAPZA1 , CCDC120, CCDC18, CEBPA, CFLAR, CHEK2, CHRNA7, CHUK, CREBBP, CYP1 B1, DAPK3, DLX5, DIABLO, DNMT3B, EBP, EIF4EBP1, ELAVL1 , ELOA, EP300, FAM98C, FBP1 , FDCSP, FYB2, GSK3A, GTF2H2, HOST, HIVEP3, HNF4A, IGFBP3, INS, KAT6A, LINS1 , LYPLAL1 , MAP2K5, MED12, MITF, MTA1 , MYL6, MYZAP, NHLRC2, NR5A1 , OLA1 , PAX2, PAX5, PHF20L1 , PICALM, PJA2, PLCG1 , PODXL2, PMFBP1 , PTBRB, RAB14, RALGAPB, RAP2C, RBM47, RGN, ROCK1 , SCRIB, SLC27A2, SPAG7, SYN3, TFAP2A, TNFAIP8L3, TOP3B, TP53, TP53BP1 , TRAF1 , TRIM71 , TSC1 , TTR, UPK1 B, YTHDF2, YWHAZ, and ZNF326.

11. The method of claim 9 or claim 10, wherein the expression and / or activity of the identified gene or combination of genes is increased and / or promoted using an activator, an agonist, a trans-activator and / or post-transcriptional enhancement.

12. The method of any one of claims 1 to 11 , wherein introducing / exposing step (i) comprises introducing one or more expression cassette into the iPSC, said expression cassette comprising a sequence encoding the one or more ageing-inducing factor under the control of an inducible promoter which is regulated by a transcriptional regulator protein,CLO-C-P3828PCT wherein the activity of the transcriptional regulator protein is controlled by an exogenously supplied substance, such as tetracycline and derivatives thereof or cumate.

13. The method of any one of claims 1 to 12, wherein the ageing-inducing factor is an alternative splice form of Lamin A, such as progerin.

14. The method of claim 12 or claim 13, wherein introducing / exposing step (i) additionally comprises adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC, or wherein the screening method additionally comprises a step (iib) of adding the exogenous substance to the iPSC, thereby driving expression of the one or more ageinginducing factor in the iPSC for a period of time.

15. The method of any one of claims 1 to 14, wherein the one or more ageing-inducing factor is introduced into the iPSC using a first expression cassette comprising a sequence coding for the one or more ageing-inducing factor operably linked to a doxycycline-responsive promoter, optionally wherein the first expression cassette is integrated into the genome of the iPSC at a first genome safe-harbour (GSH) site, such as at the AAVS1 locus.

16. The method of claim 14 or claim 15, wherein introducing / exposing step (i) comprises adding tetracycline or a derivative thereof to the iPSC, thereby driving expression of the one or more ageing-inducing factor in the iPSC, or wherein the screening method additionally comprises a step (iib) of adding tetracycline or a derivative thereof to the iPSC, thereby driving expression of the one or more ageinginducing factor in the iPSC for a period of time.

17. The method of any one of claims 12 to 16, wherein a second expression cassette is integrated into the genome of the iPSC at a second GSH site, such as the ROSA26 locus, said second expression cassette comprising a sequence coding for the transcriptional regulator protein operably linked to a ubiquitous promoter, such as the CAG promoter.

18. The method of claim 17, wherein the second expression cassette comprises a sequence coding for a reverse Tet transactivator (rtTA) operably linked to a ubiquitous promoter, such as the CAG promoter.CLO-C-P3828PCT19. The method of any one of claims 1 to 18, wherein the screen of step (ii) is performed using CRISPR / Cas9, such as CRISPRi, CRISPR-ko or a combination thereof.

20. The method of claim 19, wherein a sequence coding for Cas9 protein is introduced into the iPSC using an expression cassette comprising a sequence coding for the Cas9 protein, optionally wherein the Cas9 coding sequence is operably linked to a ubiquitous promoter, such as the CAG promoter, and / or optionally wherein the expression cassette is integrated into the genome of the iPSC at a GSH site, such as at the CYBL locus, optionally wherein the expression cassette is a third expression cassette and is integrated at a third GSH site.21 . The method of any one of claims 1 to 20, wherein the screen of step (ii) is performed prior to introducing the ageing-inducing factor into the iPSC or exposing the iPSC to the exogenous ageing-inducing factor in step (i).

22. The method of any one of claims 1 to 20, wherein the screening method additionally comprises a step (iic) of removing the one or more ageing-inducing factor or removing the exogenous substance from the iPSC, thereby reducing expression of the one or more ageinginducing factor in the iPSC, optionally followed by culturing the iPSC.

23. A method of modulating or treating ageing in vivo, said method comprising the agemodulating method of any one of claims 1 to 22.

24. A method of treating a disease or disorder associated with ageing, said method comprising the age-modulating method of any one of claims 1 to 22.

25. The method of claim 24, wherein the disease or disorder associated with ageing is selected from: cardiovascular disorders, neurodegenerative disorders, metabolic and endocrine disorders, respiratory disorders, musculoskeletal disorders, renal disorders, sensory organ disorders, gastrointestinal disorders, haematological disorders, reproductive disorders, genitourinary disorders, oral health disorders, immune system decline and inflammation, skin ageing, and cancer.CLO-C-P3828PCT26. The method of any one of claims 23 to claim 25, wherein the method comprises administering a modulator of the expression and / or activity of a gene or combination of genes identified by the screening method of any one of claims 1 to 22.

Images