Normalizing and pooling of PCR-free sequencing libraries

Abstract

Disclosed herein are methods of normalizing libraries including one or more adapter ligated nucleic acid molecules. The methods of the present disclosure do not require qPCR or any specialized adapters. Instead, the libraries utilize predetermined concentrations of one or more normalization oligonucleotides to effectuate normalization.

Description

P39430-WQ-1NORMALIZING AND POOLING OF PCR-FREE SEQUENCING LIBRARIESBACKGROUND OF THE DISCLOSURE

[0001] Next-generation sequencing is a fundamental tool in biological and medical research; it is an essential technology for the paradigm of personalized precision medicine. Library preparation is the first step of next generation sequencing. The preparation of nucleic acid libraries for next-generation sequencing involves multiple steps. For instance, nucleic acid molecules are fragmented, end-repaired, and A-tailed; adapters, such as Y-adapters, are ligated to the DNA fragments; and the resulting nucleic acid libraries are amplified.

[0002] Next-generation sequencing relies on obtaining reliable data. Uneven library concentrations from different types and qualities of samples can lead to inconsistencies in data quality. For instance, when libraries are pooled for multiplex sequencing, inaccurate quantification leads to unbalanced sequence data, where under-quantified libraries may be over-sequenced and over-quantified libraries may be under-sequenced. As such, an accurate quantification of the number of sequenceable nucleic acid molecules in a library is an important step in the next-generation sequencing workflow.

[0003] Normalization, a process of equalizing the concentration of nucleic acid molecules in libraries, is important for ensuring optimal clustering and obtaining high-quality data. Current methods for library quantification include chip electrophoresis (e.g., Agilent Bioanalyzer), fluorometric methods for dsDNA (e.g., Qubit), and qPCR. In some embodiments, normalization involves the ligation of modified adapters, followed by enzymatic digestion, controlled release of library molecules from magnetic beads (Craig Betts and Glenn Fu. 2022); or utilizes the DNA binding capacity of magnetic beads to control for library concentration (Harris et al. 2010) (Makarov et al. 2021). It is believed that the adapters used in these methods may include a modification which protects the adapter against exonucleases that are incorporated in the workflow. It is also believed that the concentration of the protected adapter versus the normal adapter is calibrating. Makarov describes that magnetic beads are bound to complementary DNA fragments and hybridized to the beads via complementary biotinylated oligonucleotides which are in turn bound to streptavidin linked magnetic beads. Makarov describes that the concentration of normalized fragments are eluted from the bead. Makarov uses the binding capacity of the beads to calibrate the DNA concentration. It isdesirable to have methods of normalizing the concentration of nucleic acid molecules in a library without the use of modified adapters.BRIEF SUMMARY OF THE DISCLOSURE

[0004] The present disclosure is directed to the normalization of adapter ligated sequencing libraries for sequencing. The present disclosure also removes the need for qPCR quantification of sequencing libraries and simplifies sample library pooling. Applicant believes that removing the need for qPCR quantification reduces workflow time and simplifies library quality control.

[0005] Unlike prior art adapters, such as those utilized in other PCR free library normalization methods, the adapters utilized in the proposed workflow have no modifications. Instead, the normalization workflows of the present disclosure utilize predetermined concentrations of one or more normalization oligonucleotides (which, in some embodiments, hybridize to an unmodified adapter and effectively "protect" the adapter) which are introduced to the library of adapter ligated nucleic acid molecules to facilitate normalization. In some embodiments, the normalization oligonucleotides are 5' blocked oligonucleotides. In other embodiments, the normalization oligonucleotides which are coupled to or capable of coupling to a functionalized substrate. In yet other embodiments, the normalization oligonucleotides are release primers.

[0006] A first aspect of the present disclosure is a method of preparing a library including a normalized concentration of Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of Y-adapter ligated nucleic acid molecules; (b) hybridizing a predetermined concentration of normalization oligonucleotides to the initial concentration of the Y-adapter ligated nucleic acid molecules in the sample; and (c) normalizing the concentration of the Y-adapter ligated nucleic acid molecules in the sample based on the hybridization of the predetermined concentration of the normalization oligonucleotides to provide the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules.

[0007] In some embodiments, each normalization nucleotide is hybridized to a singlestranded region of a Y-adapter portion of the Y-adapter ligated nucleic acid molecules. In some embodiments, single-stranded region is a P7 region. In some embodiments, single-stranded region is a P5 region.

[0008] In some embodiments, the of Y-adapter ligated nucleic acid molecules are unamplified.

[0009] In some embodiments, the normalization oligonucleotides include 5' blocked oligonucleotides. In some embodiments, the 5' blocked oligonucleotides include one or more modifications which at least mitigate nuclease degradation. In some embodiments, the 5' blocked oligonucleotides include one or more phosphorothioate bonds. In some embodiments, the 5' blocked oligonucleotides include two or more phosphorothioate bonds. In some embodiments, the 5' blocked oligonucleotides include four or more phosphorothioate bonds. In some embodiments, the 5' blocked oligonucleotides include one or more 2'-modified nucleosides. In some embodiments, the one or more 2'-modification comprises a 2'O-Methyl group. In some embodiments, the 5' blocked oligonucleotides include one or more 2'-modified di deoxy nucl eoti des .

[0010] In some embodiments, the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises removing Y-adapter ligated nucleic acid molecules from the sample which are not hybridized to the normalization oligonucleotides. In some embodiments, the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises incubating the sample with an exonuclease; and removing at least singlestranded molecules from the sample following the incubation. In some embodiments, the exonuclease has 3' to 5' activity. In some embodiments, the exonuclease is exonuclease T.

[0011] In some embodiments, the predetermined concentration of normalization oligonucleotides are coupled to a functionalized substrate. In some embodiments, the predetermined concentration of normalization oligonucleotides are capable of being coupled to a functionalized substrate. In some embodiments, the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises removing Y-adapter ligated nucleic acid molecules from the sample which are not bound to a functionalized substrate. In some embodiments, the method further comprises releasing the Y-adapter ligated nucleic acid molecules from the functionalized substrate.

[0012] In some embodiments, the Y-adapter ligated nucleic acid molecules are amplified. In some embodiments, the method further comprises (i) hybridizing capture probes to the amplified Y-adapter ligated nucleic acid molecules in the sample; and (ii) extending the hybridized capture probes to provide a sample including complexes comprising a single strand of the Y-adapter ligated nucleic acid molecule hybridized to an extended capture probe; and wherein the predetermined concentration of normalization oligonucleotides is a predetermined concentration of release primers, and wherein the release primers are hybridized to the complexes comprising the single strand of the Y-adapter ligated nucleic acid molecule hybridized to the extended capture probe. In some embodiments, the normalization of theconcentration of the Y-adapter ligated nucleic acid molecules comprises (i) extending the hybridized release primers; and (ii) purifying the sample for released amplified Y-adapter ligated nucleic acid molecules.

[0013] In some embodiments, the Y-adapter of the Y-adapter ligated nucleic acid molecules does not include any modification to prevent exonuclease digestion. In some embodiments, the method further comprises sequencing the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules. In some embodiments, the sequencing comprises next-generation sequencing.

[0014] A second aspect of the present disclosure is a method of preparing a library including a normalized concentration of unamplified Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of unamplified Y-adapter ligated nucleic acid molecules; (b) hybridizing a predetermined concentration of 5' blocked oligonucleotides to the initial concentration of the unamplified Y-adapter ligated nucleic acid molecules in the sample; (c) introducing an exonuclease to the sample to digest unamplified Y-adapter ligated nucleic acid molecules that are not hybridized to the predetermined concentration of the 5' blocked oligonucleotides; and (d) removing single stranded molecules from the sample following digestion with the exonuclease. In some embodiments, the method further comprises removing unligated and / or partially ligated nucleic acid molecules from the sample.

[0015] In some embodiments, the 5' blocked oligonucleotide is substantially complementary to a P7 region of each Y-adapter ligated nucleic acid molecule in the sample. In some embodiments, the 5' blocked oligonucleotide is substantially complementary to a P5 region of each Y-adapter ligated nucleic acid molecule in the sample.

[0016] In some embodiments, the predetermined concentration ranges from between about 2 nM to about 20 nM. In some embodiments, the 5' blocked oligonucleotide comprises one or more modifications which limit nuclease degradation. In some embodiments, the one or more modifications comprises one or more phosphorothioate bonds. In some embodiments, the one or more modifications comprises one or more 2'-modified nucleosides. In some embodiments, the one or more modifications comprises one or more dideoxynucleotides.

[0017] In some embodiments, the exonuclease has 3' to 5' activity. In some embodiments, the exonuclease having 3' to 5' activity is exonuclease T.

[0018] In some embodiments, the method further comprises sequencing the library including the normalized concentration of unamplified Y-adapter ligated nucleic acid molecules.

[0019] A third aspect of the present disclosure is a method of preparing a library including a normalized concentration of Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of unamplified Y-adapter ligated nucleic acid molecules; (b) hybridizing a predetermined concentration of oligonucleotides to the initial concentration of Y-adapter ligated nucleic acid molecules in the sample, wherein the oligonucleotides are coupled to a functionalized substrate; (c) removing unhybridized Y-adapter ligated nucleic acid molecules from the sample; and (d) releasing bound Y-adapter ligated nucleic acid molecules from the substrate to provide the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules.

[0020] In some embodiments, the method further comprises removing unligated and / or partially ligated nucleic acid molecules from the sample. In some embodiments, the surface is a bead. In some embodiments, the oligonucleotide is substantially complementary to a P7 region of each Y-adapter ligated nucleic acid molecule in the sample. In some embodiments, the oligonucleotide is substantially complementary to a P5 region of each Y-adapter ligated nucleic acid molecule in the sample.

[0021] In some embodiments, the predetermined concentration ranges from between about 2 nM to about 20 nM. In some embodiments, the method further comprises sequencing the library including the normalized concentration of unamplified Y-adapter ligated nucleic acid molecules.

[0022] A fourth aspect of the present disclosure is a method of preparing a library including a normalized concentration of amplified Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of amplified Y-adapter ligated nucleic acid molecules; (b) hybridizing a capture probe to each of the amplified Y-adapter ligated nucleic acid molecules in the sample; (c) extending the hybridized capture probe of each of the amplified Y-adapter ligated nucleic acid molecules in the sample to provide a library including complexes which each comprise a single strand of the amplified Y-adapter ligated nucleic acid molecule hybridized to an extended capture probe; (d) hybridizing a predetermined concentration of release primers to the complexes comprising the single strand of the amplified Y-adapter ligated nucleic acid molecule hybridized to the extended capture probe; (e) extending each of the hybridized release primers; and (f) purifying the library for released amplified Y-adapter ligated nucleic acid molecules to provide the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules. In some embodiments, the capture probe is substantially complementary to aP7 region of each amplified Y-adapter ligated nucleic acid molecule in the sample. In some embodiments, thecapture probe is substantially complementary to a P5 region of each amplified Y-adapter ligated nucleic acid molecule in the sample.

[0023] In some embodiments, each of the capture probes hybridize to a portion of an adapter region of the amplified Y-adapter ligated target nucleic acid molecules in the sample which is downstream from a 5' terminal end of the amplified Y-adapter ligated target nucleic acid molecule. In some embodiments, each of the capture probes are capable of binding to a functionalized substrate. In some embodiments, each of the capture probes include biotin. In some embodiments, each of the hybridized capture probes are extended using a polymerase.

[0024] In some embodiments, the method further comprises removing capture probes which are not hybridized to the amplified Y-adapter ligated nucleic acid molecules in the sample. In some embodiments, the predetermined concentration of the release primer ranges from between about 2 nM to about 20 nM. In some embodiments, each hybridized release primer is extended using a polymerase having strand displacement activity. In some embodiments, the method further comprises sequencing the library including the normalized concentration of amplified Y-adapter ligated nucleic acid molecules.

[0025] A kit comprising a 5' blocked oligonucleotide; and an exonuclease. In some embodiments, the 5' blocked oligonucleotides include one or more phosphorothioate bonds. In some embodiments, the 5' blocked oligonucleotides include one or more 2'-modified nucleosides. In some embodiments, the one or more 2'-modification comprises a 2'O-Methyl group. In some embodiments, the 5' blocked oligonucleotides include one or more 2'-modified dideoxynucleotides. In some embodiments, the exonuclease has 3' to 5' activity. In some embodiments, the exonuclease having the 3' to 5' activity is exonuclease T.BRIEF DESCRIPTION OF THE FIGURES

[0026] For a general understanding of the features of the disclosure, reference is made to the drawings. In the drawings, like reference numerals have been used throughout to identify identical elements.

[0027] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0028] FIG. 1 provides for an overview of the normalization methods of the present disclosure.

[0029] FIG. 2A provides an overview of a method of normalizing the concentrations of unamplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure.

[0030] FIG. 2B provides an overview of a method of normalizing the concentrations of unamplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure, where the method utilizes a predetermined concentration of 5' blocking oligonucleotides to protect the unamplified adapter ligated nucleic acid molecules in the library.

[0031] FIG. 2C provides an overview of a method of normalizing the concentrations of unamplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure, where the method utilizes a predetermined concentration of normalization oligonucleotides coupled to or capable of being coupled to a functionalized surface to normalize the concentration of amplified adapter ligated nucleic acid molecules in the library.

[0032] FIG. 3 illustrates a method of normalizing the concentrations of unamplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure, where the method utilizes a predetermined concentration of 5' blocking oligonucleotides (e.g., those including one or more dideoxynucleotides) to protect the unamplified adapter ligated nucleic acid molecules in the library.

[0033] FIG. 4 provides an overview of a method of normalizing the concentrations of amplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure, where the method utilizes a predetermined concentration of release primers to normalize the concentration of amplified adapter ligated nucleic acid molecules in the library.

[0034] FIG. 5 illustrates a method of normalizing the concentrations of amplified adapter ligated nucleic acid molecules in a library in accordance with one embodiment of the present disclosure, where the method utilizes a predetermined concentration of release primers to normalize the concentration of amplified adapter ligated nucleic acid molecules in the library.DETAILED DESCRIPTION

[0035] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0036] As used herein, the singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The term "includes" is defined inclusively, such that "includes A or B" means including A, B, or A and B.

[0037] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0038] The terms "comprising," "including," "having," and the like are used interchangeably and have the same meaning. Similarly, "comprises," "includes," "has," and the like are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the common United States patent law definition of "comprising" and is therefore interpreted to be an open term meaning "at least the following," and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, "a device having components a, b, and c" means that the device includes at least components a, b, and c. Similarly, the phrase: "a method involving steps a, b, and c" means that the methodincludes at least steps a, b, and c. Moreover, while the steps and processes may be outlined herein in a particular order, the skilled artisan will recognize that the ordering steps and processes may vary.

[0039] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0040] As used herein, the term "about" refers to a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In some embodiments, the term "about" means within a standard deviation using measurements generally acceptable in the art. In some embodiments, about means a range extending to + / — 10% of the specified value.

[0041] As used herein, the terms "P5" and "P7" refer to amplification primers, e.g., universal primer extension primers. It will be understood that any suitable amplification primers can be used in the methods presented herein . Uses of amplification primers such as P5 and P7 are known in the art, as exemplified by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957. For example, any suitable forward amplification primer, whether immobilized or in solution, can be useful in the methods presented herein for hybridization to a complementary sequence and amplification of a sequence. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be useful in the methods presented herein for hybridization to a complementary sequence and amplification of a sequence. One of skill in the art willunderstand how to design and use primer sequences that are suitable for capture, and amplification of nucleic acids as presented herein.

[0042] As used herein, the term "adapter" refers to a nucleotide sequence that may be added to another sequence to import additional properties to that sequence. An adapter can be single- or double-stranded or may have both a single-stranded portion and a double-stranded portion. The ligation of an adapter to a target polynucleotide or a target polynucleotide strand of interest enables the generation of amplification-ready products of the target polynucleotide or the target polynucleotide strand of interest. The target polynucleotide molecules may be fragmented or not prior to the addition of adaptors. In some embodiments, the adapter is substantially non-complementary to the 3' end or the 5' end of any target sequence present in the sample. In some embodiments, suitable adapter lengths are in the range of about 10 - 100 nucleotides, about 12 - 60 nucleotides and about 15 - 50 nucleotides in length. Generally, the adapter can include any combination of nucleotides and / or nucleic acids. In some embodiments, the adapter can include one or more cleavable groups at one or more locations. In another aspect, the adapter can include a sequence that is substantially identical, or substantially complementary, to at least a portion of a primer, for example a universal primer. In some embodiments, the adapter can include a barcode or tag to assist with downstream error correction, identification or sequencing.

[0043] As used herein "amplification" refers to a process in which a copy number increases. Amplification may be a process in which replication occurs repeatedly over time to form multiple copies of a template. Amplification can produce an exponential or linear increase in the number of copies as amplification proceeds. Exemplary amplification strategies include polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), rolling circle replication (RCA), cascade-RCA, nucleic acid-based amplification (NASBA), and the like. Also, amplification can utilize a linear or circular template. Amplification can be performed under any suitable temperature conditions, such as with thermal cycling or isothermally. Furthermore, amplification can be performed in an amplification mixture (or reagent mixture), which is any composition capable of amplifying a nucleic acid target, if any, in the mixture. PCR amplification relies on repeated cycles of heating and cooling (i.e., thermal cycling) to achieve successive rounds of replication. PCR can be performed by thermal cycling between two or more temperature setpoints, such as a higher denaturation temperature and a lower annealing / extension temperature, or among three or more temperature setpoints, such as a higher denaturation temperature, a lower annealing temperature, and an intermediateextension temperature, among others. PCR can be performed with a thermostable polymerase, such as Taq DNA polymerase. PCR produces an exponential increase in the amount of a product amplicon over successive cycles. PCR is described, for example, in U.S. Pat. No. 4,683,202; U.S. Pat. No. 4,683,195; U.S. Pat. No. 4,000,159; U.S. Pat. No. 4,965,188; U.S. Pat. No. 5,176,995), the disclosures of each are hereby incorporated by reference herein in their entirety.

[0044] As used herein, the term "biological sample," "tissue sample," "specimen" or the like refers to any sample including a biomolecule (such as a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof) that is obtained from any organism including viruses. Other examples of organisms include mammals (such as humans; veterinary animals like cats, dogs, horses, cattle, and swine; and laboratory animals like mice, rats, and primates), insects, annelids, arachnids, marsupials, reptiles, amphibians, bacteria, and fungi. Biological samples include tissue samples (such as tissue sections and needle biopsies of tissue), cell samples (such as cytological smears such as Pap smears or blood smears or samples of cells obtained by microdissection), or cell fractions, fragments, or organelles (such as obtained by lysing cells and separating their components by centrifugation or otherwise). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied tissue (for example, obtained by a surgical biopsy or a needle biopsy), nipple aspirates, cerumen, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. In certain embodiments, the term "biological sample" as used herein refers to a sample (such as a homogenized or liquefied sample) prepared from a tumor or a portion thereof obtained from a subject.

[0045] As used herein, the terms "blocking oligonucleotide" or "blocked oligonucleotide" refer to an oligonucleotide that is complementary and capable of stably binding to a region of a nucleic acid molecule or to a portion of an adapter ligated to a nucleic acid molecule. In some embodiments, a blocking oligonucleotide or blocked oligonucleotide contains one or more modified nucleotides that increase the binding between the oligonucleotide and the region of the nucleic acid molecule, or the adapter ligated to the nucleic acid molecule compared to an oligonucleotide with the same sequence but without any modified nucleotides.

[0046] As used herein, the term "end" or "ends" refer to the regions of sequence at (or proximal to) either end of a nucleic acid sequence. As used herein, the term "3' region" refersto a region of a nucleotide strand that includes the 3' end of the strand. As used herein, the term "3' end" designates the end of a nucleotide strand that has the hydroxyl group of the third carbon in the sugar-ring of the deoxyribose at its terminus. As used herein, the term "5' region" refers to a region of a nucleotide strand that includes the 5' end of the strand. As used herein, the term "5' end" designates the end of a nucleotide strand that has the fifth carbon in the sugar- ring of the deoxyribose at its terminus.

[0047] As used herein, a "library" refers to a collection of nucleic acids. A library can contain one or more fragments of nucleic acid molecules. In some embodiments, the fragments are amplified nucleic acid molecules. In other embodiments, the fragments are nucleic acid molecules that are not amplified. In some embodiments, the fragments are target nucleic acid molecules. In some embodiments, a library may include a nucleic acid molecule that has one or more known oligonucleotide sequence(s) added to the 3' end, the 5' end, or both the 3' and 5' end (e.g., adapters, y-adapters, etc.). In some embodiments, the library may be prepared so that the fragments can contain a known oligonucleotide sequence that identifies the source of the library (e.g., a molecular identification barcode identifying a patient or DNA source).

[0048] As used herein, the term "ligation" refers to a condensation reaction joining two nucleic acid strands wherein a 5 '-phosphate group of one molecule reacts with the 3 '-hydroxyl group of another molecule. Ligation is typically an enzymatic reaction catalyzed by a ligase or a topoisomerase. Ligation may join two single strands to create one single-stranded molecule. Ligation may also join two strands each belonging to a double-stranded molecule thus joining two double-stranded molecules. Ligation may also join both strands of a doublestranded molecule to both strands of another double-stranded molecule thus joining two double-stranded molecules. Ligation may also join two ends of a strand within a doublestranded molecule thus repairing a nick in the double-stranded molecule.

[0049] As used herein, the term "nanopore" refers to a pore, channel, or passage formed or otherwise provided in a membrane or other barrier material that has a characteristic width or diameter of about 0.1 nm to about 1000 nm. A nanopore can be made of a naturally occurring pore-forming protein, such as a-hemolysin from S. aureus, or a mutant or variant of a wildtype pore-forming protein, either non-naturally occurring (i.e., engineered) such as a-HL-C46, or naturally occurring. A membrane may be an organic membrane, such as a lipid bilayer, or a synthetic membrane made of a non-naturally occurring polymeric material. The nanopore may be disposed adjacent or in proximity to a sensor, a sensing circuit, or an electrode coupledto a sensing circuit, such as, for example, a complementary metal-oxide semiconductor (CMOS) or field effect transistor (FET) circuit.

[0050] As used herein, the terms "nucleic acid" or "nucleic acid molecule" as used herein, refer to a high-molecular-weight biochemical macromolecule composed of nucleotide chains that convey genetic information. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The monomers from which nucleic acids are constructed are called nucleotides. Each nucleotide consists of three components: a nitrogenous heterocyclic base, either a purine or a pyrimidine (also known as a nucleobase); and a pentose sugar. Different nucleic acid types differ in the structure of the sugar in their nucleotides; DNA contains 2-deoxyribose while RNA contains ribose.

[0051] As used herein, the term "next generation sequencing" refers to sequencing technologies having high-throughput sequencing as compared to traditional Sanger- and capillary electrophoresis-based approaches, wherein the sequencing process is performed in parallel, for example producing thousands or millions of relatively small sequence reads at a time. Some examples of next generation sequencing techniques include, but are not limited to, sequencing by synthesis, sequencing by ligation, and sequencing by hybridization. These technologies produce shorter reads (anywhere from about 25 - about 500 bp) but many hundreds of thousands or millions of reads in a relatively short time. Examples of such sequencing devices available from Illumina (San Diego, CA) include, but are not limited to iSEQ, MiniSEQ, MiSEQ, NextSEQ, NoveSEQ.

[0052] It is believed that the Illumina next-generation sequencing technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid sequencing. The process simultaneously identifies DNA bases while incorporating them into a nucleic acid chain. Each base emits a unique fluorescent signal as it is added to the growing strand, which is used to determine the order of the DNA sequence. A non-limiting example of a sequencing device available from ThermoFisher Scientific (Waltham, MA) includes the Ion Personal Genome Machine™ (PGM™) System.

[0053] It is believed that Ion Torrent sequencing measures the direct release of H+ (protons) from the incorporation of individual bases by DNA polymerase. A non-limiting example of a sequencing device available from Pacific Biosciences (Menlo Park, CA) includes the PacBio Sequel Systems. A non-limiting example of a sequencing device available from Roche (Pleasanton, CA) is the Roche 454. Next-generation sequencing methods may also include nanopore sequencing methods. In general, three nanopore sequencing approaches have been pursued: strand sequencing in which the bases of DNA are identified as they passsequentially through a nanopore, exonuclease-based nanopore sequencing in which nucleotides are enzymatically cleaved one-by-one from a DNA molecule and monitored as they are captured by and pass through the nanopore, and a nanopore sequencing by synthesis (SBS) approach in which identifiable polymer tags are attached to nucleotides and registered in nanopores during enzyme-catalyzed DNA synthesis. Common to all these methods is the need for precise control of the reaction rates so that each base is determined in order.

[0054] Strand sequencing requires a method for slowing down the passage of the DNA through the nanopore and decoding a plurality of bases within the channel; ratcheting approaches, taking advantage of molecular motors, have been developed for this purpose. Exonuclease-based sequencing requires the release of each nucleotide close enough to the pore to guarantee its capture and its transit through the pore at a rate slow enough to obtain a valid ionic current signal. In addition, both methods rely on distinctions among the four natural bases, two relatively similar purines and two similar pyrimidines.

[0055] The nanopore SBS approach utilizes synthetic polymer tags attached to the nucleotides that are designed specifically to produce unique and readily distinguishable ionic current blockade signatures for sequence determination. In some embodiments, sequencing of nucleic acid molecules includes via nanopore sequencing includes preparing nanopore sequencing complexes and determining polynucleotide sequences. Methods of preparing nanopores and nanopore sequencing are described in U.S. Patent Application Publication No. 2017 / 0268052, and PCT Publication Nos. WO2014 / 074727, W02006 / 028508, WO2012 / 083249, and WO / 2014 / 074727, the disclosures of which are hereby incorporated by reference herein in their entireties. In some embodiments, tagged nucleotides may be used in the determination of the polynucleotide sequences (see, e.g., PCT Publication No. WO / 2020 / 131759, WO / 2013 / 191793, and WO / 2015 / 148402, the disclosures of which are hereby incorporated by reference herein in their entireties).

[0056] Analysis of the data generated by sequencing is performed using software and / or statistical algorithms that perform various data conversions, e.g., conversion of signal emissions into base calls, conversion of base calls into consensus sequences for a nucleic acid template, etc. Such software, statistical algorithms, and the use of such are described in detail, in U.S. Patent Application Publication Nos. 2009 / 0024331 2017 / 0044606 and in PCT Publication No. WO / 2018 / 034745, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0057] As used herein, the term "nucleotide" refers to a nucleoside-5'-oligophosphate compound, or structural analog of a nucleoside-5 '-oligophosphate, which can act as a substrate or inhibitor of a nucleic acid polymerase. Exemplary nucleotides include, but are not limited to, nucleoside-5 '-triphosphates (e.g., dATP, dCTP, dGTP, dTTP, and dUTP); nucleosides (e.g., dA, dC, dG, dT, and dU) with 5 '-oligophosphate chains of 4 or more phosphates in length (e.g., 5'-tetraphosphosphate, 5'-pentaphosphosphate, 5'-hexaphosphosphate, 5'-heptaphosphosphate, 5'-octaphosphosphate); and structural analogs of nucleoside-5 '-triphosphates that can have a modified base moiety (e.g., a substituted purine or pyrimidine base), a modified sugar moiety (e.g., an O-alkylated sugar), and / or a modified oligophosphate moiety (e.g., an oligophosphate comprising a thio-phosphate, a methylene, and / or other bridges between phosphates).

[0058] As used herein, the "polymerase" as used herein, refers to an enzyme that catalyzes the process of replication of nucleic acids. More specifically, DNA polymerase catalyzes the polymerization of deoxyribonucleotides alongside a DNA strand, which the DNA polymerase "reads" and uses as a template. The newly polymerized molecule is complementary to the template strand and identical to the template's partner strand.

[0059] As used herein, the term "sequence," when used in reference to a nucleic acid molecule, refers to the order of nucleotides (or bases) in the nucleic acid molecules. In cases, where different species of nucleotides are present in the nucleic acid molecule, the sequence includes an identification of the species of nucleotide (or base) at respective positions in the nucleic acid molecule. A sequence is a property of all or part of a nucleic acid molecule. The term can be used similarly to describe the order and positional identity of monomeric units in other polymers such as amino acid monomeric units of protein polymers.

[0060] As used herein, the term "sequence complementarity" refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.

[0061] As used herein, the term "sequencing" refers to the determination of the order and position of bases in a nucleic acid molecule. More particularly, the term "sequencing" refers to biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. Sequencing, as the term is used herein, can include without limitation parallel sequencing or any other sequencing method known of those skilled in the art, for example, chain-termination methods, rapid DNA sequencing methods, wandering-spot analysis, Maxam-Gilbert sequencing, dye- terminator sequencing, or using any other modern automated DNA sequencing instruments.OVERVIEW

[0062] The present disclosure provides methods of preparing normalized nucleic acid libraries for sequencing. In particular, the present disclosure is directed to a workflow which employs the use of a predetermined concentration of one or more normalization oligonucleotides designed to anneal to adapter ligated nucleic acid molecules within a library. In some embodiments, the normalization oligonucleotides are 5' blocked oligonucleotides. In other embodiments, the normalization oligonucleotides are coupled to or capable of coupling to a functionalized substrate. In yet other embodiments, the normalization oligonucleotides are release primers.

[0063] The workflows of the present disclosure do not require the use of or incorporation of any specific or modified adapters. Additionally, the workflows of the present disclosure do not require the use of quantitative PCR to determine a concentration of the nucleic acid molecules within the library. Additionally, the presently disclosed methods utilize capture and release primers to release library molecules from surfaces, such as bead.NORMALIZATION OF ADAPTER LIGATED NUCLEIC ACID MOLECULES

[0064] With reference to FIG. 1, a library of Y-adapter ligated nucleic acid molecules is obtained (step 100). In some embodiments, the Y-adapter ligated nucleic acid molecules are unamplified in the library of nucleic acid molecules. In other embodiments, the Y-adapter ligated nucleic acid molecules are amplified in the library of nucleic acid molecules (and, therefore, no longer have the shape or conformation of a Y-adapter).

[0065] After a library including Y-adapter ligated nucleic acid molecules is obtained, the library is normalized. In some embodiments, the library is normalized to a predetermined concentration of an introduced normalization oligonucleotide (step 110). After removal of unwanted reagents and side products, the normalized library of adapter ligated nucleic acid molecules is then sequenced (e.g., using a whole genome sequencing technique) (step 120). In some embodiments, multiple different libraries are each independently normalized, pooled, and then sequenced.

[0066] Normalization of Libraries Including Unamplified Y-Adapter Ligated Nucleic Acid Molecules

[0067] Some aspects of the present disclosure are directed to the normalization of libraries which include unamplified adapter ligated nucleic acid molecules. The methods of this particular aspect of the present disclosure requires that the adapter ligated nucleic acidmolecules be unamplified, thus retaining their Y-shape or conformation. The normalization of the unamplified adapter ligated nucleic acid molecules occurs without the need to perform qPCR; and does not require the ligation of any special or modified adapters.

[0068] Preparation or Obtaining of a Library of Unamplified Y-Adapter Ligated Nucleic Acid molecules

[0069] In these embodiments, a first step includes preparing or obtaining a library of adapter ligated nucleic acid molecules (FIGS. 2A - 2C step 200). Methods of preparing a library of unamplified adapter ligated nucleic acid molecules are described further herein.

[0070] Removal o f Unligated or Partially Ligated Insert Molecules

[0071] Next, any unligated and / or partially ligated library insert molecules are removed from the library of unamplified adapter ligated nucleic acid molecules (see step 210 of FIGS. 2A - 2C; see also panels "a" and "b" of FIG. 3). In some embodiments, an exonuclease is introduced to the library to effectuate the removal of the unligated and / or partially ligated library insert molecules. In some embodiments, the exonuclease is one that requires double stranded nucleic acid molecules as a substrate. In some embodiments, the exonuclease may comprise activity for double-stranded DNA without nicking. In some embodiments, the exonuclease has 5' to 3' exonuclease activity. An exonuclease that has "5' exonuclease activity" is an exonuclease that digests DNA in a 5' to 3' direction. In some embodiments, the exonuclease is a T7 exonuclease.

[0072] Following the introduction of the exonuclease to the sample and subsequent "clean-up," the library will include fully adapter ligated nucleic acid molecules (see panel "c" of FIG. 3). In some embodiments, small molecules and / or fragments are removed from the library using magnetic bead purification (see panel "b" of FIG. 3). In other embodiments, small molecules and / or fragments are removed from the library using a solid-phase support reversible immobilization (SPRI) separation and purification method. In yet other embodiments, small molecules and / or fragments are removed from the library using one or more of electrophoresis, size exclusion chromatography, and / or spin column purification would be another suitable method.

[0073] Hybridization of Normalization Oligonucleotides

[0074] Subsequent to the removal of any unligated or partially ligated insert molecules, a predetermined concentration of a normalization oligonucleotide is introduced to the library (see, FIG. 2A at step 210; see panel "c" of FIG. 3). In some embodiments, the normalization oligonucleotide is at least partially complementary to and capable of stably binding to a 3' single stranded region of the Y-adapter of the adapter ligated nucleic acid molecules in thelibrary. In some embodiments, the normalization oligonucleotide is fully complementary to a single-stranded region of a Y-adapter. In other embodiments, the normalization oligonucleotide has less than 100% complementarity to a single stranded- stranded region of a Y-adapter, such as less than 95% complementarity, such as less than 90% complementarity, such as less than 85% complementarity, etc.

[0075] In some embodiments, the normalization oligonucleotide is substantially complementary to a P7 region of a Y-adapter ligated to a nucleic acid molecule (such as 100% complementary, such as at least 95% complementary, such as at least 90% complementary, such as at least 80% complementary, such as at least 80% complementary, etc.).

[0076] In some embodiments, the predetermined concentration of the introduced normalization oligonucleotide ranges from between about 2 nM to about 20 nM. In other embodiments, the predetermined concentration of the introduced normalization oligonucleotide ranges from between about 4 nM to about 16 nM. In yet other embodiments, the predetermined concentration of the introduced normalization oligonucleotide ranges from between about 6 nM to about 12 nM. In some embodiments, the predetermined concentration of the normalization oligonucleotide is less than the concentration of unamplified adapter ligated nucleic acid molecules in the prepared or obtained library.

[0077] In some embodiments, the normalization oligonucleotide is a 5' blocked oligonucleotide (see FIG. 2B, step 221). In some embodiments, the 5' blocked oligonucleotide includes one or more modifications which limit nuclease degradation, such as exonuclease degradation. In some embodiments, the 5' blocked oligonucleotide includes one or more phosphorothioate bonds. A phosphorothioate bond is a phosphodiester linkage where one of the two non-bridging oxygens has been replaced by a sulfur. In some embodiments, the 5' blocked oligonucleotide includes at least two phosphorothioate bonds. In other embodiments, the 5' blocked oligonucleotide includes at least three phosphorothioate bonds. In other embodiments, the 5' blocked oligonucleotide includes at least four phosphorothioate bonds. In other embodiments, the 5' blocked oligonucleotide includes at least five phosphorothioate bonds.

[0078] In some embodiments, the 5' blocked oligonucleotide includes one or more 2'- modified nucleosides. In other embodiments, the 5' blocked oligonucleotide includes one or more 2'-O-Methyl groups. In yet other embodiments, the 5' blocked oligonucleotide includes a single 2'-modified nucleoside.

[0079] In some embodiments, the 5' blocked oligonucleotide includes one or more dideoxynucleotides. An example of a 5' blocked oligonucleotide including one or moredideoxynucleotides is set forth in SEQ ID NO: 1, where the represents a dideoxynucleotides. G*G*G*GCAAGCAGAAGACGGCATACGAG (SEQ ID NO: 1).

[0080] In some embodiments, the introduction and subsequent hybridization of the predetermined concentration of the 5' blocked oligonucleotide to the unamplified adapter ligated nucleic acid molecules library provides for one or more protected adapter ligated nucleic acid molecules in the library. In particular, the hybridization of the predetermined concentration of the 5' blocked oligonucleotide to the library results in the formation of a double stranded end at a terminus of a single-stranded region of the Y-adapter of an unamplified adapter ligated nucleic acid molecule in the library, which may protect the adapter ligated nucleic acid molecule from digestion with an exonuclease (the introduction of an exonuclease is described further herein). As used herein, the phrase "protect from digestion with an exonuclease" refers to an inhibition of exonuclease activity on the protected Y-adapter (which includes the annealed normalization oligonucleotide) relative to the action of the exonuclease on an unprotected Y-adapter.

[0081] In other embodiments, the normalization oligonucleotide includes a first reactive moiety which is capable of reacting with, associating with, or binding to (collectively referred to "reacting with") a second reactive moiety, such as a second reactive moiety present on a functionalized substrate (e.g., a head) (see step 222 of FIG. 2C). In some embodiments, a predetermined concentration of the normalization oligonucleotide including the first reactive moiety hybridizes to a portion of the Y-adapter of an adapter ligated nucleic acid molecule in the library. In some embodiments, the normalization oligonucleotides including the first reactive moiety are hybridized to the unamplified adapter ligated nucleic acid molecules in the library, and then a functionalized substate (including the second reactive moiety) is introduced to the library such that the hybridized normalization oligonucleotide reacts with the functionalized substrate. In other embodiments, the normalization oligonucleotides including the first reactive moiety are pre-bound to a functionalized substrate, and then the complex including the normalization oligonucleotide - functionalized substrate is hybridized to the unamplified adapter ligated nucleic acid molecules in the library.

[0082] In some embodiments, the first and second reactive moieties are pairs of affinity labels. For example, and in some embodiments, the first reactive moiety may include biotin to bind to a second reactive moiety of a functionalized substrate including avidin or streptavidin. In some embodiments, the first reactive moiety includes immobilized antibodies, which may be used to bind to a second reactive moiety of a functionalized substrate including or conjugated to specific antigenic molecules. In some embodiments, the first reactive moietyincludes an antigenic molecule which may be used to bind to a second reactive moiety of a functionalized substrate, where the second moiety includes immobilized antibodies. In some embodiments, the first reactive moiety includes enzymes, which may be used to bind to a second reactive moiety of a functionalized substrate including or conjugated to specific enzyme substrates. In some embodiments, the first reactive moiety includes a substrate for an enzyme, which may be used to bind to a second reactive moiety of a functionalized substrate, where the second moiety includes an enzyme. In some embodiments, the first reactive moiety includes receptors, which may be used to bind to a second reactive moiety of a functionalized substrate including or conjugated to specific receptor ligands. In some embodiments, the first reactive moiety includes one or more receptor ligands, which may be used to bind to a second reactive moiety of a functionalized substrate, where the second reactive moiety includes receptors. In some embodiments, the first reactive moiety includes lectins, which may be used to bind to a second reactive moiety of a functionalized substrate including or conjugated to specific polysaccharides. In some embodiments, the first reactive moiety includes one or more polysaccharides, which may be used to bind to a second reactive moiety of a functionalized substrate, where the second reactive moiety includes or is conjugated to one or more lectins. In other embodiments, the first and second reactive moieties are reactive functional groups.

[0083] Removal of Adapter Ligated Nucleic Acid Molecules from the Library Not Hybridized to a Normalization Oligonucleotide

[0084] Subsequent to the hybridization of the predetermined concentration of the normalization oligonucleotide to the adapter ligated nucleic acid molecules, those adapters that are not bound to a normalization oligonucleotide are removed from the library (see step 230 of FIG. 2A).

[0085] Embodiments Using a 5' Blocking Oligonucleotide

[0086] In those embodiments where the adapter ligated nucleic acid molecules are protected via the hybridization of a 5' blocking oligonucleotide, an exonuclease having 3' to 5' activity is introduced to the library to digest those unprotected adapter ligated nucleic acid molecules in the library, i.e., those that are not bound to a 5' blocking oligonucleotide (see step 231 of FIG. 2B; see also panel "d" of FIG. 3). An exonuclease having 3' to 5' activity is an exonuclease that digests a nucleic acid molecule or a portion thereof in a 3' to 5' direction. In some embodiments, the exonuclease having 3' to 5' activity is exonuclease I. In some embodiments, the exonuclease having 3' to 5' activity is exonuclease T.

[0087] Following the introduction of the exonuclease, single stranded molecules remaining after exonuclease degradation are removed from the library (see step 232 of FIG.2B). The skilled artisan will appreciate that after the introduction of the exonuclease having the 3' to 5' activity and the removal of single stranded molecules, the concentration of unamplified adapter ligated nucleic acid molecules in the library will be normalized to the predetermined concentration of the 5' blocking oligonucleotides.

[0088] Following normalization, the normalized library may be sequenced (see FIG. 2B, step 240; see also panels "e" and "f" of FIG. 3).

[0089] Embodiments Where Unamplified Adapter Ligated Nucleic Acid Molecules areCoupled to a Functionalized Substrate

[0090] In those embodiments where the adapter ligated nucleic acid molecules are coupled to a functionalized substrate, the unamplified adapter ligated nucleic acid molecules that are not bound to a functionalized substrate may be removed from the library (see FIG. 2C, step 233). The skilled artisan will appreciate that after the removal of the unbound unamplified adapter ligated nucleic acid molecules from the library, the concentration of unamplified adapter ligated nucleic acid molecules in the library will be normalized to the predetermined concentration of the normalizing oligonucleotide including the first reactive group.

[0091] In some embodiments, the unbound unamplified adapter ligated nucleic acid molecules may be removed by washing with a buffer or other wash solution. Non-liming examples of buffers include citric acid, potassium dihydrogen phosphate, boric acid, diethyl barbituric acid, piperazine-N,N'-bis(2-ethanesulfonic acid), dimethylarsinic acid, 2-(N- morpholino)ethanesulfonic acid, tris(hydroxymethyl)methylamine (TRIS), 2-(N- morpholino)ethanesulfonic acid (TAPS), N,N-bis(2-hydroxyethyl)glycine(Bicine), N- tris(hydroxymethyl)methylglycine (Tri cine), 4-2-hydroxy ethyl- 1 -piperazineethanesulfonic acid (HEPES), 2-{[tris(hydroxymethyl)methyl]amino}ethanesulfonic acid (TES), and combinations thereof. In other embodiments, the buffer may be comprised of tris(hydroxymethyl)methylamine (TRIS), 2-(N-morpholino)ethanesulfonic acid (TAPS), N,N- bis(2-hydroxyethyl)glycine(Bicine), N -tris(hydroxymethyl)methylglycine (Tricine), 4-2- hydroxy ethyl- 1 -piperazineethanesulfonic acid (HEPES), 2-{[tris(hydroxymethyl)methyl]amino}ethanesulfonic acid (TES), or a combination thereof.

[0092] The skilled artisan will appreciate that after washing, the adapter ligated nucleic acid molecules coupled to the functionalized substrate may be released from the substrate, such as by primer extension or by the denaturing of the adapter ligated nucleic acid molecules.

[0093] Following normalization, the normalized library may be sequenced (see FIG. 2B, step 240; see also panels "e" and "f1of FIG. 3).

[0094] Normalization of Libraries Including Amplified Y-Adapter LigatedNucleic Acid Molecules

[0095] Some aspects of the present disclosure are directed to the normalization of libraries which include amplified adapter ligated nucleic acid molecules. The methods of this particular embodiment of the present disclosure require that the adapter ligated nucleic acid molecules be amplified. The skilled artisan will appreciate that a Y-adapter that has been amplified will no longer have a "Y" shape or conformation following the amplification of an adapter ligated nucleic acid molecule including a Y-adapter. The normalization of the amplified adapter ligated nucleic acid molecules occurs without the need to perform qPCR; and does not require the ligation of any special or modified adapters.

[0096] Preparation or Obtaining of a Library of Amplified Y-Adapter Ligated Nucleic Acid Molecules

[0097] In some embodiments, a first step of normalizing a library including amplified Y-adapter ligated nucleic acid molecules comprises preparing or obtaining a library of adapter ligated nucleic acid molecules (FIG. 4, step 300). Methods of preparing a library of adapter ligated nucleic acid molecules are described further herein.

[0098] Hybridization of a Capture Probe to the Amplified Adapter Ligated Nucleic Acid Molecules

[0100] In some embodiments, a capture probe is introduced to the library of amplified adapter ligated nucleic acid molecules. In some embodiments, the amplified adapter ligated nucleic acid molecules are denatured, e.g., heat denatured, thereby permitting hybridization of the capture probes to the amplified adapter ligated nucleic acid molecules in the library (step 310 of FIG. 4; see also panels "a" and "b" of FIG. 5). In some embodiments, the hybridization of the capture probe to the adapter ligated nucleic acid molecules within the library of amplified adapter ligated nucleic acid molecules provides a library including capture probe hybridized - amplified adapter ligated nucleic acid molecules.

[0101] In some embodiments, the capture probe includes (i) a capture moiety; and (ii) a nucleic acid sequence which is at least partially complementary to and capable of stably binding to a portion of an adapter region of the amplified adapter ligated nucleic acid molecule. In some embodiments, the capture probe has a Tm ranging from about 65°C to about 75°C, such as between about 68°C to about 72°C.

[0102] In some embodiments, the capture probes hybridize to a portion of an adapter region of the amplified adapter ligated target nucleic acid molecule which is downstream from the 5' terminal end of the amplified adapter ligated target nucleic acid molecule. In someembodiments, the capture probes hybridize to a portion of an adapter region of the amplified adapter ligated target nucleic acid molecule which is at least 5 nucleotides, such as at least 10 nucleotides, such as at least 15 nucleotides, such as at least 20 nucleotides, downstream from the 5'-most nucleotide of the amplified adapter ligated target nucleic acid molecule.

[0103] In some embodiments, the capture probe hybridizes to a portion of a P5 region of an adapter. In other embodiments, the capture probe hybridizes to a portion of a P7 region of an adapter.

[0104] In some embodiments, the capture probes are capable of binding to a functionalized substrate through the capture moiety after hybridization of the capture probes to the adapter region of the amplified adapter ligated nucleic acid molecules in the library. In other embodiments, the capture probes are bound to a functionalized substrate through the capture moiety prior to hybridization, i.e. the capture probes are pre-bound to the functionalized substrate prior to their introduction to the library. For example, a capture probe including a biotin moiety may be bound to a streptavidin functionalized bead (see panel "b" of FIG. 5).

[0105] In some embodiments, the capture moiety the capture probe comprises a first moiety (e.g. a first reactive functional group) which is reactive with a second moiety (e.g. a second reactive functional group) of another entity (e.g. a second moiety conjugated to a functionalized substrate). In some embodiments, the first moiety is a first member of a pair of specific binding entities; and the second moiety is a second member of the same pair of specific binding entities. In some embodiments, a "reaction" between a first moiety and a second moiety may mean that a covalent linkage is formed between two reactive groups or two reactive functional groups of the two moi eties; or may mean that the two reactive groups or two reactive functional groups of the two moieties associate with each other, interact with each other, hybridize to each other, hydrogen bond with each other, etc. In some embodiments, the "reaction" thus includes binding events, such as the binding of a hapten with an anti-hapten antibody, or the binding of biotin with streptavidin. In some embodiments, each of the target capture primers includes the same capture moiety, e.g. biotin. In other embodiments, different subsets of target capture primers include different capture moieties.

[0106] In some embodiments, the capture moiety may include biotin to bind to a functionalized substrate including avidin or streptavidin. In other embodiments, the capture moiety may include a thiolated molecule to bind to a functionalized substrate which includes gold particles. In yet other embodiments, the capture moiety may include an amine-terminated molecule to bind to an NHS-activated substrate.

[0107] In some embodiments, the capture moiety includes immobilized antibodies, which may be used to bind to molecules including or conjugated to specific antigenic molecules, such as an antigenic molecule bound to a functionalized substrate. In other embodiments, the capture moiety includes an antigenic molecule which may be used to bind to an immobilized antibodies, such as an antibody bound to a functionalized substrate.

[0108] In some embodiments, the capture moiety includes enzymes, which may be used to bind to molecules including or conjugated to specific enzyme substrates. In other embodiments, the capture moiety includes a substrate for an enzyme, which may be used to bind to an enzyme, such as an enzyme coupled to a functionalized substrate.

[0109] In some embodiments, the capture moiety includes receptors, which may be used to bind to molecules including or conjugated to specific receptor ligands, such as a receptor ligand bound to a functionalized substrate. In other embodiments, the capture moiety includes one or more receptor ligands, which may be used to bind to molecules including receptors, such as receptors bound to a functionalized substrate.

[0110] In some embodiments, the capture moiety includes lectins, which may be used to bind to molecules including or conjugated to specific polysaccharides, such as a polysaccharide bound to a functionalized substrate. In other embodiments, the capture moiety includes one or more polysaccharides, which may be used to bind to molecules including or conjugated to one or more lectins, such as one or more lectins bound to a functionalized substrate.[OHl] In even further embodiments, the capture moiety includes one or more nucleic acid sequences which may be used to bind to molecules including or conjugated to complementary base sequences. In other embodiments, the capture moiety may include tethered DNA / RNA aptamers which may specifically bind to target analytes such as small molecules, peptides, proteins, cells.

[0112] Extension of the Hybridized Capture Probe

[0113] Following the hybridization of the capture probes to the amplified adapter ligated nucleic acid molecules in the library, the hybridized capture probe in each capture probe hybridized - amplified adapter ligated nucleic acid molecule is extended (see step 320 of FIG. 4). This results in the formation of double-stranded products, namely complexes including a single strand of the adapter ligated nucleic acid molecule hybridized to an extended capture probe (see panel "c" of FIG. 5)

[0114] In some embodiments, the one or more hybridized capture probes are extended through the use of a first polymerase. In some embodiments, the first polymerase used toextend the one or more hybridized target capture primers is the same as the second polymerase used to extend the one or more hybridized poison primers. In other embodiments, the first polymerase used to extend the one or more hybridized target capture primers is different than the second polymerase used to extend the one or more hybridized poison primers. Depending on the type of nucleic acid molecule being analyzed, the polymerase may be a DNA-dependent DNA polymerase ("DNA polymerase") or an RNA-dependent DNA polymerase ("reverse transcriptase"). Suitable polymerases are selected from a Taq or Taq-derived polymerase (e.g., KAPA 2G polymerase from KAPA BIO SYSTEMS); or a B-family DNA polymerase (e.g., KAPA HIFI polymerase from KAPA BIOSYSTEMS).

[0115] In some embodiments, the hybridization and extension processes (steps 310 and 320) are performed simultaneously. In other embodiments, the hybridization and extension processes (steps 310 and 320) are performed sequentially.

[0116] In some embodiments, the capture probe is extended to prevent or mitigate the reannealing (and / or daisy-chaining) of an unannealed strand of the amplified adapter ligated nucleic acid molecule. In some embodiments, the extension of the capture probe displaces any unannealed strands which have reannealed after heat denaturation.

[0117] Removal of Amplified Adapter Ligated Nucleic Acid Molecules from the LibraryNot Bound to a Functionalized Substrate

[0118] Following the extension of the capture probe hybridized - amplified adapter ligated nucleic acid molecules in the library, any amplified adapter ligated nucleic acid molecules (and any fragments thereof) in the library that are not bound to a functionalized substrate are removed from the library (see pane "d" of FIG. 5). Thus, after removal of the unbound amplified adapter ligated nucleic acid molecules, the library includes only the complex including the single strand of the adapter ligated nucleic acid molecule hybridized to the extended capture probe.

[0119] In some embodiments, the unbound amplified adapter ligated nucleic acid molecules may be removed by washing with a buffer or other wash solution. Non-liming examples of buffers include citric acid, potassium dihydrogen phosphate, boric acid, diethyl barbituric acid, piperazine-N,N'-bis(2-ethanesulfonic acid), dimethylarsinic acid, 2-(N- morpholino)ethanesulfonic acid, tris(hydroxymethyl)methylamine (TRIS), 2-(N- morpholino)ethanesulfonic acid (TAPS), N,N-bis(2-hydroxyethyl)glycine(Bicine), N- tris(hydroxymethyl)methylglycine (Tri cine), 4-2-hydroxy ethyl- 1 -piperazineethanesulfonic acid (HEPES), 2-{[tris(hydroxymethyl)methyl]amino}ethanesulfonic acid (TES), and combinations thereof. In other embodiments, the buffer may be comprised oftris(hydroxymethyl)methylamine (TRIS), 2-(N-morpholino)ethanesulfonic acid (TAPS), N,N- bis(2-hydroxyethyl)glycine(Bicine), N -tris(hydroxymethyl)methylglycine (Tricine), 4-2- hy droxy ethyl- 1 -piperazineethanesulfonic acid (HEPES), 2-{[tris(hydroxymethyl)methyl]amino}ethanesulfonic acid (TES), or a combination thereof.

[0120] Hybridization of a Normalization Oligonucleotide (Release Primer)

[0121] Following the removal of the unbound amplified adapter ligated nucleic acid molecules in the library, a predetermined concentration of a normalization oligonucleotide is introduced to the library and permitted to hybridize to the complex including the single strand of the adapter ligated nucleic acid molecule hybridized to the extended capture probe (see step 330 of FIG. 4; see also panel "d" of FIG. 5). In some embodiments, the normalization oligonucleotide is a release primer designed to hybridize to the single strand of the adapter ligated nucleic acid molecule upstream relative to the site of hybridization of the extended hybridized capture probe. In some embodiments, the release primer binds at least 2 bases upstream from the site of hybridization of the capture probe. In some embodiments, the release primer has a Tm ranging from about 50°C to about 60°C, such as at about 55°C.

[0122] In some embodiments, the predetermined concentration of the release primer ranges from between about 2 nM to about 20 nM. In other embodiments, the predetermined concentration of the introduced release primer ranges from between about 4 nM to about 16 nM. In yet other embodiments, the predetermined concentration of the introduced release primer ranges from between about 6 nM to about 12 nM. In some embodiments, the predetermined concentration of the release primer is less than the concentration of amplified adapter ligated nucleic acid molecules in the prepared or obtained library.

[0123] Extension of the Normalization Oligonucleotide (Release Primer)

[0124] Next, the hybridized release primer is extended using a second polymerase (see step 340 of FIG. 340; see also panel "e" of FIG. 5). In some embodiments, the extension of the hybridized release primer with the second polymerase liberates the extended hybridized capture probe from the complex including the single strand of the adapter ligated nucleic acid molecule hybridized to the extended capture probe. In some embodiments, the polymerase exhibits strand displacement activity. In some cases, the polymerase exhibits 5' - 3' exonuclease activity that digests a single strand of a double-stranded nucleic acid molecule (referred to herein as 5' - 3' double-stranded exonuclease activity) or double-stranded exonuclease activity. In some embodiments, the polymerase exhibits both strand displacement and 5' - 3' doublestranded exonuclease activity. In some embodiments, the strand displacement, 5' - 3' double-stranded exonuclease activity, or combination thereof, can displace a target nucleic acid molecule (e.g., original target nucleic acid molecule from a provided sample) into solution.

[0125] In some embodiments, following extension of the release primer, the library will include (i) released amplified adapter ligated nucleic acid molecules; and (ii) complexes bound to the functionalized substrate including the single strand of the adapter ligated nucleic acid molecule hybridized to the extended capture probe (see panel "e" of FIG. 5). Those complexes that are bound to a functionalized substrate are removed from the library, such as by washing (e.g., in those embodiments where the functionalized substrate is a bead, the bead may be removed from the library, leaving only the released amplified adapter ligated nucleic acid molecules) (see step 350 of FIG. 4).

[0126] The skilled artisan will appreciate that after the removal of the complexes bound to the functionalized substrate including the single strand of the adapter ligated nucleic acid molecule hybridized to the extended capture probe from the library, the concentration of amplified adapter ligated nucleic acid molecules in the library will be normalized to the predetermined concentration of the normalizing oligonucleotide, namely the predetermined concentration of the release primer.

[0127] Following normalization of the concentration of the amplified adapter ligated nucleic acid molecules within the library, the normalized library may be sequenced (step 360 of FIG. 4).

[0128] METHODS OF PREPARING A NUCLEIC ACID LIBRARY INCLUDING Y-ADAPTER LIGATED NUCLEIC ACID MOLECULES PRIOR TO NORMALIZATION

[0129] Aspects of the present disclosure include a method for preparing a sequencing library which may be normalized according to any of the methods described herein. In some embodiments, the method comprises: (i) obtaining a sample including one or more nucleic acid molecules (such as one or more target nucleic acid molecules and one or more non-target nucleic acid molecules), (ii) ligating a Y-adapter to the one or more nucleic acid molecules within the obtained sample, (iii) optionally amplifying the one or more adapter ligated nucleic acid molecules to provide an amplified sample, and (iv) optionally enriching the amplified sample for one or more adapter ligated target nucleic acid molecules.

[0130] Sample Preparation

[0131] In some embodiments, a sample comprising one or more nucleic acid molecules is obtained and prepared for downstream processing. In some embodiments, samples may be obtained from any source including a target nucleic acid molecule having one or more modifiednucleotides, e.g., tissue (including tumor tissue or formalin-fixed paraffin-embedded (FFPE) tissue), blood, skin, swab (e.g., buccal, vaginal), urine, saliva, etc. In some embodiments, the sample is derived from a subject or a patient, such as a subject or a patient diagnosed with a disease or suspected of having a disease. In some embodiments, the sample may include a fragment of a solid tissue, or a tumor sample derived from the subject or the patient, e.g., by biopsy. As used herein, the term "tumor sample" encompasses samples prepared from a tumor or from a sample potentially including or suspected of comprising cancer cells, or to be tested for the potential presence of cancer cells, such as a lymph node. As used herein, the term "tumor" refers to a mass or a neoplasm, which itself is defined as an abnormal new growth of cells that usually grow more rapidly than normal cells and will continue to grow if not treated sometimes resulting in damage to adjacent structures. Tumor sizes can vary widely. A tumor may be solid, or fluid filled. A tumor can refer to benign (not malignant, generally harmless), or malignant (capable of metastasis) growths. Some tumors can include neoplastic cells that are benign (such as carcinoma in situ) and, simultaneously, contain malignant cancer cells (such as adenocarcinoma). This should be understood to include neoplasms found in multiple locations throughout the body. Therefore, for purposes of the present disclosure, tumors include primary tumors, lymph nodes, lymphatic tissue, and metastatic tumors.

[0132] Methods for isolating nucleic acid molecules from obtained samples and / or purifying the obtained samples are known (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001) and several kits are commercially available (e.g., High Pure RNA Isolation Kit, High Pure Viral Nucleic Acid Kit, and MagNA Pure LC Total Nucleic Acid Isolation Kit, DNA Isolation Kit for Cells and Tissues, DNA Isolation Kit for Mammalian Blood, High Pure FFPET DNA Isolation Kit, available from Roche). In the context of the presently disclosed methods, nucleic acid molecules, including genomic DNA, can be collected, purified, and / or isolated.

[0133] It will be appreciated that nucleic acid molecules may be isolated from obtained samples using any of a variety of procedures known in the art, for example, MagMAX™ DNA Multi-Sample Ultra Kit (Applied Biosystems, Thermo Fisher Scientific), the MagMAX™ Express-96 Magnetic Particle Processor and the KingFisher™ Flex Magnetic Particle Processor (Thermo Fisher Scientific), a RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE and PureLink™ FFPE RNA Isolation Kit (Ambion™, Thermo Fisher Scientific), the ABI Prism™ 6100 Nucleic Acid PrepStation and the ABI Prism™ 6700 Automated Nucleic Acid Workstation (Applied Biosystems, Thermo Fisher Scientific), and the like.

[0134] In some embodiments, the nucleic acid molecules within the obtained sample are selected from DNA molecules, genomic DNA molecules, cfDNA molecules, cDNA molecules, RNA molecules, mRNA molecules, rRNA molecules, mtDNA, siRNA molecules, or any combination thereof. In some embodiments, the plurality of nucleic acid molecules comprises single stranded polynucleotides.

[0135] In some embodiments, the nucleic acid molecules within the obtained sample may be prepared for downstream processing (e.g., the ligation of one or more universal adapters) by fragmenting, cutting, or shearing the nucleic acids. In some embodiments, the fragmenting, cutting, and / or shearing may be accomplished using such procedures as mechanical force, sonication, restriction endonuclease cleavage, or any method known in the art. In other embodiments, no fragmentation is necessary (some genomic samples may already consist of appropriately sized fragments and will not require additional fragmentation).

[0136] In some embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 10 mer to about 1000 mer. In some embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 10 mer to about 550 mer. In other embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 15 mer to about 500 mer. In yet other embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 15 mer to about 450 mer. In further embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 15 mer to about 400 mer. In even further embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 15 mer to about 350 mer. In yet even further embodiments, following fragmentation the nucleic acid molecules within any obtained sample have a size ranging from between about 15 mer to about 300 mer. In some embodiments, the nucleic acid molecules within the sample are fragmented to a platform-specific size range.

[0137] Following the fragmentation of the sample, in some embodiments, the fragmented nucleic acid molecules are end repaired and then a "tailing" reaction is performed. Tailing is an enzymatic method for adding a non-templated nucleotide to the 3' end of a blunt, double-stranded DNA molecule. In some embodiments, a Taq polymerase is utilized for A- tailing.

[0138] Ligation Of Y-Adapters

[0139] After end-repair tailing, one or more Y-adapters are ligated to one or more nucleic acid molecules within the obtained sample to provide adapter ligated nucleic acid molecules. The term "Y-adapter" refers to an adapter formed by two DNA strands (see for example, U.S. Pat. No. 6,346,399, U.S. Pat. No. 7,741,463, US Patent application US 2007 / 0172839, and International Publication No. W02007 / 111937; the disclosures of which are hereby incorporated by reference herein in their entireties). A Y-adapter includes single stranded non-complementary regions (also referred to herein as "arms," "single-stranded arms," or "arm regions") and a double stranded complementary region (also referred to herein as "stem regions"). In particular, a first portion (a 3' region) of the first strand and a first portion (a 5' region) of a second strand form a double stranded region by sequence complementarity. The ends of the double stranded region formed by the 3' region of the first DNA strand and the 5' region of the second DNA strand of the Y-adapter are compatible with the ends of the double stranded nucleic acid molecules within the obtained sample. A second portion of the first strand and a second portion of the second strand comprise non-self-complementary single stranded regions. In some embodiments, the Y-adapter is configured for ligation to a double stranded nucleic acid molecule. In some embodiments, a double stranded region of a Y- adapter comprises a 5'-overhang or a 3'-overhang that is complementary to a 3'-overhang or a 5'-overhang of an end of a double stranded nucleic acid molecule.

[0140] In some embodiments, the Y-adapters include one or more regions which permit binding of adapter ligated nucleic acid molecules to flow cells. In some embodiments, the Y- adapters include a P5 region and a P7 region. In some embodiments, the Y-adapter includes single stranded ends.

[0141] In some embodiments, each strand of a Y-adapter has a length of at least 5 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 40 nucleotides, etc. In some embodiments, one or both non-complementary arms of the Y-adapter has a length of at least about 10, 15, 20, or 25 nucleotides. In some embodiments, one or both non-complementary arms of the Y-adapter has a length of at least about 20 nucleotides. In embodiments, the double stranded region of a Y-adapter has a length of at least about 5, 10, 15, 20, 25, 30, or more nucleotides.

[0142] In some embodiments, the Y-adapter may include one or more indexes, barcodes, or UMIs. In some embodiments, UMIs may be incorporated as part of an overall DNA amplification and sequencing workflow to perform error correction. In some embodiments, errors are introduced (1) by the polymerase during amplification, and (2) during sequencing (i.e., reading) of the amplified molecules. In some embodiments, UMIs ligated tonucleic acid molecules reduce the impact of one or both sources of error. For instance, UMIs incorporate a unique barcode onto each molecule within a given sample library. By incorporating individual barcodes on each original DNA fragment, variant alleles present in the original sample (true variants) can be distinguished from errors introduced during library preparation, target enrichment, or sequencing.

[0099] In some embodiments, the UMIs have the one of the general Formulas set forth below:(W)(N)(N)(N)(N)(N)(W)(N)(N)(N)(N)(N)(W), or (N)(W)(N)(N)(N)(W)(N)(N)(N),

[0143] where N includes (in the aggregate) about 25% adenosine; about 25% guanine; about 25% cytosine; and about 25% thymine; and W includes (in the aggregate) about 50% adenosine and about 50% thymine.

[0144] Methods of ligating adapters to a nucleic acid molecule are described in U.S. Patent Publication Nos. 2017 / 0037459, 2018 / 0334709, 2018 / 0016630 and in PCT Publication No. WO2017021449, the disclosures of which are hereby incorporated by reference herein in their entireties. The ligating step carried out under conditions adequate for the ligation of the Y-adapter to both ends of the double stranded DNA molecules. In some embodiments, universal adapters are ligated to the nucleic acid molecules with any suitable ligase, such as T4 DNA ligase.

[0145] Optional Ampli fication

[0146] Following the ligation of the adapters including the one or more phosphorothioate bonds, the sample is optionally amplified. The amplification of the one or more adapter ligated nucleic acid molecules generates one or more amplified double stranded nucleic acid molecules. In some embodiments, amplification of the one or more adapter ligated nucleic acid molecules is based on template directed oligonucleotide primer extension using one or more polymerases. For instance, the sample including the one or more adapter ligated nucleic acid molecules is contacted with a polymerase and / or other amplification reagents to provide one or more amplified nucleic acid molecules.

[0147] Non-limiting examples of polymerases include prokaryotic DNA polymerases (e.g., Pol I, Pol II, Pol III, Pol IV, and Pol V), eukaryotic DNA polymerase, archaeal DNA polymerase, etc. In some embodiments, suitable polymerases may be derived from: archaea (e.g., Thermococcus litoralis (Vent, GenBank: AAA72101), Pyrococcus furiosus (Pfu, GenBank: D12983, BAA02362), Pyrococcus woesii, Pyrococcus GB-D (Deep Vent, GenBank: AAA67131), Thermococcus kodakaraensis KODI (KOD, GenBank: BD175553,BAA06142; Thermococcus sp. strain KOD (Pfx, GenBank: AAE68738)), Thermococcus gorgonarius (Tgo, Pdb: 4699806), Sulfolobus solataricus (GenBank: NC002754, P26811), Aeropyrum pernix (GenBank: BAA81109), Archaeglobus fulgidus (GenBank: 029753), Pyrobaculum aerophilum (GenBank: AAL63952), Pyrodictium occultum (GenBank: BAA07579, BAA07580), Thermococcus 9 degree Nm (GenBank: AAA88769, Q56366), Thermococcus fumicolans (GenBank: CAA93738, P74918), Thermococcus hydrothermalis (GenBank: CAC18555), Thermococcus sp. GE8 (GenBank: CAC12850), Thermococcus sp. JDF-3 (GenBank: AX135456; WOO 132887), Thermococcus sp. TY (GenBank: CAA73475), Pyrococcus abyssi (GenBank: P77916), Pyrococcus glycovorans (GenBank: CAC12849), Pyrococcus horikoshii (GenBank: NP 143776), Pyrococcus sp. GE23 (GenBank: CAA90887), Pyrococcus sp. ST700 (GenBank: CAC 12847), Thermococcus pacificus (GenBank: AX411312.1), Thermococcus zilligii (GenBank: DQ3366890), Thermococcus aggregans, Thermococcus barossii, Thermococcus celer (GenBank: DD259850.1), Thermococcus profundus (GenBank: E14137), Thermococcus siculi (GenBank: DD259857.1), Thermococcus thioreducens, Thermococcus onnurineus NA1, Sulfolobus acidocaldarium, Sulfolobus tokodaii, Pyrobaculum calidifontis, Pyrobaculum islandicum (GenBank: AAF27815), Methanococcus jannaschii (GenBank: Q58295), Desulforococcus species TOK, Desulforococcus, Pyrolobus, Pyrodictium, Staphylothermus, Vulcanisaetta, Methanococcus (GenBank: P52025) and other archaeal B polymerases, such as GenBank AAC62712, P956901, BAAA07579)), thermophilic bacteria Thermus species (e.g., flavus, ruber, thermophilus, lacteus, rubens, aquaticus), Bacillus stearothermophilus, Thermotoga maritima, Methanothermus fervidus, KOD polymerase, TNA1 polymerase, Thermococcus sp. 9 degrees N-7, T4, T7, phi29, Pyrococcus furiosus, P. abyssi, T. gorgonarius, T. litoralis, T. zilligii, T. sp. GT, P. sp. GB-D, KOD, Pfu, T. gorgonarius, T. zilligii, T. litoralis and Thermococcus sp. 9N-7 polymerases.

[0148] To effectuate amplification, the one or more adapter ligated nucleic acid molecules including the one or more methylated nucleotides are heat denatured. Melting temperatures for heat denaturation are dependent upon several variables including the GC content of the nucleic acid molecule and / or the size of the nucleic acid molecule, but in general may be about 95°C or higher, such as for about 15 seconds to about 2 minutes. Following heat denaturation, oligonucleotide primers are annealed to the template sequence of the one or more adapter ligated nucleic acid molecules including the one or more methylated nucleotides at a lower temperature, (typically between about 40°C and about 60°C, such as for about 30 to about 60 seconds). The annealing temperature, like the heat denaturation temperature, isdependent upon the GC content and / or length of the primers. The oligonucleotides form stable associations ('anneal') with the single stranded DNA (hereinafter referred to as the template strand) and thus serve as primers for nucleic acid synthesis by a polymerase. Subsequently, a corresponding nucleic acid strand to the template is synthesized from the primer oligonucleotide through use of the polymerase and deoxynucleotide triphosphates (dNTPs) (also referred to as "primer extension"). In some embodiments, the temperature is raised for the polymerase, which in the case of commonly used thermostable polymerases is about 74° C, primer extension then lasts approximately 1 to 2 minutes. Reactions take place in a PCR master mixture which includes the nucleic acid molecule, a polymerase, oligonucleotide primers, deoxynucleotide triphosphates (dNTPs), reaction buffer, magnesium and / or optional additives.

[0149] Optional Target Enrichment

[0150] In some embodiments, the amplified or unamplified adapter ligated nucleic acid molecules are enriched for one or more target nucleic acid molecules. During the step of enrichment, non-target nucleic acid molecules are removed from the amplified sample to provide for an enriched sample, namely a sample enriched for the presence of target nucleic acid molecules.

[0151] Any method may be utilized to enrich the prepared sample for the presence of one or more target nucleic acid molecules. In some embodiments, a hybridization-based target enrichment workflow may be utilized to enrich the prepared sample. In hybridization-based target enrichment workflows, a target area of a target nucleic acid molecule is captured by one or more hybridization probes that can selectively bind to a capture surface. This capture allows the removal of non-target nucleic acids and subsequent release and collection of captured target molecules. Hybridization of target regions may occur either on a solid surface (microarray) or in solution. Hybridization-based target enrichment workflows are described in United States Patent No. 8,383,338, the disclosure of which is hereby incorporated by reference herein in its entirety. Commercial hybridization-based target enrichment workflows are available from Roche Sequencing Solutions, Inc. (e.g., KAPA HyperCap Workflow). Other commercial hybridization-based target enrichment workflows include SECAP EZ Target Enrichment System (ROCHE) and SURESELECT Target Enrichment System (AGILENT).

[0152] By way of example, hybridization-based target enrichment may be performed by capturing the target nucleic acid molecules in a sample with one or more introduced targetspecific probes. In some embodiments, the one or more target nucleic molecules in an obtained sample may be denatured and contacted with single-stranded target-specific probes. In someembodiments, the single-stranded target-specific probes may comprise a ligand for an affinity capture moiety such that following the formation of hybridization complexes, the hybridization complexes are captured by contacting the sample with the affinity capture moiety. In some embodiments, the affinity capture moiety is avidin or streptavidin and the ligand is biotin. In some embodiments, the moiety is bound to solid support. In some embodiments, the solid support may comprise superparamagnetic spherical polymer particles such as DYNABEADS™ magnetic beads or magnetic glass particles.

[0153] In other embodiments, a primer extension target enrichment (PETE) workflow may be utilized to enrich the prepared sample. PETE workflows are described in United Patent Application Publication Nos. 2021 / 0207211 and 2020 / 0392483; in United States Patent Nos. 10,907,204 and 11,499,180; and in International Publication Nos. WO / 2018 / 013710 and WO / 2022 / 008578, the disclosures of which are each incorporated by reference herein in their entireties. Commercial PETE workflows are available from Roche (e.g., HAPA HyperPETE Workflow). By way of example only, a PETE workflow may be utilized to enrich a sample with one or more target nucleic acid molecules by: a) providing a reaction mixture comprising the sample and a first target-specific primer, wherein the sample comprises a single-stranded target nucleic acid molecule having a 3' and a 5' end and non-target nucleic acid molecules; b) hybridizing a first target-specific primer to the single- stranded target nucleic acid molecules in the reaction mixture, wherein the first target-specific primer hybridizes at least 6 nucleotides from the 3' end of the single-stranded target nucleic acid molecule and comprises an affinity ligand; c) extending the hybridized first target-specific primer with a DNA polymerase to form a first double-stranded product comprising the target nucleic acid molecule hybridized to the extended first target-specific primer, wherein the hybridized target nucleic acid molecule comprises a single-stranded overhang region of at least 6 consecutive nucleotides at the 3 ' end; d) removing single-stranded target and non-target nucleic acid molecules from the reaction mixture by capturing the affinity ligand of the first double-stranded product; e) hybridizing a second target-specific primer to the single-stranded overhang region at the 3' end of the hybridized target polynucleotide of the captured first double stranded product, wherein the second target-specific primer comprises a 3' hybridizing region and a barcode region; and f) extending the hybridized second target-specific primer with a DNA polymerase, wherein the DNA polymerase comprises strand displacement activity, 5 '-3' double stranded DNA exonuclease activity, or a combination thereof, thereby displacing or degrading the extended first target-specific primer and forming a second double-stranded product comprising a barcode, wherein the second double-stranded product comprises the target nucleic acidmolecule hybridized to an extended second target-specific primer, wherein the extended second target-specific primer comprises: i) a complement of at least a portion of the target nucleic acid molecule; and, ii) a single-stranded 5' overhang region comprising the barcode.

[0154] SEQUENCING OF NORMALIZED ADAPTER LIGATED NUCLEIC ACID MOLECULES

[0155] Following the preparation of the library including the normalized adapter ligated nucleic acid molecules, the nucleic acid molecules with the library are sequenced. In some embodiments, a next-generation sequencing technique is utilized for sequencing the prepared nucleic acid library.

[0156] In some embodiments, the sequencing comprises whole genome sequencing. Whole genome sequencing (also known as WGS, full genome sequencing, complete genome sequencing, or entire genome sequencing) is the process of determining the complete DNA sequence of an organism's genome at a single time. For example, cfDNA can be taken by simple venipuncture from a subject and used for whole genome sequencing of the subject.

[0157] In some embodiments, the sample can be normalized to a known concentration and diluted to the target concentration for sequencing. In other embodiments, the normalization methods can be used to directly provide the target concentration that will be suitable for sequencing.

[0158] In some embodiments, the normalized library may be sequenced by any suitable method or with nay suitable instrument including SMRT (single-molecule real-time sequencing), ion semiconductor, pyrosequencing, sequencing by synthesis, combinatorial probe anchor synthesis, and SOLiD sequencing (sequencing by ligation). Non-limiting sequencing platforms include those provided by Illumina® (e.g., the MiniSeq™, MiSeq™, NextSeq™, and / or NovaSeq™ sequencing systems); Ion Torrent™ (e.g., the Ion PGM™, Ion S5™, and / or Ion Proton™ sequencing systems); Pacific Biosciences (e.g., the PACBIO RS II and / or Sequel II System sequencing system); ThermoFisher (e.g., a SOLID® sequencing system); or BGI Genomics (e.g., DNBSeq™ sequencing systems). See, for example U.S. Pat. Nos. 7,211,390; 7,244,559; 7,264,929; 6,255,475; 6,013,445; 8,882,980; 6,664,079; and 9,416,409; the disclosures of which are hereby incorporated by reference herein in their entireties.

[0159] In other embodiments, the library including the one or more hairpin duplex molecules prepared for sequencing may be sequenced by sequencing-by-synthesis (SBS), pyrosequencing, sequencing by ligation (SBL), or sequencing by hybridization (SBH). Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as particular nucleotidesare incorporated into a nascent nucleic acid strand (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al. Science 281(5375), 363 (1998); U.S. Pat. Nos. 6,210,891; 6,258,568; and 6,274,320, each of which is incorporated herein by reference in its entirety). In pyrosequencing, released PPi can be detected by being converted to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP generated can be detected via light produced by luciferase. In this manner, the sequencing reaction can be monitored via a luminescence detection system. In both SBL and SBH methods, target nucleic acids, and amplicons thereof, that are present at features of an array are subjected to repeated cycles of oligonucleotide delivery and detection. SBL methods, include those described in Shendure et al. Science 309: 1728-1732 (2005); U.S. Pat. Nos. 5,599,675; and 5,750,341, each of which is incorporated herein by reference in its entirety; and the SBH methodologies are as described in Bains et al., Journal of Theoretical Biology 135(3), 303-7 (1988); Drmanac et al., Nature Biotechnology 16, 54-58 (1998); Fodor et al., Science 251(4995), 767-773 (1995); and WO 1989 / 10977, each of which is incorporated herein by reference in its entirety.

[0160] In SBS, extension of a nucleic acid primer along a nucleic acid template is monitored to determine the sequence of nucleotides in the template. The underlying chemical process can be catalyzed by a polymerase, wherein fluorescently labeled nucleotides are added to a primer (thereby extending the primer) in a template dependent fashion such that detection of the order and type of nucleotides added to the primer can be used to determine the sequence of the template.

[0161] Nanopore sequencing refers to the approach in which tags that are attached to nucleotides can be distinguished by their effect on ionic currents passing through nanopores as these tagged nucleotide analogs are added to a growing (nascent) DNA strand. Measurements can be made while tagged nucleotides are still part of the ternary complex, or after their tags are released by the polymerase reaction.

[0162] Nanopore sequencing of a nucleic acid molecule may be achieved by strand sequencing and / or exosequencing of the polynucleotide sequence. In some embodiments, nanopores may be used to sequence nucleic acid molecules where a polymerized nucleic acid molecule does not pass through the nanopore during sequencing. In these embodiments, the nucleic acid molecule may be at least partially located in the vestibule of the nanopore, but not in the pore (i.e., narrowest portion) of the nanopore. The nucleic acid molecule may pass within any suitable distance from and / or proximity to the nanopore, and optionally within a distancesuch that byproducts released from nucleotide incorporation events, e.g., tags cleaved from tagged nucleotide analogs, are detected in the nanopore.

[0163] Nanopore sequencing utilizes different tagged nucleotide analogs each having a covalently attached tag moiety that provides an identifiable, and distinguishable signature when detected within or near a nanopore. In some embodiments, nanopore sequencing requires a set of at least the four-standard deoxy-nucleotides dA, dC, dG, and dT, wherein each nucleotide has an attached tag capable of being detected by a nanopore upon the nucleotide being incorporated by a strand extending enzyme. Examples of tagged nucleotide analogs are described in United States Patent No. 10,975,426, the disclosure of which is hereby incorporated by reference herein in its entirety.

[0164] In some embodiments, a strand extending enzyme (e.g., a DNA polymerase), such as one located in proximity to a nanopore, specifically binds a tagged nucleotide analog that is complimentary to a nucleotide of a nucleic acid molecule which is hybridized to a growing (nascent) nucleic acid strand at its active site. The strand extending enzyme (e.g., a DNA polymerase) then catalytically incorporates the complementary nucleotide moiety of the tagged nucleotide analog ("nucleotide incorporation event") to the end of the nascent nucleic acid strand. Nucleotide incorporation events are catalyzed by the enzyme, such as DNA polymerase or any mutant or variant thereof and use base pair interactions with a template molecule to choose amongst the available nucleotides for incorporation at each location. Completion of the catalytic incorporation event results in the release of the tag moiety and the oligophosphate moiety (minus the one phosphate incorporated into the growing strand) which then passes through the adjacent nanopore.

[0165] "Nucleotide incorporation events," as that term is used herein, means the incorporation of a tagged nucleotide analog into a growing polynucleotide chain. In some embodiments, byproducts of nucleotide incorporation events may be detected by the nanopore. In some embodiments, a byproduct may be correlated with the incorporation of a given type of modified or unmodified nucleotide. In some embodiments, the byproduct passes through the nanopore and / or generates a signal detectable in the nanopore. Released tag molecules are examples of byproducts of nucleotide incorporation events. Additional details pertaining to such nanopore-based sequencing systems and methods are described in United States Patent Nos. 9,605,309 and 9,557,294, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0166] It is believed that sequencing using the SMRT platform allows the observation of single DNA polymerases reading individual molecules of DNA in real time. It is alsobelieved that the kinetic characteristics of DNA polymerization are observable on a singlemolecule basis.

[0167] In some embodiments the incorporation of differently labeled nucleotides is observed in real time as template dependent synthesis is carried out. In particular, an individual immobilized primer / template / polymerase complex is observed as fluorescently labeled nucleotides are incorporated, permitting real time identification of each added base as it is added. In this process, label groups are attached to a portion of the nucleotide that is cleaved during incorporation. For example, by attaching the label group to a portion of the phosphate chain removed during incorporation, i.e., a P, y, or other terminal phosphate group on a nucleoside polyphosphate, the label is not incorporated into the nascent strand, and instead, natural DNA is produced. Observation of individual molecules typically involves the optical confinement of the complex within a very small illumination volume. By optically confining the complex, a monitored region is created in which randomly diffusing nucleotides are present for a very short period of time, while incorporated nucleotides are retained within the observation volume for longer as they are being incorporated. This results in a characteristic signal associated with the incorporation event, which is also characterized by a signal profile that is characteristic of the base being added. In some embodiments, interacting label components, such as fluorescent resonant energy transfer (FRET) dye pairs, are provided upon the polymerase or other portion of the complex and the incorporating nucleotide, such that the incorporation event puts the labeling components in interactive proximity, and a characteristic signal results, that is again, also characteristic of the base being incorporated (see, e.g., U.S. Pat. Nos. 6,056,661, 6,917,726, 7,033,764, 7,052,847, 7,056,676, 7,170,050, 7,361,466, 7,416,844 and Published U.S. Patent Application No. 2007-0134128, the disclosures of which are each hereby incorporated by reference herein in their entireties).

[0168] The SMRT platform uses a polymerase enzyme, a template sequence, and a primer sequence complementary to a portion of the template sequence. These components are immobilized within a confined illumination volume. The reaction mixture surrounding the complex has the four different nucleotides (A, G, T and C) each labeled with a spectrally distinguishable fluorescent label attached through its terminal phosphate group. Because the illumination volume is small, nucleotides and their associated fluorescent labels diffuse in and out of the illumination volume quickly, and thus provide only very short fluorescent signals. When a particular nucleotide is incorporated by the polymerase in a primer extension reaction, the fluorescent label associated with the nucleotide is retained within the illumination volumefor a longer time. Once incorporated, the fluorescent label is cleaved from the base through the action of the polymerase, and the label diffuses away.

[0169] In some embodiments, the sequencing comprises sequencing by expansion (SBX). This chemistry translates the sequence of DNA into a simple to measure surrogate molecule called an Xpandomer. Much like with polymerase chain reaction, Xpandomer synthesis is based on the natural function of DNA replication where expandable nucleoside triphosphates (X-NTPs) act as substrates for template-dependent, polymerase-based replication. Four easily differentiated X-NTPs (also called High Signal-to-Noise Reporters) are used during Xpandomer synthesis, one for each DNA base, and engineered polymerases incorporate the X-NTPs into an Xpandomer, which serves as a surrogate for the complement of the nucleic acid template. As the Xpandomer molecule transits through a nanopore, the distinct electrical signal of each base reporter is easily identifiable to enable highly accurate and high throughput nanopore-based nucleic acid sequencing. SBX is described in U. S. Patent No. 7,939,259, 9,771,614, 10,774,105, and 11,530,392, the disclosures of which are hereby incorporated by reference herein in their entireties.

[0170] KITS

[0171] The present disclosure also provides for kits including a capture probe and a release primer, wherein the capture probe is capable of binding to a first portion of an adapter ligated to a nucleic acid molecule, and wherein the release primer is capable of binding to a second portion of the adapter ligated to the nucleic acid molecule, wherein the second portion is upstream from the first portion. In some embodiments, the capture probe includes (i) a capture moiety; and (ii) a nucleic acid sequence which is at least partially complementary to and capable of stably binding to the first portion of the adapter region. In some embodiments, the kit may include reagents for extension of a hybridized capture probe and / or a hybridized release primer (a master mix), e.g., polymerase, dNTPs, buffers, and / or other elements (e.g., cofactors or aptamers) appropriate for amplification. In some embodiments, the kit further includes at least two different polymerases. In some embodiments, the kit further includes a plurality of nucleotides. In some embodiments, the kit further includes one or more buffer solutions and / or wash solutions. In some embodiments, the kit further includes beads having a functionalized surface.

[0172] Although the present disclosure has been described with reference to several illustrative embodiments, it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure. More particularly, reasonable variations and modificationsare possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the foregoing disclosure, the drawings, and the appended claims without departing from the spirit of the disclosure. In addition to variations and modifications in the component parts and / or arrangements, alternative uses will also be apparent to those skilled in the art.

Claims

CLAIMS1. A method of preparing a library including a normalized concentration of Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of Y-adapter ligated nucleic acid molecules; (b) hybridizing a predetermined concentration of normalization oligonucleotides to the initial concentration of the Y- adapter ligated nucleic acid molecules in the sample; and (c) normalizing the concentration of the Y-adapter ligated nucleic acid molecules in the sample based on the hybridization of the predetermined concentration of the normalization oligonucleotides to provide the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules.

2. The method of claim 1, wherein each normalization nucleotide is hybridized to a singlestranded region of a Y-adapter portion of the Y-adapter ligated nucleic acid molecules.

3. The method of claim 2, wherein the single-stranded region is a P7 region.

4. The method of claim 1, wherein the of Y-adapter ligated nucleic acid molecules are unamplified.

5. The method of claim 4, wherein the normalization oligonucleotides include 5' blocked oligonucleotides.

6. The method of claim 5, wherein the 5' blocked oligonucleotides include one or more modifications which at least mitigate nuclease degradation.

7. The method of claim 5, wherein the 5' blocked oligonucleotides include one or more phosphorothioate bonds.

8. The method of claim 5, wherein the 5' blocked oligonucleotides include one or more 2'- modified nucleosides.

9. The method of claim 8, wherein the one or more 2'-modification comprises a 2'0-Methyl group.

10. The method of claim 5, wherein the 5' blocked oligonucleotides include one or more 2'- modified dideoxynucleotides.

11. The method of any one of claims 4 - 10, wherein the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises removing Y-adapter ligated nucleic acid molecules from the sample which are not hybridized to the normalization oligonucleotide.

12. The method of any one of claims 4 - 10, wherein the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises incubating the sample with anexonuclease; and removing at least single-stranded molecules from the sample following the incubation.

13. The method of claim 12, wherein the exonuclease has 3' to 5' activity.

14. The method of claim 13, wherein the exonuclease having 3' to 5' activity is exonuclease T.

15. The method of claim 4, wherein the predetermined concentration of normalization oligonucleotides are coupled to a functionalized substrate.

16. The method of claim 4, wherein the predetermined concentration of normalization oligonucleotides are capable of being coupled to a functionalized substrate.

17. The method of any one of claims 15 - 16, wherein the normalizing of the concentration of the Y-adapter ligated nucleic acid molecules comprises removing Y-adapter ligated nucleic acid molecules from the sample which are not bound to the functionalized substrate.

18. The method of claim 17, further comprising releasing the Y-adapter ligated nucleic acid molecules from the functionalized substrate.

19. The method of claim 1, wherein the of Y-adapter ligated nucleic acid molecules are amplified.

20. The method of claim 19, further (i) comprising hybridizing capture probes to the amplified Y-adapter ligated nucleic acid molecules in the sample; and (ii) extending the hybridized capture probes to provide a sample including complexes comprising a single strand of the Y-adapter ligated nucleic acid molecule hybridized to an extended capture probe; and wherein the predetermined concentration of normalization oligonucleotides is a predetermined concentration of release primers, and wherein the release primers are hybridized to the complexes comprising the single strand of the Y-adapter ligated nucleic acid molecule hybridized to the extended capture probe.

21. The method of claim 20, wherein the normalization of the concentration of the Y-adapter ligated nucleic acid molecules comprises (i) extending the hybridized release primers; and (ii) purifying the sample for released amplified Y-adapter ligated nucleic acid molecules.

22. The method of any one of the preceding claims, wherein the Y-adapter of the Y-adapter ligated nucleic acid molecules does not include any modification to prevent exonuclease digestion.

23. The method of any one of the preceding claims, further comprising sequencing the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules.

24. The method of claim 23, wherein the sequencing comprises next-generation sequencing.

25. A method of preparing a library including a normalized concentration of unamplified Y- adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sampleincluding an initial concentration of unamplified Y-adapter ligated nucleic acid molecules;(b) hybridizing a predetermined concentration of 5' blocked oligonucleotides to the initial concentration of the unamplified Y-adapter ligated nucleic acid molecules in the sample;(c) introducing an exonuclease to the sample to digest unamplified Y-adapter ligated nucleic acid molecules that are not hybridized to the predetermined concentration of the 5' blocked oligonucleotides; and (d) removing single stranded molecules from the sample following digestion with the exonuclease.

26. The method of claim 25, further comprising removing unligated and / or partially ligated nucleic acid molecules from the sample.

27. The method of any one of claims 25 - 26, wherein the 5' blocked oligonucleotide is substantially complementary to a P7 region of each Y-adapter ligated nucleic acid molecule in the sample.

28. The method of any one of claims 25 - 27, wherein the predetermined concentration ranges from between about 2 nM to about 20 nM.

29. The method of any one of claims 25 - 28, wherein the 5' blocked oligonucleotide comprises one or more modifications which limit nuclease degradation.

30. The method of claim 29, wherein the one or more modifications comprises one or more phosphorothioate bonds.

31. The method of claim 29, wherein the one or more modifications comprises one or more 2'- modified nucleosides.

32. The method of claim 29, wherein the one or more modifications comprises one or more di deoxy nucl eoti des .

33. The method of any one of claims 25 - 32, wherein the exonuclease has 3' to 5' activity.

34. The method of claim 33, wherein the exonuclease having 3' to 5' activity is exonuclease T.

35. The method of any one of claims 25 - 34, further comprising sequencing the library including the normalized concentration of unamplified Y-adapter ligated nucleic acid molecules.

36. A method of preparing a library including a normalized concentration of Y-adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of unamplified Y-adapter ligated nucleic acid molecules; (b) hybridizing a predetermined concentration of oligonucleotides to the initial concentration of Y-adapter ligated nucleic acid molecules in the sample, wherein the oligonucleotides are coupled to a functionalized substrate; (c) removing unhybridized Y-adapter ligated nucleic acid molecules from the sample; and (d) releasing bound Y-adapter ligated nucleic acidmolecules from the substrate to provide the library including the normalized concentration of the Y-adapter ligated nucleic acid molecules.

37. The method of claim 36, further comprising removing unligated and / or partially ligated nucleic acid molecules from the sample.

38. The method of claim 36, wherein the substrate is a bead.

39. The method of any one of claims 36 - 38, wherein the oligonucleotide is substantially complementary to a P7 region of each Y-adapter ligated nucleic acid molecule in the sample.

40. The method of any one of claims 36 - 39, wherein the predetermined concentration ranges from between about 2 nM to about 20 nM.

41. The method of any one of claims 36 - 40, further comprising sequencing the library including the normalized concentration of unamplified Y-adapter ligated nucleic acid molecules.

42. The method of claim 40, wherein the sequencing comprises next-generation sequencing.

43. A method of preparing a library including a normalized concentration of amplified Y- adapter ligated nucleic acid molecules, the method comprising: (a) obtaining a sample including an initial concentration of amplified Y-adapter ligated nucleic acid molecules; (b) hybridizing a capture probe to each of the amplified Y-adapter ligated nucleic acid molecules in the sample; (c) extending the hybridized capture probe of each of the amplified Y-adapter ligated nucleic acid molecules to provide a library including complexes which each comprise a single strand of the amplified Y-adapter ligated nucleic acid molecule hybridized to an extended capture probe; (d) hybridizing a predetermined concentration of release primers to the complexes comprising the single strand of the amplified Y-adapter ligated nucleic acid molecule hybridized to the extended capture probe; (e) extending each of the hybridized release primers; and (f) purifying the library for released amplified Y- adapter ligated nucleic acid molecules.

44. The method of claim 43, wherein the capture probe is substantially complementary to a P7 region of each amplified Y-adapter ligated nucleic acid molecule in the sample.

45. The method of any one of claims 43 - 44, wherein each of the capture probes hybridize to a portion of an adapter region of the amplified Y-adapter ligated target nucleic acid molecules in the sample which is downstream from a 5' terminal end of the amplified Y- adapter ligated target nucleic acid molecule.

46. The method of any one of claims 43 - 45, wherein each of the capture probes are capable of binding to a functionalized substrate.

47. The method of any one of claims 43 - 45, wherein each of the capture probes include biotin.

48. The method of any one of claims 43 - 47, wherein each of the hybridized capture probes are extended using a polymerase.

49. The method of any one of claims 43 - 47, further comprising removing capture probes which are not hybridized to the amplified Y-adapter ligated nucleic acid molecules in the sample.

50. The method of any one of claims 43 - 49, wherein the predetermined concentration of the release primer ranges from between about 2 nM to about 20 nM.

51. The method of any one of claims 43 - 50, wherein each hybridized release primer is extended using a polymerase having strand displacement activity.

52. The method of any one of claims 43 - 51, further comprising sequencing the library including the normalized concentration of amplified Y-adapter ligated nucleic acid molecules.

53. A kit comprising a 5' blocked oligonucleotide; and an exonuclease.

54. The kit of claim 53, wherein the 5' blocked oligonucleotides include one or more phosphorothioate bonds.

55. The kit of claim 53, wherein the 5' blocked oligonucleotides include one or more 2'- modified nucleosides.

56. The kit of claim 55, wherein the one or more 2'-modification comprises a 2'O-Methyl group.

57. The kit of claim 53, wherein the 5' blocked oligonucleotides include one or more 2'- modified dideoxynucleotides.

58. The kit of any one of claims 53 - 57, wherein the exonuclease has 3' to 5' activity.

59. The kit of claim 58, wherein the exonuclease having the 3' to 5' activity is exonuclease T.

Images