Compositions and methods for genetic and epigenetic modulation

Modular cellular and heterobifunctional recruitment compositions facilitate precise epigenetic and genetic editing across tissues by connecting recruitment and nucleic acid targeting domains, addressing packaging and tropism challenges of existing technologies.

WO2026102034A1PCT designated stage Publication Date: 2026-05-15JUNIPERO THERAPEUTICS INC
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
JUNIPERO THERAPEUTICS INC
Filing Date
2025-11-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Current precision epigenetic and genetic editing compositions rely on large fusion proteins that require vectors for delivery, which face challenges in packaging and have poor tropism outside the liver, particularly in tissues like the central nervous system.

Method used

Modular cellular targeting compositions and heterobifunctional recruitment compositions that include recruitment domains and nucleic acid targeting domains, connected by linkers, which do not use BIX01338 inhibitors, allowing for precise epigenetic and genetic editing without the need for vectors.

Benefits of technology

Enable precise epigenetic and genetic editing across various tissues, including the central nervous system, by overcoming packaging and tropism limitations of existing compositions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025054210_15052026_PF_FP_ABST
    Figure US2025054210_15052026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are compositions and methods for modulating genetic and epigenetic expression. For example, the present disclosure provides modular cellular targeting compositions, heterobifunctional recruitment compositions, pharmaceutical compositions comprising modular cellular targeting compositions or heterobifunctional recruitment compositions, and methods of use thereof.
Need to check novelty before this filing date? Find Prior Art

Description

WSGR Docket No. 68656-701.601COMPOSITIONS AND METHODS FOR GENETIC AND EPIGENETIC MODULATIONCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 717,123 filed November 06, 2024, which is incorporated herein by reference for all purposes in its entirety.BACKGROUND

[0002] Current precision epigenetic and genetic editing compositions rely on the use of large fusion proteins. The use of these constructs necessitates the use of a vector or delivery system. Technical limitations include challenges in packaging these large fusion protein constructs in the vector or delivery system. Additionally, these vectors have poor tropism in tissues outside of the liver making delivery and editing within tissues such as the central nervous system (CNS) a challenge.

[0003] Accordingly, there exists a need in the art to develop compositions and methods for genetic and epigenetic modulation that overcome these technical limitations.SUMMARY

[0004] In one aspect, disclosed herein is a modular cellular targeting composition comprising: a) ) a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure; and b) a nucleic acid targeting domain comprising a polynucleic acid, wherein the recruitment domain and the targeting domain are operatively connected, and wherein the recruitment domain does not comprise a BIX01338 inhibitor. In some embodiments, the composition further comprises a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises an epigenetic enzyme or epigenetic effector. In some embodiments, the composition further comprises an epigenetic enzyme or epigenetic effector. In some embodiments, the epigenetic enzyme or epigenetic effector is endogenous to a human. In some embodiments, the epigenetic enzyme or epigenetic effector comprises a human wild-type epigenetic enzyme. In some embodiments, the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises aWSGR Docket No. 68656-701.601DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF. In some embodiments, the recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain, a histone tail peptide recruitment domain, a histone embedding peptide recruitment domain, a histone tail peptide recruitment domain and a histone embedding peptide recruitment domain, or a combination thereof. In some embodiments, the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain. In some embodiments, the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain. In some embodiments, the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain. In some embodiments, the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain. In some embodiments, the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT1L, or a PRDM family protein recruitment domain. In some embodiments, the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain. In some embodiments, the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain. In some embodiments, the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain. In some embodiments, the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain. In some embodiments, the histone deubiquitinase recruitment domain comprises a USP16, USP21, orWSGR Docket No. 68656-701.601USP22 recruitment domain. In some embodiments, the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain. In some embodiments, the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain. In some embodiments, the chromatin remodeling factor recruitment domain comprises a BRGl, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain. In some embodiments, the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain. In some embodiments, the recruitment domain comprises a biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof. In some embodiments, the recruitment domain comprises the small molecule domain. In some embodiments, the small molecule domain comprises a 5-Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VP A, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDB1-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5-methylcytosine containing DNA, or a CBP30 domain. In some embodiments, the HAT agonist comprises CTB, TTK21, YF-2, 1-CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106. In some embodiments, the histone tail peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 1-3 or 18. In some embodiments, the histone embedding peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 4-17. In some embodiments, the histone tail peptide recruitment domain comprises any one of SEQ ID NOs: 1-3 or 18. In some embodiments, the histone embedding peptide recruitment domain comprises any one of SEQ ID NOs: 4-17. In some embodiments, the nucleic acid targeting domain comprises an antisense oligonucleotide (ASO), a triplex-forming oligonucleotide (TFO) , a G-quadruplex binding sequence, a small activating RNA, a small interfering RNA (siRNA), a CRISPR guide RNA, an aptamer, a ribozyme, a DNAzyme, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a phosphorothioate stabilized oligonucleotide, a DNA or RNA binding oligonucleotide, or a combination thereof. In some embodiments, the nucleic acid targeting domain comprises an oligonucleotide that binds to a target DNA or RNA, the target DNA or RNA comprising: cis-acting non-coding RNAs, transacting non-coding RNAs, nuclear retained RNAs, introns of pre-mRNA, exons of mRNA, promoter regions of DNA, enhancer regions of DNA, silencer regions of DNA, insulatorWSGR Docket No. 68656-701.601 elements, topologically associating domains (TADs), DNA methylation sites, histone modification sites, DNase I hypersensitive sites, chromosome conformation capture (3C) interaction sites, a specific DNA or RNA sequence of interest, or a combination thereof. In some embodiments, the nucleic acid targeting domain comprises about 1 nucleotide to about 30 nucleotides. In some embodiments, the nucleic acid targeting domain comprises about 10 nucleotides to about 30 nucleotides. In some embodiments, the nucleic acid targeting domain comprises about 15 nucleotides to about 30 nucleotides. In some embodiments, the nucleic acid targeting domain comprises about 20 nucleotides to about 30 nucleotides. In some embodiments, the nucleic acid targeting domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 19-25, 27-29, or 32. In some embodiments, the nucleic acid targeting domain comprises any one of SEQ ID NOs: 19-25, 27-29, or 32. In some embodiments, the modular cellular targeting composition further comprises a linker. In some embodiments, the linker operatively connects the recruitment domain and the nucleic acid targeting domain. In some embodiments, the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof. In some embodiments, the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety. In some embodiments, the linker comprises a tissue-specific cleavable linker. In some embodiments, the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme-cleavable linker, a light-sensitive linker, or a combination thereof. In some embodiments, the linker comprises a self-immolative spacer. In some embodiments, the linker comprises about 1 to about 200 amino acids. In some embodiments, the composition is operatively connected to a tissue targeting moiety. In some embodiments, the tissue targeting moiety comprises a liver-targeting moiety, a brain-targeting moiety, a muscle-targeting moiety, a heart-targeting moiety, a kidney -targeting moiety, a lung-targeting moiety, a tumor-targeting moiety, an immune cell-targeting moiety, an ocular targeting moiety, a blood-brain-barrier crossing moiety, a cell targeting moiety; or a combination thereof. In some embodiments, the liver-targeting moiety comprises a GalNAc moiety, an asialoglycoprotein receptor (ASGPR) ligand, a triantennary N-acetylgalactosamine, a multivalent GalNAc cluster, a peptide targeting liver-specific antigens; or a combination thereof. In some embodiments, the brain moiety comprises a synaptic vesicle glycoprotein 2A (SV2A) binding peptide, an anti-SV2A antibody or antibody fragment, a neurotrophin receptor (p75NTR) binding peptide, a neuropilin- 1 (NRP1) targeting peptide, a neuron-specific enolase (NSE) targeting moiety, a glial fibrillary acidicWSGR Docket No. 68656-701.601 protein (GFAP) targeting antibody or antibody fragment, a peptide targeting brain-specific antigens; or a combination thereof. In some embodiments, the muscle-targeting moiety comprises, an a7pi integrin-binding peptide, a peptide targeting the acetylcholine receptor, a peptide targeting TfR, a peptide targeting muscle-specific antigens; or a combination thereof. In some embodiments, the heart-targeting moiety comprises, a cardiac troponin-binding peptide, an anti-cardiac troponin antibody or antibody fragment, a peptide targeting cardiac-specific antigens; or a combination thereof. In some embodiments, the kidney-targeting moiety comprises, a megalin-binding peptide, a cubilin-binding peptide, a peptide targeting kidneyspecific peptide antigens; or a combination thereof. In some embodiments, the lung-targeting moiety comprises, a pulmonary surfactant protein binding peptide, an angiotensin converting enzyme (ACE) binding peptide, a PEC AM- 1 targeting antibody or antibody fragment, a peptide targeting claudin-18, an ICAM-1 targeting moiety, a peptide targeting lung specific-antigens; or a combination thereof. In some embodiments, the tumor-targeting moiety comprises, a folate receptor targeting moiety, an EGFR targeting antibody or antibody fragment, a HER2 targeting antibody or antibody fragment, an RGD peptide targeting avP3 integrin, a CD 19 targeting moiety, a CD20 targeting moiety, a prostate-specific membrane antigen (PSMA) targeting moiety, a GRP78 targeting peptide, a peptide targeting tumor-associated antigens; or a combination thereof. In some embodiments, the immune cell -targeting moiety comprises, a CD3 targeting moiety, a CD4 targeting moiety, a CD8 targeting moiety, a CD40 targeting moiety, a peptide targeting CCR5, a dendritic cell-targeting antibody or antibody fragment, an immune cell targeting-peptide; or a combination thereof. In some embodiments, the ocular targeting moiety comprises, an integrin avP3 targeting peptide, a peptide targeting retinal pigment epithelium, a transferrin receptor targeting moiety, a peptide targeting retinal ganglion cells, a peptide targeting ocular specific antigens; or a combination thereof. In some embodiments, the blood-brain-barrier crossing moiety comprises, a transferrin receptor (TfR) binding peptide, an anti-TfR antibody or antibody fragment, a Tissue Non-Specific Alkaline Phosphatase (ALPL) binding peptide, an anti-ALPL antibody or antibody fragment, a glucose transporter 1 (GLUT1) binding peptide, a low-density lipoprotein receptor-related protein 1 (LRP1) binding peptide, an insulin receptor binding peptide, a rabies virus glycoprotein (RVG) peptide, a peptide targeting blood-brain-barrier (BBB) antigens to allow for crossing the BBB; or a combination thereof. In some embodiments, the composition comprises about 1 to about 5000 amino acids. In some embodiments, the composition comprises about 500 to about 1000 amino acids. In some embodiments, the composition comprises about 1000 to about 2000 amino acids. In some embodiments, the composition comprises about 2000 to about 5000 amino acids.WSGR Docket No. 68656-701.601

[0005] In one aspect, disclosed herein is a heterobifunctional recruitment composition comprising: a recruitment domain, wherein the recruitment domain comprises a first recruitment domain and a second recruitment domain, wherein the first recruitment domain comprises a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure, and the second recruitment domain comprises a recruitment domain for a genome associated protein, wherein the first recruitment domain and the second recruitment domain are operatively connected and wherein the genome associated protein does not comprise an anchored transcription factor.

[0006] In some embodiments, the heterobifunctional recruitment composition further comprises a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure, the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises an epigenetic enzyme or epigenetic effector. In some embodiments, the epigenetic enzyme or epigenetic effector comprises a human wild-type epigenetic enzyme. In some embodiments, the epigenetic enzyme or epigenetic effector comprises a DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF. In some embodiments, the first recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, or a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain. In some embodiments, the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain. In some embodiments, the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain. In some embodiments, the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain. In some embodiments, the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10,WSGR Docket No. 68656-701.601HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain. In some embodiments, the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT1L, or a PRDM family protein recruitment domain. In some embodiments, the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain. In some embodiments, the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain. In some embodiments, the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain. In some embodiments, the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain. In some embodiments, the histone deubiquitinase recruitment domain comprises a USP16, USP21, or USP22 recruitment domain. In some embodiments, the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain. In some embodiments, the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain. In some embodiments, the chromatin remodeling factor recruitment domain comprises a BRG1, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain. In some embodiments, the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain, the first recruitment domain comprises biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof. In some embodiments, the first recruitment domain comprises the small molecule domain. In some embodiments, the small molecule domain comprises a 5-Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VP A, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A- 485, 1-CBP112, SETDB1-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5- methylcytosine containing DNA, or a CBP30 domain. In some embodiments, the HAT agonist comprises CTB, TTK21, YF-2, 1-CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106. In some embodiments, the heterobifunctional recruitment composition further comprises an endogenous genome-associated protein. In some embodiments, the genome- associated protein comprises a transcription factor, a transcriptional coactivator, a transcriptional corepressor, a chromatin remodeling factor, a histone modifier, a DNA modifier, an architecturalWSGR Docket No. 68656-701.601 protein, an RNA polymerase II and associated factors, a mediator complex component, an enhancer-associated factor, an insulator protein, a topoisomerase, a pioneer factor, a polycomb group protein, a trithorax group protein, a heterochromatin protein, a DNA methylation reader, a histone modification reader, a long non-coding RNAs associated with chromatin, or a combination thereof. In some embodiments, the second recruitment domain comprises a genome-associated protein recruitment domain. In some embodiments, the genome-associated protein recruitment domain comprises a transcription factor recruitment domain, a transcriptional coactivator recruitment domain, a transcriptional corepressor recruitment domain, a chromatin remodeling factors recruitment domain, a histone modifier recruitment domain, a DNA modifier recruitment domain, an architectural protein recruitment domain, an RNA polymerase II and associated factor recruitment domain, a mediator complex component recruitment domain, an enhancer-associated factor recruitment domain, an insulator protein recruitment domain, a topoisomerase recruitment domain, a pioneer factor recruitment domain, a polycomb group protein recruitment domain, a trithorax group protein recruitment domain, a heterochromatin protein recruitment domain, a DNA methylation reader recruitment domain, a histone modification reader recruitment domain, a long non-coding RNAs associated with chromatin recruitment domain, or a combination thereof. In some embodiments, the heterobifunctional recruitment composition further comprises a linker. In some embodiments, the linker operatively connects the recruitment domain and the nucleic acid targeting domain. In some embodiments, the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof. In some embodiments, the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety. In some embodiments, the linker comprises a tissue-specific cleavable linker. In some embodiments, the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme-cleavable linker, a light-sensitive linker, or a combination thereof. In some embodiments, the linker comprises a self-immolative spacer. In some embodiments, the linker comprises about 1 to about 200 amino acids. In some embodiments, the composition is operatively connected to a tissue targeting moiety. In some embodiments, the tissue targeting moiety comprises a liver-targeting moiety, a brain-targeting moiety, a muscle-targeting moiety, a heart-targeting moiety, a kidney -targeting moiety, a lung-targeting moiety, a tumor-targeting moiety, an immune cell-targeting moiety, an ocular targeting moiety, a blood-brain-barrier crossing moiety, a cell targeting moiety; or a combination thereof. In some embodiments, theWSGR Docket No. 68656-701.601 liver-targeting moiety comprises a GalNAc moiety, an asialoglycoprotein receptor (ASGPR) ligand, a triantennary N-acetylgalactosamine, a multivalent GalNAc cluster, a peptide targeting liver-specific antigens; or a combination thereof. In some embodiments, the brain moiety comprises a synaptic vesicle glycoprotein 2A (SV2A) binding peptide, an anti-SV2A antibody or antibody fragment, a neurotrophin receptor (p75NTR) binding peptide, a neuropilin- 1 (NRP1) targeting peptide, a neuron-specific enolase (NSE) targeting moiety, a glial fibrillary acidic protein (GFAP) targeting antibody or antibody fragment, a peptide targeting brain-specific antigens; or a combination thereof. In some embodiments, the muscle-targeting moiety comprises, an a7pi integrin-binding peptide, a peptide targeting the acetylcholine receptor, a peptide targeting TfR, a peptide targeting muscle-specific antigens; or a combination thereof. In some embodiments, the heart-targeting moiety comprises, a cardiac troponin-binding peptide, an anti-cardiac troponin antibody or antibody fragment, a peptide targeting cardiac-specific antigens; or a combination thereof. In some embodiments, the kidney-targeting moiety comprises, a megalin-binding peptide, a cubilin-binding peptide, a peptide targeting kidneyspecific peptide antigens; or a combination thereof. In some embodiments, the lung-targeting moiety comprises, a pulmonary surfactant protein binding peptide, an angiotensin converting enzyme (ACE) binding peptide, a PEC AM- 1 targeting antibody or antibody fragment, a peptide targeting claudin-18, an ICAM-1 targeting moiety, a peptide targeting lung specific-antigens; or a combination thereof. In some embodiments, the tumor-targeting moiety comprises, a folate receptor targeting moiety, an EGFR targeting antibody or antibody fragment, a HER2 targeting antibody or antibody fragment, an RGD peptide targeting avP3 integrin, a CD 19 targeting moiety, a CD20 targeting moiety, a prostate-specific membrane antigen (PSMA) targeting moiety, a GRP78 targeting peptide, a peptide targeting tumor-associated antigens; or a combination thereof. In some embodiments, the immune cell -targeting moiety comprises, a CD3 targeting moiety, a CD4 targeting moiety, a CD8 targeting moiety, a CD40 targeting moiety, a peptide targeting CCR5, a dendritic cell-targeting antibody or antibody fragment, an immune cell targeting-peptide; or a combination thereof. In some embodiments, the ocular targeting moiety comprises, an integrin avP3 targeting peptide, a peptide targeting retinal pigment epithelium, a transferrin receptor targeting moiety, a peptide targeting retinal ganglion cells, a peptide targeting ocular specific antigens; or a combination thereof. In some embodiments, the blood-brain-barrier crossing moiety comprises, a transferrin receptor (TfR) binding peptide, an anti-TfR antibody or antibody fragment, a Tissue Non-Specific Alkaline Phosphatase (ALPL) binding peptide, an anti-ALPL antibody or antibody fragment, a glucose transporter 1 (GLUT1) binding peptide, a low-density lipoprotein receptor-related protein 1 (LRP1) binding peptide, an insulin receptor binding peptide, a rabies virus glycoprotein (RVG) peptide, a peptide targetingWSGR Docket No. 68656-701.601 blood-brain-barrier (BBB) antigens to allow for crossing the BBB; or a combination thereof. In some embodiments, the composition comprises about 1 to about 5000 amino acids. In some embodiments, the composition comprises about 500 to about 1000 amino acids. In some embodiments, the composition comprises about 1000 to about 2000 amino acids. In some embodiments, the composition comprises about 2000 to about 5000 amino acids.

[0007] In one aspect, provided herein are recombinant polynucleic acids encoding modular cellular targeting compositions or heterobifunctional recruitment compositions as disclosed herein.

[0008] In one aspect, provided herein are pharmaceutical compositions comprising modular cellular targeting compositions or heterobifunctional recruitment compositions and a pharmaceutically acceptable excipient.

[0009] In one aspect, provided herein is a method of introducing one or more modifications in an epigenome, the method comprising: administering a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof. In some embodiments, the one or more modifications in the epigenome comprises increasing or decreasing methylation, increasing or decreasing acetylation, increasing or decreasing ubiquitylation, increasing or decreasing phosphorylation, increasing or decreasing sumoylation, increasing or decreasing ribosylation, increasing or decreasing citrullination, or a combination thereof. In some embodiments, the one or more modifications comprises one or more transient modifications. In some embodiments, the method comprises increasing methylation. In some embodiments, the increasing methylation comprises increasing methylation of a CpG island associated with a gene. In some embodiments, the gene comprises a gene associated with progressive supranuclear palsy, angelman syndrome, prader-willi, alzheimer’s disease, cancer, type 1 or type 2 diabetes, liver disease, kidney disease, eye disease, parkinson’s disease, hepatitis B viral infection, t-cell mediated autoimmunity, huntington’s disease, a disease or condition associated with the central nervous system, or a disease or condition associated with the peripheral nervous system. In some embodiments, the gene comprises MAPT, SOD1, PCSK9, HTT, or PR.

[0010] In one aspect, provided herein is a method of modulating gene expression, the method comprising: administering a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof.

[0011] In one aspect, provided herein is a method of treating a disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as disclosed herein. In some embodiments, the method of treatingWSGR Docket No. 68656-701.601 the disease or condition in the subject in need thereof comprises introducing one or more modifications in an epigenome of the subject, or modulating gene expression in the subject. In some embodiments, the disease or condition comprises a disease or condition associated with the epigenome. In some embodiments, the disease or condition comprises progressive supranuclear palsy, angelman syndrome, prader-willi, alzheimer’s disease, cancer, type 1 or type 2 diabetes, liver disease, kidney disease, eye disease, parkinson’s disease, hepatitis B viral infection, t-cell mediated autoimmunity, huntington’s disease, a disease or condition associated with the central nervous system, or a disease or condition associated with the peripheral nervous system.

[0012] In one aspect, provided herein is a method of cellular reprogramming comprising a) administering a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to a cell b) culturing the cell, wherein the culturing comprises conditions that induces cellular reprogramming and c) isolating reprogrammed cells with a desired cellular identity.

[0013] In one aspect, provided herein is a method of creating epigenetic memory in cells comprising a) administering a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to a cell b) dividing the cell. In some embodiments, the method further comprises c) detecting an induced epigenetic mark in a divided cell.

[0014] In one aspect, disclosed herein is a method of creating a synthetic transcriptional circuit comprising a) administering a first composition comprising a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof and b) administering a second, third, or more composition comprising a composition, a recombinant polynucleic acid, or a pharmaceutical composition as disclosed herein to the cell, the tissue, the subject, or a combination thereof, wherein administering the first, second, third, or more composition induces a series of transcriptional events. In some embodiments, the administering comprises a specific temporal sequence. In some embodiments, the series of transcriptional events comprises increasing or decreasing expression of a first gene, a second gene, a third gene, or more than three genes. In some embodiments, the method further comprises detecting a gene expression pattern.INCORPORATION BY REFERENCE

[0015] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.WSGR Docket No. 68656-701.601BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0017] FIG. 1A depicts an embodiment of a modular cellular targeting composition. The embodiment depicted in FIG. 1A is complexed with an epigenetic modulator and DNA methylation is shown.

[0018] FIG. IB depicts an embodiment of a heterobifunctional recruitment composition. The embodiment depicted in FIG. IB is complexed with an epigenetic modulator and DNA methylation is shown.

[0019] FIG. 2 depicts proposed mechanisms for epigenetic editing using a modular cellular targeting composition. Two proposed mechanisms of epigenetic editing with a modular cellular targeting composition are depicted, including editing using a modular cellular targeting composition comprising a nucleic acid targeting domain targeting DNA, and a nucleic acid targeting domain targeting pre-mRNA.

[0020] FIG. 3 depicts proposed mechanisms for epigenetic editing using a modular cellular targeting composition, including editing using a modular cellular targeting composition comprising a nucleic acid targeting domain targeting nascent pre-mRNA transcripts.

[0021] FIG. 4 depicts a schematic of the MAPT promoter region and depicts nearby RNAs to be targeted by nucleic acid targeting domains.

[0022] FIG. 5A depicts a schematic of the HTT promoter region and depicts nearby RNAs to be targeted by nucleic acid targeting domains.

[0023] FIG. 5B shows a schematic of the SOD1 promoter region and depicts nearby RNAs to be targeted by nucleic acid targeting domains.

[0024] FIG. 6 depicts a schematic of the SNURF-UBE3 A locus. Angelman-Syndrome (AS) genes (UBE3A)are shown, PWS genes (SNURF / SNRPN, SNORD116, IPW) are shown, CTCF sites are denoted by dashed line boxes, and additional dispensable genes (PWAR1, SNORD115, and UBE3A-ATS) are shown. PWAR1, SNORD115, and UBE3A-ATS are not expressed in non-neuronal cell types.

[0025] FIG. 7 shows an embodiment of a modular cellular targeting composition and a heterobifunctional recruitment composition. In this embodiment, an epigenetic editor is fused to the composition with a protein fusion partner / proximity system as shown.WSGR Docket No. 68656-701.601

[0026] FIG. 8A and FIG. 8B depict the results of a concentration dependent gene knockdown experiment of the HTT gene. Modular cellular targeting compositions were designed to target nascent transcripts upstream (5’) and downstream (3’) of the HTT transcription start site. Compositions were generated comprising a nucleic acid targeting domain comprising 2’-M0E, PS modified ASOs linked to a biotin recruitment domain. Stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3 A were generated. The cell lines were then treated with the modular cellular targeting compositions targeting the HTT gene at lOnM, FIG. 8A, and 50nM, FIG. 8B, concentrations. A non-targeting control modular cellular targeting composition was also administered.

[0027] FIG. 9A and FIG. 9B depict the results of a dose dependent knockdown experiment of the HTT gene. A modular cellular targeting composition comprising a biotin recruitment domain and a nucleic acid targeting domain comprising a 2’-M0E and PS modified ASO comprising SEQ ID NO: 20 was administered to stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3A at doses of 10 nM, 50 nM, or 250 nM. A non-targeting control modular cellular targeting composition was also administered. FIG. 9A depicts the results in the control mSA cell line and FIG. 9B depicts the results in the cell line comprising mSA fused to DNMT3 A.

[0028] FIG. 10A and FIG. 10B depict the results of a concentration dependent knockdown experiment of the SOD1 gene. A modular cellular targeting composition comprising a biotin recruitment domain and a nucleic acid targeting domain comprising a 2’ -MOE and PS modified ASO comprising SEQ ID NO: 32 was administered to stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3A at doses of 10 nM or 50 nM. A non-targeting control modular cellular targeting composition was also administered. FIG. 10A depicts the results in the control mSA cell line and FIG. 10B depicts the results in the cell line comprising mSA fused to DNMT3 A.

[0029] FIG. 11 depicts the results of an HTT knockdown experiment. Modular cellular targeting compositions were designed to target nascent transcripts of the HTT transcription start site. Compositions were generated comprising a nucleic acid targeting domain comprising 2’- MOE, PS modified ASOs linked to a biotin recruitment domain (corresponding to SEQ ID NOs: 19-21). To test the ability of these modular cellular targeting composition to induce knockdown of HTT, stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3A or ZNF-10 (KRAB) were generated. The cell lines were then treated with the modular cellular targeting compositions targeting the HTT gene at 50nM concentrations.

[0030] FIG. 12 depicts the results of a bisulfite sequencing CPG methylation experiment. . Modular cellular targeting compositions were designed to target nascent transcripts of the HTTWSGR Docket No. 68656-701.601 transcription start site. Compositions were generated comprising a nucleic acid targeting domain comprising 2’-M0E, PS modified ASOs linked to a biotin recruitment domain (corresponding to SEQ ID NOs: 19-21). To test the ability of these modular cellular targeting composition to induce knockdown of HTT, stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3A or ZNF-10 (KRAB) were generated. The cell lines were then treated with the modular cellular targeting compositions targeting the HTT gene at 50nM concentrations. As a comparison, the cells were also treated with dCas9-DNMT3 A, Tominersen, a non-targeting control modular cellular targeting composition, or no construct.

[0031] FIG. 13 depicts the results of an HTT knockdown experiment. Modular cellular targeting compositions comprising biotinylated ASOs targeting either the HTT sense transcript or the antisense transcript were tested in stable HEK cells expressing monomeric streptavidin (mSA) alone or mSA fusions to DNMT3A, ZNF10-KRAB, or TET3.

[0032] FIG. 14 depicts the results of an HTT knockdown experiment. Modular cellular targeting compositions comprising biotinylated ASOs targeting either the HTT sense transcript or the antisense transcript were tested in stable HEK cells expressing monomeric streptavidin (mSA) alone or mSA fusions to DNMT3A, ZNF10-KRAB, or TET3. The HEK cells were cultured for 1 month without redosing of the modular cellular targeting compositions. HTT expression was measured and is shown at the 1 month time point.DETAILED DESCRIPTIONI. OVERVIEW

[0033] Current precision epigenetic and genetic editing compositions rely on the use of large fusion proteins. The use of these constructs necessitates the use of a vector or delivery system. Technical limitations include challenges in packaging these large fusion protein constructs in the vector or delivery system. Additionally, these vectors have poor tropism in tissues outside of the liver making delivery and editing within tissues such as the central nervous system (CNS) a challenge.

[0034] Precision endogenous epigenetic and genetic editing is a process performed by endogenous epigenetic and DNA or RNA modifying enzymes via natural transcriptional or epigenetic regulation. An object of the present disclosure is to provide a precision epigenetic or genetic editing composition to enable precision targeting and epigenetic or genetic editing while overcoming the technical limitations of current precision epigenetic and genetic editing compositions.WSGR Docket No. 68656-701.601

[0035] Accordingly, the present disclosure provides modular cellular targeting compositions, heterobifunctional recruitment compositions, pharmaceutical compositions comprising modular cellular targeting compositions or heterobifunctional recruitment compositions, and methods of use thereof. In some embodiments, modular cellular targeting compositions or heterobifunctional recruitment compositions overcome the technical limitations of current precision epigenetic and genetic editing compositions by recruiting endogenous epigenetic, DNA, or RNA modulating enzymes or proteins, thereby overcoming the challenges associated with fusion proteins.

[0036] Certain specific details of this description are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the present disclosure may be practiced without these details. In other instances, well-known structures have not been shown or described in detail to avoid unnecessarily obscuring descriptions of the embodiments. Unless the context requires otherwise, throughout the specification and claims which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to.” Further, headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed disclosure.

[0037] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0039] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some versions contain one or more introns.

[0040] The term “effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological or therapeutic result.WSGR Docket No. 68656-701.601

[0041] The term “endogenous” refers to any material from or produced inside an organism, cell, tissue, or system.

[0042] The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.

[0043] The term "amino acid" as used herein refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. The term “amino acid analogs” as used herein refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. The term “amino acid mimetics” as used herein refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

[0044] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a proteins or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides,WSGR Docket No. 68656-701.601 modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.

[0045] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range such as 95-99% identity, includes something with 95%, 96%, 97%, 98% or 99% identity, and includes subranges such as 96-99%, 96-98%, 96-97%.

[0046] The term “about” or “approximately” can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, within 5-fold, or within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0047] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.

[0048] Reference in the specification to “some embodiments,” “an embodiment,” “one embodiment” or “other embodiments” means that a particular feature, structure, or characteristic described in connection with the embodiments is included in at least some embodiments, but not necessarily all embodiments, of the present disclosures.

[0049] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subjectWSGR Docket No. 68656-701.601 matter belongs. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise.II. COMPOSITIONS

[0050] In some aspects, provided herein are compositions comprising modular cellular targeting compositions or heterobifunctional recruitment compositions.A. Modular Cellular Targeting Composition

[0051] In some aspects, provided herein is a modular cellular targeting composition. In some embodiments, a modular cellular targeting composition comprises a general structure as shown and described in FIG. 1A. In some embodiments, a modular cellular targeting composition comprises a recruitment domain, and a nucleic acid targeting domain. In some embodiments, the recruitment domain, and the nucleic acid targeting domain are operatively connected. In some embodiments, the recruitment domain, and the nucleic acid targeting domain are operatively connected by a linker. In some embodiments, a modular cellular targeting composition comprises a recruitment domain, a nucleic acid targeting domain, and an endogenous enzyme. In some embodiments, a modular cellular targeting composition comprises a recruitment domain, a nucleic acid targeting domain operatively connected to the recruitment domain, and an endogenous enzyme. In some embodiments, a modular cellular targeting composition comprises a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure; and a nucleic acid targeting domain comprising a polynucleic acid, wherein the recruitment domain and the nucleic acid targeting domain are operatively connected, and wherein the recruitment domain does not comprise an inhibitor of the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a modular cellular targeting composition comprises a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure; and a nucleic acid targeting domain comprising a polynucleic acid, wherein the recruitment domain and the nucleic acid targeting domain are operatively connected, and wherein the recruitment domain does not comprise a BIX01338 inhibitor.1. Recruitment Domain

[0052] In some embodiments, a modular cellular targeting composition comprises a recruitment domain that recruits any protein or nucleic acid that modifies DNA, RNA,WSGR Docket No. 68656-701.601 epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a modular cellular targeting composition comprises a recruitment domain that recruits any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding or otherwise associating with any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding and simultaneously inhibiting any protein or nucleic acid or any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding and simultaneously agonizing any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain binds any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure via covalent or ionic bonds.

[0053] In some embodiments, a “recruitment domain” refers to a protein or nucleic acid that binds or otherwise associates with any protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. By way of example, a ten-eleven translocation 1 (TET1) recruitment domain refers to a protein or nucleic acid domain that binds or otherwise associates with a TET1 protein.

[0054] In some embodiments, the recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a DNA or RNA polymerase recruitment domain, a methyl-CpG binding protein recruitment domain, a histone tail peptide recruitment domain, a histone embedding peptide recruitment domain, a histone tail peptide recruitment domain and a histone embedding peptide recruitment domain, or a combination thereof.

[0055] In some embodiments, the recruitment domain comprises a Ubiquitin-like with PHD and Ring Finger Domain 1 (UHRF1), Ubiquitin-like with PHD and Ring Finger Domains 2 (UHRF2), Alpha-thalassemia mental retardation X-linked (ATRX), Death-associated protein 6 (DAXX), SMCHD1, or an 11 -zinc finger protein (CTCF) recruitment domain.WSGR Docket No. 68656-701.601

[0056] In some embodiments, the DNA demethylase recruitment domain comprises a ten- eleven translocation 1 (TET1), ten-eleven translocation 2 (TET2), ten-eleven translocation 3 (TET3), Thymine-DNA glycosylase (TDG), Activation-induced cytidine deaminase (AID), or a Methyl-CpG-binding domain protein 4 (MBD4) recruitment domain.

[0057] In some embodiments, the histone acetyltransferase recruitment domain comprises, a p300, CREB binding protein (CBP), General control non-depressible 5 (GCN5), P300 / CBP- associated factor (PCAF), Tip60, Histone acetyltransferase 1 (HAT1), lysine acetyltransferase 2 A (KAT2A), lysine acetyltransferase 2 B (KAT2B), lysine acetyltransferase 5 (KAT5), lysine acetyltransferase 6 A (KAT6A), lysine acetyltransferase 6 B (KAT6B), lysine acetyltransferase 7 (KAT7), or lysine acetyltransferase 8 (KAT8) recruitment domain.

[0058] In some embodiments, the histone deacetylase recruitment domain comprises an histone deacetylase 1 (HDAC1), histone deacetylase 2 (HDAC2), histone deacetylase 3 (HDAC3), histone deacetylase 4 (HDAC4), histone deacetylase 5 (HDAC5), histone deacetylase 6 (HDAC6), histone deacetylase 7 (HDAC7), histone deacetylase 8 (HDAC8), histone deacetylase 9 (HDAC9), histone deacetylase 10 (HDAC10), histone deacetylase 11 (HDAC11), Sirtuin 1 (SIRT1), Sirtuin 2 (SIRT2), Sirtuin 3 (SIRT3), Sirtuin 4 (SIRT4), Sirtuin 5 (SIRT5), Sirtuin 6 (SIRT6), or Sirtuin 7 (SIRT7) recruitment domain.

[0059] In some embodiments, the histone methyltransferase recruitment domain comprises an functional enzymatic component of the Polycomb Repressive Complex 2 (PRC2), SETD2, ASH1 Like Histone Lysine Methyltransferase (ASH1L), Nuclear receptor-binding SET domain protein 1 (NSD1), SUV39H1 Histone Lysine Methyltransferase (SUV39H1), SUV39H2 Histone Lysine Methyltransferase (SUV39H2), Histone-lysine N-methyltransferase SETDB1 (SETDB1), Histone-lysine N-methyltransferase SETDB2 (SETDB2), Euchromatic histonelysine N-methyltransferase 2 (G9a), GLP, dotl-like histone H3K79 methyltransferase (DOT IL), or a PRDM family protein recruitment domain. In some embodiments, the functional enzymatic component of the PRC2 comprises a SUZ12, EED, EZH1, EZH2, or RBBP4 domain.

[0060] In some embodiments, the histone demethylase recruitment domain comprises an Lysine-specific histone demethylase 1 (LSD1), Lysine (K)-specific demethylase IB (KDM1B), Lysine (K)-specific demethylase 2A (KDM2A), Lysine (K)-specific demethylase 2B (KDM2B), Lysine (K)-specific demethylase 3 A (KDM3 A), Lysine (K)-specific demethylase 3B (KDM3B), Lysine (K)-specific demethylase 4A (KDM4A), Lysine (K)-specific demethylase 4B (KDM4B), Lysine (K)-specific demethylase 4C (KDM4C), Lysine (K)-specific demethylase 4D (KDM4D), Lysine (K)-specific demethylase 5A (KDM5A), Lysine (K)-specific demethylase 5B (KDM5B), Lysine (K)-specific demethylase 5C (KDM5C), Lysine (K)-specific demethylase 5D (KDM5D), Lysine (K)-specific demethylase 6A (KDM6A), Lysine (K)-specific demethylase 6B (KDM6B),WSGR Docket No. 68656-701.601Lysine (K)-specific demethylase 7A (KDM7A), or Lysine (K)-specific demethylase 8 (KDM8) recruitment domain.

[0061] In some embodiments, the histone phosphorylase recruitment domain comprises an aurora kinase, Ataxia-telangiectasia mutated kinase (ATM), Ataxia telangiectasia and Rad3- related kinase (ATR), or DNA-dependent protein kinase (DNA-PK) recruitment domain.

[0062] In some embodiments, the histone dephosphorylase recruitment domain comprises a Protein phosphatase 1 (PPI), Protein phosphatase 2A (PP2A), or Wild-type p53-induced phosphatase 1 (WIP1) recruitment domain.

[0063] In some embodiments, the histone ubiquitinase recruitment domain comprises a Ring finger protein 20 (RNF20), Ring finger protein 40 (RNF40), polycomb group RING finger protein 4 (BMI1), E3 ubiquitin-protein ligase (RING1A), or RING1B recruitment domain.

[0064] In some embodiments, the histone deubiquitinase recruitment domain comprises a ubiquitin specific peptidase 16 (USP16), ubiquitin specific peptidase 21 (USP21), or aubiquitin specific peptidase 22 (USP22) recruitment domain.

[0065] In some embodiments, the histone SUMOylase recruitment domain comprises a Protein Inhibitor of Activated STAT 1 (PIAS1), Protein Inhibitor of Activated STAT 2 (PIAS2), Protein Inhibitor of Activated STAT 3 (PIAS3), or Protein Inhibitor of Activated STAT 4 (PIAS4) recruitment domain.

[0066] In some embodiments, the histone deSUMOylase recruitment domain comprises a Sentrin-specific protease 1 (SENP1), Sentrin-specific protease 2 (SENP2), Sentrin-specific protease 3 (SENP3), Sentrin-specific protease 5 (SENP5), Sentrin-specific protease 6 (SENP6), or a Sentrin-specific protease 7 (SENP7) recruitment domain.

[0067] In some embodiments, the chromatin remodeling factor recruitment domain comprises an ATP-dependent chromatin remodeler (BRG1), BRM, chromodomain helicase DNA binding protein 1 (CHD1), chromodomain helicase DNA binding protein 2 (CHD2), chromodomain helicase DNA binding protein 3 (CHD3), chromodomain helicase DNA binding protein 4 (CHD4), INO80 Complex ATPase Subunit (INO80), or an Imitation Switch (ISWI) recruitment domain.

[0068] In some embodiments, the methyl-CpG binding protein recruitment domain comprises an MeCP2, Methyl-CpG Binding Domain Protein 1 (MBD1), Methyl-CpG Binding Domain Protein 2 (MBD2), Methyl-CpG Binding Domain Protein 3 (MBD3), or a Methyl-CpG Binding Domain Protein 4 (MBD4) recruitment domain.

[0069] In some embodiments, the recruitment domain comprises a biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a DNA or RNA recruitingWSGR Docket No. 68656-701.601 aptamer, a recruiting peptide of less than 30 amino acids, a recruiting cyclic peptide of less than 30 amino acids, a small molecule domain, or a combination thereof. In some embodiments, the recruitment domain comprises the small molecule domain.

[0070] In some embodiments, the small molecule domain comprises a 5-Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VP A, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDB1-TTD-IN-1, HAT agonists such as CTB, TTK21, YF-2, 1-CBP112, CTPB, 5-Ph-IAA- AM, YF-2, hydrochloride, SPV106 and the like, 5-methylcytosine containing RNA / DNA, or a CBP30 domain.

[0071] In some embodiments, the histone tail peptide recruitment domain comprises a peptide from about 5 to about 15 amino acids in length. In some embodiments, the histone tail peptide recruitment domain comprises about 5 amino acids to about 15 amino acids in length. In some embodiments, the histone tail peptide recruitment domain comprises about 5 amino acids to about 6 amino acids, about 5 amino acids to about 7 amino acids, about 5 amino acids to about 8 amino acids, about 5 amino acids to about 9 amino acids, about 5 amino acids to about 10 amino acids, about 5 amino acids to about 11 amino acids, about 5 amino acids to about 12 amino acids, about 5 amino acids to about 13 amino acids, about 5 amino acids to about 14 amino acids, about 5 amino acids to about 15 amino acids, about 6 amino acids to about 7 amino acids, about 6 amino acids to about 8 amino acids, about 6 amino acids to about 9 amino acids, about 6 amino acids to about 10 amino acids, about 6 amino acids to about 11 amino acids, about 6 amino acids to about 12 amino acids, about 6 amino acids to about 13 amino acids, about 6 amino acids to about 14 amino acids, about 6 amino acids to about 15 amino acids, about 7 amino acids to about 8 amino acids, about 7 amino acids to about 9 amino acids, about 7 amino acids to about 10 amino acids, about 7 amino acids to about 11 amino acids, about 7 amino acids to about 12 amino acids, about 7 amino acids to about 13 amino acids, about 7 amino acids to about 14 amino acids, about 7 amino acids to about 15 amino acids, about 8 amino acids to about 9 amino acids, about 8 amino acids to about 10 amino acids, about 8 amino acids to about 11 amino acids, about 8 amino acids to about 12 amino acids, about 8 amino acids to about 13 amino acids, about 8 amino acids to about 14 amino acids, about 8 amino acids to about 15 amino acids, about 9 amino acids to about 10 amino acids, about 9 amino acids to about 11 amino acids, about 9 amino acids to about 12 amino acids, about 9 amino acids to about 13 amino acids, about 9 amino acids to about 14 amino acids, about 9 amino acids to about 15 amino acids, about 10 amino acids to about 11 amino acids, about 10 amino acids to about 12 amino acids, about 10 amino acids to about 13 amino acids, about 10 amino acids toWSGR Docket No. 68656-701.601 about 14 amino acids, about 10 amino acids to about 15 amino acids, about 11 amino acids to about 12 amino acids, about 11 amino acids to about 13 amino acids, about 11 amino acids to about 14 amino acids, about 11 amino acids to about 15 amino acids, about 12 amino acids to about 13 amino acids, about 12 amino acids to about 14 amino acids, about 12 amino acids to about 15 amino acids, about 13 amino acids to about 14 amino acids, about 13 amino acids to about 15 amino acids, or about 14 amino acids to about 15 amino acids in length. In some embodiments, the histone tail peptide recruitment domain comprises about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 12 amino acids, about 13 amino acids, about 14 amino acids, or about 15 amino acids in length. In some embodiments, the histone tail peptide recruitment domain comprises at least about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 12 amino acids, about 13 amino acids, or about 14 amino acids in length. In some embodiments, the histone tail peptide recruitment domain comprises at most about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 12 amino acids, about 13 amino acids, about 14 amino acids, or about 15 amino acids in length.

[0072] In some embodiments, the histone tail peptide recruitment domain comprises the amino acid sequence of [SEQ ID NO: 1] (ARTKQTARKSTGGKAPRKQLATKAARKSAPSTGGVKK). In some embodiments, the histone tail peptide recruitment domain comprises from about 0 % to about 100 % sequence identity to SEQ ID NO: 1. In some embodiments, the histone tail peptide recruitment domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 1. In some embodiments, the histone tail peptide recruitment domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 1. In some embodiments, the histone tail peptide recruitment domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 1.

[0073] In some embodiments, the histone tail peptide recruitment domain comprises the amino acid sequence of SEQ ID NO: 2 (ARTKQTARKSTG). In some embodiments, the histone tail peptide recruitment domain comprises from about 0 % to about 100 % sequence identity to SEQ ID NO: 2. In some embodiments, the histone tail peptide recruitment domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 2. In some embodiments, the histone tail peptide recruitment domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%,WSGR Docket No. 68656-701.601 or about 99% sequence identity to SEQ ID NO: 2. In some embodiments, the histone tail peptide recruitment domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 2.

[0074] In some embodiments, the histone tail peptide recruitment domain comprises the amino acid sequence of SEQ ID NO: 18 (ARTKQTARKS). In some embodiments, the histone tail peptide recruitment domain comprises from about 0 % to about 100 % sequence identity to SEQ ID NO: 18. In some embodiments, the histone tail peptide recruitment domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 18. In some embodiments, the histone tail peptide recruitment domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 18. In some embodiments, the histone tail peptide recruitment domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 18.

[0075] In some embodiments, the histone tail peptide recruitment domain comprises the amino acid sequence of [SEQ ID NO: 3] (AARKSAPSTGGVKK). In some embodiments, the histone tail peptide recruitment domain comprises from about 0 % to about 100 % sequence identity to SEQ ID NO: 3. In some embodiments, the histone tail peptide recruitment domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 3. In some embodiments, the histone tail peptide recruitment domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 3. In some embodiments, the histone tail peptide recruitment domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 3.

[0076] In some embodiments, the histone tail peptide recruitment domain comprises a DNMT3A, HP1, SUV39H1, H2, or PRC2 recruitment domain.

[0077] In some embodiments, the histone tail peptide recruitment domain comprises a recruitment domain and an agonist domain. In some embodiments, the recruitment domain comprises a DNMT3A, HP1, SUV39H1, or H2 recruitment domain and a PRC2 agonist domain. In some embodiments, the recruitment domain comprises SEQ ID NO: 2 or SEQ ID NO: 18 or a sequence with about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 18 and the PRC2 agonist domain comprises SEQ ID NO: 3 or a sequence with about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 3. In some embodiments, the histone tail peptide recruitment domain comprising the recruitment domain and the agonist domain comprises SEQ ID NO: 1 or a sequence with about 0 %, 10 %, 20%,WSGR Docket No. 68656-701.60130%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to SEQ ID NO: 1.

[0078] In some embodiments, the recruitment domain comprises a histone embedding peptide recruitment domain. In some embodiments, the histone embedding peptide recruitment domain comprises about 4 amino acids to about 18 amino acids in length. In some embodiments, the histone embedding peptide recruitment domain comprises about 4 amino acids to about 5 amino acids, about 4 amino acids to about 6 amino acids, about 4 amino acids to about 7 amino acids, about 4 amino acids to about 8 amino acids, about 4 amino acids to about 9 amino acids, about 4 amino acids to about 10 amino acids, about 4 amino acids to about 11 amino acids, about 4 amino acids to about 15 amino acids, about 4 amino acids to about 16 amino acids, about 4 amino acids to about 17 amino acids, about 4 amino acids to about 18 amino acids, about 5 amino acids to about 6 amino acids, about 5 amino acids to about 7 amino acids, about 5 amino acids to about 8 amino acids, about 5 amino acids to about 9 amino acids, about 5 amino acids to about 10 amino acids, about 5 amino acids to about 11 amino acids, about 5 amino acids to about 15 amino acids, about 5 amino acids to about 16 amino acids, about 5 amino acids to about 17 amino acids, about 5 amino acids to about 18 amino acids, about 6 amino acids to about 7 amino acids, about 6 amino acids to about 8 amino acids, about 6 amino acids to about 9 amino acids, about 6 amino acids to about 10 amino acids, about 6 amino acids to about 11 amino acids, about 6 amino acids to about 15 amino acids, about 6 amino acids to about 16 amino acids, about 6 amino acids to about 17 amino acids, about 6 amino acids to about 18 amino acids, about 7 amino acids to about 8 amino acids, about 7 amino acids to about 9 amino acids, about 7 amino acids to about 10 amino acids, about 7 amino acids to about 11 amino acids, about 7 amino acids to about 15 amino acids, about 7 amino acids to about 16 amino acids, about 7 amino acids to about 17 amino acids, about 7 amino acids to about 18 amino acids, about 8 amino acids to about 9 amino acids, about 8 amino acids to about 10 amino acids, about 8 amino acids to about 11 amino acids, about 8 amino acids to about 15 amino acids, about 8 amino acids to about 16 amino acids, about 8 amino acids to about 17 amino acids, about 8 amino acids to about 18 amino acids, about 9 amino acids to about 10 amino acids, about 9 amino acids to about 11 amino acids, about 9 amino acids to about 15 amino acids, about 9 amino acids to about 16 amino acids, about 9 amino acids to about 17 amino acids, about 9 amino acids to about 18 amino acids, about 10 amino acids to about 11 amino acids, about 10 amino acids to about 15 amino acids, about 10 amino acids to about 16 amino acids, about 10 amino acids to about 17 amino acids, about 10 amino acids to about 18 amino acids, about 11 amino acids to about 15 amino acids, about 11 amino acids to about 16 amino acids, about 11 amino acids to about 17 amino acids, about 11 amino acids to about 18 amino acids,WSGR Docket No. 68656-701.601 about 15 amino acids to about 16 amino acids, about 15 amino acids to about 17 amino acids, about 15 amino acids to about 18 amino acids, about 16 amino acids to about 17 amino acids, about 16 amino acids to about 18 amino acids, or about 17 amino acids to about 18 amino acids in length. In some embodiments, the histone embedding peptide recruitment domain comprises about 4 amino acids, about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 15 amino acids, about 16 amino acids, about 17 amino acids, or about 18 amino acids in length. In some embodiments, the histone embedding peptide recruitment domain comprises at least about 4 amino acids, about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 15 amino acids, about 16 amino acids, or about 17 amino acids in length. In some embodiments, the histone embedding peptide recruitment domain comprises at most about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 15 amino acids, about 16 amino acids, about 17 amino acids, or about 18 amino acids in length.

[0079] In some embodiments, the histone embedding peptide recruitment domain comprises SEQ ID NO: 4 (PGMRLRSGRSTGAP), SEQ ID NO; 5 (GKSTHPMVTRSKAD), SEQ ID NO: 6 (GRSL), SEQ ID NO: 7 (VRRSNRIRLKPLEYWR), SEQ ID NO: 8 (NVRRTKRIRLKPLEYWR), SEQ ID NO: 9 (IYTRSGRLVKPPLSFWC), SEQ ID NO: 10 (KSRRISRRPSDWWV), SEQ ID NO: 11 (LRKSTRVKVAPLQYWR), SEQ ID NO: 12 (GGYNLRPRTYQPQRYG), SEQ ID NO: 13 (FRHRKISVK), SEQ ID NO: 14 (ISLDNLVEGKRKRR), SEQ ID NO: 15 (AVYYCARKSSRLRSTLDYWGQ), SEQ ID NO: 16 (KSTHPMVTRSK), SEQ ID NO: 17 (FMKLRSGLMI), or SEQ ID NO: 18 (GMRLRSGRST).

[0080] In some embodiments, the histone embedding peptide recruitment domain comprises from about 0 % to about 100 % sequence identity to any one of SEQ ID NOs: 4-18. In some embodiments, the histone tail peptide recruitment domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity any one of SEQ ID NOs: 4-18. In some embodiments, the histone tail peptide recruitment domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to any one of SEQ ID NOs: 4-18. In some embodiments, the histone tail peptide recruitment domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 4-18.

[0081] In some embodiments, the histone embedding peptide recruitment domain comprises an endogenous peptide or a viral peptide. In some cases, the endogenous peptide comprises anWSGR Docket No. 68656-701.601IL-33 peptide. In some cases, the viral peptide comprises a KSVH LANA peptide or a CMV CTD peptide.

[0082] In some embodiments, a recruitment domain comprises a modified recruitment domain. In some embodiments, a modified recruitment domain comprises a recruitment domain that has been modified by modifying at least 1 nucleic acid or amino acid relative to an unmodified recruitment domain.

[0083] In some embodiments, a modified recruitment domain comprises about 0% to about 100% nucleic acid sequence identity to an unmodified recruitment domain.

[0084] In some embodiments, a modified recruitment domain comprises about 0% to about 100% amino acid sequence identity to an unmodified recruitment domain.2. Nucleic Acid Targeting Domain

[0085] In some embodiments, a modular cellular targeting composition comprises a nucleic acid targeting domain. In some embodiments, the nucleic acid targeting domain is designed to hybridize or otherwise associate with a target nucleic acid. In some embodiments, the target nucleic acid comprises RNA or DNA.

[0086] In some embodiments, a nucleic acid targeting domain comprises an antisense oligonucleotide (ASO), a triplex-forming oligonucleotide (TFO), a G-quadruplex binding sequence, a small activating RNA, a small interfering RNA (siRNA), a CRISPR guide RNA, an aptamer, a ribozyme, a DNAzyme, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a single guide RNA (sgRNA), a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a phosphorothioate stabilized oligonucleotide, DNA or RNA binding oligonucleotides, or a combination thereof.

[0087] In some embodiments, the nucleic acid targeting domain comprises an oligonucleotide that binds to a target DNA or RNA. In some embodiments, the target DNA or RNA comprises cis-acting non-coding RNAs, trans-acting non-coding RNAs, nuclear retained RNAs, introns of pre-mRNA, exons of mRNA, an mRNA, promoter regions of DNA, enhancer regions of DNA, silencer regions of DNA, insulator elements, topologically associating domains (TADs), DNA methylation sites, histone modification sites, DNase I hypersensitive sites, chromosome conformation capture (3C) interaction sites, a specific DNA or RNA sequence of interest, or a combination thereof.

[0088] The term “Nucleic Acid Targeting Domain” refers to a structure capable of hybridizing to a region of a nucleic acid molecule or an amino acid molecule. In some embodiments, this term includes antisense oligonucleotides (ASO), oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, triplex-forming oligonucleotides (TFO), G-WSGR Docket No. 68656-701.601 quadruplex binding sequences, small activating RNAs, small interfering RNAs (siRNA), CRISPR guide RNAs, aptamers, ribozymes, DNAzymes, peptide nucleic acids (PNA), locked nucleic acids (LNA), single guide RNAs (sgRNA), morpholino oligonucleotides, 2'-O-methyl modified oligonucleotides, phosphorothioate stabilized oligonucleotides, DNA or RNA binding oligonucleotides, or a combination thereof. Nucleic acid targeting domains may be prepared linearly and can also be joined or otherwise prepared to be circular. Moreover, branched structures are known in the art. An “antisense compound,” “ASO,” or “antisense oligomeric compound” refers to an oligomeric compound that is at least partially complementary to the region of a nucleic acid molecule to which it hybridizes, and which modulates its expression. Consequently, while all antisense compounds can be said to be oligomeric compounds, not all oligomeric compounds are antisense compounds. An “antisense oligonucleotide” is an antisense compound that is a nucleic acid-based oligomer. An antisense oligonucleotide can be chemically modified. Nonlimiting examples of oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides and alternate splicers. In one embodiment, the nucleic acid targeting domains comprises an antisense strand hybridized to a sense strand. Nucleic acid targeting domains can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or terminal bulges or loops. Nucleic acid targeting domain double-stranded compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self-complementarity to allow for hybridization and formation of a fully or partially double-stranded compound.

[0089] In some embodiments, the nucleic acid targeting domain sequence is at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides in length.

[0090] In some embodiments, the nucleic acid targeting domain sequence is about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, about 11 nucleotides, about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20WSGR Docket No. 68656-701.601 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 500 nucleotides in length.

[0091] In some embodiments, the nucleic acid targeting domain sequence is at most 3 nucleotides, at most 4 nucleotides, at most 5 nucleotides, at most 6 nucleotides, at most 7 nucleotides, at most 8 nucleotides, at most 9 nucleotides, at most 10 nucleotides, at most 11 nucleotides, at most 12 nucleotides, at most 13 nucleotides, at most 14 nucleotides, at most 15 nucleotides, at most 16 nucleotides, at most 17 nucleotides, at most 18 nucleotides, at most 19 nucleotides, at most 20 nucleotides, at most 30 nucleotides, at most 40 nucleotides, at most 50 nucleotides, at most 60 nucleotides, at most 70 nucleotides, at most 80 nucleotides, at most 90 nucleotides, at most 100 nucleotides, at most 200 nucleotides, at most 300 nucleotides, at most 400 nucleotides, or at most 500 nucleotides in length.

[0092] In some embodiments, the nucleic acid targeting domains comprise compounds from 8 to 80 nucleobases (i.e., from 8 to 80 linked nucleosides). One will appreciate that this comprehends nucleic acid targeting domains of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases.

[0093] In one embodiment, the nucleic acid targeting domains comprise 13 to 80 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67,68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases.

[0094] In one embodiment, the nucleic acid targeting domains comprise 12 to 50 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases.

[0095] In one embodiment, the nucleic acid targeting domains comprise 12 to 30 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases.

[0096] In some embodiments, the nucleic acid targeting domains comprise 15 to 30 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases.WSGR Docket No. 68656-701.601

[0097] In one embodiment, the nucleic acid targeting domains comprise 20 to 30 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases.

[0098] In one embodiment, the nucleic acid targeting domains comprise 20 to 24 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 20, 21, 22, 23, or 24 nucleobases.

[0099] In one embodiment, the nucleic acid targeting domains comprise 16 to 20 nucleobases. One will appreciate that this embodies nucleic acid targeting domains of 16, 17, 18, 19 or 20 nucleobases.

[0100] In one embodiment, the nucleic acid targeting domains comprise 20 nucleobases.

[0101] In one embodiment, the nucleic acid targeting domains comprise 19 nucleobases.

[0102] In one embodiment, the nucleic acid targeting domains comprise 18 nucleobases.

[0103] In one embodiment, the nucleic acid targeting domains comprise 17 nucleobases.

[0104] In one embodiment, the nucleic acid targeting domains comprise 16 nucleobases.

[0105] In one embodiment, the nucleic acid targeting domains comprise 15 nucleobases.

[0106] In one embodiment, the nucleic acid targeting domains comprise 14 nucleobases.

[0107] In one embodiment, the nucleic acid targeting domains comprise 13 nucleobases.

[0108] In some embodiments, a nucleic acid targeting domain comprises the nucleotide sequence of SEQ ID NO: 19 (GUAAAAGCAGAACCUGAG), SEQ ID NO: 20 (UCAUCAGCUUUUCCAGGG), SEQ ID NO: 21 (AAACUCACGGUCGGUGCA), SEQ ID NO: 22 (GUUGCUGGGUCACUCUGU), SEQ ID NO: 23 (CUCCCUUACCAUGCAGUC), SEQ ID NO: 24 (UGUGUGAGGCAGAACCUG), SEQ ID NO: 25 (GGCUAGGGCUGUCAAUCA), SEQ ID NO: 26 (GTGTCTTGCTGGACGTCA), SEQ ID NO: 27 (CTGCTGGAAGGACTTGAG), SEQ ID NO: 28 (CAATGAATGGGGCTCTGG), SEQ ID NO: 29 (AGCGGGCCCAAACTCACG), SEQ ID NO: 31 (CTCAGTAACATTGACACCAC), SEQ ID NO: 32 (AAGCAAGGGACGAGCACA), or a combination thereof. In some embodiments, a nucleic acid targeting domain comprises about 0 %, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to any one of SEQ ID NOs: 19-32. In some embodiments, a nucleic acid targeting domain comprises at least about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or about 99% sequence identity to any one of SEQ ID NOs: 19-32. In some embodiments, a nucleic acid targeting domain comprises at most about 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 19-32.

[0109] In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence upstream (i.e., 5’) or downstream (i.e., 3’) of a transcription start site ofWSGR Docket No. 68656-701.601 a gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence upstream or downstream of a transcription start site of an HTT gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence from about 0 to about 350 positions upstream of an HTT gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence from about 0 to about 550 positions downstream of an HTT gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence upstream or downstream of a transcription start site of an SOD1 gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence from about 0 to about 350 positions upstream of an SOD1 gene. In some embodiments, a nucleic acid targeting domain binds or interacts with an RNA or DNA sequence from about 0 to about 550 positions downstream of an SOD1 gene. a. Chemical Modifications of Nucleic Acid Targeting Domains

[0110] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base (sometimes referred to as a “nucleobase” or simply a “base”). The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage. It is often preferable to include chemical modifications in oligonucleotides to alter their activity. Chemical modifications can alter oligonucleotide activity by, for example: increasing affinity of a nucleic acid targeting domain for its target RNA, increasing nuclease resistance, and / or altering the pharmacokinetics of the nucleic acid targeting domain. The use of chemistries that increase the affinity of a nucleic acid targeting domain for its target can allow for the use of shorter nucleic acid targeting domain compounds.[oni] The term “nucleobase” or “heterocyclic base moiety” as used herein, refers to the heterocyclic base portion of a nucleoside. In general, a nucleobase is any group that contains one or more atom or groups of atoms capable of hydrogen bonding to a base of another nucleic acid. In addition to “unmodified” or “natural” nucleobases such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are amenable toWSGR Docket No. 68656-701.601 the compounds described herein. The terms modified nucleobase and nucleobase mimetic can overlap but generally a modified nucleobase refers to a nucleobase that is fairly similar in structure to the parent nucleobase, such as for example a 7-deaza purine, a 5-methyl cytosine, or a G-clamp, whereas a nucleobase mimetic would include more complicated structures, such as for example a tricyclic phenoxazine nucleobase mimetic. Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art.

[0112] Nucleic acid targeting domains provided herein may also contain one or more nucleosides having modified sugar moieties. The furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) and substitution of an atom or group such as — S — , — N(R) — or — C(R1)(R2) for the ring oxygen at the d'position. Modified sugar moieties are well known and can be used to alter, typically increase, the affinity of the antisense compound for its target and / or increase nuclease resistance. A representative list of modified sugars includes but is not limited to bicyclic modified sugars (BNA's), including methyleneoxy (4'-CH2-O-2') BNA and ethyleneoxy (4'-CH2CH2-O-2') BNA; and substituted sugars, especially 2 '-substituted sugars having a 2'-F, 2'-OCH2 or a 2'- O(CH2)2 — OCH3 substituent group. Sugars can also be replaced with sugar mimetic groups, among others. Methods for the preparations of modified sugars are well known to those skilled in the art. In the context of the present disclosure, chemically modified sugar moieties include, but are not limited to, 2'-O-(2 -methoxy ethyl), 2'-fluoro, 2'-dimethylaminooxy ethoxy, 2'- dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidinium ethyl, 2'-carbamate, 2'- aminooxy, 2'-acetamido, methyleneoxy (4'-CH2-O-2') BNA and ethyleneoxy (4'-CH2CH2-O- 2') BNA.

[0113] The nucleic acid targeting domains described herein may include intemucleoside linking groups that link the nucleosides or otherwise modified monomer units together thereby forming a nucleic acid targeting domain. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Representative non-phosphorus containing intemucleoside linking groups include, but are not limited to, methylenemethylimino ( — CH2 — N(CH3) — O — CH2 — ), thiodiester ( — O — C(O) — S — ), thionocarbamate ( — O — C(O)(NH) — S — ); siloxane ( — O — Si(H)2-0 — ); and N,N'- dimethylhydrazine ( — CH2 — N(CH3) — N(CH3) — ). Nucleic acid targeting domains having non-phosphorus intemucleoside linking groups are referred to as oligonucleosides. Modified intemucleoside linkages, compared to natural phosphodiester linkages, can be used to alter,WSGR Docket No. 68656-701.601 typically increase, nuclease resistance of the antisense compound. Internucleoside linkages having a chiral atom can be prepared racemic, chiral, or as a mixture. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known to those skilled in the art.

[0114] In some embodiments, suitable modifications used in nucleic acid targeting domains include, but are not limited to, 4'-thio-modified bases: 4'-thio-adenosine, 4'-thio-guanosine, 4'- thio-cytidine, 4'-thio-uridine, 4'-thio-5-methyl-cytidine, 4'-thio-pseudouridine, and 4'-thio-2- thiouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4- thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3 -methyluridine, 5-carboxymethyl- uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-l -methylpseudouridine, 2-thio-l-methyl-pseudouridine, 1 -methyl- 1-deaza-pseudouri dine, 2-thio-l- methyl-l-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2- thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl- cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1- methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio- 5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio-l- methyl-l-deaza-pseudoisocytidine, 1-methyl-l-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-m ethoxy -pseudoisocytidine, 4-methoxy-l-methyl- pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine,7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8- aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6- (cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladeno sine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2- methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine,7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy -guanosine, 1- methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2- dimethyl-6-thio-guanosine, and combinations thereof.WSGR Docket No. 68656-701.601

[0115] As used herein the term “mimetic” refers to groups that are substituted for some sugar, a nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-intemucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino. Representative examples of a mimetic for a sugarinternucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases. Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.

[0116] As used herein the term “nucleoside” includes, nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and / or sugar groups.

[0117] As used herein, the term “oligonucleotide” refers to an oligomeric compound which is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term includes oligonucleotides composed of naturally- and non-naturally occurring nucleobases, sugars and covalent internucleoside linkages, possibly further including non-nucleic acid conjugates.

[0118] The present disclosure provides compounds having reactive phosphorus groups useful for forming internucleoside linkages including for example phosphodiester and phosphorothioate intemucleoside linkages. Methods of preparation and / or purification of precursors or antisense compounds are not a limitation of the compositions or methods provided herein. Methods for synthesis and purification of DNA, RNA, and the nucleic acid targeting domains provided herein are well known to those skilled in the art.

[0119] As used herein the term “chimeric antisense compound” refers to an antisense compound, having at least one sugar, nucleobase and / or internucleoside linkage that is differentially modified as compared to the other sugars, nucleobases and internucleoside linkages within the same oligomeric compound. The remainder of the sugars, nucleobases and internucleoside linkages can be independently modified or unmodified. In general a chimeric oligomeric compound will have modified nucleosides that can be in isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and or mimetic groups can comprise a chimeric oligomeric compound.

[0120] In some embodiments, chimeric nucleic acid targeting domains contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. An additional region of theWSGR Docket No. 68656-701.601 nucleic acid targeting domain may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. As used herein, the term “fully modified motif’ refers to an antisense compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.

[0121] The nucleic acid targeting domains may contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or p, or as (D) or (L) such as for amino acids et al. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms.

[0122] In one aspect, nucleic acid targeting domains are modified by covalent attachment of one or more conjugate groups. Conjugate groups may be attached by reversible or irreversible attachments. Conjugate groups may be attached directly to antisense compounds or by use of a linker. Linkers may be mono- or bifunctional linkers. Such attachment methods and linkers are well known to those skilled in the art. In general, conjugate groups may be attached to nucleic acid targeting domains to modify one or more properties. Such considerations are well known to those skilled in the art. b. Nucleic Acid Targeting Domain Synthesis

[0123] Nucleic Acid Targeting Domain may be synthesized by oligomerization. Oligomerization of modified and unmodified nucleosides can be routinely performed according to literature procedures for DNA and / or RNA.

[0124] Nucleic acid targeting domains can be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The disclosure is not limited by the method of antisense compound synthesis.WSGR Docket No. 68656-701.601 c. Nucleic Acid Targeting Domain Purification and Analysis

[0125] Methods of nucleic acid targeting domain purification and analysis are known in the art. Analysis methods include capillary electrophoresis (CE) and electrospray-mass spectroscopy. Such synthesis and analysis methods can be performed in multi-well plates. The methods described herein are not limited by the method of nucleic acid targeting domain purification.3. Select Embodiments of Modular Cellular Targeting Compositions

[0126] In some embodiments, a modular cellular targeting composition comprises a formula A-B-C, wherein A comprises a recruitment domain, B comprises a linker, and C comprises a nucleic acid targeting domain. In some embodiments, A comprises a recruitment domain as disclosed herein. In some embodiments, B comprises a linker as disclosed herein. In some embodiments, C comprises a nucleic acid targeting domain as disclosed herein.

[0127] In some embodiments, a modular cellular targeting composition comprises a formula A’-A-B-C, wherein A’ comprises an epigenetic enzyme, a DNA enzyme, or an RNA enzyme, A comprises a recruitment domain, B comprises a linker, and C comprises a nucleic acid targeting domain.

[0128] In some embodiments, a modular cellular targeting composition comprises a formula A’-A-B-C, wherein A’ comprises an endogenous epigenetic enzyme, an endogenous DNA enzyme, or an endogenous RNA enzyme, A comprises a recruitment domain, B comprises a linker, and C comprises a nucleic acid targeting domain.

[0129] In some embodiments, a modular cellular targeting composition comprises a DNA methyltransferase recruitment domain, a linker, and a nucleic acid targeting domain comprising any one of SEQ ID NOs: 19-32, wherein the nucleic acid targeting domain comprises a 2'-O- methyl modified oligonucleotide, a phosphorothioate stabilized oligonucleotide, or a combination thereof.

[0130] In some embodiments, a modular cellular targeting composition comprises a DNA methyltransferase recruitment domain, a linker, and a nucleic acid targeting domain comprising any one of SEQ ID NOs: 19-32, wherein the nucleic acid targeting domain comprises a 2'-O- methyl modified oligonucleotide and a phosphorothioate stabilized oligonucleotide.B. Heterobifunctional Recruitment Composition

[0131] In some aspects, provided herein is a heterobifunctional recruitment composition. In some embodiments, a heterobifunctional recruitment composition comprises a general structure as shown and described in FIG. IB. In some embodiments, a heterobifunctional recruitmentWSGR Docket No. 68656-701.601 composition comprises a first recruitment domain, and a second recruitment domain. In some embodiments, the first recruitment domain, and the second recruitment domain are operatively connected. In some embodiments, the first recruitment domain, and the second recruitment domain are operatively connected by a linker. In some embodiments, a heterobifunctional recruitment composition comprises a first recruitment domain, a second recruitment domain, and an endogenous enzyme. In some embodiments, a comprises a first recruitment domain, a second recruitment domain operatively connected to the first recruitment domain, and an endogenous enzyme. In some embodiments, a heterobifunctional recruitment composition further comprises a nucleic acid targeting domain. In some embodiments, a heterobifunctional recruitment composition comprises a recruitment domain, wherein the recruitment domain comprises a first recruitment domain and a second recruitment domain, wherein the first recruitment domain comprises a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure, and the second recruitment domain comprises a recruitment domain for a genome associated protein, wherein the first recruitment domain and the second recruitment domain are operatively connected and wherein the genome associated protein does not comprise an anchored transcription factor.1. First Recruitment Domain

[0132] In some embodiments, a heterobifunctional recruitment composition comprises a recruitment domain that recruits any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding or otherwise associating with any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding and simultaneously inhibiting any protein or nucleic acid, or any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain functions by binding and simultaneously agonizing any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure. In some embodiments, a recruitment domain binds any endogenous protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure via covalent or ionic bonds.

[0133] In some embodiments, a first recruitment domain refers to a protein or nucleic acid that binds or otherwise associates with any protein or nucleic acid that modifies DNA, RNA,WSGR Docket No. 68656-701.601 epigenetic markers, histones, chromatin, histone structure, or chromatin structure. By way of example, a ten-eleven translocation 1 (TET1) recruitment domain refers to a protein or nucleic acid domain that binds or otherwise associates with a TET1 protein.

[0134] In some embodiments, the first recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, or a methyl-CpG binding protein recruitment domain.

[0135] In some embodiments, the first recruitment domain comprises a Ubiquitin-like with PHD and Ring Finger Domain 1 (UHRF1), Ubiquitin-like with PHD and Ring Finger Domains 2 (UHRF2), Alpha-thalassemia mental retardation X-linked (ATRX), Death-associated protein 6 (DAXX), SMCHD1, or an 11 -zinc finger protein (CTCF) recruitment domain.

[0136] In some embodiments, the DNA demethylase recruitment domain comprises a ten- eleven translocation 1 (TET1), ten-eleven translocation 2 (TET2), ten-eleven translocation 3 (TET3), Thymine-DNA glycosylase (TDG), Activation-induced cytidine deaminase (AID), or a Methyl-CpG-binding domain protein 4 (MBD4) recruitment domain.

[0137] In some embodiments, the histone acetyltransferase recruitment domain comprises, a p300, CREB binding protein (CBP), General control non-depressible 5 (GCN5), P300 / CBP- associated factor (PCAF), Tip60, Histone acetyltransferase 1 (HAT1), lysine acetyltransferase 2 A (KAT2A), lysine acetyltransferase 2 B (KAT2B), lysine acetyltransferase 5 (KAT5), lysine acetyltransferase 6 A (KAT6A), lysine acetyltransferase 6 B (KAT6B), lysine acetyltransferase 7 (KAT7), or lysine acetyltransferase 8 (KAT8) recruitment domain.

[0138] In some embodiments, the histone deacetylase recruitment domain comprises an histone deacetylase 1 (HDAC1), histone deacetylase 2 (HDAC2), histone deacetylase 3 (HDAC3), histone deacetylase 4 (HDAC4), histone deacetylase 5 (HDAC5), histone deacetylase 6 (HDAC6), histone deacetylase 7 (HDAC7), histone deacetylase 8 (HDAC8), histone deacetylase 9 (HDAC9), histone deacetylase 10 (HDAC10), histone deacetylase 11 (HDAC11), Sirtuin 1 (SIRT1), Sirtuin 2 (SIRT2), Sirtuin 3 (SIRT3), Sirtuin 4 (SIRT4), Sirtuin 5 (SIRT5), Sirtuin 6 (SIRT6), or Sirtuin 7 (SIRT7) recruitment domain.

[0139] In some embodiments, the histone methyltransferase recruitment domain comprises an functional enzymatic component of the Polycomb Repressive Complex 2 (PRC2), SETD2, ASH1 Like Histone Lysine Methyltransferase (ASH1L), Nuclear receptor-binding SET domainWSGR Docket No. 68656-701.601 protein 1 (NSD1), SUV39H1 Histone Lysine Methyltransferase (SUV39H1), SUV39H2 Histone Lysine Methyltransferase (SUV39H2), Histone-lysine N-methyltransferase SETDB1 (SETDB1), Histone-lysine N-methyltransferase SETDB2 (SETDB2), Euchromatic histonelysine N-methyltransferase 2 (G9a), GLP, dotl-like histone H3K79 methyltransferase (DOT IL), or a PRDM family protein recruitment domain. In some embodiments, the functional enzymatic component of the PRC2 comprises a SUZ12, EED, EZH1, EZH2, or RBBP4 domain.

[0140] In some embodiments, the histone demethylase recruitment domain comprises an Lysine-specific histone demethylase 1 (LSD1), Lysine (K)-specific demethylase IB (KDM1B), Lysine (K)-specific demethylase 2A (KDM2A), Lysine (K)-specific demethylase 2B (KDM2B), Lysine (K)-specific demethylase 3 A (KDM3 A), Lysine (K)-specific demethylase 3B (KDM3B), Lysine (K)-specific demethylase 4A (KDM4A), Lysine (K)-specific demethylase 4B (KDM4B), Lysine (K)-specific demethylase 4C (KDM4C), Lysine (K)-specific demethylase 4D (KDM4D), Lysine (K)-specific demethylase 5A (KDM5A), Lysine (K)-specific demethylase 5B (KDM5B), Lysine (K)-specific demethylase 5C (KDM5C), Lysine (K)-specific demethylase 5D (KDM5D), Lysine (K)-specific demethylase 6A (KDM6A), Lysine (K)-specific demethylase 6B (KDM6B), Lysine (K)-specific demethylase 7A (KDM7A), or Lysine (K)-specific demethylase 8 (KDM8) recruitment domain.

[0141] In some embodiments, the histone phosphorylase recruitment domain comprises an aurora kinase, Ataxia-telangiectasia mutated kinase (ATM), Ataxia telangiectasia and Rad3- related kinase (ATR), or DNA-dependent protein kinase (DNA-PK) recruitment domain.

[0142] In some embodiments, the histone dephosphorylase recruitment domain comprises a Protein phosphatase 1 (PPI), Protein phosphatase 2A (PP2A), or Wild-type p53-induced phosphatase 1 (WIP1) recruitment domain.

[0143] In some embodiments, the histone ubiquitinase recruitment domain comprises a Ring finger protein 20 (RNF20), Ring finger protein 40 (RNF40), polycomb group RING finger protein 4 (BMI1), E3 ubiquitin-protein ligase (RING1A), or RING1B recruitment domain.

[0144] In some embodiments, the histone deubiquitinase recruitment domain comprises a ubiquitin specific peptidase 16 (USP16), ubiquitin specific peptidase 21 (USP21), or aubiquitin specific peptidase 22 (USP22) recruitment domain.

[0145] In some embodiments, the histone SUMOylase recruitment domain comprises a Protein Inhibitor of Activated STAT 1 (PIAS1), Protein Inhibitor of Activated STAT 2 (PIAS2), Protein Inhibitor of Activated STAT 3 (PIAS3), or Protein Inhibitor of Activated STAT 4 (PIAS4) recruitment domain.

[0146] In some embodiments, the histone deSUMOylase recruitment domain comprises a Sentrin-specific protease 1 (SENP1), Sentrin-specific protease 2 (SENP2), Sentrin-specificWSGR Docket No. 68656-701.601 protease 3 (SENP3), Sentrin-specific protease 5 (SENP5), Sentrin-specific protease 6 (SENP6), or a Sentrin-specific protease 7 (SENP7) recruitment domain.

[0147] In some embodiments, the chromatin remodeling factor recruitment domain comprises an ATP-dependent chromatin remodeler (BRG1), BRM, chromodomain helicase DNA binding protein 1 (CHD1), chromodomain helicase DNA binding protein 2 (CHD2), chromodomain helicase DNA binding protein 3 (CHD3), chromodomain helicase DNA binding protein 4 (CHD4), INO80 Complex ATPase Subunit (INO80), or an Imitation Switch (ISWI) recruitment domain.

[0148] In some embodiments, the methyl-CpG binding protein recruitment domain comprises an MeCP2, Methyl-CpG Binding Domain Protein 1 (MBD1), Methyl-CpG Binding Domain Protein 2 (MBD2), Methyl-CpG Binding Domain Protein 3 (MBD3), or a Methyl-CpG Binding Domain Protein 4 (MBD4) recruitment domain.

[0149] In some embodiments, the recruitment domain comprises a biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a DNA or RNA recruiting aptamer, a recruiting peptide of less than 30 amino acids, a recruiting cyclic peptide of less than 30 amino acids, a small molecule domain, or a combination thereof. In some embodiments, the recruitment domain comprises the small molecule domain.

[0150] In some embodiments, the small molecule domain comprises a 5-Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VP A, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDB1-TTD-IN-1, HAT agonists (CTB, TTK21, YF-2, 1-CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, SPV106), 5-methylcytosine containing RNA / DNA, or a CBP30 domain.2. Second Recruitment Domain

[0151] In some embodiments, a heterobifunctional recruitment composition comprises a second recruitment domain. In some embodiments, the second recruitment domain comprises a genome-associated protein recruitment domain.

[0152] In some embodiments, a second recruitment domain refers to a protein or nucleic acid that binds or otherwise associates with any protein or nucleic acid that is a transcription factor, a transcriptional coactivator, a transcriptional corepressor, a chromatin remodeling factors, a histone modifier, a DNA modifier, an architectural protein, an RNA polymerase II and associated factor, a mediator complex component, an enhancer-associated factor, an insulator protein, a topoisomerase, a pioneer factor, a polycomb group protein, a trithorax group protein, aWSGR Docket No. 68656-701.601 heterochromatin protein, a DNA methylation reader, a histone modification reader, a long noncoding RNA associated with chromatin, or a combination thereof.

[0153] In some embodiments, a second recruitment domain comprises a genome-associated protein recruitment domain, a transcription factor recruitment domain, a transcriptional coactivator recruitment domain, a transcriptional corepressor recruitment domain, a chromatin remodeling factors recruitment domain, a histone modifier recruitment domain, a DNA modifier recruitment domain, an architectural protein recruitment domain, an RNA polymerase II and associated factor recruitment domain, a mediator complex component recruitment domain, an enhancer-associated factor recruitment domain, an insulator protein recruitment domain, a topoisomerase recruitment domain, a pioneer factor recruitment domain, a polycomb group protein recruitment domain, a trithorax group protein recruitment domain, a heterochromatin protein recruitment domain, a DNA methylation reader recruitment domain, a histone modification reader recruitment domain, a long non-coding RNAs associated with chromatin recruitment domain, or a combination thereof.

[0154] In some embodiments, the second recruitment domain comprises a recruitment domain for a genome associated protein, wherein the genome associated protein does not comprise an anchored transcription factor.3. Nucleic Acid Targeting Domain

[0155] In some embodiments, a heterobifunctional recruitment composition further comprises a nucleic acid targeting domain as disclosed herein.4. Select Embodiments of Heterobifunctional Recruitment Compositions

[0156] In some embodiments, a heterobifunctional recruitment compositions comprises a formula A-B-C, wherein A comprises a first recruitment domain, B comprises a linker, and C comprises a second recruitment domain. In some embodiments, A comprises a first recruitment domain as disclosed herein. In some embodiments, B comprises a linker as disclosed herein. In some embodiments, C comprises a second recruitment domain as disclosed herein.

[0157] In some embodiments, a modular cellular targeting composition comprises a formula A’-A-B-C, wherein A’ comprises an epigenetic enzyme, a DNA enzyme, or an RNA enzyme, A comprises a first recruitment domain as disclosed herein, B comprises a linker as disclosed herein, and C comprises a second recruitment domain as disclosed herein.

[0158] In some embodiments, a modular cellular targeting composition comprises a formula A’-A-B-C, wherein A’ comprises an endogenous epigenetic enzyme, an endogenous DNA enzyme, or an endogenous RNA enzyme, A comprises a first recruitment domain as disclosedWSGR Docket No. 68656-701.601 herein, B comprises a linker as disclosed herein, and C comprises a second recruitment domain as disclosed herein.C. Additional Components of Modular Cellular Targeting Compositions or Heterobifunctional Recruitment Compositions1. Enzymes or Endogenous Enzymes

[0159] In some embodiments, a modular cellular targeting composition or heterobifunctional recruitment composition comprises an enzyme or is designed to recruit an endogenous enzyme. In some embodiments, the endogenous enzyme comprises an epigenetic enzyme, or a DNA / RNA modulating enzyme.

[0160] Epigenetic enzymes: In some embodiments, the epigenetic enzyme comprises any enzyme or protein capable of modifying the epigenome or an epigenetic marker. In some embodiments, the epigenetic enzyme or protein comprises a DNA methyltransferase, a DNA demethylase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a DNA or RNA polymerase, or a methyl-CpG binding protein.

[0161] DNA / RNA modifying enzymes: In some embodiments, a DNA / RNA modifying enzyme may be used in the compositions disclosed herein. In some embodiments, a DNA / RNA modifying enzyme comprises a polymerase. The polymerases may be wild type polymerases, functional fragments, mutants, variants, or truncated variants, and the like. The polymerases may include wild type polymerases from eukaryotic, prokaryotic, archael, or viral organisms, and / or the polymerases may be modified by genetic engineering, mutagenesis, directed evolution-based processes. The polymerases may include T7 DNA polymerase, T5 DNA polymerase, T4 DNA polymerase, Klenow fragment DNA polymerase, DNA polymerase III and the like. The polymerases may also be thermostable, and may include Taq, Tne, Tma, Pfu, Tfl, Tth, Stoffel fragment, VENT® and DEEPVENT® DNA polymerases, KOD, Tgo, JDF3, an RNA polymerase e.g., RNA polymerase I-V, T3, T7 or SP6 RNA polymerase, a reverse transcriptase, or mutants, variants and derivatives thereof.2. Linkers

[0162] In some embodiments, a modular cellular targeting composition comprises a linker. In some embodiments, the linker connects the recruitment domain and the nucleic acid targeting domain.WSGR Docket No. 68656-701.601

[0163] In some embodiments, the linker comprises a cleavable linker, a flexible linker, a ph- sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof.

[0164] In some embodiments, the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety.

[0165] In some embodiments, the linker comprises a tissue-specific cleavable linker.

[0166] In some embodiments, the tissue-specific cleavable linker comprises: a protease- cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme-cleavable linker, a light-sensitive linker, or a combination thereof.

[0167] In some embodiments, the linker sequence is at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides in length.

[0168] In some embodiments, the linker sequence is about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, about 11 nucleotides, about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 500 nucleotides in length.

[0169] In some embodiments, the linker sequence is at most 3 nucleotides, at most 4 nucleotides, at most 5 nucleotides, at most 6 nucleotides, at most 7 nucleotides, at most 8 nucleotides, at most 9 nucleotides, at most 10 nucleotides, at most 11 nucleotides, at most 12 nucleotides, at most 13 nucleotides, at most 14 nucleotides, at most 15 nucleotides, at most 16 nucleotides, at most 17 nucleotides, at most 18 nucleotides, at most 19 nucleotides, at most 20 nucleotides, at most 30 nucleotides, at most 40 nucleotides, at most 50 nucleotides, at most 60 nucleotides, at most 70 nucleotides, at most 80 nucleotides, at most 90 nucleotides, at most 100WSGR Docket No. 68656-701.601 nucleotides, at most 200 nucleotides, at most 300 nucleotides, at most 400 nucleotides, or at most 500 nucleotides in length.

[0170] In some embodiments, the linker sequence is at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 11 amino acids, at least 12 amino acids, at least 13 amino acids, at least 14 amino acids, at least 15 amino acids, at least 16 amino acids, at least 17 amino acids, at least 18 amino acids, at least 19 amino acids, at least 20 amino acids, at least 30 amino acids, at least 40 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids, at least 100 amino acids, at least 200 amino acids, at least 300 amino acids, at least 400 amino acids, or at least 500 amino acids in length.

[0171] In some embodiments, the linker sequence is about 3 amino acids, about 4 amino acids, about 5 amino acids, about 6 amino acids, about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, about 11 amino acids, about 12 amino acids, about 13 amino acids, about 14 amino acids, about 15 amino acids, about 16 amino acids, about 17 amino acids, about 18 amino acids, about 19 amino acids, about 20 amino acids, about 30 amino acids, about 40 amino acids, about 50 amino acids, about 60 amino acids, about 70 amino acids, about 80 amino acids, about 90 amino acids, about 100 amino acids, about 200 amino acids, about 300 amino acids, about 400 amino acids, or about 500 amino acids in length.

[0172] In some embodiments, the linker sequence is at most 3 amino acids, at most 4 amino acids, at most 5 amino acids, at most 6 amino acids, at most 7 amino acids, at most 8 amino acids, at most 9 amino acids, at most 10 amino acids, at most 11 amino acids, at most 12 amino acids, at most 13 amino acids, at most 14 amino acids, at most 15 amino acids, at most 16 amino acids, at most 17 amino acids, at most 18 amino acids, at most 19 amino acids, at most 20 amino acids, at most 30 amino acids, at most 40 amino acids, at most 50 amino acids, at most 60 amino acids, at most 70 amino acids, at most 80 amino acids, at most 90 amino acids, at most 100 amino acids, at most 200 amino acids, at most 300 amino acids, at most 400 amino acids, or at most 500 amino acids in length.

[0173] The linker may be as simple as a covalent bond, or it may be a polymeric linker many atoms in length. In some embodiments, the linker is a polypeptide or based on amino acids. In other embodiments, the linker is not peptide-like. In some embodiments, the linker is a covalent bond (e.g., a carbon-carbon bond, disulfide bond, carbon-heteroatom bond, etc.). In some embodiments, the linker is a carbon-nitrogen bond of an amide linkage. In some embodiments, the linker is a cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic or heteroaliphatic linker. In some embodiments, the linker is polymericWSGR Docket No. 68656-701.601(e.g., polyethylene, polyethylene glycol, polyamide, polyester, etc.). In some embodiments, the linker comprises a monomer, dimer, or polymer of aminoalkanoic acid. In some embodiments, the linker comprises an aminoalkanoic acid (e.g., glycine, ethanoic acid, alanine, beta-alanine, 3- aminopropanoic acid, 4-aminobutanoic acid, 5-pentanoic acid, etc.). In some embodiments, the linker comprises a monomer, dimer, or polymer of aminohexanoic acid (Ahx). In some embodiments, the linker is based on a carbocyclic moiety (e.g., cyclopentane, cyclohexane). In other embodiments, the linker comprises a polyethylene glycol moiety (PEG). In other embodiments, the linker comprises amino acids. In some embodiments, the linker comprises a peptide. In some embodiments, the linker comprises an aryl or heteroaryl moiety. In some embodiments, the linker is based on a phenyl ring. The linker may include funtionalized moieties to facilitate attachment of a nucleophile (e.g., thiol, amino) from the peptide to the linker. Any electrophile may be used as part of the linker. Exemplary electrophiles include, but are not limited to, activated esters, activated amides, Michael acceptors, alkyl halides, aryl halides, acyl halides, and isothiocyanates.3. Tissue Targeting Moieties

[0174] In some embodiments, the composition is operatively connected to a tissue targeting moiety.

[0175] In some embodiments, the tissue targeting moiety comprises a liver-targeting moiety, a brain-targeting moiety, a muscle-targeting moiety, a heart-targeting moiety, a kidney -targeting moiety, a lung-targeting moiety, a tumor-targeting moiety, an immune cell-targeting moiety, an ocular targeting moiety, a blood-brain-barrier crossing moiety, a cell targeting moiety; or a combination thereof.

[0176] In some embodiments, the liver-targeting moiety comprises a GalNAc moiety, an asialoglycoprotein receptor (ASGPR) ligand, a triantennary N-acetylgalactosamine, a multivalent GalNAc cluster, a peptide targeting liver-specific antigens; or a combination thereof.

[0177] In some embodiments, the brain moiety comprises a synaptic vesicle glycoprotein 2A (SV2A) binding peptide, an anti-SV2A antibody or antibody fragment, a neurotrophin receptor (p75NTR) binding peptide, a neuropilin- 1 (NRP1) targeting peptide, a neuron-specific enolase (NSE) targeting moiety, a glial fibrillary acidic protein (GFAP) targeting antibody or antibody fragment, a peptide targeting brain-specific antigens; or a combination thereof.

[0178] In some embodiments, the muscle-targeting moiety comprises, an a7pi integrin- binding peptide, a peptide targeting the acetylcholine receptor, a peptide targeting TfR, a peptide targeting muscle-specific antigens; or a combination thereof.WSGR Docket No. 68656-701.601

[0179] In some embodiments, the heart-targeting moiety comprises, a cardiac troponinbinding peptide, an anti-cardiac troponin antibody or antibody fragment, a peptide targeting cardiac-specific antigens; or a combination thereof.

[0180] In some embodiments, the kidney-targeting moiety comprises, a megalin-binding peptide, a cubilin-binding peptide, a peptide targeting kidney-specific peptide antigens; or a combination thereof.

[0181] In some embodiments, the lung-targeting moiety comprises, a pulmonary surfactant protein binding peptide, an angiotensin converting enzyme (ACE) binding peptide, a PEC AM- 1 targeting antibody or antibody fragment, a peptide targeting claudin-18, an ICAM-1 targeting moiety, a peptide targeting lung specific-antigens; or a combination thereof.

[0182] In some embodiments, the tumor-targeting moiety comprises, a folate receptor targeting moiety, an EGFR targeting antibody or antibody fragment, a HER2 targeting antibody or antibody fragment, an RGD peptide targeting avP3 integrin, a CD 19 targeting moiety, a CD20 targeting moiety, a prostate-specific membrane antigen (PSMA) targeting moiety, a GRP78 targeting peptide, a peptide targeting tumor-associated antigens; or a combination thereof.

[0183] In some embodiments, the immune cell-targeting moiety comprises, a CD3 targeting moiety, a CD4 targeting moiety, a CD8 targeting moiety, a CD40 targeting moiety, a peptide targeting CCR5, a dendritic cell-targeting antibody or antibody fragment, an immune cell targeting-peptide; or a combination thereof.

[0184] In some embodiments, the ocular targeting moiety comprises, an integrin avP3 targeting peptide, a peptide targeting retinal pigment epithelium, a transferrin receptor targeting moiety, a peptide targeting retinal ganglion cells, a peptide targeting ocular specific antigens; or a combination thereof.

[0185] In some embodiments, the blood-brain-barrier crossing moiety comprises, a transferrin receptor (TfR) binding peptide, an anti-TfR antibody or antibody fragment, a Tissue Non-Specific Alkaline Phosphatase (ALPL) binding peptide, an anti-ALPL antibody or antibody fragment, a glucose transporter 1 (GLUT1) binding peptide, a low-density lipoprotein receptor- related protein 1 (LRP1) binding peptide, an insulin receptor binding peptide, a rabies virus glycoprotein (RVG) peptide, a peptide targeting blood-brain-barrier (BBB) antigens to allow for crossing the BBB; or a combination thereof.WSGR Docket No. 68656-701.6014. Polynucleic acids

[0186] In some embodiments, a composition comprises a recombinant polynucleic acid encoding a modular cellular targeting composition or heterobifunctional recruitment composition as disclosed herein.III. PHARMACEUTICAL COMPOSITIONS

[0187] Pharmaceutical compositions or formulations comprising modular cellular targeting compositions, heterobifunctional recruitment compositions, or combinations thereof of the described compositions and for use in any of the described methods can be prepared according to conventional techniques well known in the pharmaceutical industry and described in the published literature. In some embodiments, a pharmaceutical composition or formulation is administered to a subject. In some embodiments, a pharmaceutical composition or formulation is administered to a subject to treat a subject. In some embodiments, a pharmaceutical composition or formulation is administered to a subject to treat a disease or condition in a subject in need thereof. In some embodiments, a pharmaceutical composition or formulation for treating a subject comprises an effective amount of any modular cellular targeting composition, heterobifunctional recruitment composition, or combinations thereof as described herein, or a pharmaceutically acceptable salt, solvate, hydrate or ester thereof. The pharmaceutical formulation comprising a modular cellular targeting composition, heterobifunctional recruitment composition, or combination thereof may further comprise a pharmaceutically acceptable excipient, diluent, or carrier.

[0188] Pharmaceutically acceptable salts are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. (See, e.g., S. M. Berge, et al., J. Pharmaceutical Sciences, 66: 1-19 (1977), incorporated herein by reference for this purpose. The salts can be prepared in situ during the final isolation and purification of the compounds, or separately by reacting the free base form with a suitable organic acid. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other documented methodologies such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemi sulfate,WSGR Docket No. 68656-701.601 heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3 -phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p- toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl sulfonate.

[0189] In some embodiments, the compositions are formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. In embodiments, the compositions are formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. In embodiments, a pharmaceutical formulation or composition of the present disclosure includes, but is not limited to, a solution, emulsion, microemulsion, foam or liposome-containing formulation (e.g., cationic or noncationic liposomes).

[0190] The pharmaceutical composition or formulation described herein may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients as appropriate and well known to those of skill in the art or described in the published literature. In embodiments, liposomes also include sterically stabilized liposomes, e.g., liposomes comprising one or more specialized lipids. These specialized lipids result in liposomes with enhanced circulation lifetimes. In embodiments, a sterically stabilized liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. In some embodiments, a surfactant is included in the pharmaceutical formulation or compositions. The use of surfactants in drug products, formulations and emulsions is well known in the art. In embodiments, the present disclosure employs a penetration enhancer to effect the efficient delivery of the antisense oligonucleotide, e.g., to aid diffusion across cell membranes and / or enhance the permeability of a lipophilic drug. In some embodiments, the penetration enhancers are a surfactant, fatty acid, bile salt, chelating agent, or non-chelating nonsurfactant.

[0191] In some embodiments, the pharmaceutical formulation comprises multiple modular cellular targeting compositions, heterobifunctional recruitment compositions, or combinations thereof. In embodiments, the modular cellular targeting composition, heterobifunctionalWSGR Docket No. 68656-701.601 recruitment composition, or combination thereof is administered in combination with another drug or therapeutic agent.IV. METHODSA. Methods of Using Compositions Disclosed Herein

[0192] In one aspect, disclosed herein is a method of introducing one or more modifications in an epigenome, a DNA, or an RNA, the method comprising: administering a composition or pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof. An example embodiment is shown in FIG. 2 and FIG. 3.

[0193] In one aspect, disclosed herein is a method of treating a disease or condition in a subject in need thereof the method comprising: administering a composition or pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof.

[0194] In one aspect, disclosed herein is a method of cellular reprogramming comprising a) administering a composition or pharmaceutical composition as disclosed herein to a cell b) culturing the cell, wherein the culturing comprises conditions that induces cellular reprogramming and c) isolating reprogrammed cells with a desired cellular identity.

[0195] In one aspect, disclosed herein is a method of creating epigenetic memory in cells, comprising a) administering a composition or pharmaceutical composition as disclosed herein to a cell and b) dividing the cell.

[0196] In one aspect, disclosed herein is a method of creating a synthetic transcriptional circuit comprising a) administering a first composition comprising a composition or pharmaceutical composition as disclosed herein to a cell, a tissue, a subject, or a combination thereof and b) administering a second, third, or more composition comprising a composition or pharmaceutical composition as disclosed herein to the cell, the tissue, the subject, or a combination thereof, wherein administering the first, second, third, or more composition induces a series of transcriptional events.

[0197] In some embodiments, the method of introducing one or more modifications in an epigenome, a DNA, or an RNA comprises increasing or decreasing the expression of a gene or epigenetic marker. In some embodiments, the epigenetic marker comprises increasing or decreasing methylation, increasing or decreasing acetylation, increasing or decreasing ubiquitylation, increasing or decreasing phosphorylation, increasing or decreasing sumoylation, increasing or decreasing ribosylation, increasing or decreasing citrullination, or a combination thereof. In some embodiments, the expression of the gene or the epigenetic marker is increased or decreased by from about 1% to about 100%. In some embodiments, the expression of the gene or the epigenetic marker is increased or decreased by at least or about 5%, 10%, 15%, 20%,WSGR Docket No. 68656-701.60125%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or greater than 100%. In some embodiments, the expression of the gene or the epigenetic marker is increased or decreased by at least or about 1 to 100 fold. In some embodiments, the epigenetic marker comprises any epigenetic marker.

[0198] In some embodiments, a composition as disclosed herein is administered at a dose of about 1 nM to about 12 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 1 nM to about 2 nM, about 1 nM to about 3 nM, about 1 nM to about 4 nM, about 1 nM to about 5 nM, about 1 nM to about 6 nM, about 1 nM to about 7 nM, about 1 nM to about 8 nM, about 1 nM to about 9 nM, about 1 nM to about 10 nM, about 1 nM to about 11 nM, about 1 nM to about 12 nM, about 2 nM to about 3 nM, about 2 nM to about 4 nM, about 2 nM to about 5 nM, about 2 nM to about 6 nM, about 2 nM to about 7 nM, about 2 nM to about 8 nM, about 2 nM to about 9 nM, about 2 nM to about 10 nM, about 2 nM to about 11 nM, about 2 nM to about 12 nM, about 3 nM to about 4 nM, about 3 nM to about 5 nM, about 3 nM to about 6 nM, about 3 nM to about 7 nM, about 3 nM to about 8 nM, about 3 nM to about 9 nM, about 3 nM to about 10 nM, about 3 nM to about 11 nM, about 3 nM to about 12 nM, about 4 nM to about 5 nM, about 4 nM to about 6 nM, about 4 nM to about 7 nM, about 4 nM to about 8 nM, about 4 nM to about 9 nM, about 4 nM to about 10 nM, about 4 nM to about 11 nM, about 4 nM to about 12 nM, about 5 nM to about 6 nM, about 5 nM to about 7 nM, about 5 nM to about 8 nM, about 5 nM to about 9 nM, about 5 nM to about 10 nM, about 5 nM to about 11 nM, about 5 nM to about 12 nM, about 6 nM to about 7 nM, about 6 nM to about 8 nM, about 6 nM to about 9 nM, about 6 nM to about 10 nM, about 6 nM to about 11 nM, about 6 nM to about 12 nM, about 7 nM to about 8 nM, about 7 nM to about 9 nM, about 7 nM to about 10 nM, about 7 nM to about 11 nM, about 7 nM to about 12 nM, about 8 nM to about 9 nM, about 8 nM to about 10 nM, about 8 nM to about 11 nM, about 8 nM to about 12 nM, about 9 nM to about 10 nM, about 9 nM to about 11 nM, about 9 nM to about 12 nM, about 10 nM to about 11 nM, about 10 nM to about 12 nM, or about 11 nM to about 12 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 1 nM, about 2 nM, about 3 nM, about 4 nM, about 5 nM, about 6 nM, about 7 nM, about 8 nM, about 9 nM, about 10 nM, about 11 nM, or about 12 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at least about 1 nM, about 2 nM, about 3 nM, about 4 nM, about 5 nM, about 6 nM, about 7 nM, about 8 nM, about 9 nM, about 10 nM, or about 11 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at most about 2 nM, about 3 nM, about 4 nM, about 5 nM, about 6 nM, about 7 nM, about 8 nM, about 9 nM, about 10 nM, about 11 nM, or about 12 nM.WSGR Docket No. 68656-701.601

[0199] In some embodiments, a composition as disclosed herein is administered at a dose of about 7 nM to about 16 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 7 nM to about 8 nM, about 7 nM to about 9 nM, about 7 nM to about 10 nM, about 7 nM to about 11 nM, about 7 nM to about 12 nM, about 7 nM to about 13 nM, about 7 nM to about 14 nM, about 7 nM to about 15 nM, about 7 nM to about 16 nM, about8 nM to about 9 nM, about 8 nM to about 10 nM, about 8 nM to about 11 nM, about 8 nM to about 12 nM, about 8 nM to about 13 nM, about 8 nM to about 14 nM, about 8 nM to about 15 nM, about 8 nM to about 16 nM, about 9 nM to about 10 nM, about 9 nM to about 11 nM, about9 nM to about 12 nM, about 9 nM to about 13 nM, about 9 nM to about 14 nM, about 9 nM to about 15 nM, about 9 nM to about 16 nM, about 10 nM to about 11 nM, about 10 nM to about 12 nM, about 10 nM to about 13 nM, about 10 nM to about 14 nM, about 10 nM to about 15 nM, about 10 nM to about 16 nM, about 11 nM to about 12 nM, about 11 nM to about 13 nM, about 11 nM to about 14 nM, about 11 nM to about 15 nM, about 11 nM to about 16 nM, about 12 nM to about 13 nM, about 12 nM to about 14 nM, about 12 nM to about 15 nM, about 12 nM to about 16 nM, about 13 nM to about 14 nM, about 13 nM to about 15 nM, about 13 nM to about 16 nM, about 14 nM to about 15 nM, about 14 nM to about 16 nM, or about 15 nM to about 16 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 7 nM, about 8 nM, about 9 nM, about 10 nM, about 11 nM, about 12 nM, about 13 nM, about 14 nM, about 15 nM, or about 16 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at least about 7 nM, about 8 nM, about 9 nM, about 10 nM, about 11 nM, about 12 nM, about 13 nM, about 14 nM, or about 15 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at most about 8 nM, about 9 nM, about 10 nM, about 11 nM, about 12 nM, about 13 nM, about 14 nM, about 15 nM, or about 16 nM.

[0200] In some embodiments, a composition as disclosed herein is administered at a dose of about 5 nM to about 60 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 5 nM to about 10 nM, about 5 nM to about 15 nM, about 5 nM to about 20 nM, about 5 nM to about 25 nM, about 5 nM to about 30 nM, about 5 nM to about 35 nM, about 5 nM to about 40 nM, about 5 nM to about 45 nM, about 5 nM to about 50 nM, about 5 nM to about 55 nM, about 5 nM to about 60 nM, about 10 nM to about 15 nM, about 10 nM to about 20 nM, about 10 nM to about 25 nM, about 10 nM to about 30 nM, about 10 nM to about 35 nM, about 10 nM to about 40 nM, about 10 nM to about 45 nM, about 10 nM to about 50 nM, about 10 nM to about 55 nM, about 10 nM to about 60 nM, about 15 nM to about 20 nM, about 15 nM to about 25 nM, about 15 nM to about 30 nM, about 15 nM to about 35 nM, about 15 nM to about 40 nM, about 15 nM to about 45 nM, about 15 nM to about 50 nM, aboutWSGR Docket No. 68656-701.60115 nM to about 55 nM, about 15 nM to about 60 nM, about 20 nM to about 25 nM, about 20 nM to about 30 nM, about 20 nM to about 35 nM, about 20 nM to about 40 nM, about 20 nM to about 45 nM, about 20 nM to about 50 nM, about 20 nM to about 55 nM, about 20 nM to about 60 nM, about 25 nM to about 30 nM, about 25 nM to about 35 nM, about 25 nM to about 40 nM, about 25 nM to about 45 nM, about 25 nM to about 50 nM, about 25 nM to about 55 nM, about 25 nM to about 60 nM, about 30 nM to about 35 nM, about 30 nM to about 40 nM, about 30 nM to about 45 nM, about 30 nM to about 50 nM, about 30 nM to about 55 nM, about 30 nM to about 60 nM, about 35 nM to about 40 nM, about 35 nM to about 45 nM, about 35 nM to about 50 nM, about 35 nM to about 55 nM, about 35 nM to about 60 nM, about 40 nM to about 45 nM, about 40 nM to about 50 nM, about 40 nM to about 55 nM, about 40 nM to about 60 nM, about 45 nM to about 50 nM, about 45 nM to about 55 nM, about 45 nM to about 60 nM, about 50 nM to about 55 nM, about 50 nM to about 60 nM, or about 55 nM to about 60 nM. In some embodiments, a composition as disclosed herein is administered at a dose of about 5 nM, about 10 nM, about 15 nM, about 20 nM, about 25 nM, about 30 nM, about 35 nM, about 40 nM, about 45 nM, about 50 nM, about 55 nM, or about 60 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at least about 5 nM, about 10 nM, about 15 nM, about 20 nM, about 25 nM, about 30 nM, about 35 nM, about 40 nM, about 45 nM, about 50 nM, or about 55 nM. In some embodiments, a composition as disclosed herein is administered at a dose of at most about 10 nM, about 15 nM, about 20 nM, about 25 nM, about 30 nM, about 35 nM, about 40 nM, about 45 nM, about 50 nM, about 55 nM, or about 60 nM.B. Diseases & Conditions and Methods of Treatment

[0201] Any of the compositions provided herein may be administered to an individual. “Individual” may be used interchangeably with “subject” or “patient.” An individual may be a mammal, for example a human or animal such as a non-human primate, a rodent, a rabbit, a rat, a mouse, a horse, a donkey, a goat, a cat, a dog, a cow, a pig, or a sheep. In embodiments, the individual is a human. In embodiments, the individual is a fetus, an embryo, or a child. In other embodiments, the individual may be another eukaryotic organism, such as a plant. In some embodiments, the compositions provided herein are administered to a cell ex vivo.

[0202] In some embodiments, the compositions provided herein are administered to an individual as a method of treating a disease or disorder. In some embodiments, the individual has a genetic disease, such as any of the diseases described herein. In some embodiments, the individual is at risk of having a disease, such as any of the diseases described herein. In some embodiments, the individual is at increased risk of having a disease or disorder caused by insufficient amount of a protein or insufficient activity of a protein. If an individual is “at anWSGR Docket No. 68656-701.601 increased risk” of having a disease or disorder caused insufficient amount of a protein or insufficient activity of a protein, the method involves preventative or prophylactic treatment. For example, an individual may be at an increased risk of having such a disease or disorder because of family history of the disease. In some embodiments, individuals at an increased risk of having such a disease or disorder benefit from prophylactic treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder). In embodiments, a fetus is treated in utero, e.g., by administering a composition as disclosed herein to the fetus directly or indirectly (e.g., via the mother). In some cases, the subject pharmaceutical composition and method are applicable for treatment of an eye disease or condition. In some cases, the subject pharmaceutical composition and method are applicable for treatment of Optic atrophy type 1, autosomal dominant optic atrophy (ADOA), ADOA-plus syndrome; a mitochondrial disorder; glaucoma; normal tension glaucoma; Charcot-Marie-Tooth disease; mitochondria dysfunction; diabetic retinopathy; age-related macular degeneration; retinal ganglion cell death; mitochondrial fission-mediated mitochondrial dysfunction; progressive external ophthalmoplegia; deafness; ataxia; motor neuropathy; sensory neuropathy; myopathy; Behr syndrome; brain dysfunction; encephalopathy; peripheral neuropathy; fatal infantile mitochondrial encephalomyopathy; hypertrophic cardiomyopathy; spastic ataxic syndrome; sensory motor peripheral neuropathy; hypotonia; gastrointestinal dysmotility and dysphagia; optic atrophy; optic atrophy plus syndrome; Mitochondrial DNA depletion syndrome 14; late- onset cardiomyopathy; diabetic cardiomyopathy; Alzheimer’s Disease; focal segmental glomerulosclerosis; kidney disease; Huntington’s Disease; cognitive function decline in healthy aging; Prion diseases; late onset dementia and parkinsonism; mitochondrial myopathy; Leigh syndrome; Friedreich’s ataxia; Parkinson’s disease; MELAS (Mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes); pyruvate dehydrogenase complex deficiency; chronic kidney disease; Leber’s hereditary optic neuropathy; obesity; age-related systemic neurodegeneration; skeletal muscle atrophy; heart and brain ischemic damage; massive liver apoptosis; NARP (neuropathy, ataxia, retinitis pigmentosa); MERRF (myoclonic epilepsy and ragged red fibers); Dravet Syndrome; Haploinsufficiencies; Pearsons / Kerns-Sayre syndrome; MIDD (maternally inherited diabetes and deafness); mitochondrial trifunctional protein deficiency; Fuchs corneal endothelial dystrophy; macular telangiectasia; retinitis pigmentosa; Leber congenital amaurosis; inherited maculopathy; Stargardt disease; Sorsby fundus dystrophy; progressive supranuclear palsy; angelman syndrome; prader-willi; cancer; type 1 or type 2 diabetes; liver disease; kidney disease; eye disease; a disease or condition associated with the central nervous system; or a disease or condition associated with the peripheral nervous system.WSGR Docket No. 68656-701.601

[0203] In some embodiments, the compositions and methods provided herein are applicable for treatment of mitochondrial disorders, for instance, alleviation of one or more optic symptoms of a primary mitochondrial disorder. In some cases, the compositions and methods provided herein are applicable for treatment of optic neuropathies (e.g., DOA or dominant optic atrophy, LHON or Leber hereditary optic neuropathy), CPEO (chronic progressive external ophthalmoplegia), or pigmentary retinopathy (e.g., NARP (neuropathy, ataxia, retinitis pigmentosa), MELAS (mitochondrial encephalopathy, lactic acidosis and stroke like episodes), MERRF (myoclonic epilepsy and ragged red fibers), Leigh syndrome, Pearsons / Kerns-Sayre syndrome, MIDD (maternally inherited diabetes and deafness), or mitochondrial trifunctional protein deficiency). In some embodiments, the compositions and methods provided herein are applicable for treatment of age-related ophthalmic diseases with associated mitochondrial dysfunction, such as Glaucoma, age-related macular degeneration, diabetic retinopathy, Fuchs corneal endothelial dystrophy, or Macular telangiectasia.

[0204] In some embodiments, the compositions and methods provided herein are applicable for treatment of hereditary ophthalmic diseases with associated mitochondrial dysfunction, such as, Retinitis pigmentosa (e.g., CERKL retinitis pigmentosa), Leber congenital amaurosis, or Inherited maculopathies (e.g., Stargardt’ s disease or Sorsby’ s fundus dystrophy).

[0205] In some cases, a therapeutic agent comprises a composition or pharmaceutical composition as disclosed herein. In some cases, a therapeutic agent comprises a vector, e.g., a viral vector, expressing a composition that binds to a targeted region of a pre-mRNA that encodes a target sequence. The methods provided herein can be adapted to contacting a vector that encodes an agent, e.g., an oligonucleotide, to a cell, so that the agent binds to a pre-mRNA in the cell and modulates the processing of the pre-mRNA. In some cases, the viral vector comprises an adenoviral vector, adeno-associated viral (AAV) vector, lentiviral vector, Herpes Simplex Virus (HSV) viral vector, retroviral vector, or any applicable viral vector. In some cases, a therapeutic agent comprises a gene editing tool that is configured to modify a gene encoding the target peptide sequence such that a gene region that encodes the inefficient translation region is deleted. In some cases, a gene editing tool comprises vector, e.g., viral vector, for gene editing based on CRISPR-Cas9, TALEN, Zinc Finger, or other applicable technologies.C. Administration

[0206] Suitable routes for administration of a composition or pharmaceutical composition as disclosed herein may vary depending on cell type to which delivery of the composition or pharmaceutical composition is desired. The composition or pharmaceutical composition of theWSGR Docket No. 68656-701.601 present disclosure may be administered to patients parenterally, for example, by intravitreal injection, intrathecal injection, intracerebroventricular injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection. In some embodiments, the composition or pharmaceutical composition of the present disclosure is administered as a naked nucleic acid.

[0207] In embodiments, the composition or pharmaceutical composition is administered with one or more agents capable of promoting penetration of the composition or pharmaceutical composition across the blood-brain barrier by any method known in the art.

[0208] In some embodiments, the composition or pharmaceutical composition is administered without a vector. In some embodiments, the composition or pharmaceutical composition is administered without a vector when the composition or pharmaceutical composition does not comprise an epigenetic or DNA / RNA modifying enzyme fused to the composition or pharmaceutical composition.

[0209] In embodiments, the composition or pharmaceutical composition is administered with a tissue targeting moiety as disclosed herein to facilitate tissue specific administration.

[0210] In some embodiments, a composition or pharmaceutical composition as disclosed herein is administered non-virally.D. Additional Delivery Options

[0211] In some aspects, the disclosure provides methods comprising delivering one or more compositions, such as or one or more modular cellular targeting compositions or heterobifunctional recruitment compositions as described herein, or one or more recombinant polynucleic acids encoding one or more components of a modular cellular targeting composition or heterobifunctional recruitment composition as described herein to a host cell.

[0212] Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a modular cellular targeting composition or heterobifunctional recruitment composition to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.

[0213] Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipidmucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. DeliveryWSGR Docket No. 68656-701.601 can be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration).

[0214] The use of RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo), or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.

[0215] The tropism of a viruses can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof.

[0216] In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures.

[0217] Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and q / 2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, otherWSGR Docket No. 68656-701.601 viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.

[0218] In various embodiments, the compositions disclosed herein may be engineered for delivery in one or more rAAV vectors. An rAAV as related to any of the methods and compositions provided herein may be of any serotype including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 2 / 1, 2 / 5, 2 / 8, 2 / 9, 3 / 1, 3 / 5, 3 / 8, or 3 / 9).

[0219] As used herein, the serotype of an rAAV refers to the serotype of the capsid proteins of the recombinant virus. Non-limiting examples of derivatives and pseudotypes include rAAV2 / l, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y^F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. A non-limiting example of derivatives and pseudotypes that have chimeric VP1 proteins is rAAV2 / 5-lVPlu, which has the genome of AAV2, capsid backbone of AAV5 and VPlu of AAV1. Other non-limiting example of derivatives and pseudotypes that have chimeric VP1 proteins are rAAV2 / 5-8VPlu, rAAV2 / 9- IVPlu, and rAAV2 / 9-8VPlu.

[0220] Methods of making or packaging rAAV particles are known in the art and reagents are commercially available. For example, a plasmid comprising a gene of interest may be combined with one or more helper plasmids, e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (encoding VP1, VP2, and VP3, including a modified VP2 region as described herein), and transfected into a recombinant cells such that the rAAV particle can be packaged and subsequently purified.

[0221] Recombinant AAV may comprise a nucleic acid vector, which may comprise at a minimum: (a) one or more heterologous nucleic acid regions comprising a sequence encoding a protein or polypeptide of interest or an RNA of interest (e.g., a siRNA or microRNA), and (b) one or more regions comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITRWSGR Docket No. 68656-701.601 sequences or engineered ITR sequences) flanking the one or more nucleic acid regions (e.g., heterologous nucleic acid regions). Herein, heterologous nucleic acid regions comprising a sequence encoding a protein of interest or RNA of interest are referred to as genes of interest.

[0222] Any one of the rAAV particles provided herein may have capsid proteins that have amino acids of different serotypes outside of the VPlu region. In some embodiments, the serotype of the backbone of the VP1 protein is different from the serotype of the ITRs and / or the Rep gene. In some embodiments, the serotype of the backbone of the VP1 capsid protein of a particle is the same as the serotype of the ITRs. In some embodiments, the serotype of the backbone of the VP1 capsid protein of a particle is the same as the serotype of the Rep gene. In some embodiments, capsid proteins of rAAV particles comprise amino acid mutations that result in improved transduction efficiency.

[0223] In some embodiments, the nucleic acid vector comprises one or more regions comprising a sequence that facilitates expression of the nucleic acid (e.g., the heterologous nucleic acid), e.g., expression control sequences operatively linked to the nucleic acid. Numerous such sequences are known in the art. Non-limiting examples of expression control sequences include promoters, insulators, silencers, response elements, introns, enhancers, initiation sites, termination signals, and poly(A) tails. Any combination of such control sequences is contemplated herein (e.g., a promoter and an enhancer).

[0224] Final AAV constructs may incorporate a sequence encoding a composition as disclosed herein.

[0225] In some embodiments, a rAAV constructs or the herein compositions are administered to a subject enterally. In some embodiments, a rAAV constructs or the herein compositions are administered to the subject parenterally. In some embodiments, a rAAV particle or the herein compositions are administered to a subject subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro-ventricularly, intramuscularly, intrathecally (IT), intraci sternally, intraperitoneally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs. In some embodiments, a rAAV particle or the herein compositions are administered to the subject by injection into the hepatic artery or portal vein.V. SELECT ENUMERATED EMBODIMENTS1. A modular cellular targeting composition comprising: a) a recruitment domain for an endogenous enzyme; and b) a nucleic acid targeting domain comprising a polynucleic acid, wherein the recruitment domain and the targeting domain are operatively connected, and wherein the recruitment domain does not comprise a BIX01338 inhibitor.WSGR Docket No. 68656-701.6012. The composition of embodiment 1, wherein the composition further comprises an endogenous epigenetic enzyme or endogenous epigenetic effector.3. The composition of embodiment 2, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector is endogenous to a human.4. The composition of embodiment 3, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector comprises a human wild-type epigenetic enzyme.5. The composition of any one of embodiments 2-4, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector comprises a DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF.6. The composition of embodiment 1, wherein the recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain, a histone tail peptide recruitment domain, a histone embedding peptide recruitment domain, a histone tail peptide recruitment domain and a histone embedding peptide recruitment domain, or a combination thereof.7. The composition of embodiment 7, wherein the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain.8. The composition of embodiment 7, wherein the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain.9. The composition of embodiment 7, wherein the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain.10. The composition of embodiment 7, wherein the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8,WSGR Docket No. 68656-701.601HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain.11. The composition of embodiment 7, wherein the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT1L, or a PRDM family protein recruitment domain.12. The composition of embodiment 7, wherein the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain.13. The composition of embodiment 7, wherein the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain.14. The composition of embodiment 7, wherein the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain.15. The composition of embodiment 7, wherein the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain.16. The composition of embodiment 7, wherein the histone deubiquitinase recruitment domain comprises a USP16, USP21, or USP22 recruitment domain.17. The composition of embodiment 7, wherein the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain.18. The composition of embodiment 7, wherein the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain.19. The composition of embodiment 7, wherein the chromatin remodeling factor recruitment domain comprises a BRG1, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain.20. The composition of embodiment 7, wherein the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain.21. The composition of any one of embodiments 1-21, wherein the recruitment domain comprises a biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof.22. The composition of embodiment 22, wherein the recruitment domain comprises the small molecule domain.23. The composition of embodiment 23, wherein the small molecule domain comprises a 5- Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-WSGR Docket No. 68656-701.601370284, SAHA, VPA, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDB1-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5-methylcytosine containing DNA, or a CBP30 domain.24. The composition of embodiment 24, wherein the HAT agonist comprises CTB, TTK21, YF- 2, 1-CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106.25. The composition of embodiment 6, wherein the histone tail peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 1-3 or 18.26. The composition of embodiment 7, wherein the histone embedding peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 4- 17.27. The composition of embodiment 1, wherein the nucleic acid targeting domain comprises an antisense oligonucleotide (ASO), a triplex-forming oligonucleotide (TFO), a G-quadruplex binding sequence, a small activating RNA, a small interfering RNA (siRNA), a CRISPR guide RNA, an aptamer, a ribozyme, a DNAzyme, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a phosphorothioate stabilized oligonucleotide, a DNA or RNA binding oligonucleotide, or a combination thereof.28. The composition of embodiment 1, wherein the nucleic acid targeting domain comprises an oligonucleotide that binds to a target DNA or RNA, the target DNA or RNA comprising: cisacting non-coding RNAs, trans-acting non-coding RNAs, nuclear retained RNAs, introns of pre-mRNA, exons of mRNA, promoter regions of DNA, enhancer regions of DNA, silencer regions of DNA, insulator elements, topologically associating domains (TADs), DNA methylation sites, histone modification sites, DNase I hypersensitive sites, chromosome conformation capture (3C) interaction sites, a specific DNA or RNA sequence of interest, or a combination thereof.29. The oligonucleotide of embodiment 28 or embodiment 29 wherein the nucleic acid targeting domain comprises about 1 nucleotide to about 30 nucleotides.30. The oligonucleotide of embodiment 30, wherein the nucleic acid targeting domain comprises about 10 nucleotides to about 30 nucleotides.31. The oligonucleotide of embodiment 31, wherein the nucleic acid targeting domain comprises about 15 nucleotides to about 30 nucleotides.32. The oligonucleotide of embodiment 32, wherein the nucleic acid targeting domain comprises about 20 nucleotides to about 30 nucleotides.WSGR Docket No. 68656-701.60133. The composition of embodiment 1, wherein the nucleic acid targeting domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 19-25, 27-29, or 32.34. The composition of embodiment 1, wherein the nucleic acid targeting domain comprises any one of SEQ ID NOs: 19-25, 27-29, or 32.35. The composition of embodiment 1, further comprising a linker.36. The composition of embodiment 36, wherein the linker operatively connects the recruitment domain and the nucleic acid targeting domain.37. The composition of embodiment 36, wherein the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof.38. The composition of embodiment 36, wherein the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety.39. The composition of embodiment 36, wherein the linker comprises a tissue-specific cleavable linker.40. The composition of embodiment 40, wherein the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme- cleavable linker, a light-sensitive linker, or a combination thereof.41. The composition of any one of embodiments 36-41, wherein the linker comprises a self- immolative spacer.42. The composition of any one of embodiments 36-42, wherein the linker comprises about 1 to about 200 amino acids.43. The composition of embodiment 1, wherein the composition is operatively connected to a tissue targeting moiety.44. The composition of embodiment 44, wherein the tissue targeting moiety comprises a livertargeting moiety, a brain-targeting moiety, a muscle-targeting moiety, a heart-targeting moiety, a kidney -targeting moiety, a lung-targeting moiety, a tumor-targeting moiety, an immune cell-targeting moiety, an ocular targeting moiety, a blood-brain-barrier crossing moiety, a cell targeting moiety; or a combination thereof.45. The composition of embodiment 45, wherein the liver-targeting moiety comprises a GalNAc moiety, an asialoglycoprotein receptor (ASGPR) ligand, a triantennary N- acetylgalactosamine, a multivalent GalNAc cluster, a peptide targeting liver-specific antigens; or a combination thereof.WSGR Docket No. 68656-701.60146. The composition of embodiment 45, wherein the brain moiety comprises a synaptic vesicle glycoprotein 2A (SV2A) binding peptide, an anti-SV2A antibody or antibody fragment, a neurotrophin receptor (p75NTR) binding peptide, a neuropilin- 1 (NRP1) targeting peptide, a neuron-specific enolase (NSE) targeting moiety, a glial fibrillary acidic protein (GFAP) targeting antibody or antibody fragment, a peptide targeting brain-specific antigens; or a combination thereof.47. The composition of embodiment 45, wherein the muscle-targeting moiety comprises, an a7pi integrin-binding peptide, a peptide targeting the acetylcholine receptor, a peptide targeting TfR, a peptide targeting muscle-specific antigens; or a combination thereof.48. The composition of embodiment 45, wherein the heart-targeting moiety comprises, a cardiac troponin-binding pepti de, an anti -cardiac troponin antibody or antibody fragm en t, a peptide targeting cardiac-specific antigens; or a combination thereof.49. The compositi on of embodiment 45, wherein the kidney-targeting moiety comprises, a megalin-binding peptide, a cubilin-binding peptide, a peptide targeting kidney-specific peptide antigens; or a combination thereof.50. The composition of embodiment 45, wherein the lung-targeting moiety comprises, a pulmonary surfactant protein binding peptide, an angiotensin converting enzyme (ACE) binding peptide, a PEC AM- 1 targeting antibody or antibody fragment, a peptide targeting claudin-18, an ICAM-1 targeting moiety, a peptide targeting lung specific-antigens; or a combination thereof.51. The composition of embodiment 45, wherein the tumor-targeting moiety comprises, a folate receptor targeting moiety, an EGFR targeting antibody or antibody fragment, a HER2 targeting antibody or antibody fragment, an RGD peptide targeting avP3 integrin, a CD19 targeting moiety, a CD20 targeting moiety, a prostate-specific membrane antigen (PSMA) targeting moiety, a GRP78 targeting peptide, a peptide targeting tumor-associated antigens; or a combination thereof.52. The compositi on of embodiment 45, wherein the immune cell -targeting moiety comprises, a CD3 targeting moiety, a CD4 targeting moiety, a CD8 targeting moiety, a CD40 targeting moiety, a peptide targeting CCR5, a dendritic cell-targeting antibody or antibody fragment, an immune cell targeting-peptide; or a combination thereof.53. The composition of embodiment 45, wherein the ocular targeting moiety comprises, an integrin avP3 targeting peptide, a peptide targeting retinal pigment epithelium, a transferrin receptor targeting moiety, a peptide targeting retinal ganglion cells, a peptide targeting ocular specific antigens; or a combination thereof.WSGR Docket No. 68656-701.60154. The composition of embodiment 45, wherein the blood-brain-barrier crossing moiety comprises, a transferrin receptor (TfR) binding peptide, an anti-TfR antibody or antibody fragment, a Tissue Non-Specific Alkaline Phosphatase (ALPL) binding peptide, an anti- ALPL antibody or antibody fragment, a glucose transporter 1 (GLUT1) binding peptide, a low-density lipoprotein receptor-related protein 1 (LRP1) binding peptide, an insulin receptor binding peptide, a rabies virus glycoprotein (RVG) peptide, a peptide targeting blood-brain-barrier (BBB) antigens to allow for crossing the BBB; or a combination thereof.55. The composition of any one of embodiments 1-55, wherein the composition comprises about 1 to about 5000 amino acids.56. The composition of embodiment 56, wherein the composition comprises about 500 to about 1000 amino acids.57. The composition of embodiment 56, wherein the composition comprises about 1000 to about 2000 amino acids.58. The composition of any one of embodiments 1-58, wherein the composition comprises about 2000 to about 5000 amino acids.59. A heterobifunctional recruitment composition comprising: a recruitment domain, wherein the recruitment domain comprises a first recruitment domain and a second recruitment domain, wherein the first recruitment domain comprises a recruitment domain for an endogenous enzyme, and the second recruitment domain comprises a recruitment domain for a genome associated protein, wherein the first recruitment domain and the second recruitment domain are operatively connected and wherein the genome associated protein does not comprise an anchored transcription factor.60. The composition of embodiment 60, wherein the composition further comprises an endogenous epigenetic enzyme or endogenous epigenetic effector.61. The composition of embodiment 61, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector is endogenous to a human.62. The composition of embodiment 61, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector comprises a human wild-type epigenetic enzyme.63. The composition of any one of embodiments 61-63, wherein the endogenous epigenetic enzyme or endogenous epigenetic effector comprises a DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF.WSGR Docket No. 68656-701.60164. The composition of embodiment 60, wherein the first recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, or a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain.65. The composition of embodiment 65, wherein the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain.66. The composition of embodiment 65, wherein the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain.67. The composition of embodiment 65, wherein the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain.68. The composition of embodiment 65, wherein the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain.69. The composition of embodiment 65, wherein the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT1L, or a PRDM family protein recruitment domain.70. The composition of embodiment 65, wherein the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain.71. The composition of embodiment 65, wherein the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain.72. The composition of embodiment 65, wherein the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain.73. The composition of embodiment 65, wherein the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain.74. The composition of embodiment 65, wherein the histone deubiquitinase recruitment domain comprises a USP16, USP21, or USP22 recruitment domain.WSGR Docket No. 68656-701.60175. The composition of embodiment 65, wherein the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain.76. The composition of embodiment 65, wherein the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain.77. The composition of embodiment 65, wherein the chromatin remodeling factor recruitment domain comprises a BRG1, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain.78. The composition of embodiment 65, wherein the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain.79. The composition of any one of embodiments 60-79, wherein the first recruitment domain comprises biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof.80. The composition of embodiment 80, wherein the first recruitment domain comprises the small molecule domain.81. The composition of embodiment 81, wherein the small molecule domain comprises a 5- Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC- 370284, SAHA, VPA, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDBl-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5-methylcytosine containing DNA, or a CBP30 domain.82. The composition of embodiment 82, wherein the HAT agonist comprises CTB, TTK21, YF- 2, 1-CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106.83. The composition of embodiment 60, further comprising an endogenous genome-associated protein.84. The composition of embodiment 84, wherein the genome-associated protein comprises a transcription factor, a transcriptional coactivator, a transcriptional corepressor, a chromatin remodeling factor, a histone modifier, a DNA modifier, an architectural protein, an RNA polymerase II and associated factors, a mediator complex component, an enhancer- associated factor, an insulator protein, a topoisomerase, a pioneer factor, a polycomb group protein, a trithorax group protein, a heterochromatin protein, a DNA methylation reader, a histone modification reader, a long non-coding RNAs associated with chromatin, or a combination thereof.WSGR Docket No. 68656-701.60185. The composition of embodiment 60, wherein the second recruitment domain comprises a genome-associated protein recruitment domain.86. The composition of embodiment 86, wherein the genome-associated protein recruitment domain comprises a transcription factor recruitment domain, a transcriptional coactivator recruitment domain, a transcriptional corepressor recruitment domain, a chromatin remodeling factors recruitment domain, a histone modifier recruitment domain, a DNA modifier recruitment domain, an architectural protein recruitment domain, an RNA polymerase II and associated factor recruitment domain, a mediator complex component recruitment domain, an enhancer-associated factor recruitment domain, an insulator protein recruitment domain, a topoisomerase recruitment domain, a pioneer factor recruitment domain, a polycomb group protein recruitment domain, a trithorax group protein recruitment domain, a heterochromatin protein recruitment domain, a DNA methylation reader recruitment domain, a histone modification reader recruitment domain, a long non-coding RNAs associated with chromatin recruitment domain, or a combination thereof.87. The composition of any one of embodiments 60-87, further comprising a linker.88. The composition of embodiment 88, wherein the linker connects the first recruitment domain and the second recruitment domain.89. The composition of embodiment 88, wherein the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a peptide linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof.90. The composition of embodiment 88, wherein the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety.91. The composition of embodiment 88, wherein the linker comprises a tissue-specific cleavable linker.92. The composition of embodiment 92, wherein the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme- cleavable linker, a light-sensitive linker, or a combination thereof.93. The composition of any embodiments 88-93, wherein the linker comprises a self-immolative spacer.94. The composition of any one of embodiments 88-94, wherein the linker comprises about 5 to about 200 amino acids.WSGR Docket No. 68656-701.60195. The composition of any one of embodiments 60-95, wherein the composition comprises about 1 to about 5000 amino acids, about 500 to about 1000 amino acids, about 1000 to about 2000 amino acids, or about 2000 to about 5000 amino acids.96. The composition of any one of embodiments 60-95, wherein the composition comprises less than about 550 amino acids.97. A composition comprising a recombinant polynucleic acid encoding the composition of any one of embodiments 1-97.98. A pharmaceutical composition comprising the composition of any one of embodiments 1-98 and a pharmaceutically acceptable excipient.99. A method of introducing one or more modifications in an epigenome, the method comprising: administering the composition of any one of embodiments 1-97, the recombinant polynucleic acid of embodiment 98, or the pharmaceutical composition of embodiment 99 to a cell, a tissue, a subject, or a combination thereof.100. A method of modulating gene expression, the method comprising: administering the composition of any one of embodiments 1-97, the recombinant polynucleic acid of embodiment 95, or the pharmaceutical composition of embodiment 99 to a cell, a tissue, a subject, or a combination thereof.101. A method of treating a disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of the pharmaceutical composition of embodiment 99 to a subject.102. The method of embodiment 102, wherein the method of treating the disease or condition in the subject in need thereof comprises introducing one or more modifications in an epigenome of the subject, or modulating gene expression in the subject.103. The method of embodiments 102 or 103, wherein the disease or condition comprises a disease or condition associated with the epigenome.104. The method of embodiment 102, wherein the disease or condition comprises progressive supranuclear palsy, angelman syndrome, prader-willi, alzheimer’s disease, cancer, type 1 or type 2 diabetes, liver disease, kidney disease, eye disease, parkinson’s disease, hepatitis B viral infection, t-cell mediated autoimmunity, huntington’s disease, a disease or condition associated with the central nervous system, or a disease or condition associated with the peripheral nervous system.105. The method of embodiment 103, wherein the one or more modifications in the epigenome comprises increasing or decreasing methylation, increasing or decreasing acetylation, increasing or decreasing ubiquitylation, increasing or decreasing phosphorylation, increasing orWSGR Docket No. 68656-701.601 decreasing sumoylation, increasing or decreasing ribosylation, increasing or decreasing citrullination, or a combination thereof.106. The method of embodiment 106, wherein the one or more modifications comprises one or more transient modifications.107. The method of embodiment 106, wherein the method comprises increasing methylation.108. The method of embodiment 108, wherein the increasing methylation comprises increasing methylation of a CpG island associated with a gene.109. The method of embodiment 109, wherein the gene comprises a gene associated with the disease or condition of embodiment 104.110. The method of embodiment 110, wherein the method comprises increasing or decreasing expression of the gene.111. The method of embodiment 111, wherein the gene comprises MAPT, SOD1, PCSK9, HTT, or PR.112. A method of cellular reprogramming comprising a) administering the composition of any one of embodiments 1-97 the recombinant polynucleic acid of embodiment 98, or the pharmaceutical composition of embodiment 99 to a cell b) culturing the cell, wherein the culturing comprises conditions that induces cellular reprogramming and c) isolating reprogrammed cells with a desired cellular identity.113. A method of creating epigenetic memory in cells, comprising a) administering the composition of any one of embodiments 1-97, the recombinant polynucleic acid of embodiment 98, or the pharmaceutical composition of embodiment 99 to a cell and b) dividing the cell.114. The method of embodiment 114 further comprising c) detecting an induced epigenetic mark in a divided cell.115. A method of creating a synthetic transcriptional circuit comprising a) administering a first composition comprising the composition of any one of embodiments 1-97, the recombinant polynucleic acid of embodiment 98, or the pharmaceutical composition of embodiment 99 to a cell, a tissue, a subject, or a combination thereof and b) administering a second, third, or more composition comprising the composition of any one of embodiments 1-97, the recombinant polynucleic acid of embodiment 98, or the pharmaceutical composition of embodiment 99 to the cell, the tissue, the subject, or a combination thereof, wherein administering the first, second, third, or more composition induces a series of transcriptional events.116. The method of embodiment 116, wherein the administering comprises a specific temporal sequence.WSGR Docket No. 68656-701.601117. The method of embodiment 116, wherein the series of transcriptional events comprises increasing or decreasing expression of a first gene, a second gene, a third gene, or more than three genes.118. The method of any one of embodiments 116-118, further comprising detecting a gene expression pattern.VI. EXAMPLES

[0226] The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.

[0227] Example 1: Methylation and Silencing of the HTT and SOD1 Genes with Modular Cellular Targeting Compositions

[0228] Modular cellular targeting compositions will be generated to demonstrate epigenetic silencing of two clinically relevant genes with divergent promoters, Amyotrophic Lateral Sclerosis (ALS) associated SOD1, and Huntington’s Disease (HD) associated HTT (FIG. 5A and 5B). A nucleic acid targeting domain comprising ASOs will be designed. The ASO nucleic acid targeting domain will be designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT (i.e., the sense and the natural antisense transcripts of the SOD1 and HTT genes). By targeting intronic regions, the modular cellular targeting compositions will be concentrated on nascent transcripts proximal to the promoter region of the SOD1 and HTT genes, see e.g., FIG. 5A and 5B. This binding strategy will maximize nuclear localization of the modular cellular targeting composition by minimizing binding to mature cytoplasmic mRNAs. Evaluation of the modular cellular targeting compositions is performed in two cell lines known to express SOD1 and HTT - HEK293s and SY-SY5Ys, as well as iPSC derived neurons. Using a tooled induced proximity approach, a recruitment domain comprising FLAG tagged monomeric streptavidin (mSA) is fused to an epigenome editor and a nucleic acid targeting domain comprising 5' biotinylated ASOs designed to bind to intronic regions of pre- mRNAs near the divergent promoters of SOD1 and HTT (active mSA fusions). The ASOs are conjugated to the monomeric streptavidin (mSA) recruitment domain with a non-cleavable linker. This strategy is used to generate four different modular cellular targeting compositions, each comprising a different epigenome editor. The four epigenome editors comprise full-length DNMT3a, DNMT3a autoinhibitory mutation (G532N), full-length ZNF10, and the KRAB domain of ZNF. Positive controls will employ dCas9 fusions to constitutively active versions of full-length DNMT3a, DNMT3a autoinhibitory mutation (G532N), full-length ZNF10, and the KRAB domain of ZNF. The nucleic acid targeting domain of the positive controls comprises several guide RNAs (gRNAs) against both SOD1 and HTT. Positive controls will also include 1) FLAG tagged monomeric streptavidin (mSA) fused to an epigenome editor and conjugated toWSGR Docket No. 68656-701.601 a dCas9 gRNAs complex coupled to the streptavidin aptamer that binds in the biotin pocket of streptavidin, and 2) RNAseH active gapmer ASOs directed at SOD1 and HTT using clinically relevant sequences. Negative controls will include 1) a modular cellular targeting system with a recruitment domain comprising mSA bound to an inactivated DNMT3a - (E756A), and a targeting domain comprising 5' biotinylated ASOs designed to bind to intronic regions of pre- mRNAs near the divergent promoters of SOD1 and HTT as described above, and 2) an active mSA fusion as described above but comprising a 5’ biotinylated scramble ASO sequence.

[0229] The efficacy and durability of epigenetic edits will be assessed by measuring gene expression via qPCR over regular intervals for 4 weeks post-transfection. Amplicon bisulfite sequencing will be performed to evaluate DNA methylation by DNMT3a / DNMT3a (G532N), and Cut&Run qPCR will be conducted to assess histone methylation by ZNF10 / KRAB.

[0230] It is hypothesized that a modular cellular targeting composition comprising an active mSA fusion as described above will demonstrate knockdown of SOD1 or HTT by qPCR following a single dose of an active mSA fusion in HEK 293 s and SH-SY5Ys cells. It is further hypothesized that SOD1 and HTT mRNA levels will be decreased in cells administered a single dose of an active mSA fusion as compared to SOD1 and HTT mRNA levels in cells where a single dose of an active mSA fusion is not administered.

[0231] It is also hypothesized that CpG methylation of SOD1 and HTT in cells administered an active mSA fusion comprising DNMT3a or DNMT3a (G532N) will be increased relative to control cells. It is hypothesized that H3K9me3 levels will be increased relative to control cells in cells administered an active mSA fusion comprising full-length ZNF10, or the KRAB domain of ZNF. Finally, it is hypothesized the above results will be repeated in iPSC derived neurons, demonstrating this system functions in primary cells.

[0232] Example 2: Methylation and Silencing of the HTT and SOD1 Genes with Modular Cellular Targeting Compositions

[0233] Modular cellular targeting compositions comprising a recruitment domain and a nucleic acid targeting domain will be generated to demonstrate epigenetic silencing of two clinically relevant genes with divergent promoters, Amyotrophic Lateral Sclerosis (ALS) associated SOD1, and Huntington’s Disease (HD) associated HTT (FIG. 5A and 5B). A nucleic acid targeting domain comprising an ASO will be designed. The ASO nucleic acid targeting domain will be designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT (i.e., the sense and the natural antisense transcripts of the SOD1 and HTT genes). By targeting intronic regions, the modular cellular targeting compositions are designed to concentrate on nascent transcripts proximal to the promoter region of the SOD1 and HTT genes, see e.g., FIG. 5A and 5B. This binding strategy is designed to maximize nuclearWSGR Docket No. 68656-701.601 localization of the modular cellular targeting composition by minimizing binding to mature cytoplasmic mRNAs.

[0234] Evaluation of the modular cellular targeting compositions will be performed in two cell lines known to express SOD1 and HTT - HEK293s and SY-SY5Ys, as well as iPSC derived neurons. Using a tooled induced proximity approach, a modular cellular targeting composition will be created comprising 1) a recruitment domain comprising a DNA methyltransferase recruitment domain operatively connected to a nucleic acid targeting domain comprising an ASO designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT, and 2) a recruitment domain comprising a histone methyltransferase recruitment domain operatively connected to a nucleic acid targeting domain comprising an ASO designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT. This strategy will be used to generate four different modular cellular targeting compositions once the recruitment domain has recruited an endogenous epigenome editor. The recruitment domains will be designed to recruit endogenous epigenome editors comprising full-length DNMT3a, DNMT3a autoinhibitory mutation (G532N), full-length ZNF10, and the KRAB domain of ZNF. Positive controls will employ dCas9 fusions to constitutively active versions of full-length DNMT3a, DNMT3a autoinhibitory mutation (G532N), full-length ZNF10, and the KRAB domain of ZNF. The nucleic acid targeting domain of the positive controls comprises several guide RNAs (gRNAs) against both SOD1 and HTT. Positive controls will also include 1) FLAG tagged monomeric streptavidin (mSA) fused to an epigenome editor and conjugated to a dCas9 gRNAs complex coupled to the streptavidin aptamer that binds in the biotin pocket of streptavidin, and 2) RNAseH active gapmer ASOs directed at SOD1 and HTT using clinically relevant sequences. Negative controls will include 1) a modular cellular targeting system with a recruitment domain comprising mSA bound to an inactivated DNMT3a - (E756A), and a targeting domain comprising 5' biotinylated ASOs designed to bind to intronic regions of pre- mRNAs near the divergent promoters of SOD1 and HTT as described above, and 2) an active mSA fusion as described above but comprising a 5’ biotinylated scramble ASO sequence.

[0235] The efficacy and durability of epigenetic edits will be assessed by measuring gene expression via qPCR over regular intervals for 4 weeks post-transfection.

[0236] Amplicon bisulfite sequencing will be performed to evaluate DNA methylation by DNMT3a / DNMT3a (G532N), and Cut&Run qPCR will be conducted to assess histone methylation by ZNF10 / KRAB.

[0237] It is hypothesized that a modular cellular targeting composition comprising a recruitment domain and a nucleic acid targeting domain as described above will demonstrate knockdown of SOD1 or HTT by qPCR following a single administration of the composition inWSGR Docket No. 68656-701.601HEK 293s and SH-SY5Ys cells. It is further hypothesized that S0D1 and HTT mRNA levels will be decreased in cells administered a single dose of the composition as compared to SOD1 and HTT mRNA levels in cells where a single dose of the composition is not administered.

[0238] It is also hypothesized that CpG methylation of SOD1 and HTT in cells administered the composition comprising a DNA methyltransferase recruitment domain will be increased relative to control cells. It is hypothesized that H3K9me3 levels will be increased relative to control cells in cells administered the composition comprising a histone methyltransferase recruitment domain. Finally, it is hypothesized the above results will be repeated in iPSC derived neurons, demonstrating the systems functionality in primary cells.

[0239] Example 3: Epigenetic Changes Induced by Modular Cellular Targeting Compositions are Reversible

[0240] To demonstrate the reversibility of epigenetic editing using modular cellular targeting compositions a targeting domain comprising Chloroalkynated ASOs will be conjugated to a recruitment domain comprising a HaloTag fused to full-length DNA demethylase TET1, TET1 comprising the catalytic domain only, full-length histone acetyltransferase p300, or p300 comprising only the histone acetyltransferase domain. TET1 and p300 antagonize DNMT3a and ZNF10 / KRAB respectively. Consequently, a modular cellular targeting composition comprising a recruitment domain comprising a HaloTag fused to full- length DNA demethylase TET1, TET1 comprising the catalytic domain only, full-length histone acetyltransferase p300, or p300 comprising only the histone acetyltransferase domain and a nucleic acid targeting domain comprising Chloroalkynated ASOs designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT will be generated (active HaloTag fusions). As positive controls, dCas9 fused to the TET1 catalytic domain or the p300 HAT domain will be used. Negative controls will use HaloTag fusions to inactive variants of TET1 or p300, and HaloTag fusions with scrambled chloroalkynated ASOs.

[0241] The HaloTag fusions will be administered to the same cells administered the mSA fusions described in Example 1. HTT and SOD1 expression, DNA methylation, and histone methylation will be measured as described in Example 1. It is hypothesized that the effects of the mSA fusion on gene expression and methylation will be reversed upon administration of HaloTag fusions, e.g., SOD1 and HTT mRNA levels will be increased, and CpG and H3K9me3 methylation will be decreased.

[0242] Example 4: Epigenetic Changes Induced by Modular Cellular Targeting Compositions are Reversible

[0243] To demonstrate the reversibility of epigenetic editing using modular cellular targeting compositions a targeting domain comprising Chloroalkynated ASOs will beWSGR Docket No. 68656-701.601 conjugated to 1) a recruitment domain comprising a DNA demethylase recruitment domain designed to recruit TET1, or 2) a recruitment domain comprising a histone acetyltransferase recruitment domain. The chloroalkynated ASOs will be designed to bind to intronic regions of pre-mRNAs near the divergent promoters of SOD1 and HTT.

[0244] As positive controls, dCas9 fused to the TET1 catalytic domain or the p300 HAT domain will be used. Negative controls will use HaloTag fusions to inactive variants of TET1 or p300, and HaloTag fusions with scrambled chloroalkynated ASOs.

[0245] The HaloTag fusions will be administered to the same cells administered the mSA fusions described in Example 1. HTT and SOD1 expression, DNA methylation, and histone methylation will be measured as described in Example 1. It is hypothesized that the effects of the mSA fusion on gene expression and methylation will be reversed upon administration of the chloroalkynated ASOs conjugated to 1) a recruitment domain comprising a DNA demethylase recruitment domain designed to recruit TET1, or 2) a recruitment domain comprising a histone acetyltransferase recruitment domain., e.g., SOD1 and HTT mRNA levels will be increased, and CpG and H3K9me3 methylation will be decreased.

[0246] Example 5: Reversible Methylation and Silencing of the MAPT Gene with Modular Cellular Targeting Compositions

[0247] Neurodegenerative diseases such as Alzheimer’s disease (AD), are driven by the pathological aggregation of proteins. Although AD has proven an etiologically diverse disease, Tau has been demonstrated as a critical factor in the pathogenesis of AD and related dementias. Indeed, the pathological role of Tau extends beyond Alzheimer’s disease, contributing to up to 75% of age-related dementias and a spectrum of rarer conditions collectively known as tauopathies. These tauopathies impact approximately 6 million individuals, with nearly 250,000 new cases each year in the United States alone, underscoring the urgent need for effective therapeutics. Tau aggregation occurs through multiple mechanisms, including MAPT gene mutations, alternative splicing imbalances, and post-translational modifications such as hyperphosphorylation. These processes, along with factors like impaired autophagy and oxidative stress, contribute to tau accumulation and subsequent neurodegeneration in tauopathies. Given the central role of Tau in disease pathogenesis and progression, it has become a highly attractive target for therapeutic intervention.

[0248] Accordingly, modular cellular targeting compositions comprising monomeric streptavidin (mSA) fused to an epigenetic editor (active mSA fusions), employing biotinylated ASOs to retarget editors to specific pre-mRNAs will be generated as described in Examples 1 and 3. The ASO targeting domains will target pre-mRNAs in the 5' regions of the MAPT sense and natural antisense transcripts (FIG. 4). The epigenetic editors will comprise those describedWSGR Docket No. 68656-701.601 in Example 1, full-length DNMT3a, DNMT3a autoinhibitory mutation (G532N), full-length ZNF10, and the KRAB domain of ZNF. The SH-SY5Y cell line and iPSC derived neurons will be used to demonstrate the edits. This strategy enables demonstration of specific and durable silencing of MAPT mRNA and Tau protein in both immortalized and clinically relevant cell models. Finally, these epigenetic edits will be reversed by recruiting activating chromatin modifiers to the downregulated MAPT locus by using HaloTag fusions and methods as described in Example 3.

[0249] It is hypothesized that a modular cellular targeting composition comprising an active mSA fusion as described above will demonstrate knockdown of MAPT by qPCR following a single dose of an active mSA fusion in SH-SY5Ys cells. It is further hypothesized that MAPT mRNA levels will be decreased in cells administered a single dose of an active mSA fusion as compared to MAPT mRNA levels in cells where a single dose of an active mSA fusion is not administered.

[0250] It is also hypothesized that CpG methylation of MAPT in cells administered an active mSa fusion comprising DNMT3a or DNMT3a (G532N) will be increased relative to control cells. It is hypothesized that H3K9me3 levels will be increased relative to control cells in cells administered an active mSa fusion comprising full-length ZNF10, or the KRAB domain of ZNF. It is hypothesized the above results will be repeated in iPSC derived neurons, demonstrating this system functions in primary cells. Finally, it is hypothesized that the effects of the mSA fusion on gene expression and methylation will be reversed upon administration of HaloTag fusions, e.g., MAPT mRNA levels will be increased, and CpG and H3K9me3 methylation will be decreased.

[0251] Example 6: Reversible Methylation and Silencing of the MAPT Gene with Modular Cellular Targeting Compositions

[0252] Additional, modular cellular targeting compositions will be generated to target MAPT. Compositions will include 1) a recruitment domain comprising a DNA methyltransferase recruitment domain operatively connected to a nucleic acid targeting domain comprising an ASO designed to bind to pre-mRNAs in the 5' regions of the MAPT sense and natural antisense transcripts, and 2) a recruitment domain comprising a histone methyltransferase recruitment domain operatively connected to a nucleic acid targeting domain comprising an ASO designed to pre-mRNAs in the 5' regions of the MAPT sense and natural antisense transcripts. The SH-SY5Y cell line and iPSC derived neurons will be used to demonstrate the edits. This strategy enables demonstration of specific and durable silencing of MAPT mRNA and Tau protein in both immortalized and clinically relevant cell models. Finally,WSGR Docket No. 68656-701.601 these epigenetic edits will be reversed by recruiting activating chromatin modifiers to the downregulated MAPT locus by using HaloTag fusions and methods as described in Example 3.

[0253] It is hypothesized that the modular cellular targeting compositions described above will demonstrate knockdown of MAPT by qPCR following a single dose of in SH-SY5Ys cells. It is further hypothesized that MAPT mRNA levels will be decreased in cells administered a single dose of the compositions as compared to MAPT mRNA levels in cells where a single dose of the compositions are not administered.

[0254] It is also hypothesized that CpG methylation of MAPT in cells administered the composition comprising a DNA methyltransferase recruitment domain will be increased relative to control cells. It is hypothesized that H3K9me3 levels will be increased relative to control cells in cells administered the composition comprising a histone methyltransferase recruitment domain. It is hypothesized the above results will be repeated in iPSC derived neurons, demonstrating this systems functionality in primary cells. Finally, it is hypothesized that the effects of the compositions on gene expression and methylation will be reversed upon administration of HaloTag fusions, e.g., MAPT mRNA levels will be increased, and CpG and H3K9me3 methylation will be decreased.

[0255] Example 7: Demethylation of CTCF Sites with a Modular Cellular Targeting Composition

[0256] Angelman Syndrome (AS) is a severe neurogenetic disorder affecting approximately 1 in 15,000 individuals. It is caused by the loss of function of the maternally inherited Ubiquitin- Protein Ligase E3A (UBE3A) gene on chromosome 15ql l-ql3. AS presents with a spectrum of debilitating symptoms, including severe intellectual disability, motor dysfunction, developmental delays, absence of speech, ataxia, sleep disturbances, and frequent seizures. The patients often display a distinct behavioral pattern, characterized by frequent smiling and laughter which adds to their unique personality. These symptoms arise from disrupted neuronal function due to the absence of UBE3A protein, which is essential for synaptic plasticity, neuronal signaling, and proper brain development. A schematic demonstrating the UBE3 A gene locus and CTCF sites is shown in FIG. 6.

[0257] Growing understanding of the molecular mechanisms underlying AS has highlighted antisense oligonucleotide (ASO) therapies as a promising treatment strategy. These ASOs specifically target and downregulate UBE3 A-ATS, effectively reactivating the silenced paternal UBE3 A allele. Preclinical studies in AS animal models have demonstrated the potential of this approach, showing successful reactivation of UBE3A and positive benefits in behavioral outcomes and seizure frequency, with promising results even when administered in utero. Early clinical trial evidence supports this approach and has demonstrated improvements in cognitiveWSGR Docket No. 68656-701.601 function, motor skills, and communication leading to an overall enhanced quality of life for patients and their families.

[0258] However, ASO therapies face significant limitations, primarily the need for repeated dosing via invasive lumbar punctures. This is particularly challenging for pediatric AS patients, who require administration under general anesthesia. The transient nature of ASO effects necessitates regular treatments, raising concerns about long-term feasibility, patient comfort, and the cumulative risks associated with repeated procedures and anesthesia exposure. Given these challenges, there is a pressing need for more durable treatment options for AS patients. Epigenetic editing has emerged as a promising approach to durably treat the root cause of AS by reactivating the silenced paternal UBE3 A allele. Unlike ASOs, which offer temporary symptom relief, epigenetic editing holds the potential to produce long-lasting or even permanent changes in gene expression, reducing or eliminating the need for repeated interventions.

[0259] A modular cellular targeting composition will be generated to demonstrate demethylation of specific methylated regions near CCCTC-binding factor (CTCF) binding sites. By removing DNA methylation, CTCF binding will be reenabled, reversing the silencing of the UBE3 A allele. The modular cellular targeting composition comprises 1) a monomeric streptavidin (mSA) recruitment domain fused to TET1 or ZNF10 / KRAB, and 2) a biotinylated ASO targeting domain to target the composition to specific pre-mRNAs and their nearby genomic loci. To restore CTCF binding by demethylation the modular cellular targeting composition will target the TET1 demethylase to specific methylated regions near CTCF binding sites. ASO design will deploy a tiling strategy, focusing on intronic regions on pre- mRNAs near CTCF insulator sites downstream of IPW sites. By targeting intronic regions, modular cellular targeting compositions are concentrated on nascent transcripts proximal to the CTCF sites as introns are spliced out concurrently with transcription. Further, this strategy maximizes nuclear localization of modular cellular targeting compositions by minimizing binding to mature mRNAs. To prevent cleavage of these RNA transcripts, ASO chemistries that inhibit RNAseH and enhance drug-like properties will be used, such as phosphorothioate (PS) and 2'-M0E modifications.

[0260] The modular cellular targeting compositions will be administered to cells of the LUHMES neuronal cell line. To demonstrate feasibility, a tooled induced proximity approach will be used by fusing FLAG-tagged monomeric streptavidin (mSA) to epigenome editors and using 5' biotinylated ASOs as the targeting domain (active mSA fusion). The mSA / epigenome editor will be conjugated to the 5' biotinylated ASO targeting domain using a non-cleavable linker. Two versions of the TET1 DNA demethylase will be fused to the mSA recruitment domain for this study: full-length TET1 and the TET1 catalytic domain. Stable LUHMES cellWSGR Docket No. 68656-701.601 lines expressing the modular cellular targeting compositions will be generated. As positive controls, dCas9 will be fused to constitutively active TET1 and conjugated to several gRNAs against each pertinent CTCF site downstream of the IPW. RNAseH active gapmer ASOs directed at UBE3 A-ATS will also be used as a positive control. Negative controls will include 1) the active mSA fusion as described above, but changed by employing an inactivated version of TET1 - with (H1672Y, D1674A) mutations and 2) the active mSA fusion as described above, but employing scrambled ASOs.

[0261] The efficacy and durability of epigenetic edits will be assessed by measuring UBE3 A and SNORD116 gene expression via qPCR over regular intervals for 4 weeks post-transfection and performing amplicon bisulfite sequencing to evaluate DNA demethylation by TET1. Lead sequences demonstrating the most efficacious restoration of UBE3A while maintaining SNORE) 116 expression will be interrogated for on-target specificity through high-throughput sequencing. RNA-seq will identify any off-target changes in gene expression compared to untreated differentiated LUHMES cells. To support this expression data, bisulfite whole-genome sequencing will be performed to assess off-target CpG demethylation. These assays will be repeated in iPSC derived neurons from healthy and AS patients to ensure on-target specificity translates to primary cells.

[0262] It is hypothesized that a modular cellular targeting composition comprising an active mSA fusion as described above will restore mRNA expression of UBE3A compared to control cells, while maintaining SNORD116 mRNA expression levels. It is hypothesized this restoration will be supported by epigenetic changes shown by increased DNA demethylation at CTCF sites in cells administered the active mSA fusion as compared to controls.

[0263] In addition to the active mSA fusions described above, modular cellular targeting compositions designed to recruit endogenous TET1 will also be generated. These constructs will comprise a DNA or RNA recruitment domain containing 5’ methylated cytosine (5mC), the natural ligand for TET1, conjugated to an ASO targeting domain designed to bind to DNA regions near CCCTC-binding factor (CTCF) binding sites (5mC-ASO).

[0264] It is hypothesized the construct will demonstrate wildtype TET1 recruitment in vitro. It is hypothesized that UBE3A expression levels in LUHMES cells will be increased in cells administered the 5mC-ASO constructs as compared to control cells. This enhanced UBE3 A expression will be accompanied by a corresponding increase in demethylation at targeted CTCF sites. These effects will be sustained, with UBE3A expression maintaining at least 50% of its peak level after 2 weeks of continuous passaging in both LUHMES cells and iPSC-derived neurons.WSGR Docket No. 68656-701.601

[0265] Example 8: Demethylation of CTCF Sites with a Modular Cellular Targeting Composition

[0266] Additional, modular cellular targeting compositions will be generated to target specific methylated regions near CCCTC-binding factor (CTCF) binding sites. Additional compositions will include 1) a DNA methyltransferase recruitment domain operatively connected to a nucleic acid targeting domain comprising an ASO designed to target the composition to specific pre-mRNAs near methylated regions near CCCTC-binding factor (CTCF) insulator sites downstream of IPW sites.

[0267] The modular cellular targeting compositions will be administered to cells of the LUHMES neuronal cell line. A first modular cellular targeting composition will be designed with a methyltransferase recruitment domain designed to recruit full-length TET1. A second modular cellular targeting composition will be designed with a methyltransferase recruitment domain designed to recruit the TET1 catalytic domain. Stable LUHMES cell lines expressing the modular cellular targeting compositions will be generated. As positive controls, dCas9 will be fused to constitutively active TET1 and conjugated to several gRNAs against each pertinent CTCF site downstream of the IPW. RNAseH active gapmer ASOs directed at UBE3 A-ATS will also be used as a positive control. Negative controls will include 1) an active mSA fusion as described above in example 7 but changed by employing an inactivated version of TET1 - with (H1672Y, D1674A) mutations and 2) the active mSA fusion as described above in example 7, but employing scrambled ASOs.

[0268] The efficacy and durability of epigenetic edits will be assessed by measuring UBE3 A and SNORD116 gene expression via qPCR over regular intervals for 4 weeks post-transfection and performing amplicon bisulfite sequencing to evaluate DNA demethylation by TET1. Lead sequences demonstrating the most efficacious restoration of UBE3A while maintaining SNORD1 16 expression will be interrogated for on-target specificity through high-throughput sequencing. RNA-seq will identify any off-target changes in gene expression compared to untreated differentiated LUHMES cells. To support this expression data, bisulfite whole-genome sequencing will be performed to assess off-target CpG demethylation. These assays will be repeated in iPSC derived neurons from healthy and AS patients to ensure on-target specificity translates to primary cells.

[0269] It is hypothesized that a modular cellular targeting composition comprising the DNA methyltransferase recruitment domains described above will restore mRNA expression of UBE3A compared to control cells, while maintaining SNORD116 mRNA expression levels. It is hypothesized this restoration will be supported by epigenetic changes shown by increased DNAWSGR Docket No. 68656-701.601 demethylation at CTCF sites in cells administered the modular cellular targeting compositions as compared to controls.

[0270] Example 9: Modulating Histones with a Modular Cellular Targeting Composition

[0271] The experimental approach used to generate and test the mSA fusions described in Example 5 will be modified by generating an active mSA fusion comprising a ZNF10 or KRAB domain as the epigenetic editor. The biotinylated ASO targeting domain used for this construct will be designed to target the construct to the SNORD115 cluster to condense histone architecture and prohibit transcriptional readthrough into UBE3A-ATS.

[0272] LUHMES cells will be stably transduced with mSA fused to either full-length ZNF10 or its KRAB domain alone. Positive controls will include dCas9 fused to the KRAB domain, dCas9 with biotinylated aptamer gRNA to confirm mSA fusion system activity, and a clinically relevant ASO sequence to reactivate the paternal UBE3 A allele. Negative controls will include co-transfection of unfused components ZNF10 or KRAB unfused to mSA, and a scramble ASO targeting sequence with active ZNF10 or KRAB fusions. Efficacy will be assessed through changes in UBE3A, SNORD116, and SNORD115 expression by qPCR and epigenetic remodeling via histone methylation Cut&Run qPCR over 2 weeks post-treatment. Lead sequences will be evaluated for specificity using RNA-seq and genome wide Cut&Run sequencing, with assays repeated in iPSC-derived neurons from healthy and AS patients.

[0273] It is hypothesized that SNORD115 mRNA will be decreased with a corresponding increase in UBE3A mRNA expression in cells administered the active mSA fusion as compared to controls.

[0274] In addition to the active mSA fusion described above, modular cellular targeting constructs designed to recruit endogenous histone methyltransferases will be generated.

[0275] Endogenous SETDB1 will be recruited in wild-type LUHMES cells using SETDB1- TTD-IN-1 (STI) ASO conjugates (ST1-ASO). STI is a small molecule agonist that binds to the Tudor domain of SETDB1, a histone methyltransferase that acts downstream of ZNF10 / KRAB to catalyze H3K9 trimethylation and transcriptional repression. By conjugating STI to a targeting ASO, endogenous SETDB1 will be recruited at the SNORD115 cluster. The efficacy of the STI -ASO conjugates on differentiated LUHMES cells will be assessed by measuring SNORE) 116, SNORE) 115, and UBE3A expression changes by qPCR. Histone methylation changes at the SNORE) 115 cluster will also be assessed using Cut&Run qPCR for H3K9me3. The constructs will be further tested in iPSC-derived neurons from healthy and AS patients. To comprehensively characterize the effects, high-throughput sequencing techniques will beWSGR Docket No. 68656-701.601 employed, including RNA-seq for transcriptome analysis and Cut&Run sequencing for genomewide assessment of H3K9me3 modifications.

[0276] It is hypothesized that SNORD115 mRNA will be decreased with a corresponding increase in UBE3A mRNA expression in cells administered ST1-ASO as compared to controls.

[0277] Example 10: Concentration-dependent gene knockdown by ASOs recruiting DNMT3A in HEK cells

[0278] Modular cellular targeting compositions were designed to target nascent transcripts upstream (5’) and downstream (3’) of the HTT transcription start site. Compositions were generated comprising a nucleic acid targeting domain comprising 2’ -MOE, PS modified ASOs linked to a biotin recruitment domain (corresponding to SEQ ID NOs: 19-21). To test the ability of these modular cellular targeting composition to induce knockdown of HTT, stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3 A were generated. The cell lines were then treated with the modular cellular targeting compositions targeting the HTT gene at lOnM and 50nM concentrations. A modular cellular targeting composition comprising a non-targeting control was also administered as a control. The results of the administration are shown in FIG. 8A and FIG. 8B. DNMT3A recruitment by biotinylated ASO modular cellular targeting compositions in cell lines expressing mSA fused to DNMT3 A resulted in a concentration-dependent reduction of HTT expression three days post-transfection, whereas cells expressing mSA alone showed no knockdown. The ASO sequences corresponding to the constructs shown in FIG. 8A and FIG. 8B are shown in Table 1.

[0279] Table 1. Nucleic acid targeting domain sequences of HTT targeting constructs.WSGR Docket No. 68656-701.601

[0280] The dose dependent knockdown of HTT by the modular cellular targeting composition comprising a biotin recruitment domain and a nucleic acid targeting domain comprising a 2’ -MOE and PS modified ASO comprising SEQ ID NO: 20 (alternate sequence identifier B) was also evaluated. A modular cellular targeting composition comprising a nontargeting control was also administered as a control. HEK cells lines were generated as described above. A dose-response experiment comparing Sequence B / SEQ ID NO: 20 to a nontargeting control ASO showed that HTT silencing only occurred in the HEK cells expressing mSA fused to DNMT3A, not with the cells expressing only mSA control. Three days posttransfection, the modular cellular targeting composition induced a dose-dependent reduction in HTT expression at 10 nM, 50 nM, and 250 nM. The results of the dose-response experiment are shown in FIG. 9 A and FIG. 9B.

[0281] Modular cellular targeting compositions were also designed to target nascent transcripts of SOD1. Compositions were generated comprising a nucleic acid targeting domain comprising 2’-M0E, PS modified ASOs linked to a biotin recruitment domain (corresponding to SEQ ID NO: 32). To test the ability of this modular cellular targeting composition to induce knockdown of SOD1, stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3 A were generated. The cell lines were then treated with the modular cellular targeting composition comprising the nucleic acid targeting domain of 2’ -MOE, PS modified SEQ ID NO: 32 targeting the SOD1 gene at lOnM and 50nM concentrations. A modular cellular targeting composition comprising a non-targeting control was also administered as a control. The results are shown in FIG. 10A and FIG. 10B. The ASO sequences corresponding to the constructs shown in FIG. 10A and FIG. 10B are shown in Table 2.WSGR Docket No. 68656-701.601

[0282] Table 2. Nucleic acid targeting domain sequences of SOD1 targeting constructs.

[0283] Additional modular cellular targeting compositions were designed to target nascent transcripts of the HTT transcription start site. Compositions were generated comprising a nucleic acid targeting domain comprising 2’ -MOE, PS modified ASOs linked to a biotin recruitment domain (corresponding to SEQ ID NOs: 19-21). To test the ability of these modular cellular targeting composition to induce knockdown of HTT, stable HEK293 cell lines expressing either monomeric streptavidin (mSA) or mSA fused to DNMT3A or ZNF-10 (KRAB) were generated. The cell lines were then treated with the modular cellular targeting compositions targeting the HTT gene at 50nM concentrations. A modular cellular targeting composition comprising a nontargeting control was also administered as a control. The results of the administration are shown in FIG. 11. Both cell lines expressing DNMT3A-mSA and ZNFlO-KRAB-mSA fusions induced HTT silencing three days post-transfection, while the mSA control cell line showed no knockdown. The ASO sequences corresponding to the constructs shown in FIG. 11 and FIG. 12 are shown in Table 3.WSGR Docket No. 68656-701.601

[0284] Table 3. Nucleic acid targeting domain sequences of HTT targeting constructs.

[0285] To evaluate the mechanism of gene silencing observed in FIG. 11, a CPG methylation analysis of the HTT locus was performed by bisulfite sequencing. The results of the CPG methylation analysis are shown in FIG. 12. The CpG methylation analysis revealed that ASO-mediated DNMT3 A recruitment produced comparable CpG methylation levels to dCas9-WSGR Docket No. 68656-701.601DNMT3 A, whereas untransfected, non-targeting control (NTC) and the clinical ASO Tominersen showed no effect on CpG methylation.

[0286] Example 11: Screening a panel of ASOs targeting HTT reveals effector-specific knockdown.

[0287] Modular cellular targeting compositions comprising biotinylated ASOs targeting either the HTT sense transcript or the antisense transcript were tested in stable HEK cells expressing monomeric streptavidin (mSA) alone or mSA fusions to DNMT3A, ZNF10-KRAB, or TET3. The results are shown in FIG. 13. Five days post-transfection, ASOs recruiting DNMT3A or ZNF10-KRAB induced robust HTT knockdown, whereas TET3 and mSA controls showed no appreciable reduction in HTT expression. The cells were maintained in culture for 1 month without redosing of the modular cellular targeting compositions. HTT expression was measured following the 1 month period, with the results shown in FIG. 14. At the 1 -month time point, HTT expression had rebounded to near baseline in mSA, DNMT3 A, and TET3 lines, whereas ZNFlO-KRAB-recruiting ASOs maintained durable HTT knockdown, indicating effector-specific persistence of repression.

[0288] The ASO sequences corresponding to the constructs shown in FIG. 13 and FIG. 14 are shown in Table 4.

[0289] Table 4. Nucleic acid targeting domain sequences of HTT targeting constructs.WSGR Docket No. 68656-701.601

Claims

WSGR Docket No. 68656-701.601CLAIMSWhat is claimed is:

1. A modular cellular targeting composition comprising: a) a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure; and b) a nucleic acid targeting domain comprising a polynucleic acid, wherein the recruitment domain and the nucleic acid targeting domain are operatively connected, and wherein the recruitment domain does not comprise a BIX01338 inhibitor.

2. The composition of claim 1, wherein the composition further comprises a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure.

3. The composition of claim 2, wherein the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises an epigenetic enzyme or epigenetic effector.

4. The composition of claim 3, wherein the epigenetic enzyme or epigenetic effector is endogenous to a human.

5. The composition of claim 4, wherein the epigenetic enzyme or epigenetic effector comprises a human wild-type epigenetic enzyme.

6. The composition of any one of claims 2-5, wherein the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises a DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF.

7. The composition of claim 1, wherein the recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain, a histone tail peptide recruitment domain, a histone embedding peptide recruitment domain, a histone tailWSGR Docket No. 68656-701.601 peptide recruitment domain and a histone embedding peptide recruitment domain, or a combination thereof.

8. The composition of claim 7, wherein the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain.

9. The composition of claim 7, wherein the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain.

10. The composition of claim 7, wherein the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain.

11. The composition of claim 7, wherein the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain.

12. The composition of claim 7, wherein the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT IL, or a PRDM family protein recruitment domain.

13. The composition of claim 7, wherein the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain.

14. The composition of claim 7, wherein the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain.

15. The composition of claim 7, wherein the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain.

16. The composition of claim 7, wherein the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain.

17. The composition of claim 7, wherein the histone deubiquitinase recruitment domain comprises a USP16, USP21, or USP22 recruitment domain.

18. The composition of claim 7, wherein the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain.

19. The composition of claim 7, wherein the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain.

20. The composition of claim 7, wherein the chromatin remodeling factor recruitment domain comprises a BRG1, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain.WSGR Docket No. 68656-701.60121. The composition of claim 7, wherein the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain.

22. The composition of any one of claims 1-21, wherein the recruitment domain comprises a biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof.

23. The composition of claim 22, wherein the recruitment domain comprises the small molecule domain.

24. The composition of claim 23, wherein the small molecule domain comprises a 5- Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VPA, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDB1-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5-methylcytosine containing DNA, or a CBP30 domain.

25. The composition of claim 24, wherein the HAT agonist comprises CTB, TTK21, YF-2, 1- CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106.

26. The composition of claim 7, wherein the histone tail peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 1-3 or 18.

27. The composition of claim 7, wherein the histone embedding peptide recruitment domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 4-17.

28. The composition of claim 1, wherein the nucleic acid targeting domain comprises an antisense oligonucleotide (ASO), a triplex-forming oligonucleotide (TFO), a G-quadruplex binding sequence, a small activating RNA, a small interfering RNA (siRNA), a CRISPR guide RNA, an aptamer, a ribozyme, a DNAzyme, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a phosphorothioate stabilized oligonucleotide, a DNA or RNA binding oligonucleotide, or a combination thereof.

29. The composition of claim 1, wherein the nucleic acid targeting domain comprises an oligonucleotide that binds to a target DNA or RNA, the target DNA or RNA comprising: cisacting non-coding RNAs, trans-acting non-coding RNAs, nuclear retained RNAs, introns of pre- mRNA, exons of mRNA, promoter regions of DNA, enhancer regions of DNA, silencer regions of DNA, insulator elements, topologically associating domains (TADs), DNA methylation sites, histone modification sites, DNase I hypersensitive sites, chromosome conformation capture (3C) interaction sites, a specific DNA or RNA sequence of interest, or a combination thereof.WSGR Docket No. 68656-701.60130. The oligonucleotide of claim 28 or claim 29 wherein the nucleic acid targeting domain comprises about 1 nucleotide to about 30 nucleotides.

31. The oligonucleotide of claim 30, wherein the nucleic acid targeting domain comprises about 10 nucleotides to about 30 nucleotides.

32. The oligonucleotide of claim 31, wherein the nucleic acid targeting domain comprises about 15 nucleotides to about 30 nucleotides.

33. The oligonucleotide of claim 32, wherein the nucleic acid targeting domain comprises about 20 nucleotides to about 30 nucleotides.

34. The composition of claim 1, wherein the nucleic acid targeting domain comprises about 90% to about 95% sequence identity to any one of SEQ ID NOs: 19-25, 27-29, or 32.

35. The composition of claim 1, wherein the nucleic acid targeting domain comprises any one of SEQ ID NOs: 19-25, 27-29, or 32.

36. The composition of claim 1, further comprising a linker.

37. The composition of claim 36, wherein the linker operatively connects the recruitment domain and the nucleic acid targeting domain.

38. The composition of claim 36, wherein the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof.

39. The composition of claim 36, wherein the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety.

40. The composition of claim 36, wherein the linker comprises a tissue-specific cleavable linker.

41. The composition of claim 40, wherein the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox-sensitive linker, an enzyme-cleavable linker, a light-sensitive linker, or a combination thereof.

42. The composition of any one of claims 36-41, wherein the linker comprises a self- immolative spacer.

43. The composition of any one of claims 36-42, wherein the linker comprises about 1 to about 200 amino acids.

44. The composition of claim 1, wherein the composition is operatively connected to a tissue targeting moiety.

45. The composition of claim 44, wherein the tissue targeting moiety comprises a livertargeting moiety, a brain-targeting moiety, a muscle-targeting moiety, a heart-targeting moiety, aWSGR Docket No. 68656-701.601 kidney -targeting moiety, a lung-targeting moiety, a tumor-targeting moiety, an immune celltargeting moiety, an ocular targeting moiety, a blood-brain-barrier crossing moiety, a cell targeting moiety; or a combination thereof.

46. The composition of claim 45, wherein the liver-targeting moiety comprises a GalNAc moiety, an asialoglycoprotein receptor (ASGPR) ligand, a triantennary N-acetylgalactosamine, a multivalent GalNAc cluster, a peptide targeting liver-specific antigens; or a combination thereof.

47. The composition of claim 45, wherein the brain moiety comprises a synaptic vesicle glycoprotein 2A (SV2A) binding peptide, an anti-SV2A antibody or antibody fragment, a neurotrophin receptor (p75NTR) binding peptide, a neuropilin-1 (NRP1) targeting peptide, a neuron-specific enolase (NSE) targeting moiety, a glial fibrillary acidic protein (GFAP) targeting antibody or antibody fragment, a peptide targeting brain-specific antigens; or a combination thereof.

48. The composition of claim 45, wherein the muscle-targeting moiety comprises, an a7pi integrin-binding peptide, a peptide targeting the acetylcholine receptor, a peptide targeting TfR, a peptide targeting muscle-specific antigens; or a combination thereof.

49. The composition of claim 45, wherein the heart-targeting moiety comprises, a cardiac troponin-binding peptide, an anti-cardiac troponin antibody or antibody fragment, a peptide targeting cardiac-specific antigens; or a combination thereof.

50. The composition of claim 45, wherein the kidney-targeting moiety comprises, a megalin- binding peptide, a cubilin-binding peptide, a peptide targeting kidney-specific peptide antigens; or a combination thereof.

51. The composition of claim 45, wherein the lung-targeting moiety comprises, a pulmonary surfactant protein binding peptide, an angiotensin converting enzyme (ACE) binding peptide, a PEC AM- 1 targeting antibody or antibody fragment, a peptide targeting claudin-18, an ICAM-1 targeting moiety, a peptide targeting lung specific-antigens; or a combination thereof.

52. The composition of claim 45, wherein the tumor-targeting moiety comprises, a folate receptor targeting moiety, an EGFR targeting antibody or antibody fragment, a HER2 targeting antibody or antibody fragment, an RGD peptide targeting av03 integrin, a CD 19 targeting moiety, a CD20 targeting moiety, a prostate-specific membrane antigen (PSMA) targeting moiety, a GRP78 targeting peptide, a peptide targeting tumor-associated antigens; or a combination thereof.

53. The composition of claim 45, wherein the immune cell -targeting moiety comprises, a CD3 targeting moiety, a CD4 targeting moiety, a CD8 targeting moiety, a CD40 targeting moiety, a peptide targeting CCR5, a dendritic cell-targeting antibody or antibody fragment, an immune cell targeting-peptide; or a combination thereof.WSGR Docket No. 68656-701.60154. The composition of claim 45, wherein the ocular targeting moiety comprises, an integrin avP3 targeting peptide, a peptide targeting retinal pigment epithelium, a transferrin receptor targeting moiety, a peptide targeting retinal ganglion cells, a peptide targeting ocular specific antigens; or a combination thereof.

55. The composition of claim 45, wherein the blood-brain-barrier crossing moiety comprises, a transferrin receptor (TfR) binding peptide, an anti-TfR antibody or antibody fragment, a Tissue Non-Specific Alkaline Phosphatase (ALPL) binding peptide, an anti-ALPL antibody or antibody fragment, a glucose transporter 1 (GLUT1) binding peptide, a low-density lipoprotein receptor-related protein 1 (LRP1) binding peptide, an insulin receptor binding peptide, a rabies virus glycoprotein (RVG) peptide, a peptide targeting blood-brain-barrier (BBB) antigens to allow for crossing the BBB; or a combination thereof.

56. The composition of any one of claims 1-55, wherein the composition comprises about 1 to about 5000 amino acids.

57. The composition of claim 56, wherein the composition comprises about 500 to about 1000 amino acids.

58. The composition of claim 56, wherein the composition comprises about 1000 to about 2000 amino acids.

59. The composition of any one of claims 1-58, wherein the composition comprises about 2000 to about 5000 amino acids.

60. A heterobifunctional recruitment composition comprising: a recruitment domain, wherein the recruitment domain comprises a first recruitment domain and a second recruitment domain, wherein the first recruitment domain comprises a recruitment domain for a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure, and the second recruitment domain comprises a recruitment domain for a genome associated protein, wherein the first recruitment domain and the second recruitment domain are operatively connected and wherein the genome associated protein does not comprise an anchored transcription factor.

61. The composition of claim 60, wherein the composition further comprises a protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure.

62. The composition of claim 61, wherein the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises an epigenetic enzyme or epigenetic effector.

63. The composition of claim 62, wherein the epigenetic enzyme or epigenetic effector comprises a human wild-type epigenetic enzyme.WSGR Docket No. 68656-701.60164. The composition of any one of claims 61-63, wherein the protein or nucleic acid that modifies DNA, RNA, epigenetic markers, histones, chromatin, histone structure, or chromatin structure comprises a DNA methyltransferase, a histone acetyltransferase, a histone deacetylase, a histone methyltransferase, a histone demethylase, a histone phosphorylase, a histone dephosphorylase, a histone ubiquitinase, a histone deubiquitinase, a histone SUMOylase, a histone deSUMOylase, a chromatin remodeling factor, a methyl-CpG binding protein, or UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF.

65. The composition of claim 60, wherein the first recruitment domain comprises a DNA methyltransferase recruitment domain, a DNA demethylase recruitment domain, a histone acetyltransferase recruitment domain, a histone deacetylase recruitment domain, a histone methyltransferase recruitment domain, a histone demethylase recruitment domain, a histone phosphorylase recruitment domain, a histone dephosphorylase recruitment domain, a histone ubiquitinase recruitment domain, a histone deubiquitinase recruitment domain, a histone SUMOylase recruitment domain, a histone deSUMOylase recruitment domain, a chromatin remodeling factor recruitment domain, a methyl-CpG binding protein recruitment domain, or a UHRF1, UHRF2, ATRX, DAXX, SMCHD1, or CTCF recruitment domain.

66. The composition of claim 65, wherein the DNA methyltransferase recruitment domain comprises a DNMT1, DNMT3A, DNMT3B, or DNMT3L recruitment domain.

67. The composition of claim 65, wherein the DNA demethylase recruitment domain comprises a TET1, TET2, TET3, TDG, AID, or MBD4 recruitment domain.

68. The composition of claim 65, wherein the histone acetyltransferase recruitment domain comprises, a p300, CBP, GCN5, PCAF, Tip60, HAT1, KAT2A, KAT2B, KAT5, KAT6A, KAT6B, KAT7, or KAT8 recruitment domain.

69. The composition of claim 65, wherein the histone deacetylase recruitment domain comprises an HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, or SIRT7 recruitment domain.

70. The composition of claim 65, wherein the histone methyltransferase recruitment domain comprises an PRC2, SETD2, ASH1L, NSD1, SUV39H1, SUV39H2, SETDB1, SETDB2, G9a, GLP, DOT IL, or a PRDM family protein recruitment domain.

71. The composition of claim 65, wherein the histone demethylase recruitment domain comprises an LSD1, KDM1B, KDM2A, KDM2B, KDM3A, KDM3B, KDM4A, KDM4B, KDM4C, KDM4D, KDM5A, KDM5B, KDM5C, KDM5D, KDM6A, KDM6B, KDM7A, or KDM8 recruitment domain.WSGR Docket No. 68656-701.60172. The composition of claim 65, wherein the histone phosphorylase recruitment domain comprises an aurora kinase, ATM, ATR, or DNA-PK recruitment domain.

73. The composition of claim 65, wherein the histone dephosphorylase recruitment domain comprises a PPI, PP2A, or WIP1 recruitment domain.

74. The composition of claim 65, wherein the histone ubiquitinase recruitment domain comprises an RNF20, RNF40, BMI1, RING1 A, or RING1B recruitment domain.

75. The composition of claim 65, wherein the histone deubiquitinase recruitment domain comprises a USP16, USP21, or USP22 recruitment domain.

76. The composition of claim 65, wherein the histone SUMOylase recruitment domain comprises a PIAS1, PIAS2, PIAS3, or PIAS4 recruitment domain.

77. The composition of claim 65, wherein the histone deSUMOylase recruitment domain comprises a SENP1, SENP2, SENP3, SENP5, SENP6, or SENP7 recruitment domain.

78. The composition of claim 65, wherein the chromatin remodeling factor recruitment domain comprises a BRG1, BRM, CHD1, CHD2, CHD3, CHD4, INO80, or ISWI recruitment domain.

79. The composition of claim 65, wherein the methyl-CpG binding protein recruitment domain comprises an MeCP2, MBD1, MBD2, MBD3, or MBD4 recruitment domain.

80. The composition of any one of claims 60-79, wherein the first recruitment domain comprises biotin-streptavidin domain, a monomeric streptavidin domain, an FKBP12 domain, an FKBP12(F36V) domain, a proteolysis targeting chimera (PROTAC) domain, an scFv domain, a small molecule domain, a peptide domain, a cyclic peptide domain, a DNA recruiting aptamer domain, an RNA recruiting aptamer domain, or a combination thereof.

81. The composition of claim 80, wherein the first recruitment domain comprises the small molecule domain.

82. The composition of claim 81, wherein the small molecule domain comprises a 5- Azacytidine domain, 5-Aza-2'-deoxycytidine, SGI-1027, Bobcat339, UC-514321, NSC-370284, SAHA, VPA, TSA, Romidepsin, Beleodaq, MS-275, Vorinostat, DZNeP, EPZ005687, GSK126, UNC1999, EPZ11989, JQ1, JQ2, GSK3326595, JNJ64619178, C646, A-485, 1-CBP112, SETDBl-TTD-IN-1, a HAT agonist, 5-methylcytosine containing RNA, 5-methylcytosine containing DNA, or a CBP30 domain.

83. The composition of claim 82, wherein the HAT agonist comprises CTB, TTK21, YF-2, 1- CBP112, CTPB, 5-Ph-IAA-AM, YF-2, hydrochloride, or SPV106.

84. The composition of claim 60, further comprising an endogenous genome-associated protein.WSGR Docket No. 68656-701.60185. The composition of claim 84, wherein the genome-associated protein comprises a transcription factor, a transcriptional coactivator, a transcriptional corepressor, a chromatin remodeling factor, a histone modifier, a DNA modifier, an architectural protein, an RNA polymerase II and associated factors, a mediator complex component, an enhancer-associated factor, an insulator protein, a topoisomerase, a pioneer factor, a polycomb group protein, a trithorax group protein, a heterochromatin protein, a DNA methylation reader, a histone modification reader, a long non-coding RNAs associated with chromatin, or a combination thereof.

86. The composition of claim 60, wherein the second recruitment domain comprises a genome-associated protein recruitment domain.

87. The composition of claim 86, wherein the genome-associated protein recruitment domain comprises a transcription factor recruitment domain, a transcriptional coactivator recruitment domain, a transcriptional corepressor recruitment domain, a chromatin remodeling factors recruitment domain, a histone modifier recruitment domain, a DNA modifier recruitment domain, an architectural protein recruitment domain, an RNA polymerase II and associated factor recruitment domain, a mediator complex component recruitment domain, an enhancer- associated factor recruitment domain, an insulator protein recruitment domain, a topoisomerase recruitment domain, a pioneer factor recruitment domain, a poly comb group protein recruitment domain, a trithorax group protein recruitment domain, a heterochromatin protein recruitment domain, a DNA methylation reader recruitment domain, a histone modification reader recruitment domain, a long non-coding RNAs associated with chromatin recruitment domain, or a combination thereof.

88. The composition of any one of claims 60-87, further comprising a linker.

89. The composition of claim 88, wherein the linker connects the first recruitment domain and the second recruitment domain.

90. The composition of claim 88, wherein the linker comprises a cleavable linker, a flexible linker, a ph-sensitive linker, a disulfide linker, a peptide linker, a glycine linker, a polyethylene glycol (PEG) linker, a peptide linker, a nucleotide linker, an alkyl linker, a disulfide linker, an ester bond linker, amide bond linker, a carbamate bond linker, a click chemistry-compatible linker, an azide-alkyne linker, diels-alder linker, a thiol-ene linker; or a combination thereof.

91. The composition of claim 88, wherein the linker comprises an organic molecule, an organic group, a polymer, or a chemical moiety.

92. The composition of claim 88, wherein the linker comprises a tissue-specific cleavable linker.WSGR Docket No. 68656-701.60193. The composition of claim 92, wherein the tissue-specific cleavable linker comprises: a protease-cleavable linker, a pH-sensitive linker, a redox- sen si five linker, an enzyme-cleavable linker, a light-sensitive linker, or a combination thereof.

94. The composition of any claims 88-93, wherein the linker comprises a self-immolative spacer.

95. The composition of any one of claims 88-94, wherein the linker comprises about 5 to about 200 amino acids.

96. The composition of any one of claims 60-95, wherein the composition comprises about 1 to about 5000 amino acids, about 500 to about 1000 amino acids, about 1000 to about 2000 amino acids, or about 2000 to about 5000 amino acids.

97. The composition of any one of claims 60-95, wherein the composition comprises less than about 550 amino acids.

98. A composition comprising a recombinant polynucleic acid encoding the composition of any one of claims 1-97.

99. A pharmaceutical composition comprising the composition of any one of claims 1-98 and a pharmaceutically acceptable excipient.

100. A method of introducing one or more modifications in an epigenome, the method comprising: administering the composition of any one of claims 1-97, the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to a cell, a tissue, a subject, or a combination thereof.

101. A method of modulating gene expression, the method comprising: administering the composition of any one of claims 1-97, the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to a cell, a tissue, a subject, or a combination thereof.

102. A method of treating a disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of the pharmaceutical composition of claim 99 to a subject.

103. The method of claim 102, wherein the method of treating the disease or condition in the subject in need thereof comprises introducing one or more modifications in an epigenome of the subject, or modulating gene expression in the subject.

104. The method of claims 102 or 103, wherein the disease or condition comprises a disease or condition associated with the epigenome.

105. The method of claim 102, wherein the disease or condition comprises progressive supranuclear palsy, angelman syndrome, prader-willi, alzheimer’s disease, cancer, type 1 or type 2 diabetes, liver disease, kidney disease, eye disease, parkinson’s disease, hepatitis B viral infection, t-cell mediated autoimmunity, huntington’s disease, a disease or condition associatedWSGR Docket No. 68656-701.601 with the central nervous system, or a disease or condition associated with the peripheral nervous system.

106. The method of claim 103, wherein the one or more modifications in the epigenome comprises increasing or decreasing methylation, increasing or decreasing acetylation, increasing or decreasing ubiquitylation, increasing or decreasing phosphorylation, increasing or decreasing sumoylation, increasing or decreasing ribosylation, increasing or decreasing citrullination, or a combination thereof.

107. The method of claim 106, wherein the one or more modifications comprises one or more transient modifications.

108. The method of claim 106, wherein the method comprises increasing methylation.

109. The method of claim 108, wherein the increasing methylation comprises increasing methylation of a CpG island associated with a gene.

110. The method of claim 109, wherein the gene comprises a gene associated with the disease or condition of claim 104.

111. The method of claim 110, wherein the method comprises increasing or decreasing expression of the gene.

112. The method of claim 111, wherein the gene comprises MAPT, SOD1, PCSK9, HTT, or PR.

113. A method of cellular reprogramming comprising a) administering the composition of any one of claims 1-97 the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to a cell b) culturing the cell, wherein the culturing comprises conditions that induces cellular reprogramming and c) isolating reprogrammed cells with a desired cellular identity.

114. A method of creating epigenetic memory in cells, comprising a) administering the composition of any one of claims 1-97, the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to a cell and b) dividing the cell.

115. The method of claim 114 further comprising c) detecting an induced epigenetic mark in a divided cell.

116. A method of creating a synthetic transcriptional circuit comprising a) administering a first composition comprising the composition of any one of claims 1-97, the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to a cell, a tissue, a subject, or a combination thereof and b) administering a second, third, or more composition comprising the composition of any one of claims 1-97, the recombinant polynucleic acid of claim 98, or the pharmaceutical composition of claim 99 to the cell, the tissue, the subject, or aWSGR Docket No. 68656-701.601 combination thereof, wherein administering the first, second, third, or more composition induces a series of transcriptional events.

117. The method of claim 116, wherein the administering comprises a specific temporal sequence.

118. The method of claim 116, wherein the series of transcriptional events comprises increasing or decreasing expression of a first gene, a second gene, a third gene, or more than three genes.

119. The method of any one of claims 116-118, further comprising detecting a gene expression pattern.