Engineered fungi having increased virulence and methods of using the same

Genetic modification of entomopathogenic fungi using CRISPR-Cas9 to suppress the Bbsmrl gene enhances virulence and oosporein production, addressing the inefficiencies of conventional biocontrol agents and chemical pesticides, resulting in faster pest kill times and reduced environmental impact.

WO2026102511A1PCT designated stage Publication Date: 2026-05-21EMPRESA BRASILEIRA DE PESQUISA AGROPECUARIA EMBRAPA +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

Conventional agricultural methods heavily rely on chemical pesticides, which pose environmental and health risks, and existing biocontrol agents like entomopathogenic fungi suffer from slow infection kinetics and high inoculum requirements, necessitating improved genetic modifications to enhance virulence and efficiency.

Method used

Genetic modification of entomopathogenic fungi, such as Beauveria bassiana, through CRISPR-Cas9 to suppress the Bbsmrl gene or AZF1 protein, leading to increased oosporein production and enhanced virulence, with faster pest kill times and reduced inoculum needs.

Benefits of technology

The engineered fungi demonstrate significantly improved virulence, faster pest killing, lower lethal inoculum requirements, and reduced regulatory burden, making them more effective and environmentally friendly biocontrol agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BR2025050526_21052026_PF_FP_ABST
    Figure BR2025050526_21052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention is related in general, to the field of biotechnology, especially to the use of genetic engineering in the development of entomopathogenic fungus with desirable traits to increase efficiency in the biocontrol of nematode and arthropod pests, such as insects and mites, with wide application in agriculture as an environmental friendly alternative to the use of chemical pesticides, therefore contributing to sustainable agriculture by reducing reliance on said chemical pesticides. The present invention teaches that, surprisingly, a genetic modification of a transcription factor-encoding gene, preferably Bbsmr1 or a functional homologue thereof, allowed increases virulence against pests. The invention also provides a method of controlling a pest, a seed treated with said genetically engineered fungi as well as a plant germinated therefrom.
Need to check novelty before this filing date? Find Prior Art

Description

ENGINEERED FUNGI HAVING INCREASED VIRULENCE AND METHODS OF USING THE SAMEFIELD OF THE INVENTION

[0001] The present invention is related, in general, to the field of biotechnology, especially to the use of genetic engineering in the development of entomopathogenic fungus with desirable traits to increase efficiency in the biocontrol of pests, such as nematode and arthropod pests, with wide application in agriculture as an environmental friendly alternative to the use of chemical pesticides, therefore contributing to sustainable agriculture by reducing reliance on said chemical pesticides. The present invention teaches that, surprisingly, a genetic modification of a transcription factor-encoding gene, preferably Bbsmr1 or a functional homologue thereof, allowed increases efficiency in the biocontrol of nematode and arthropod pests. The invention also provides a method of controlling a pest, a seed treated with said genetically engineered fungi as well as a plant germinated therefrom..BACKGROUND OF THE INVENTION

[0002] The challenge of managing arthropod pests in agriculture is significant, as these pests cause substantial economic losses and threaten food security globally. Arthropod pests, such as insects and mites, exert a negative impact on food security and agricultural productivity worldwide, leading to substantial economic losses. Invasive insects alone incur approximately $70 billion in costs to the global economy each year [1].

[0003] Over the past five decades, conventional agricultural systems have heavily relied on synthetic chemical pesticides as the primary method to control pests and safeguard crop yields on a global scale. However, this reliance on chemical pesticides has raised concerns due to its adverse effects on the environment and human health, as documented in various studies [2,3]. The escalating expenses associated with the discovery, development, and registration of new synthetic pesticides, coupled with the rapid emergence of pest resistance [4] have fueled interest in non-chemical alternatives. The prevailing chemical paradigm within industrial agriculture relies heavily on insecticides, often causing secondary outbreaks or resurgence of insect pestsdue to the elimination of natural enemies or development of resistant populations [5]. Consequently, more than 550 arthropod species have developed resistance to at least one insecticide, underscoring the constraints of a chemical control approach [6]. Given this context, biological control strategies play a crucial role in sustainable integrated pest management schemes, reducing the dependence on chemical pesticides, thereby mitigating environmental pollution and the threat of pesticide resistance.

[0004] Biological control agents are pivotal players of the recent microbial revolution in agriculture, with a global market share of agricultural biologicals estimated in USD 15.10 billion by 2024 and USD 43.53 billion by 2035 [7]. Alternatively, the widespread adoption of beneficial microorganisms as biocontrol agents, particularly entomopathogenic fungi like Metarhizium spp. (Ascomycota: Clavicipitaceae) and Beauveria spp. (Ascomycota: Cordycipitaceae), form a significant component of biopesticide use across organic and conventional agricultural systems worldwide [8]. Despite their potential, challenges exist in the efficacy of these fungi due to their slow infection kinetics and the high inoculum levels required to effectively control pests [9]. Efforts are underway to develop faster and more efficient methods for selecting suitable microbial strains for biopesticide development; however, these processes are often time-consuming and labor-intensive, with success rates remaining low. Consequently, there is a growing interest in exploring genetic transformation techniques to enhance fungal attributes for biocontrol applications, addressing the pressing needs of the agricultural industry.

[0005] Engineered fungi are revolutionizing many applications in pharmaceutical, medical, and agricultural settings by helping to better understand gene functions involved in the interactions between fungal pathogens with their hosts. Particularly, the multifunctional endophytic entomopathogenic Beauveria bassiana and other hypocrealean species are also widely exploited for their secondary metabolites, which are useful in biotechnology and medicine

[0010] . Many entomopathogenic fungal secondary metabolites have antimicrobial and cytotoxic activities, and B. bassiana synthetizes nonribosomal peptides and polyketides, such as beauvericin and bassianolide (cyclooligomeric nonribosomal peptides), a variety ofbeauverolides (cyclic peptides), oosporein (dibenzoquinone), bassiatin (diketomorpholine), and tenellin (2-pyridone) [11 ,12]. It is thought that these fungi synthesize such compounds in order to kill insects as well as to limit bacterial competition within the host

[0013] , a typical co-evolutionary arms race strategy deployed by pathogen versus host. Despite all the benefits in plant protection and health afforded by entomopathogenic fungi, fungal insecticides, also known as mycoinsecticides, still struggle due to their slow speed of kill and high doses required to cause satisfactory and consistent control of the target insect pests across different environmental conditions [9,14]. Such fungal phenotypic traits can be improved by genetic engineering of exogenous or endogenous virulence factors

[0015] .

[0006] Beauveria bassiana induces innate immune responses in the cuticle and gut to undermine the proliferation of bacterial competitors residing in these tissues during their growth in the insect host

[0016] . After invading insect hosts, B. bassiana produces a variety of toxins, and genome analysis of B. bassiana revealed its potential to produce putative secondary metabolites. A well annotated genome of B. bassiana ARSEF 2860 shows 41 putative secondary metabolites biosynthetic gene clusters. Expression of biosynthetic gene clusters (BGCs) under suitable conditions leads to production of secondary metabolites such as bassiacridin, beauvericin, bassianin, bassianolide, beauverolides, tenellin, oosporein, and oxalic acid [11 ,17,18]. Among these toxins, some have shown antimicrobial and antifungal activity in vitro and some have been associated with specificity and virulence because they suppress the immune response of the host, i.e. they are immunomodulators

[0019] . Of particular interest, the red pigment dibenzoquinone known as oosporein acts as an antimicrobial compound post-insect death that inhibits microbial competition and assures nutrients are available for fungal growth and reproduction

[0013] .

[0007] Notably, B. bassiana can produce red pigmented compounds during the late stages of growth, and the cluster of six genes responsible for the production of the red pigment oosporein has been functionally characterized in this fungus [13,20]. Considering that many B. bassiana commercial isolates have been widely utilized in pest control due to the production of metabolites that promote fungal growth, enhancement of virulence in B. bassiana strainsthrough the overexpression of secondary metabolites has been considered a viable option to improve the shortcoming of fungal insecticides. In this sense, harnessing the production of secondary metabolites in genetically engineered entomopathogenic fungi has been sought as an alternative to unlock a plethora of bioactive compounds with unique insecticidal activities, thus enhancing the reliability and performance of these fungal biocontrol agents as effective alternatives to chemical pesticides [20, 21].

[0008] Clustered regularly interspaced short palindromic repeats (CRISPR) coupled with the endonuclease Cas9 (CRISPR-Cas9) is a powerful genetic tool that enables efficient and precise genome editing in filamentous fungi, surpassing traditional methods like plasmid and Agrobacterium-vned'iaied transformation. Proof-of-concept studies using the CRISPR-Cas9 system on entomopathogenic fungi were previously demonstrated for B. bassiana

[0030] and Metarhizium brunneum [31 ,32], but none of them generated strains with improved ecological fitness or virulence properties to make them better biocontrol agents for pest management. Despite considerable past efforts to develop transgenic fungal strains expressing arachnid (spider or scorpion) or wasp toxins [33,34], their release into the field is impeded by public, environmental, and safety concerns that are rooted in existing regulatory policies. These concerns have thus far limited their broad utilization as registered biocontrol agents. Although the genetic manipulation of endogenous genes associated with virulence factors in entomopathogenic fungi using CRISPR-Cas9 is thought to be a preferred method for generating markerless mutants with enhanced phenotypic characteristics when compared to wild-type strains [21 ,35] aiming at streamlining the approval process and gaining acceptance from regulatory agencies , so far no genetic modification using such tools has been taught to produce markerless mutants with enhanced phenotypic characteristics.

[0009] Therefore, there is a demand for provision of entomopathogenic fungal strains with enhanced reliability and performance as pest control agents, preferably achieved through genetic modifications that are not subject to the stringent requirements imposed by regulatory agencies to transgenic strains and other market mutants.SUMMARY OF THE INVENTION

[0010] The present invention surprisingly teaches that a genetic modification resulting in partial or complete suppression of the expression of the Bbsmrl gene, or partial or complete suppression of the activity of the AZF1 protein (a transcription factor) results in a fungal strain with increased virulence against pests. The genetic modification can be produced by several known techniques, including those that generate markerless mutants, such as gene editing using CRISPR-Cas9, thus streamlining its approval process and acceptance by regulatory agencies.

[0011] Therefore, the present invention surprising provides, among others, an engineered entomopathogenic fungus with:1. Enhanced Virulence: increased virulence against insect pests, outperforming traditional strains.2. Faster Killing Time: The engineered strains demonstrate a significantly reduced lethal time compared to wild-type strains, indicating a faster speed of killing the target pests. This offers a competitive advantage over existing biocontrol agents like Metarhizium anisopliae, which have slower infection kinetics.3. Lower Lethal Inoculum Requirement: A modified strain according to the present invention requires a much lower lethal inoculum concentration to achieve effective pest control, reducing the cost and environmental impact compared to conventional chemical pesticides and other biocontrol agents.4. Reduced Environmental Impact: By enhancing the efficacy of a biological control agent, a modified strain according to the present invention reduces the reliance on chemical pesticides, mitigating environmental pollution and the development of pest resistance associated with synthetic chemicals.5. Lower Regulatory Burden: Markerless mutants obtained according to the present invention have a streamlined approval process and acceptance by regulatory agencies.BRIEF DESCRIPTION OF THE INVENTION

[0012] The present invention provides a genetically engineered funguscomprising a genetic modification selected from the group consisting of: (i) a genetic modification that partially or completely suppresses expression of the Bbsmrl gene; and (ii) a genetic modification that partially or completely suppresses the activity of the AZF1 protein.

[0013] In one embodiment, the genetically engineered fungus is an oosporein producing fungus. In a further embodiment, the genetic modification leads to the derepression of a gene cluster associated with oosporein biosynthesis, thereby increasing oosporein production.

[0014] The invention encompasses fungi from various taxonomic groups. In one embodiment, the fungus is from a genus selected from the group consisting of Acremonium spp., Arcopilus spp., Beauveria spp., Blackwellomyces spp., Chaetomium spp., Cochliobolus spp., Comiculantispora spp., Lecanicillium spp., Oospora spp., Phlebia spp. and Tremella spp.

[0015] In a specific embodiment, the fungus is from a species selected from the group consisting of Acremonium alabamense, A. altematum, A. cavaraeanum,A. chrysogenum, A. falciforme, A. kiliense, A. recifei, A. strictum, A. zeae, Arcopilus amazonicus, A. aureus, A. cupreus, A. flavigenus, A. fusiformis, A. turgidopilosus, Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis,B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Chaetomium atrobrunneum, C. aureum, C. bostrychodes, C. cochliodes, C. crispatum, C. cupreum, C. elatum, C. funicola, C. globosum, C. indicum, C. murorum, C. thermophilum, Cochliobolus akaii, C. bicolor, C. carbonum, C. cymbopogonis, C. cynodontis, C. eleusines, C. geniculatus, C. hawaiiensis, C. heterostrophus, C. kusanoi, C. lunatus, C. miyabeanus, C. nisikadoi, C. pallescens, C. sativus, C. spicifer, C. victoriae, Comiculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L. antillanum, L. araneicola, L. coprophilum, L. evansii, L. flavidum, L. fusisporum, L. gracile, L. kalimantanense, L. lecanii, L. longisporum, L. muscarium, L. nodulosum, L. saksenae, L. tenuipes, Oospora colorans, Phlebia acerina, P. centrifuga, P.coccineofulva, P. hydnoidea, P. incamata, P. livida, P. mellea, P. radiata, P. rufa, P. subochracea, P. tremellosa, Tremella aurantia, T. encephala, T. foliacea, T. fuciformis, T. mesenterica, T. mycophaga, and T. simplex.

[0016] In certain embodiments, the fungus is an entomopathogenic fungus. In further embodiments, the fungus has increased virulence and enhanced fungal fitness. The entomopathogenic fungus may be selected from the group consisting of Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Comiculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L. antillanum, L. araneicola, L. coprophilum, L. evansii, L. flavidum, L. fusisporum, L. gracile, L. kalimantanense, L. lecanii, L. longisporum, L. muscarium, L. nodulosum, L. saksenae, and L. tenuipes. In a preferred embodiment, the entomopathogenic fungus is Beauveria bassiana.

[0017] In one embodiment, the AZF1 protein comprises an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 3-16.

[0018] In one embodiment, the Bbsmrl gene comprises a nucleotide sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and 17-26, or degenerated sequences thereof encoding the same amino acid sequences.

[0019] The genetic modification may be produced via gene editing, gene modification, gene silencing or mutagenesis. In one embodiment, the genetic modification is a deletion, insertion, or substitution of one or more nucleotides in the promoter region, in the 5'UTR region, in the coding region, or in the 3'UTR region of the native gene. In specific embodiments, gene editing is introducedvia a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) or CRISPR / Cas system mediated deletion. In other embodiments, the gene silencing is an RNA-mediated gene silencing.

[0020] In some embodiments, the fungus comprises a further genetic modification increasing expression of one or more genes involved in the production of oosporein.

[0021] The invention also provides a composition or product comprising a genetically engineered entomopathogenic fungus as described herein. In one embodiment, said composition is a biopesticide for pest control. The invention further provides a kit comprising: (a) a genetically engineered entomopathogenic fungus as described herein; and / or (b) a composition or product as described herein.

[0022] The invention further provides a method for producing a fungus with enhanced production of oosporein, virulence and / or entomopathogenic performance comprising culturing the genetically engineered fungus described herein.

[0023] The invention also provides a method for enhancing the virulence and biocontrol performance of entomopathogenic fungi, and a method for enhancing the production of oosporein in fungi. These methods comprise introducing the abovementioned genetic modification into said fungi.

[0024] In applying these methods, the fungus may be an oosporein producing fungus as described above. The genetic modification may lead to the derepression of a gene cluster associated with oosporein production. In preferred embodiments, the fungus is entomopathogenic (e.g. Beauveria bassiana) and the genetic modification preferably leads to increased virulence against pests and / or enhanced fungal fitness.

[0025] Also the objects of the present invention are the use of said genetically engineered fungi for the manufacture of a composition, kit or product for controlling a pest, a kit and composition comprising thereof, a method of controlling a pest, as well as a seed treated with the genetically engineered fungi and a plant germinated therefrom.

[0026] Other embodiments, features, and advantages of the invention will become apparent from the following detailed description, examples, and claims.BRIEF DESCRITPION OF SEQUENCES

[0027] The nucleotide sequences of the native transcription factor-encoding genes and genes from the biosynthetic gene cluster associated with a compound involved in host immune evasion, as well as their target expression products for suppression according to the present invention, can be identified from a myriad of organisms. Although the nucleotide sequences mentioned are described herein, they should not be considered as limitations of the present invention. Thus, a sequence of the native transcription factor-encoding genes and genes from said biosynthetic gene cluster can be identified and functionally annotated by sequence comparison.

[0028] A person skilled in the art can readily identify a sequence of a particular native transcription factor-encoding gene or a particular gene in a suitable database, such as GenBank, using publicly available sequence analysis programs and parameters. The description of sequences can be found below:

[0029] SEQ ID NO: 1 corresponds to the complete amino sequence of the transcription factor Bbsmrl (finger protein AZF1) from Beauveria bassiana ARSEF 2860.

[0030] SEQ ID NO: 2 corresponds to the partial mRNA nucleotide sequence of transcription factor Bbsmrl (finger protein AZF1) from Beauveria bassiana ARSEF 2860 encoding gene.

[0031] SEQ ID NOs: 3-16 correspond to the amino sequences homologous to the transcription factor Bbsmrl (finger protein AZF1) from Beauveria bassiana ARSEF 2860 identified in the GenBank.

[0032] SEQ ID NOs: 17-26 correspond to the nucleotide sequences homologous to the transcription factor Bbsmrl (finger protein AZF1) encoding gene from Beauveria bassiana ARSEF 2860 identified in the GenBank.DESCRITPION OF DRAWINGS

[0033] Figure 1: Gene editing strategy and construction of B. bassiana (^Bbsmrl) mutants. A) Gene edition strategy. Red arrow corresponds to the specific Cas9 target site. Black arrows correspond to diagnostic primers. B) Diagnostic PCR for detection of positive mutants ( BbsmrT) using specific markers (long read primers: Bbsrm1-F + Bbsmrl -R) before monosporicpurification step in 1 % agarose gel. The PCR products formed band sizes of 1.9 kb and 4.8 kb for the WT strain and the putative transformants (containing the insert DNA of geneticin resistance gene), respectively. C) Diagnostic PCR for site- specific mutation in Bbsmrl using specific markers (short read primers: Bbsmr1-F + Gent_R) in 1% agarose gel to confirm the positive transformants. The ~2.4 kb band corresponds to a positive ΔBbsmr1 mutant, confirming the integration of geneticin cassette into Bbsmrl gene. As expected, no band appears in WT due to the absence of the geneticin resistance gene. All homokaryon mutants are highlighted with a green inverted triangle and they show a band in both gels (B, C). Ctrl is the negative control without any DNA.

[0034] Figure 2: Oosporein production during in vitro growth. A) Oosporein production (in ppm) by ^Bbsmrl strains during four days of growth in 50-mL PDB at 28 °C and 250 rpm. The pink / red color in the culture supernatant of ΔBbsmr1 strains is the evidence of oosporein presence, whilst null oosporein was found in the WT’s liquid cultures. B) Kinetics of oosporein production (ppm) during four days cultivation. Significant differences in oosporein production (mean±SE, n = 6) between mutants within each time interval are indicated by asterisks (* P < 0.05, ** P < 0.01 or *** P < 0.001) according to Tukey’s test. Different symbols and colors represent the mutants.

[0035] Figure 3: Knockout Bbsrml mutants of B. bassiana exhibit varied degrees of virulence against the greater wax moth. A) Single-dose survival response of Galleria mellonella larvae following exposure to eight different mutant strains (designed ^Bbsmrl). Inoculum concentration at 1 x 107blastospores / mL and insects were treated using the direct contact application by exposing larvae for 10 sec to 1 mL of blastospore suspension. Natural mortality in controls were attributed to unknown causes with dead larvae appearing all black and putrefied. Survival curves were compared with nonparametric log-rank test and lettering indicates significant differences (P < 0.05). B) Overall mortality confirmed by mycosis of G. mellonella after 3 days posttreatment with blastospores of ΔBbsmr1 and wild-type strains. Means (± SE) not sharing any letter are significantly different by Tukey’s HSD (P < 0.05). C) Vertical bars represent median and 90% lethal times estimated by Weibull parametric model fitted to survival data followed by their respective 95%confidence intervals. Lettering indicates significant differences based on the non-overlapping of confidence intervals. D) Hazard ratio depicting the likelihood of insect death occurring after exposure to B. bassiana mutants in relation to the wild-type. The higher this ratio the greater the risk of death imposed by the mutant strain in comparison to the wild-type. P values are given for all comparisons.

[0036] Figure 4: B. bassiana mutants display greater and faster killing activity against the greater wax moth compared with the wild-type strain. A) Survival probability of G. mellonella following exposure to crescent concentrations (5 x 105to 1 x 107blastospores / mL) of different knockout mutants (ΔBbsmr1) compared with the wild-type strain. Lettering indicates statistical differences based on the log-rank test (P < 0.05) for comparison between survival curves within each fungal concentration. Survival curves with means (± SE) represent data from five replicates (n = 100 - 140 insects / concentration / strain) derived from two independent bioassays. Lettering represents statistical differences (P < 0.05) based on a log-rank test comparing the Kaplan-Meier survival curves. Natural mortality in controls were attributed to unknown causes with dead larvae appearing all black and putrefied. B) LT50 (± 95% Cl) values across different fungal concentrations. ND = not determined due to mortality level did not reach 50%. C) LC50 (± 95% Cl) values across different time intervals following exposure to fungal treatments. The LC50 dose for untreated G. mellonella was fixed at zero and reported for all blastospore concentrations for comparison. Lettering of LTsos and LCsos indicates statistical differences based on the non-overlapping of their 95% Cis (P < 0.05). D) Microscopic observation of fungal development and insect immune responses to the WT and mutant strains at different times after cuticle-contact infection. No evidence of aggregation of hemocytes in the hemolymph from wild-type-infected larvae, whereas at within 3 days after exposure to fungal treatments of B. bassiana mutants, blastospores (indicated by arrows) appeared in the hemolymph and induced cellular defense mechanism observed by pronounced hemocyte aggregations to these cells. E) Quantification of free-floating fungal blastospores in insect hemolymph 72 h after cuticle-contact infection.

[0037] Figure 5: Oosporein biosynthetic gene cluster regulation in B. bassiana mutants with disrupted Bbsmrl and off-target detection by whole genome sequencing analysis. A) Fold change in gene expression of Bbsmrl, OpS1-7, OpS11 and OpS12 genes in the ΔBbsmr1 mutants normalized to wild-type (WT) expression levels. Asterisks indicate significant differences between the WT and the mutants (P < 0.05). B) Read mapping of WT and in the Bbsmrl mutant sequencing reads to the genome of ΔBbsmr1_3, confirming the disruption and location of the insertions.

[0038] Figure 6: Phenotypic characterization of the mutant strains. A) Blastospore production by knockout B. bassiana mutants ( ΔBbsmr1) compared with the wild-type (WT) strain during liquid culture growth at 250 rpm and 28 °C for three days. Lettering of means (± SE) indicates statistical differences based on the Tukey’s test (P < 0.05). Symbols represent observational data in each treatment (n = 8). B. bassiana knockout mutants ( ΔBbsmr1) displaying varied growth behavior when grown on potato- dextrose-agar (PDA) without the selectable marker. B) Colony growth kinetics expressed in area (cm2) for three mutants ( ΔBbsmr1) and wild-type (WT), and colony conidiation recorded after 12 days post-inoculation. Lettering of means (± SE, n = 6) within each time interval indicates statistical differences based on the Tukey’s test (P < 0.05). c, Morphology of fungal colonies grown on PDA after 12 days post-inoculation.

[0039] Figure 7: Multi-stress tolerance displayed by B. bassiana mutants and wild-type (WT) are variable when grown in the presence of various chemical stressors. A) Comparative multi-stress response among B. bassiana mutants and wild-type strain challenged with osmotic (0.8 M NaCI), oxidative (2.0 M H2O2 and 0.02 M Menadione), and cell wall (100 μg / mL Congo red) stressor agents compared to control cultures grown only in PDA. Inoculum of 5 μL from a fungal suspensions containing 5 x 107blastospores / mL was added to the center of the agar media and evaluation was carried out across time measuring the area of colonies. Lettering of means (± SE, n = 6) indicates statistical differences between strains, within each time interval, based on the Tukey’s test (P < 0.05). B) Morphological aspects of the mutant and WT colonies when grown in thepresence of various cell chemical stressors, after 12 days of incubation.

[0040] Figure 8: Principal component analysis (PCA) revealing the relationship of pleotropic impacts of growth with virulence traits on B. bassiana mutants and wild-type strain. A) Biplot consisting of two principal components corresponding to 93.7% of total data variance from 11 meaningful phenotypic variables (arrows with their respective contribution levels) that clearly separates the three B. bassiana mutants (ΔBbsmr1 #3, #5 and #38) from the wild-type (WT) strain (dots). B) Heatmap based on Manhattan distance and Wald method for clustering the variables and strains using dendrograms.

[0041] Figure 9: Generic map of the geneticin cassette (donor DNA), including homology arms, primers locations and insertion site.

[0042] Figure 10: Illustrative step-by-step transformation protocol developed for B. bassiana protoplasts to implement CRISPR-Cas9 RNPs. (1-7) Preparation of germlings from germinated blastospores followed by enzymatic digestion using kitalase to obtain protoplasts. Between steps 7 and 8, the protoplasts are mixed with the pre-assembled RNPs to induce the gene disruption in a PEG solution. (8-11) Regeneration of transformed protoplasts on selective medium containing the marker geneticin. (12) Screening of putative transformants using 24-well- plates containing PDA amended with geneticin, followed by picking colonies and growing them in PDB for further DNA extraction and then PCR diagnosis to confirm the true mutants.

[0043] Figure 11 : Blastospores of B. bassiana kill faster the greater wax moth (G. mellonella) than aerial conidia after treatment at a concentration of 5 x 106propagules / mL. A) Survival curves were compared with log-rank test (P < 0.05) while LT50 values (95% confidence intervals) were estimated from survival curves adjusted to a parametric Weibull model. B) Appearance of G. mellonella larvae after 5 days post-inoculation with aerial conidia (cadavers with no signs of oosporein production after death) and blastospores (all cadavers exhibited red pigmentation due to oosporein production after larval death) in comparison to the mock control larvae depicting healthy and normal morphology.

[0044] Figure 12: Blastospores of B. bassiana require lower lethal concentrations to kill the greater wax moth than aerial conidia. Horizontal dashed lines in plots represent 50% and 90% lethality. Concentration-mortalitycurves (solid and dashed lines) fitted to 2- parameter Weibull model at different days of evaluation. Symbols represent mean mortality values. Lettering indicates significant (Log-likelihood ratio test at P < 0.05) differences between aerial conidia and blastospores induced mortality curves. Axis-x represents the log 10 inoculum concentration.

[0045] Figure 13: Disruption of the B. bassiana Bbsmrl gene mediated by the Cas9-RNP transformation system and oosporein in vitro quantification. A) Protein purification and in vitro cleavage activity assay. SDS-PAGE gel (10%) depicting protein expression and purification conditions. Lane 1 represents flow- through after passing the crude extract of Cas9 in lysis buffer through the Ni- NTA column; Lanes 2 and 3 depict the two washes of Cas9 in Ni-NTA column; Lane 4 is the first elution of the Ni-NTA column to collect the purified Cas9, whereas lanes 5 and 6 are second and third elutions showing no sign of Cas9; Lane 7 represents about 20 pg purified NLSH2BCas9 protein after overnight dialysis at 4 °C and using a spin-column concentrator with a molecular cutoff of 100 kD. B) Top: diagram depicting the template length, the sgRNA cleavage site, and the lengths of expected fragments after cleavage with Cas9; Bottom: assessment of the cleavage efficiency by gel electrophoresis after incubation at 37 °C for 1.5 h using DNA template amount of 200 or 300 ng per reaction.

[0046] Figure 14: Previous evidence of positive CRISPR-Cas9 edited B. bassiana transformants. Knockout Bbsmrl mutants (#3, #5 and #38) growing in selective medium (PDA + geneticin 300 μg / mL) and absence of growth for the wild-type (WT).

[0047] Figure 15: Target site mutation confirmation after Bbsmrl gene disruption in B. bassiana. A) Genome scheme of ^Bbsmrl showing smr1 region after geneticin cassette insertion. The blued-dashed rectangle represents the sequenced region. B) Alignment between sequences of ΔBbsmr1_3 and the expected mutant strain construction. “*” corresponds to absence of point mutation.

[0048] Figure 16: Dose-mortality response curves of G. mellonella larvae following exposure to different B. bassiana (ARSEF2860) mutants compared with the wild-type strain. Loglikelihood ratio test indicating significance at P < 0.05 for the interaction between inoculum concentration (transformed by log 10)and strain based on a generalized linear binomial model with logit link function (fitted curves are the predicted values). Symbols with different colors represent observed data from two independent experiments and five biological replicates (n = 100 - 140 insects per concentration of each treatment). Control was fixed at zero concentration and consisted of only 0.01% Silwet® L-77.

[0049] Figure 17: Epifluorescent photomicrographs depicting the germination of B. bassiana (ARSEF2860) blastospores after 6 h application via natural cuticle infection route in G. mellonella larva. A, B) Parental wild-type. C, D) ΔBbsmr1_38 mutant. The standard inoculum concentration applied was 5 x 107blastopores / mL. Blastospores were treated with 1% of calcofluor white for 20 min before visualization.DETAILED DESCRIPTION OF THE INVENTION

[0050] The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.I. Overview

[0051] The present invention relates generally to the field of fungal biotechnology and, more particularly, to genetically engineered fungi with enhanced efficacy as biocontrol agents.

[0052] Fungi possess complex and highly regulated genetic networks that control their metabolic and physiological processes. Many of these processesare governed by transcription factors, which are proteins that bind to DNA to control the expression of genes. These transcription factors can act as activators (turning genes on) or as repressors (turning genes off).

[0053] A significant technical problem in the field of fungal biotechnology is that many valuable or desirable genetic pathways are "silenced" or "repressed" in wild-type fungal strains. This repression is often mediated by specific repressor transcription factors that are naturally expressed and active in the fungus. The active presence of these repressors forms a "brake" on the fungus's genetic potential, preventing the expression of certain traits or the production of valuable compounds, such as secondary metabolites.

[0054] The present invention is based, in part, on the discovery that the transcription factor AZF1 , which is encoded by the gene Bbsmrl (or its homologs), functions as one such repressor. Specifically, the AZF1 protein acts as a negative regulator of fungal virulence against insects. Transcription factor AZF1 has also been shown to acts as a negative regulator of a secondary metabolite gene cluster responsible for the production of oosporein, a potent dibenzoquinone with insecticidal and antimicrobial properties. In wild-type fungi, the natural activity of the AZF1 protein suppresses this pathway, contributing to limiting the fungus's natural virulence.

[0055] The present invention solves this technical problem by providing genetically engineered fungi in which this natural repression is lifted. The invention provides a genetically engineered fungus comprising a genetic modification that partially or completely suppresses the expression of the Bbsmrl gene or partially or completely suppresses the activity of the AZF1 protein. By unlocking this pathway, the genetic modification causes increased virulence against pests and a "de-repression" of the oosporein biosynthetic gene cluster, leading to a dramatic overproduction of oosporein (e.g., from non- detectable levels to over 100 ppm, as described in Mascarin et al. (2024)).

[0056] Oosporein is known to be involved in evading host insect immunity (Feng et al. (2015)). Consequently, this oosporein overproduction provides a significant technical advantage, resulting in enhanced fungal virulence (e.g., faster insect kill times, or reduced LTso) and enhanced fungal fitness, making the genetically engineered fungus a more potent and effective biocontrol agent.II. Definitions

[0057] As used herein, the term "5'UTR region" or "51Untranslated Region" refers to a nucleotide sequence located between the transcription start site and the translation start codon (e.g., ATG) of a gene's coding sequence. This region is transcribed into messenger RNA (mRNA) but is not translated into an amino acid sequence. It contains regulatory elements, such as ribosome binding sites, that influence the translation efficiency of the mRNA.

[0058] As used herein, the term "3'UTR region" or "31Untranslated Region" refers to a nucleotide sequence located immediately downstream of a gene's translation stop codon. This region is transcribed into mRNA but is not translated. It contains regulatory elements that influence mRNA stability, localization, and translation.

[0059] As used herein, the term "activity" or "protein activity" refers to the biological function of a protein. For a transcription factor, such as the AZF1 protein, "activity" refers to its ability to perform its function, for example, binding to a specific DNA promoter region and repressing transcription.

[0060] As used herein, the term "amino acid sequence" or "polypeptide" refers to a polymer of amino acid residues linked by peptide bonds.

[0061] As used herein, the terms "applying" or "delivering" refer to the act of placing the genetically engineered fungus or a composition thereof in a location, such as by spraying, drenching, coating, dusting, or in-furrow application, so that it may come into contact with a pest, a crop, or a substrate.

[0062] As used herein, the term "AZF1 protein" refers to the polypeptide transcription factor encoded by the Bbsmrl gene. The term encompasses the amino acid sequence of Beauveria bassiana as set forth in SEQ ID NO: 1 , as well as homologous polypeptide sequences from other fungal species, such as those set forth in SEQ ID NOs: 3-16. The term explicitly includes polypeptide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 3-16, provided that the polypeptide, in its wild-type form, retains the biological activity of acting as a repressor.

[0063] As used herein, the term "Bbsmrl gene" refers to a nucleotide sequenceencoding an AZF1 transcription factor or a functional homolog thereof. The term encompasses the nucleotide sequence of Beauveria bassiana as set forth in SEQ ID NO: 2, as well as homologous nucleotide sequences from other fungal species, such as those set forth in SEQ ID NOs: 17-26. The term explicitly includes nucleotide sequences having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and 17-26.

[0064] As used herein, the term "biopesticide" refers to a formulation or composition intended for pest control that is based on or derived from a biological agent, such as the genetically engineered fungus of the present invention.

[0065] As used herein, the term "coding region" or "coding Sequence (CDS)" refers to the portion of a gene's nucleotide sequence that is translated into an amino acid sequence.

[0066] As used herein, the term "composition" refers to a formulation comprising the genetically engineered fungus of the invention and at least one other component, such as an agriculturally acceptable carrier, adjuvant, UV protectant, or other pesticide.

[0067] As used herein, the terms "controlling a pest" or "pest control" refer to the act of killing, inhibiting, repelling, or reducing the population, growth, or negative impact of a pest.

[0068] As used herein, the term "CRISPR / Cas system" refers to a type of gene editing technology that uses a Cas nuclease (e.g., Cas9) and a guide RNA (gRNA) that directs the nuclease to a specific target nucleotide sequence in the genome. Binding of the nuclease to the target sequence results in a doublestrand or single-strand break, which can be repaired by the cell to introduce a genetic modification, such as a deletion or insertion.

[0069] As used herein, the term "crop" refers to any plant, or part thereof, that is cultivated for agricultural or horticultural purposes.

[0070] As used herein, the term "culturing" refers to the process of growing a microorganism, such as a fungus, in or on a nutrient medium (i.e. , solid-state orliquid submerged fermentation).

[0071] As used herein, the term "degenerated sequence" or "degenerate nucleotide sequence" refers to a nucleotide sequence that differs from a reference nucleotide sequence but, due to the redundancy or degeneracy of the genetic code, encodes the identical amino acid sequence (polypeptide) as the reference sequence.

[0072] As used herein, the term "deletion" refers to a genetic modification in which one or more nucleotides are removed from a nucleotide sequence.

[0073] As used herein, the term "derepression" refers to the process by which a gene or gene cluster, which is normally suppressed by a repressor protein, is activated or has its expression increased. In the context of the present invention, suppressing the AZF1 repressor leads to the derepression of the oosporein gene cluster.

[0074] As used herein, the term "entomopathogenic fungus" refers to a fungus that is capable of causing disease or death in insects, and is therefore parasitic to insects. Beauveria bassiana is an example of an entomopathogenic fungus.

[0075] As used herein, the terms "expression" or "gene expression" refer to the process by which information from a gene's nucleotide sequence is used to synthesize a functional gene product, typically a protein. The process includes transcription (synthesis of RNA) and translation (synthesis of protein).

[0076] As used herein, the term "fungal fitness" refers to the ability of a fungus to survive, compete, and reproduce in its environment. In the context of an entomopathogenic fungus, fitness can include traits such as virulence, stress tolerance, and competitive ability.

[0077] As used herein, the term "fungus" (plural: "fungi") refers to any member of the kingdom Fungi, a group of eukaryotic organisms that includes yeasts, molds, and mushrooms.

[0078] As used herein, the term "further genetic modification" refers to a second, third, or subsequent genetic modification introduced into the fungus, in addition to the primary genetic modification that suppresses Bbsmrl or AZF1.

[0079] As used herein, the term "gene" refers to a nucleotide sequence that includes a coding sequence as well as regulatory regions (e.g., promoter, 5'UTR, 3'UTR) and, in eukaryotes, may include introns.

[0080] As used herein, the term "gene cluster" or "biosynthetic gene cluster" refers to a group of two or more genes, typically located in close proximity on the same chromosome, that are involved in the same metabolic pathway (e.g., for the production of a secondary metabolite like oosporein) and are often coregulated.

[0081] As used herein, the term "gene editing" refers to a technique for making precise, targeted modifications to a specific site in an organism's genome. Examples include, but are not limited to, modifications introduced via a CRISPR / Cas system, TALENs, ZFNs, or meganucleases.

[0082] As used herein, the term "gene modification" is a broad term referring to any alteration of a gene's nucleotide sequence, which can be targeted (gene editing) or random (mutagenesis).

[0083] As used herein, the term "gene silencing" refers to a mechanism that results in the suppression of gene expression. This term often refers to post- transcriptional gene silencing, such as RNA-mediated gene silencing.

[0084] As used herein, the term "genetically engineered fungus" refers to a fungus comprising a genetic modification introduced by human intervention.

[0085] As used herein, the term "genetic modification" refers to any change made to the nucleotide sequence of an organism's genome by human intervention. This term broadly encompasses, but is not limited to, a deletion, insertion, or substitution of one or more nucleotides, and may be introduced via gene editing, gene modification, gene silencing, or mutagenesis.

[0086] As used herein, the term "increasing expression" refers to an upregulation in the level of transcription and / or translation of a gene, resulting in a higher level of functional gene product (e.g., mRNA or protein) compared to a wild-type or control fungus.

[0087] As used herein, the term "insertion" refers to a genetic modification in which one or more nucleotides are added into a nucleotide sequence.

[0088] As used herein, the term "kit" refers to a product containing two or more components packaged together, for example, a container holding the genetically engineered fungus or composition thereof, and instructions for its use in pest control.

[0089] As used herein, the term "manufacture" refers to the process of producingor fabricating a product, such as a biopesticide composition or a kit.

[0090] As used herein, the term "meganuclease" refers to an endodeoxyribonuclease (an enzyme that cuts DNA) characterized by a large recognition site (e.g., 12-40 base pairs). Engineered meganucleases can be used for gene editing.

[0091] As used herein, the term "mutagenesis" refers to a process of introducing a genetic modification, typically in a random or non-targeted manner, by exposing an organism to a chemical mutagen (e.g., ethyl methanesulfonate, EMS) or physical mutagen (e.g., ultraviolet radiation).

[0092] As used herein, the term "native gene" refers to a gene as it is found in its natural, wild-type state in the organism's genome.

[0093] As used herein, the term "nucleotide sequence" or "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). This term refers to the primary structure of the molecule and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA.

[0094] As used herein, the term "oosporein" is a red-pigmented dibenzoquinone secondary metabolite (a natural product) produced by various fungi.

[0095] As used herein, the term "oosporein production" refers to the biosynthesis of oosporein by a fungus.

[0096] As used herein, the term "oosporein producing fungus" refers to any fungus, such as certain species of Beauveria, Chaetomium, or Lecanicillium, that is metabolically capable of biosynthesizing oosporein.

[0097] As used herein, the term "pest" refers to any organism (e.g., an insect, mite, nematode, or other arthropod) that is detrimental to humans, crops, animals, or human interests.

[0098] As used herein, the term "product" refers to an article that is manufactured. In the context of the invention, this includes the genetically engineered fungus itself, as well as compositions and kits comprising the fungus.

[0099] As used herein, the term "promoter region" or "promoter" refers to a nucleotide sequence, typically located upstream (5') of a gene's coding sequence, to which RNA polymerase and transcription factors bind to initiatetranscription (the synthesis of RNA).

[0100] As used herein, the term "RNA-mediated gene silencing" also known as "RNA interference (RNAi)", is a biological process in which RNA molecules inhibit gene expression. Typically, a double-stranded RNA (dsRNA) molecule, which is homologous to a target gene (e.g., BbSMRT), is introduced or expressed in a cell, triggering an enzymatic pathway (e.g., Dicer / RISC) that leads to the degradation of the target gene's messenger RNA (mRNA), thereby "suppressing expression" of the gene.

[0101] As used herein, the term "seed" refers to a plant embryo enclosed in a protective outer covering, which is capable of germinating to produce a new plant.

[0102] As used herein, the terms "sequence identity" or "percent identity" refer to the percentage of nucleotides (for a nucleotide sequence) or amino acid residues (for a polypeptide sequence) in a candidate sequence that are identical to the residues in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways known in the art, for instance, using publicly available computer software such as the BLAST (Basic Local Alignment Search Tool) program, available at the National Center for Biotechnology Information (NCBI) website. The BLASTN algorithm (for nucleotide sequences) or BLASTP algorithm (for amino acid sequences) using default parameters (e.g., Expect threshold = 10, Word size = 3, Gap Costs = Existence: 11 , Extension: 1) is preferably used for such analysis.

[0103] As used herein, the term "substrate" refers to any material, surface, or medium. In the context of pest control, this includes, but is not limited to, soil, potting media, a crop, a plant surface, or any area where a pest is present or where a crop will be cultivated.

[0104] As used herein, the term "substitution" refers to a genetic modification in which one or more nucleotides in a nucleotide sequence are replaced with different nucleotides.

[0105] As used herein, the terms "suppresses" or "suppression" (e.g.,"partially or completely suppresses") refer to a reduction in the level or function of a target.• "suppression of expression" (e.g., of the BbSMRI gene) refers to a partial or complete reduction in the level of transcription of the gene or translation of its mRNA, resulting in a lower amount of the encoded protein (AZF1) being produced, relative to a wild-type fungus. This includes a 100% reduction ("knockout").• "suppression of activity" (e.g., of the AZF1 protein) refers to a partial or complete reduction in the protein's biological function (e.g., its ability to bind DNA and repress transcription), relative to a wild-type protein. This suppression can occur even if the protein is expressed, for example, as a result of a genetic modification that introduces a point mutation in a key functional domain.

[0106] As used herein, the term "transcription activator-like effector nuclease (TALEN)" refers to a type of engineered nuclease used for gene editing, in which a non-specific DNA-cleaving nuclease (e.g., Fokl) is fused to a "transcription activator-like effector" (TALE) DNA-binding domain, which can be engineered to target a specific nucleotide sequence.

[0107] As used herein, the term "treated" (e.g., "seed treated") refers to the application of (e.g., coating) the genetically engineered fungus or a composition thereof to an object, such as a seed, resulting in the fungus being on the surface of or in association with the object (e.g., a coated seed).

[0108] As used herein, the term "use" (as in "Use of the... fungus") refers to the employment of the fungus for a specified purpose, such as for the manufacture of a biopesticide.

[0109] As used herein, the term "virulence" refers to the degree of pathogenicity or harm a pathogen (e.g., the fungus) can cause to its host (e.g., an insect). In the context of this invention, "increased virulence" means the engineered fungus is more effective at killing the pest, often measured by a reduced lethal time (LT50) or reduced lethal concentration (LC50) compared to a wild-type fungus.

[0110] As used herein, the term "zinc finger nuclease (ZFN)" refers to a type of engineered nuclease used for gene editing, in which a non-specific DNA-cleaving nuclease (e.g., Fokl) is fused to an engineered "zinc finger" DNA- binding domain, which targets the nuclease to a specific nucleotide sequence.III. The Target: Bbsmrl Gene and AZF1 Protein

[0111] The present invention provides genetic modifications that suppress the expression or activity of a specific repressor, the Bbsmrl gene and its encoded AZF1 protein.

[0112] The "Bbsmrl gene" is a nucleotide sequence that encodes the AZF1 transcription factor. An exemplary Bbsmrl gene sequence from Beauveria bassiana is set forth in SEQ ID NO: 2. The invention is not limited to this specific sequence but encompasses homologous genes from other fungi that perform the same function (i.e., repressing a secondary metabolite pathway). Such homologous nucleotide sequences are set forth, for example, in SEQ ID NOs: 17-26. Accordingly, the invention is directed to a genetically engineered fungus comprising a modification in a BbSMRI gene, wherein said gene comprises a nucleotide sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NOs: 17-26, or degenerated sequences thereof.

[0113] The "AZF1 protein" is the polypeptide transcription factor encoded by the Bbsmrl gene. An exemplary AZF1 amino acid sequence from Beauveria bassiana is set forth in SEQ ID NO: 1. Homologous AZF1 protein sequences from other fungal species are set forth, for example, in SEQ ID NOs: 3-16. The invention is directed to a genetically engineered fungus comprising a modification that suppresses the activity of an AZF1 protein, wherein said protein comprises an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NOs: 3-16.IV. Host Fungal Organisms

[0114]

[0064] The genetic modifications of the present invention may be introduced into any fungus that possesses a native Bbsmrl gene or homolog,and a corresponding secondary metabolite pathway that is repressed by the encoded AZF1 protein. In preferred embodiments, the fungus is an oosporein producing fungus.

[0115] In certain embodiments, the fungus is from a genus selected from the group consisting of Acremonium spp., Arcopilus spp., Beauveria spp., Blackwellomyces spp., Chaetomium spp., Coch I iobolus spp., Comiculantispora spp., Lecanicillium spp., Oospore spp., Phlebia spp. and Tremella spp.

[0116] In a specific embodiment, the fungus is from a species selected from the group consisting of Acremonium alabamense, A. altematum, A. cavaraeanum, A. chrysogenum, A. falciforme, A. kiliense, A. recifei, A. strictum,A. zeae, Arcopilus amazonicus, A. aureus, A. cupreus, A. flavigenus, A. fusiformis, A. turgidopilosus, Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica,B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilis, B. roseostromatus, Chaetomium atrobrunneum, C. aureum, C. bostrychodes, C. cochliodes, C. crispatum, C. cupreum, C. elatum, C. funicola, C. globosum, C. indicum, C. murorum, C. thermophilum, Cochliobolus akaii, C. bicolor, C. carbonum, C. cymbopogonis, C. cynodontis, C. eleusines, C. geniculatus, C. hawaiiensis, C. heterostrophus, C. kusanoi, C. lunatus, C. miyabeanus, C. nisikadoi, C. pallescens, C. sativus, C. spicifer, C. victoriae, Comiculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L. antillanum, L. araneicola, L. coprophilum, L. evansii, L. flavidum, L. fusisporum, L. gracile, L. kalimantanense, L. lecanii, L. longisporum, L. muscarium, L. nodulosum, L. saksenae, L. tenuipes, Oospora colorans, Phlebia acerina, P. centrifuga, P. coccineofulva, P. hydnoidea, P. incamata, P. livida, P. mellea, P. radiata, P. rufa, P. subochracea, P. tremellosa, Tremella aurantia, T. encephala, T. foliacea, T. fuciformis, T. mesenterica, T. mycophaga, and T. simplex.

[0117] In a preferred embodiment, the fungus is an entomopathogenic fungus. Preferred entomopathogenic fungi are selected from the group consisting of Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis,B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Comiculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L. antillanum, L. araneicola, L. coprophilum, L. evansii, L. flavidum, L. fusisporum, L. gracile, L. kalimantanense, L. lecanii, L. longisporum, L. muscarium, L. nodulosum, L. saksenae, and L. tenuipes.

[0118] In a most preferred embodiment, the entomopathogenic fungus is Beauveria bassiana.V. Methods of Genetic Modification

[0119] The genetic modification of the present invention may be produced by any method known in the art for suppressing gene expression or protein activity, including, but not limited to, gene editing, gene modification, gene silencing, or mutagenesis.A. Targeted Gene Editing

[0120] In a preferred embodiment, the genetic modification is introduced via a targeted gene editing system. Such systems are used to create a precise double-strand break (DSB) at or near the target BbSMRI gene, which is then repaired by the cell in a way that disrupts the gene. Such systems include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas systems.

[0121] In a preferred embodiment, a CRISPR / Cas system is used. This system involves introducing a Cas nuclease (e.g., Cas9) and one or more guide RNAs (sgRNAs) designed to be complementary to a target sequence within the BbSMRI gene. The sgRNA directs the Cas nuclease to the target site, where it induces a DSB.

[0122] The cell's natural repair of this DSB, typically through the non- homologous end joining (NHEJ) pathway, results in small, random insertions or deletions (indels) at the cut site. If this DSB is targeted to the coding region of the BbSMRI gene, the resulting indel is likely to cause a frameshift mutation, leading to a premature stop codon and a truncated, non-functional protein. Thiseffectively "suppresses the activity of the AZF1 protein."

[0123] If the DSB is targeted to the promoter region or 5'UTR region of the Bbsmrl gene, the resulting indel can disrupt the binding of RNA polymerase or other factors, thereby preventing transcription and "suppressing the expression of the Bbsmrl gene."

[0124] In another embodiment, the DSB is repaired via homologous recombination (HR) by providing a "donor DNA" template. This donor DNA can be an oligonucleotide or a plasmid containing a nucleotide sequence (e.g., a selectable marker gene, or simply a stop codon) flanked by homology arms that match the sequences upstream and downstream of the target Bbsmrl gene. This method can be used to create a precise deletion of the entire Bbsmrl coding sequence, or a substitution or insertion of a specific element, resulting in complete suppression of expression.B. Gene Silencing (RNA-mediated)

[0125] In another embodiment, the genetic modification is one that leads to RNA-mediated gene silencing (also known as RNA interference or RNAi) of the Bbsmrl gene. This is a method for "suppressing expression" at the post- transcriptional level.

[0126] This is achieved by introducing a new genetic construct (e.g., on a plasmid or integrated into the genome) designed to express a double-stranded RNA (dsRNA) molecule, such as a hairpin RNA (hpRNA) or short-hairpin RNA (shRNA). This dsRNA is designed to be homologous to the nucleotide sequence of the Bbsmrl gene. When this dsRNA is expressed, it is recognized by the fungal Dicer / RISC pathway, which targets and degrades the native Bbsmrl messenger RNA (mRNA). The degradation of the mRNA prevents it from being translated into the AZF1 protein, thereby achieving partial or complete suppression of expression.C. Random Mutagenesis and Screening

[0127] In another embodiment, the genetic modification is introduced via mutagenesis. This involves exposing the wild-type fungus (e.g., B. bassiana spores) to a chemical mutagen (e.g., ethyl methanesulfonate (EMS), N-methyl- N'-nitro-N-nitrosoguanidine (NTG)) or a physical mutagen (e.g., ultraviolet (UV) radiation).

[0128] This mutagen exposure creates a population of fungi with random mutations throughout their genomes. This mutant population is then subjected to a screening process to identify individuals in which the BbSMRI gene has been "hit." As the suppression of the Bbsmrl I AZF repressor leads to increased virulence and the de-repression and overproduction of the visible red pigment oosporein (Mascarin et al. (2024)), this screening can be performed visually. Mutants are plated on a suitable medium, and colonies that exhibit a strong red or orange / pink pigmentation (in contrast to the white / beige wild-type) are selected. These pigmented colonies are then isolated and their Bbsmrl gene is sequenced to confirm that they contain a genetic modification (e.g., a substitution, deletion, or insertion) that suppresses the expression or activity of the gene or its protein.D. Further Genetic Modifications

[0129] The genetically engineered fungus of the invention may, in some embodiments, comprise a further genetic modification. For example, in addition to suppressing the Bbsmrl repressor, the fungus may be further engineered to increase expression of one or more genes involved in the production of oosporein, such as the OpS3 pathway-specific activator (Feng et al. (2015)) or the pathway genes themselves, to further enhance the oosporein production phenotype.VI. Phenotypic and Metabolic Outcomes

[0130] The genetic modification of the present invention results in several advantageous phenotypic and metabolic outcomes. The primary outcome is the increased virulence and derepression of a gene cluster associated with oosporein production. By suppressing the AZF1 repressor, the "brake" on this metabolic pathway is removed, leading to a significant increased virulence and increase in oosporein production. As demonstrated in Mascarin et al. (2024), Bbsmrl mutant strains (^Bbsmrl) produced high levels of oosporein (e.g., up to 118 ppm), whereas the wild-type parent strain produced no detectable oosporein under the same conditions.

[0131] This oosporein overproduction, in turn, contributes to increased virulence and enhanced fungal fitness. Oosporein has been shown to be a virulence factor that helps the fungus evade the host insect's immune system(Feng et al. (2015); Mascarin et al. (2024)). The resulting engineered fungus is therefore a more potent biocontrol agent. As shown in Mascarin et al. (2024), the ΔBbsmr1 mutants exhibited a faster speed-of-kill (e.g., a 43% reduction in LT50) and a significantly lower lethal dose (e.g., a >180-fold reduction in LC50) against insect pests compared to the wild-type fungus.VII. Compositions, Formulations, and Kits

[0132] The present invention also provides a composition or product comprising the genetically engineered entomopathogenic fungus described herein. In a preferred embodiment, this composition is a biopesticide for pest control.

[0133] The composition may be formulated in any manner known in the art, such as a wettable powder (WP), granules (G), dust (D), or a liquid formulation (e.g., emulsifiable concentrate (EC) or suspension) containing the fungal propagules (e.g., conidia, blastospores, or mycelial fragments). The composition typically includes an agriculturally acceptable carrier or excipient, which may include clays, silicas, lignosulfonates, oils, or water. The composition may further include adjuvants such as UV protectants, stickers, or flowability agents.

[0134] The present invention also provides a kit comprising: (a) the genetically engineered entomopathogenic fungus as described herein, or (b) a composition or product thereof, optionally packaged with instructions for use in a pest control method.

[0135] In one embodiment, the invention provides a seed treated with the genetically engineered fungus or the composition. The fungus may be applied to the seed as a coating or a powder, providing protection to the resulting plant as it germinates and grows.VIII. Methods of Use for Pest Control

[0136] The present invention provides methods for enhancing the virulence and biocontrol performance of entomopathogenic fungi, and methods for enhancing the production of oosporein in fungi. These methods comprise introducing a genetic modification into said fungi that partially or completely suppresses the expression of the Bbsmrl gene or the activity of the AZF1 protein, as described in detail in Section V.

[0137] The invention further provides a method for controlling a pest. The method comprises applying or delivering the genetically engineered entomopathogenic fungus, or a composition thereof, to a pest, a crop, or a substrate subject to a pest. The substrate is preferably a substrate wherein a crop will be cultivated, such as soil or potting medium.

[0138] The pest to be controlled may be any pest susceptible to the fungus. This includes, but is not limited to, a plant pest, a nematode, or an arthropod pest.

[0139] In one embodiment, the pest is a nematode selected from the group consisting of Meloidogyne spp., Heterodera, Globodera spp., Pratylenchus spp., and Rotylenchulus spp.

[0140] In another embodiment, the pest is an arthropod pest. This includes any insect pest or mite pest.

[0141] In one embodiment, the insect pest is selected from the group consisting of an Aphidian pest, a Coleopteran pest, a Dipteran pest, an Hemipteran pest, a Lepidopteran pest, an Orthopteran pest, and a Thysanopteran pest.

[0142] More specifically, the insect pest may be selected from the group consisting of Aedes spp. (Mosquitoes), Anopheles spp. (Mosquitoes), Anthonomus grandis (Boll Weevil), Aphis gossypii (Cotton Aphid), Bemisia tabaci (Silverleaf Whitefly), Blissus spp. (Chinch Bugs), Coccus viridis (Green Scale), Cosmopolites sordidus (Banana Weevil), Culex spp. (Mosquitoes), Cydia pomonella (Codling Moth), Diaphorina citri (Asian Citrus Psyllid), Frankliniella occidentalis (Western Flower Thrips), Galleria mellonella (Greater Wax Moth), Halyomorpha halys (Brown Marmorated Stink Bug), Helicoverpa armigera (Cotton Bollworm I Old World Bollworm), Hypothenemus hampei (Coffee Berry Borer), Leptinotarsa decemlineata (Colorado Potato Beetle), Lygus spp. (Tarnished Plant Bug), Macrosiphoniella sanbomi (Chrysanthemum Aphid), Melolontha melolontha (Cockchafer), Myzus persicae (Green Peach Aphid), Myzus spp. (Aphids), Ostrinia nubilalis (European Corn Borer), Paysandisia archon (Palm Moth), Pianococcus citri (Citrus Mealybug), Plutella xylostella (Diamondback Moth), Saissetia spp. (Scale insects), Sitophilus spp. (Grain Weevils), Spodoptera spp. (Armyworms), Thaumetopoea pityocampa(Pine Processionary), and Trialeurodes vaporariorum (Greenhouse Whitefly).

[0143] In another embodiment, the pest is a mite pest selected from the group consisting of Panonychus spp, Tetranychus urticae, (Two-spotted Spider Mite) and Varroa destructor (Varroa Mite).

[0144] Accordingly, the present invention also provides for the use of the genetically engineered entomopathogenic fungus described herein for the manufacture of a composition, kit, or product for controlling a pest.IX. Techniques for carrying out the invention

[0145] Detection of mRNA can be performed using known assays of the technique, such as, but not limited to, northern blotting, reverse transcription polymerase chain reaction (RT-PCR), hybridization in situ, RNA sequencing (RNA-seq), microarray analysis, fluorescent hybridization in situ (FISH), digital drop PCR (ddPCR), next generation sequencing (NGS), hybridization in situ single molecule fluorescent (smFISH), rolling circle amplification (RCA), hybridization chain reaction (HCR).

[0146] Techniques for suppressing the expression of a native fungal gene are well known from the state of the art and include random and targeted mutagenesis techniques. There are several techniques for introducing mutations that can be used to completely or partially suppress the expression of a gene native to a plant, including: chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, insertion of T-DNA by transformation with a bacterium capable of transferring DNA to plants. In addition, any genome editing technique can be utilized, including transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), RNA-guided Fokl nucleases, homing endonucleases, CRISPR-Cas9, CRISPR-Cas12a(Cpf1). Any technique capable of completely suppressing the expression of the transcription factor-encoding gene native to an entomopathogenic fungus can be used to produce a plant according to the present invention.

[0147] Targeted Genome Editing: Modern, precise methods for introducing targeted genetic modifications, such as deletions, insertions, or substitutions (e.g., via CRISPR / Cas9, TALENs, or ZFNs) are known in the art. Nodvig, C.S., Nielsen, J.B., Kogle, M.E., & Mortensen, U.H. (2015). A "plug-and-play" toolbox for versatile and high-efficiency CRISPR-Cas9-mediated genome editing infilamentous fungi. Applied and Environmental Microbiology, 81(13), 4487-4497 discloses a comprehensive and adaptable CRISPR-Cas9 system, including vectors and protocols, designed specifically for use across a range of filamentous fungi. DiCarlo, J.E., et al. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research, 41 (7), 4336-4343. Discloses the application of the CRISPR-Cas9 system for efficient multiplexed genome editing in a fungal model organism, yeast. Giesbers, C., et al. (2018). A versatile and broad-host-range non- homologous end-joining-based CRISPR-Cas9 system for gene disruption in filamentous fungi. Fungal Biology and Biotechnology, 5(1). Describes a CRISPR-Cas9 system that relies on the Non-Homologous End Joining (NHEJ) repair pathway, which is particularly effective for creating gene knockouts via indels — a method for suppressing protein activity. Sander, J.D., & Joung, J.K. (2014). CRISPR-Cas systems for editing, regulating and targeting genomes. Nature Biotechnology, 32, 347-355. Details the mechanisms and applications of CRISPR-Cas systems for genetic modification, providing broad support for the state of the art. Gaj, T., Gersbach, C.A., & Barbas III, C.F. (2013). ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering. Trends in Biotechnology, 31(7), 397-405. Reviews and explains the technical basis for ZFNs (zinc-finger nucleases) and TALENs, in addition to CRISPR / Cas, as viable and known tools for introducing targeted DNA breaks, which lead to gene disruption and modification.

[0148] Gene Silencing Techniques (RNA Interference): These publications describe methods for suppressing gene expression at the post-transcriptional level, a direct method for achieving "partial or complete suppression of expression". Cogoni, C., & Macino, G. (1999). Gene silencing in Neurospora crassa by transgenic copies of the gene. Fungal Genetics and Biology, 27(2-3), 118-125. Discloses the phenomenon of "quelling," the fungal equivalent of RNA interference (RNAi), where the introduction of a transgene homologous to a native gene results in the silencing of both. Sallada, T.C., & Chalamgari, V. (2019). RNA interference in fungi: Re-exploring the power of gene silencing. Biotechnology Letters, 41 , 649-658. Details the mechanisms of RNAi in various fungi and its practical application as a tool for "knockdown" or suppression oftarget gene expression, including for transcription factors.)Gold, S.E. (2007). RNA interference in pathogenic fungi. In: Pathogenic Fungi (pp. 203-217). Humana Press. Describes the application of RNAi technology to study and modify pathogenic fungi, demonstrating its utility in the relevant art.

[0149] Random Mutagenesis Techniques: These publications describe the classical, non-targeted methods for introducing genetic modifications. These methods are used to create large populations of mutants, which are then screened for a desired phenotype (e.g., loss of AZF1 protein activity). Adelberg, E.A., Mandel, M., & Chen, G.C. (1965). Optimal conditions for mutagenesis by N-methyl-N'-nitro-N-nitrosoguanidine in Escherichia coli K12. Biochemical and Biophysical Research Communications, 18(5-6), 788-795. Discloses a protocol for chemical mutagenesis using a potent mutagen (NTG). This and similar chemical methods, such as using Ethyl methanesulfonate (EMS). Kavanaugh, A., & C.F.A. Moore. (2007). Mutagenesis. In: Methods in Molecular Biology, vol. 376: Aspergillus: Molecular Biology and Genomics (pp. 95-103). Humana Press. Provides detailed protocols for both UV and chemical mutagenesis specifically in a model filamentous fungus, Aspergillus. Such protocols are broadly applicable.

[0150] Core Fungal Transformation Techniques (Delivery Methods): These publications describe the essential, underlying techniques used to physically introduce the genetic material (e.g., plasmids, linear DNA, or RNP complexes) into the fungal cell to effect any of the modifications listed above. Michielse, B.A., Hooykaas, P.J., van den Hondel, C.A., & Ram, A.F. (2005). Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Microbiology and Molecular Biology Reviews, 69(3), 354-369. Details the protocols for using Agrobacterium tumefaciens as a highly efficient vehicle for transferring DNA to a wide variety of fungal species. Groot, M. J., et al. (1998). Agrobacterium tumefaciens-med'iated transformation of Aspergillus awamori. Nature Biotechnology, 16, 839-842. Discloses successful use of ATMT for transforming a filamentous fungus of industrial importance. Yelton, M.M., Hamer, J.E., & Timberlake, W.E. (1984). Transformation of Aspergillus nidulans by using a trpC plasmid. Proceedings of the National Academy of Sciences, 81(5), 1470-1474. Discloses a method of protoplast-mediated transformation,which involves using enzymes to remove the fungal cell wall and then using PEG and calcium chloride to induce the uptake of plasmid DNA.

[0151] The sequences of the present invention can be identified from a myriad of organisms. Although the nucleotide sequences mentioned above are described herein, they should not be considered as limitations of the present invention. Thus, a sequence of the Bbsmrl gene orthe AZF1 transcription factor can be identified and functionally annotated by sequence comparison. A person skilled in the art can readily identify a sequence of the Bbsmrl gene or the AZF1 transcription factor in a suitable database, such as GenBank, using publicly available sequence analysis programs and parameters. Alternatively, selection of cDNA libraries or genomic libraries employing suitable hybridization probes or primers based on DNA or protein sequences described herein should lead to the identification of functionally related the Bbsmrl gene or the AZF1 transcription factor sequences (functional homologue). It is also appreciated in the field that sequences with reduced levels of identity can also be isolated with the aid of degenerate oligonucleotides and PCR-based methodology.EXAMPLES

[0152] Considering the above, a person skilled in the art will understand that the following embodiments described are merely representative of the invention, which can be implemented in various ways. Thus, specific structural and functional details disclosed in the present application should not be interpreted as limiting.EXAMPLE 1 - Production of genetically modified Beauveria bassianaMicrobial cultures, media and growth conditions

[0153] The wild-type strain (WT) Beauveria bassiana ARSEF2860 was originally isolated from Schizaphis graminum (Hemiptera: Aphididae) on spring wheat in 1987 in Parma, Idaho, USA and was obtained from the USDA ARSEF culture collection. Its genome is available at Genbank (GCA_000280675.1). Pure cultures were maintained in 20% glycerol stocks at - 80°C and fresh cultures were grown on a weekly basis on 20 mL of potato dextrose agar (PDA - 20 Difco™, Sparks, MD, USA) medium in 100 x 15-mm Petri dish plates.Fresh fungal cultures retrieved from frozen stocks were grown at 28 °C and in the dark for 14 days prior to using in experiments. Fungal germlings were produced in potato dextrose broth (PDB - Difco™).

[0154] Transformant selection was carried out in R-Top medium containing geneticin (G418-sulfate, VWR Chemicals, Solon, OH, USA) at 300 μg / mL, poured into sterile Petri dishes (90 x 15 25 mm) containing on the bottom PDA medium amended with the same concentration of this antibiotic. This geneticin concentration was previously selected according to its ability to impair germination and growth of B. bassiana WT protoplasts.Bioinformatics

[0155] The B. bassiana ARSEF2680 gene Bbsmrl (1473 bp) was identified at Genebank Protein Id: XP_008598185.1 and gene code: BBA_04866 according to Xiao et al.

[0040] . The upstream and downstream regions of Bbsmrl were identified at MycoCosm database

[0041] . The protospacer / sgRNA sequence was identified using CCTop

[0042] (https: / / cctop.cos.uni- heidelberq.de / ). and Clustal Omega - Multiple Sequence Alignment software was applied for DNA alignment

[0043] .DNA purification, PCR procedures and plasmid construction

[0156] Primers used in this study are listed in Table 1. B. bassiana wild-type (WT) ARSEF2860 and mutant genomic DNA were purified using a phenol / chloroform protocol

[0044] .

[0157] The donor DNA was constructed by amplification of the geneticin / G418 resistance gene marker (2816 bp) under the control of a constitutive promoter trpC (GenBank: X02390.1) from the pll99 plasmid (5.3 kb) using the primers combination AZF1_sg8_Gen_KO-F + AZF1_sg8_Gen_KO-R (2916 bp DNA fragment). Each primer contained 50 nucleotides corresponding to the upstream or downstream homologous flanking regions of the Bbsmrl gene target site. This repair template cassette was amplified using master mix repliQa® HiFi ToughMix following the program: 10 sec at 98 °C and 35 cycles (15 sec at 68 °C and 30 sec at 68 °C). The generic map of the geneticin cassette, including homology arms, diagnose primer’s locations and insertion site is available in Fig. 9.

[0158] DNA fragment amplification for the in vitro Cas9 cleavage assay and diagnostic PCR employed to track positive transformants were produced in a thermal cycler with GoTaq® Green Master Mix (Promega) using the following program: 95 °C for 3 min, 35 cycles of 30 sec at 95 °C, 30 sec at 61 °C, 2.5 min at 72 °C) and a final extension of 5 min at 72 °C. The DNA fragment used as a template for in vitro Cas9-cleavage assay was amplified using primers Bbsmr1-F and Bbsmr1-R (1984 bp fragment) (Table 1, Fig. 9). Moreover, diagnostic PCR to detect positive transformants presenting the insert geneticin resistance gene was conducted using the following combinations of primers: Bbsmr1-F + Bbsmr1-R generating a larger fragment of 4.8 kb which contains the geneticin resistance gene; Bbsmr1-F + Gent_R resulting in a fragment of 2392 bp; and Gent_F + Bbsmr1-R producing a fragment of 2843 bp in ΔBbsmr1 strains (Table 1). These primers were designed to amplify regions upstream and downstream of homology sites, including part of the insert DNA from geneticin gene. This diagnostic strategy allows the confirmation of the specific DNA insertion site in contrast to the WT strain that exhibited a PCR product of 1.9 kb after amplification with the primer pairs Bbsrm1-F + Bbsmr1-R. In addition, purified DNA fragments were sequenced by Sanger sequencing using the primer Bbsmr1_F (-501 bp upstream of Bbsmrl cleavage site).Cas9 overexpression and protein purification

[0159] Transformed E. coli Rosetta™ (DE3) strain containing plasmid with Cas9 cassette was induced to overexpress this protein from plasmid pHis- parallel1-NLSH2BCas9 (Addgene plasmid #112065; http: / / n2t.net / addgene: 112065; RRID:Addgene_112065)

[0045] after addition of 0.3 mM IPTG for 12 h of growth in 1-L of LB medium at 37 °C and 200 rpm. This protocol was adapted from Pokhrel et al.

[0046] and its details are described in Fig. 10. A final purified concentration of Cas9 reached 2.0 mg / mL, and then stored at - 80 °C until use.In vitro Cas9-sgRNA RNP cleavage efficiency assay

[0160] In brief, the sgRNA was synthetized using a commercially available kit (EnGen® sgRNA Synthesis Kit, S. pyogenes Protocol NEB #E3322). In the first step, ssDNA target- specific oligonucleotide was designedby selecting 20 nucleotide sequence (not including the PAM [NGG]) of the target gene Bbsmrl using a forward primer designed (Table 1). PCR cycle for synthesis of ssDNA oligos was set to 3 min at 98 °C, 35 cycles (10 sec at 98 °C, 30 sec at 60 °C, 30 sec at 72 °C) and a final extension at 72 °C for 2 min. Secondly, following the manufacturer’s protocol (https: / / www.neb.com / en / Droducts / e3322-enqen-sqrna-svnthesis-kit- s- pyogenes), the target-specific oligos were mixed with the EnGen 2x sgRNA Reaction Mix (NTPs, dNTPs, S. pyogenes Cas9 Scaffold Oligo), 0.1 M DTT and the EnGen sgRNA Enzyme Mix (DNA and RNA polymerases), and all steps occurred in a single reaction during a 30-min incubation at 37 °C. The resulting sgRNA contained the target-specific / crRNA sequence as well as the tracrRNA. For purification of sgRNA to remove proteins, salts and most unincorporated nucleotides, we used spin columns compatible with the size of sgRNA (~100 nts) from Zymo™ RNA Clean-Concentrator kit (#ZR1013). sgRNA was stored at - 80 °C until use in the transformation assay.

[0161] Previously to the enzymatic reaction, DNA amplicon Bbsmrl produced, as described previously, was cleaned and concentrated using ice cold 0.1 x volume of 3 M sodium acetate (30 pL) plus 2.5x volumes of 100% ethanol (350 pL). DNA was further precipitated by centrifugation at 18000 rpm, 4 °C for 10 min. DNA pellet was washed twice with ice-cold 80% pure ethanol, centrifuged again (18000 rpm, 4 °C, 10 min) and then air-dried for 10 min prior to re-suspending with 30 pL of 0.1% DEPC water. In that way, it was possible to reach a concentration of donor DNA higher than 300 ng / pL with high quality revealed by 0.8% agarose gel and absorbance ratio (A260 / A280) of 1.7-2.0. Four samples of donor DNA were pooled together in a single sample to reach a concentration of 6 pg required for the Cas9-sgRNA RNP transformation assay using fungal protoplasts.

[0162] The in vitro reaction for Cas9-sgRNA RNP cleavage efficiency assay consisted in mixing 2 pL (1 pg) Cas9, 2 pL NEB3.1 buffer (10x), 2 pL (200 ng) sgRNA, 2 pL (200 ng or 300 ng) DNA template, and 12 pL of 0.1% DEPC nuclease-free water, totaling 20 pL of final volume. The preformed ribonucleoproteins based on 1 pg Cas9 + 200 ng sgRNA were used to digest 200 ng or 300 ng DNA template of Bbsmrl at 37 °C for 2 h in the thermocycler(adapted from Wang et al.

[0045] ). After that, the whole digested products (20 pL) were loaded in the agarose gel (1%) and run at 80V to separate the bands. As for the control, the same amount of DNA template was loaded in the gel to serve as basis of comparison to the digested sample.Protoplastinq and fungal transformation

[0163] Protoplastation and transformation were previously described in Fusarium oxysporum by Pokhrel et al.

[0046] . Illustrative and detailed step-by- step transformation protocol for B. bassiana is available in Fig. 10. In addition, Fig. 1 A shows the general scheme of gene edition strategy used in the present invention work.Relative expression of oosoorein-associated key genes by RT-qPCR

[0164] Two knockout mutants of Bbsmrl and the WT strain (as the control treatment) were grown under pH 8.0 in a rotary incubator shaker in PDB with 100 mM Tris buffer at 28 °C and 250 rpm for 3 days to produce mycelium for RNA extraction. Fungal biomass was subsequently collected and harvested using centrifugation. The cell pellets were flash frozen with liquid nitrogen and kept at -80 °C until RNA extraction. The frozen cell pellets were lyophilized in 1.5 ml tubes and the dried pellet was ground with a small plastic pestle (Kimble Inc). RNA extraction was performed using a Qiagen RNAeasy plant kits (Qiagen Inc, Germantown, MD, USA) with on column DNAase treatment using the manufacturer’s protocol, with the following change in the cell disruption method. The ground cell pellet was resuspended in 1 mL RTL buffer (from the kit) and the cells disrupted by passing the solution through a 22 ga needle 10 times, which was adapted from Cortes-Maldonado et al.

[0047] . The qPCR primers for target genes and housekeeping gene (BbActin) are listed in Table 1.

[0165] To assess the relative expression of Bbsmrl in the B. bassiana defective mutants (ΔBbsmr1_3 and ΔBbsmr1 _38) compared with the WT parent, RNA extraction and purification were performed for 3-day-old liquid grown cultures with pH 8.0 using the protocol detailed above. Reverse transcription was conducted using 300 ng of RNA from each sample via the QuantiTec reverse transcription kit (Qiagen). This protocol included a genomicDNA removal step using gDNA Wipeout Buffer (Qiagen) prior to the reverse transcription step via Quantiscript RT buffer (Qiagen). Gene-specific primers used to detect the Bbsmrt and BbOsp genes were those designed by Fan et al.

[0013] (Table 1). Gene expression was evaluated in a 10 pL reaction volume using 1 pL of sample cDNA and the PowerUP SYBR green Master mix qPCR kit (Qiagen) following the recommended qPCR cycling conditions (holding at 95 °C for 10 min, 40 cycles of 15 s at 95 °C, and 1 min at 60 °C), including an endpoint Melt Curve analysis. The qPCR assay was carried out on an Applied Biosystems QuantStudio 6 Flex Real-time PCR system (ThermoFisher Scientific™). Four biological replicates were evaluated for each treatment group, and the expression levels were normalized against the fungal gene Actin (Table 1). The expression data was analyzed using the AACt method

[0048] and their significance evaluated on log-transformed values via one-way AN OVA with Dunnett’s multiple comparison test. The statistical analysis and graphs were generated on Prism 10.0 (GraphPad).Off-target assessment by genome analysis

[0166] The absence of off-target effects in the fungus genome after CRISPR-Cas9-mediated disruption of Bbsmrl was confirmed by draft genome sequencing of our mutants ΔBbsmr1_3 and ΔBbsmr1 _38. DNA was extracted from one-mL samples from a 4 day of cultivation in PDB were collected and harvested by centrifugation. The cell pellet was freeze-dried and DNA extracted using a CTAB based method of Watanabe et al.

[0049] . Sequencing libraries were constructed using the Illumina DNA prep kit following the manufacturer’s protocol. The libraries were sequenced on an Illumina Novaseq X10 using 2x150 bp paired end sequencing.

[0167] The raw reads were quality trimmed and assembled using CLC Genomic workbench 23.05. All sequencing data is available under GenBank Bioproject PRJNA1093450. To determine possible sequence independent off- target effects, sequencing reads from the mutants were mapped (>0.5 alignment query and >0.9 sequence identity) to the wild-type draft genome using CLC Genomic workbench 23.05. Variants were called to detect single and multiple nucleotide variants, insertions, deletions and their combinations (> 90% frequency). In addition, their functional consequences of the variants werepredicted (amino acid changes), when they fell within a coding region. To determine possible sequence dependent off-target effects, the guide RNA sequence was used to identify regions of the genome with greater than 13 of 20 nucleotides shared. These regions in the mutant genome were manually examined for possible effects.Phenotypic quantification of oosporein

[0168] The standard oosporein (purity > 95% by HPLC, DiagnoCine, Totowa, NJ, USA) was dissolved using 1 mg in 1 mL of DMSO and standard calibration curve was made using a range of 0 to 100 ppm, measured with a spectrophotometer UV-VIS at a wavelength of 430 nm, following the protocol proposed by Lara-Juache et al.

[0050] . One-mL samples from days 2 to 4 of cultivation in PDB were collected and centrifuged at 25200xg (= 12000 rpm) for 15 min at 4 °C to pellet down fungal biomass and extract 50-pL aliquot of the supernatant to be used in the oosporein quantification. Oosporein measurements were performed with six biological replicates for each day of growth and each strain. Standard calibration curve of oosporein is given by y = 0.0003x + 0.0022, where x is oosporein concentration in ppm (mg / L) and y is the absorbance measured at 430 nm.Virulence bioassays

[0169] The greater wax moth larvae, Galleria mellonella (Lepidoptera: Pyralidae), were purchased from Waxworms.net (Vanderhorst Wholesale Inc., Saint Maries, Ohio, USA). Larvae from the last instar were used in all bioassays and did not require any diet during the bioassay. All bioassays were performed with at least two independent batches of larvae and blastospores.

[0170] Blastospores were produced in liquid medium (adapted from Mascarin et al.

[0027] ) containing free-vitamin basal salts prepared with miliQ- water (amount per L: 4.0 g KH2PO4, 0.8 g CaCI2.2H2O, 0.6 g MgSO4.7H2O, 0.1 g FeSO4.7H2O, 16 mg MnSO4.H2O, and 14 mg ZnSO4.7H2O), 8% (w / v) anhydrous dextrose (40% carbon, mw = 180.16 g / mol, VWR Chemicals, Solon, OH, USA), and 2.5% (w / v) casamino acids (AMRESCO®, distributed by VWR Chemicals, Solon, OH, USA) using a working volume of 50 mL liquid medium in 125- mL Erlenmeyer flasks capped with aluminum foil. The nonionicsurfactant Silwet® L-77 (mw = 338.66 g / mol, Cas number 27306-78-1 , Phytotech Labs, Lenexa, KS, USA) was added directly to the autoclaved miliQ-H20 at a concentration of 0.01% (v / v). Blastospores were harvested after 3 days of cultivation, filtered through nylon mesh filter screen (37 pm pore size, Sefar-Nitex®s) to remove mycelium, and then centrifuged at 1200 x g and 4 °C for 15 min to remove spent medium. Subsequently, blastospore suspensions were prepared with 0.01% of aqueous surfactant solution. Viability of blastospores were determined on 60-mm Petri dish containing 5 mL of PDA medium by inoculating 100 pL of 1 x 105blastospores / mL on the center of the plate. After 12 h incubation at 25 °C in the dark, germinated and non-germinated blastospores (n = 200 cells per treatment) were counted to establish the proportion of viability.

[0171] Viability of blastospores was always greater than 90% in all cases.

[0172] There were performed bioassays to assess the in vivo virulence of multiple mutants of Bbsmrl using as the insect host model Galleria mellonella larvae. The first bioassay focused on a single-dose response analysis with eight mutants (name here as ΔBbsmr1_3, ΔBbsmr1_4, ΔBbsmr1_5, ΔBbsmr1_18, ΔBbsmr1_34, ΔBbsmr1_38, ΔBbsmr1_4Q, ΔBbsmr1_44). The parent wild-type strain (WT) was used for comparison, while a mock control was fungus-free consisting only of surfactant solution.

[0173] The first set of experiments consisted of single dose-mortality bioassays using a standard concentration of 1 x 107blastospores / mL. There were two forms of fungal treatment: larvae were treated topically by soaking them to 1 mL of 1 x 107blastospores / mL in a Petri plate (100 x 60 mm); / / ) these treated insects were subsequently placed onto filter-paper disks (Qualitative 413, VWR North American, West Chester, PA, USA) pre-treated with 150 pL of 1 x 107blastospores / mL in 6-well-plates to simulate a residual contact exposure. A total of 20 larvae were distributed into 6-well-tissue culture plate (Avantor®, 19isturbed by VWR Chemicals, Solon, OH, USA), and each treatment had 4 plates with a total of 80 larvae. Mock control had larvae treated only with aqueous solution of Silwet® L-77 at 0.01%. Two moistened cotton balls were added to each plate to maintain relative humidity above 95% during the entireperiod of the experimentation. The whole experiment was kept in an environmentally walk-in controlled room at 24 °C for 5 days with 8:14 (L:D) h artificial photoperiod. This bioassay was repeated twice overtime using different batches of insects and blastospores.

[0174] In the second set of bioassays, a multiple dose-mortality response experiment was performed with crescent concentrations of fungal inoculum in order to estimate the lethal concentrations for three best mutants selected in the first single-dose virulence bioassay, and compared with the wild type. A mock control encompassed only the fungus-free surfactant solution. The following concentrations were tested: 0 (0.01% Silwet® L77), 5 x 105, 1 x 106, 5 x 106and 1 x 107blastospores / mL. The entire experiment was repeated twice using independent batches of insects and blastospores, and each treatment had a total of 5 biological replicates and 100 larvae per treatment.

[0175] The number of dead insects was counted twice daily until 5 days post-inoculation. Natural mortality in control groups was attributed to unknown causes, whereas mortality from fungus-treated groups was confirmed by mycosis presenting fungal outgrowth (white mycelium) and / or pinkish body of cadavers due to oosporein production. Mortality caused by other factors was not included in survival analysis. For single dose-mortality bioassays, survival curves were determined by non-parametric Kaplan-Meier method and compared with log-rank test (P < 0.05), while estimated median and 90% time of lethality (LT50 and LT90) were retrieved from adjusted survival curves to parametric Weibull model. For multiple dose- mortality bioassays, same approach was adopted to estimate lethal times in each evaluation time, while a generalized linear model with binomial distribution was employed to fit data and allow estimation of median and 90% lethal concentrations (LC50 and LC90).Phenotypic characterization of ABbsmrl mutants

[0176] Pleiotropic effects due to disruption of Bbsmii were assessed in comparison to the WT strain. The ability to grow vegetatively and to sporulate on PDA medium was evaluated for ΔBbsmr1 mutants in comparison to its WT strain. Plates (60 x 15 mm) were filled with 5 mL of PDA medium, and theninoculated with a droplet of 5 pL from a suspension of 5 x 107blastospores / mL on the center of the plates. There were 6 biological replicates per treatment and the entire assay was repeated twice using different batches of fungal inoculum. Growth diameter transformed into colony area was measured with a digital calliper in two directions after 4, 6, 9 and 12 days post-inoculation with incubation at 28 °C in the dark.

[0177] The fitness comparison among mutants and parental WT by examining their ability in producing blastospores by submerged liquid fermentation was proceeded according to Mascarin et al.

[0027] . Each fungal strain had two replicates per experiment and the entire experiment was repeated four times with different fungal batches on different occasions. Results were expressed as blastospores per mL of liquid medium in each time interval.

[0178] The susceptibility of ΔBbsmr1 mutants compared with the WT when challenged with the cell chemical stressors 0.8 M NaCI, 2 mM H2O2, 0.02 mM menadione, and 100 μg / mL Congo red, either by oxidative, osmotic stress or cell wall damage, was assessed from Guo et al.

[0051] . There were 5-6 biological replicates per treatment and the entire assay was repeated twice using different batches of fungal inoculum.Statistics

[0179] Mortality data from the insect bioassays were fitted to generalized linear mixed models to determine the significance of fixed effects and to estimate LC50 and LC90 using the “drc” package

[0052] . Survival analysis using the non-parameter Kaplan-Meier method allowed to obtain survival curves using the “survminer” package

[0053] . Log-rank test was employed to compare the survival curves. Weibull model was fitted to Kaplan-Meier survival curves in order to estimate the LT50 and LT90 using the “flexsurv” package

[0054] . Blastospore production, colony growth area and colony sporulation datasets were all Iog10-transformed prior to two-way ANOVA with fixed factors for strain and cultivation time. Oosporein content data were fitted to a linear model and submitted to two-way ANOVA with strain and cultivation time as fixed factors. Means were always compared by multiple pairwise Tukey’s HSD test with significant at P < 0.05 using the “emmeans” package

[0055] .

[0180] A principal component analysis (PCA) is a useful tool to manage many highly correlated variables within the data set in order to reduce the dimensionality by using fewer original variables while explaining most of the data variance. In this way, it is possible to identify patterns among the original variables and commonalities among the objects (strains). We started with 19 phenotypic traits (variables) in the multivariate analysis to explain the relationship between virulence and pleiotropic effects for distinguishing B. bassiana knockout mutants and wild-type (WT). Blastospore production and colony sporulation were both Iog10-transformed necessary to approach multivariate normality prior to PCA, performed using the “factoextra” package

[0056] . Non-meaningful variables were dropped out from the analysis according to their low contribution ( / .e., low correlation or correlation with the last dimensions) to each principal component (PC1 and PC2), ending up with only meaningful 11 variables that explained 93.7% of the total variability, in contrast to 87.7% of explained variance when there were 19 variables. Subsequently, a biplot was constructed to plot on the same space phenotypic variables (arrows) and strains (dots) for coordinated by the two first principal components. Furthermore, a heatmap was built using the “gplots” package

[0057] with the same 11 variables selected by the PCA to facilitate visualization and comparison between mutants and WT based on their similarity calculated with Manhattan distance method and further clustering with Ward method to assemble the dendrograms.

[0181] The gene expression data was analyzed using the AACt method

[0048] and their significance evaluated via one-way ANOVA with Dunnett’s multiple comparison test.

[0182] Statistical significance was assessed at P < 0.05 and the asterisks represent the strength of the significance: * P < 0.05; ** P < 0.01 ; *** P < 0.001 ; **** p < 0.0001. The statistical analyses and graphs were generated on Prism 10.0 (GraphPad) or on R statistical software (version 3.2.4).EXAMPLE 2: Blastospores are more virulent than conidia

[0183] To select the infective inoculum of the fungus used in all virulence bioassays with G. mellonella, we firstly compared the virulence between yeastlike cells termed blastospores with aerial conidia of B. bassiana. Blastosporesof B. bassiana were much more virulent to G. mellonella larvae outperforming aerial conidia, as the former was able to kill 22% faster and 3.3-fold more insects than the latter (x2= 102.1 , df = 2, P < 0.0001) (Fig. 11 A). Notably, overall mortality of conidia-treated insects reached 29.4% in contrast to 97% dead insects after 5 days post-inoculation with blastospores. Interestingly, cadavers from conidia-treated insects did not exhibit the conspicuous red pigmentation due to oosporein production after host death as observed for blastospores- treated insects, where in this case all cadavers showed red pigmentation (Fig. 11B). Mock control larvae survived 97.10% over the course of the experimentation period and depicted a healthy and normal body morphology. Since blastospores displayed stronger virulence than aerial conidia and their production in liquid medium only took 3-4 days of growth compared to more than 10 days to produce aerial conidia on PDA plates, blastospores were used as the active inoculum in subsequent virulence bioassays with mutants of Bbsmrl.

[0184] Regardless of the propagule type tested, an increase in insect mortality was followed by an increase in the inoculum concentration (x2= 76.36, df = 1 , P < 0.0001) and evaluation time (x2= 80.32, df = 2, P < 0.0001) (Fig. 12). The triple interaction concentration x day x inoculum type was significant and indicates that blastospores tested at different concentrations on different evaluation times were more effective in killing the host insect than aerial conidia (x2= 7.29, df = 2, P = 0.026). Examining the virulence degree based on lethal concentrations to kill 50% and 90% of the insect host population, blastospores displayed 8.2 to 76.5-fold greater virulence in relation to aerial conidia respectively, at days 3, 4 and 5 post-inoculation (Table 2).EXAMPLE 3: Cas9-RNP for disruption of the transcription factor Bbsmrl

[0185] First, we purified the Cas9 nuclease, reaching a final yield of 2 mg / mL, and confirmed its molecular weight of 160 kDa according to the SDS- PAGE results (Fig. 13A). To confirm whether the putative Bbsmrl gene from B. bassiana (BBA_04866) was involved in oosporein synthesis, the doublestrand break target site was chosen with a location close to the 5'-terminus of the coding region in the first exon. The PCR template cleavage efficiency wasclose to 100% in vitro, demonstrating the developed NLSH2BCas9 / sgRNA system had highly efficient cleavage activity for two concentrations of DNA template tested, 200 and 300 ng (Fig. 13B).

[0186] When using a concentration of Cas9 / sgRNA at 40 / 8 (pg / pg, ratio 5:1) and 6.0 μg of donor DNA resulted in generation ΔBbsmr1 transformants that grew on PDA amended with geneticin as opposed to the parental WT (Fig. 14). All colonies from the transformation medium were transferred to 24-well- plates containing PDA + 300 μg / mL geneticin and grew within 4-6 days at 28 °C in the dark. Mutants were screened by running three PCR reactions using primers to detect and confirm the putative mutations. Among 44 screened transformants, the PCR results indicated 41 positive mutants, which included single or multiple insertions (a PCR product >2.4 kb). We identified homokaryon mutants using standard PCR with the proper set of primers that confirmed the presence of the geneticin resistance gene insertion by homologous recombination in Bbsmrl gene (Fig. 1B,C). Subsequently, eight of these mutants were used in the screening virulence bioassays. Thus, the transformation efficiency via CRISPR-Cas9 was 93.2%. After single sporing the transformants for purification of heterokaryons, another round of diagnostic PCR and sequencing of mutants confirmed the specific site of geneticin cassette insertion, disrupting Bbsmrl. Fig. 15A shows a scheme of the targeted gene Bbsmrl after its disruption, including the homology arm, part of the geneticin cassette inserted and the exact sequenced site (upstream). Sequencing of the locus of homokaryon mutants ΔBbsmr1_3, ΔBbsmr1_38, and ΔBbsmr1_44 indicated it was identical to the expected disrupted mutant sequence (Fig. 15B), thus providing the first evidence of the specific site mutation.

[0187] Of the mutants grown in PDB for at least 4 days, 87.8% (36 / 41) had the red / pink pigmentation phenotype, a strong indication of oosporein production and confirmation that Bbsmrl represses the biosynthetic pathway of this secondary metabolite in B. bassiana. In contrast, liquid cultures of the parental WT strain were devoid of oosporein even after 10 days of growth and exhibited a yellowish pigmentation instead. Four selected Bbsmrl mutants (ΔBbsmr1_3, ΔBbsmr1_5, ΔBbsmr1_34, and ΔBbsmr1_38) having a singleinsertion of the geneticin resistance cassette in the locus were able to produce the red pigment when cultured in PDB medium after 5 days, supporting this transcription factor negatively regulates the secondary metabolite gene cluster responsible for the oosporein biosynthesis (Fig. 2A).

[0188] Three selected mutants were able to secrete oosporein in PDB to varying degrees (F = 17.58, df = 2, 45, P < 0.0001). There was a trend for an increasing oosporein titer over cultivation time for ΔBbsmr1_5 and ΔBbsmr1_38 (F = 8.37, df = 2, 45, P < 0.0001), but not for ΔBbsmr1_3, for which oosporein titers remained virtually unaltered. Notably, the mutant ΔBbsmr1 38 overproduced this compound by yielding 46% and 104% more oosporein than the ΔBbsmr1_3 and ΔBbsmr1_5 strains, respectively, after 4 days of growth (Fig. 2B).EXAMPLE 4: ΔBbsmr1 mutants display increased virulence

[0189] Among eight B. bassiana mutants assayed against the fourthinstar larvae of the greater wax moth (G. mellonella), six out of the eight mutants significantly outperformed the WT strain, indicating a greater virulence attained by these mutants based on their speed of killing the target host (interaction strain-time: x2= 32.91 , df = 9, P = 0.00013) (Fig. 3A). Mutants ΔBbsmr1_4 and ΔBbsmr1_40 performed similarly to the WT strain in the virulence assay. Independent of the fungal strains, larval mortality significantly increased over time post- exposure (x2= 213.45, df = 1, P < 0.0001). When examining survival curves, mutants 3, 5, and 38 induced the fastest decrease in larval survival among all other mutants and WT (x2= 662.2, df = 9, P < 0.0001), with a mortality peak found at 3 days post-exposure. Following exposure to fungal treatments at day 3, the larval mortality was over 75% for mutants 3, 5, and 38 and was significantly higher than the other mutants and parental WT (x2= 452.13, df = 9, P < 0.0001) (Fig. 3B).

[0190] According to the hazard ratio test and corroborating the above- mentioned results, ΔBbsmr1 strains 3, 5, 34, and 38 provided the highest ratios (HR > 4) in relation to WT, confirming their virulence in terms of increasing the risk of death to the insect host when exposed to these mutants (Fig. 3C). The less virulent ΔBbsmr1 strains (18 and 44) also exhibited significant hazard ratios (P < 0.05), whereas hazard rations of ΔBbsmr1 strains 4 and 40 were notsignificantly different in virulence to the insect host (P > 0.05) in relation to WT.

[0191] Larvae from control groups survived 93% 5 days post-exposure.

[0192] Among eight mutants selected, four strains significantly (P < 0.05) reduced the median and 90% lethal times (LT50 and LT90) (Fig. 3D) when compared to WT. Both LT50 and LT90 values were significantly reduced for mutants 3, 5, 34, and 38 in relation to the other mutants and WT. Thus, the lower the lethal times (LT50 and LT90), the more virulent and a faster speed of killing was displayed for the mutant strains. ΔBbsmr1 strains 3, 5, 34, and 38 resulted in 50% insect death within 2.53, 2.97, 3.13, and 2.93 days, while 90% of death occurred within 3.18, 3.73, 3.94, and 3.68 days, corresponding to 43%, 33%, 29%, and 34% faster speed of kill than WT (LC50 = 4.40 days and LC90 = 5.54 days), respectively.

[0193] Interestingly, after larval death, cadavers from mutant treatments had a pinkish coloration due to oosporein production by the fungus, and this trend was more pronounced and happened sooner when insects were exposed to the three most highly virulent mutants. Conversely, cadavers from infected larvae with the wild-type strain showed a delayed death coupled with longer time to exhibit the pink color after death (~2 days post-death). The few dead larvae found in controls appeared blackened and putrefied, and the cause of death was not related to fungal infection.

[0194] With respect to a multiple-dose-time mortality bioassay, three selected virulent B. bassiana mutants (ΔBbsmr1_3, ΔBbsmr1_5, and ΔBbsmr1_38) outperformed the WT counterpart, indicating a significantly greater virulence attained by these mutants based on their time of killing and inoculum concentration (interaction strain-time-dose: x2= 49.6, df = 12, P < 0.0001) (Fig. 4A). Aside from the specific bioactivity of each fungal strain, larval mortality significantly increased with exposure time and inoculum concentration, establishing a time- dose dependent relationship with insect death (interaction time-dose: x2= 91 -7, df = 4, P < 0.0001) (Fig. 16). All fungal strains (mutants and WT) at all test concentrations differed statistically from the uninoculated control group, and all B. bassiana mutants significantly decreased survival rates by 180-fold of the host insect in comparison to the WT (x2= 1004, df = 4, P < 0.0001).

[0195] Notably, mutants improved the dose required to kill insects, as they rendered more than a 180 fold and up to 1.5 x 107fold decrease in LC50 compared to WT across different time intervals (Fig. 4B). Surprisingly, when mortality was assessed 3 days after exposure to fungal treatments, the WT killed less than 10% of insects (LC50 not possible to be determined), whereas the three mutants induced more than 80% mortality, with the lowest LC50 being achieved with ΔBbsmr1_38 requiring as few as 4900 blastospores / mL. The strongest reduction in LC50s by these mutants was attained after 4 days of exposure, which corresponded to only 135-6355 blastospores / mL for mutants in contrast to 2.1 x 109blastospores / mL estimated for WT, representing a remarkable difference >330-fold in lethal concentration. The lowest LC50s were observed at 5 days post-exposure to the mutants, as they required a dose of 183 to 1213-fold lower than the parental WT to kill 50% of insects. Overall, mutants ΔBbsmr1_3 and ΔBbsmr1_38 had outstanding performance in yielding both the lowest LT50s and LC50s. Interestingly, blastospores were present in the hemolymph of the insect as soon as 3 days post- infection with B. bassiana mutants, whereas in WT-infected larvae blastospores were not observed at this time point.

[0196] Based on speed of kill, all three mutants had an improved LT50 with a reduction in the range of 18-39% relative to WT, after exposing insects to blastospore loads from 5 x 105to 1 x 107blastospores / mL (Fig. 4C). The lowest LT50s were attained by the highest inoculum concentration tested, resulting in 2.8 to 3.1 days for mutants to kill 50% of the insect population in contrast to 4.4 days required for WT. Remarkably, all three mutants induced a faster mortality than WT with the lowest blastospore concentration (5 x 105blastospores / mL), in which the strongest reduction in LT50 was achieved with mutant ΔBbsmr1_38 inciting 50% mortality in only 3.3 days.

[0197] Together with the lethal time data, it is evident that blastospores from these mutants displayed a faster infection rate by breaching the insect cuticle and forming blastospores in the hemolymph earlier than WT. The density of free-living blastospores in the hemolymph of the host recorded at 3 days postinoculation via cuticle infection reached 1.13 x 107blastospores / mL (SE ± 0.29, n = 6 larvae) of hemolymph (retrieved from infected larvae with ΔBbsmr1 _38),whereas blastospores were absent in the hemolymph from WT-infected larvae within this same time interval. This fast infection rate was followed by sooner host death depicting a conspicuous pinkish color in cadavers due to earlier oosporein production compared to the yellowish aspect of recently dead larvae by WT (Fig. 4D).

[0198] According to photomicrographs taken with an epifluorescent microscope, it was possible to visualize the germination of blastospores on the G. mellonella larva cuticle at 6 h post-application by a natural cuticle infection route (Fig. 17). Blastospores from the ΔBbsmr1 _38 mutant displayed faster germination and longer hyphal extensions on the insect cuticle surface than blastospores from the parental WT isolate, indicating that the higher virulence attained by this mutant could also be related to its accelerated germination speed on the insect host.EXAMPLE 5: Relative expression of key genes in oosporein biosynthetis

[0199] To confirm the knockdown of Bbsmrl after CRISPR-Cas9 geneediting and its effects on the oosporein biosynthetic gene cluster, the gene expression analysis was carried out for Bbsmrl and 9 OpS genes (OpS1- OpS7, OpS11, OpS12) of this cluster from in vitro cultures of WT and two mutant strains grown in PDB with initial pH set to 8.0. Our RT-qPCR data indicated that Bbsmrl was transcriptionally silent (null expression) in defective Bbsrmrl mutants compared with the parental counterpart (one-way ANOVA: F = 167.1, df = 2, 7, P < 0.0001 ; Fig. 5A). The disruption of the Bbsmrl transcription factor led to derepression of ORFs corresponding to OpS1-OpS7 and significant decreased expression of two ORFs located on the 5' -flanking side of OpS1, designated OpS11 and OpS12 (F = 38.72, df = 2, 9, P < 0.0001 and F = 53.36, df = 2, 9, P < 0.0001, respectively; Fig. 5B). Of these, OpS2 and OpS5 exhibited the strongest upregulation with > 100 fold-change (F = 469.7, df= 2, 7, P < 0.0001 and F = 587.9, df = 2, 6, P < 0.0001, respectively), whilst little or no change in expression was seen in the parental WT. This data confirms successful Bbsmrl gene disruption by the CRISPR-Cas9- RNP system while oosporein production correlated with OpS1-OpS7 expression in the mutant strains.EXAMPLE 6: Evaluating potential off-targets effects and the selectivity of the insertion

[0200] Whole genome sequencing was used to evaluate the precise integration of the donor DNA and potential off-target effects. Two mutants (ΔBbsmr1_3 and ΔBbsmr1_38) and the parental WT isolate underwent whole genome sequencing revealing the insertion occurred at the expected cleavage site of the guide RNA for both mutants (Fig. 5C). Off-target effects were evaluated in two manners, a guide RNA sequence-dependent approach and a guide RNA sequence-independent approach. For the guide RNA sequencedependent approach, sites in the genome with a sequence identity of greater than 65% to the guide RNA were manually inspected and found no changes were detected. For the guide RNA sequence-independent approach, the mutant reads were mapped to the wild-type genome and variants called, and no significant off-targets effects were identified using this approach. Each mutant had less than 10 variants (single or multiple nucleotide polymorphisms, insertions or deletions) and they either resulted in synonymous mutations or were in non-coding regions.EXAMPLE 7: In vitro blastospore production by B. bassiana mutants

[0201] In vitro blastospore production in liquid culture did not increase over time (F = 1.21 , df = 1 , 51 , P = 0.295), indicating that fermentation reached its production peak by day 2 of growth. Nonetheless, blastospore production varied among the WT and mutant strains, of which ΔBbsmr1 _38 yielded the lowest blastospore concentration across all time points (F = 36.47, df = 3, 51 , P < 0.0001). In comparison to the WT, mutant ΔBbsmr1 _38 produced 4.3- and 6.5- fold less blastospores after 2 and 3 days offermentation, respectively (Fig. 6A). Conversely, mutants ΔBbsmr1_3 and ΔBbsmr1_5 attained similar blastospore yields to the WT.EXAMPLE 8: Colony growth and sporulation by B. bassiana mutants

[0202] In general, there was a significant reduction in colony growth between the WT and mutant ΔBbsmr1_38 (F = 10.77, df = 3, 80, P < 0.0001), but the other mutants had similar growth in colony area to the WT. All three mutants produced fewer asexual conidia (spore yields) compared to the WT (F= 25.4, df = 3, 20, P < 0.0001), with a pronounced reduction for mutant ΔBbsmr1_5 (Fig. 6B,C).EXAMPLE 9: Tolerance of B. bassiana mutants to cell chemical stressors

[0203] Fungal mutants and WT responded differently when grown in the presence of various cell chemical stressors at different time points (Fig. 7A,B). Greater differences were seen when colonies were measured after 8 days of growth in all cases. Oxidative stress mediated by menadione (F = 17.32, df = 3,36, P < 0.0001) significantly reduced colony growth of all mutants across all evaluation intervals, while osmotic stress by NaCI (F = 7.28, df = 3, 36, P < 0.0001) only affected the mutant ΔBbsmr1 _38 relative to the WT at 8 days postinoculation. Differences in growth area were attained only 8 days postinoculation with H2O2 (F = 142.1, df = 1, 36, P < 0.0001) and Congo red (F = 1148.66, df = 1, 36, P < 0.0001). At 4-day post- inoculation, there was reduced colony growth for mutant ΔBbsmr1_38 in relation to the WT when challenged with the cell wall inhibitor Congo red. All mutants exhibited similar growth area to the WT when challenged with oxidative stress caused by H2O2 across all time intervals (F = 1.64, df = 3, 36, P = 0.09). Interestingly, the ΔBbsmr1 _3 mutant grew better than the other fungal mutants and WT in PDA without any chemical stressor (control plates) at 8 days post- inoculation (F =3.87, df = 3,37, P = 0.017).

[0204] To summarize the results considering the most significant phenotypic variables (pleiotropic effects and virulence parameters), the PCA was highly informative and useful to explain the differences between WT and knockout mutants of B. bassiana (Fig. 8A). Compared to the WT, this multivariate analysis clearly indicated a high correlation of mutants (ΔBbsmr1_3, ΔBbsmr1_5 and ΔBbsmr1 _38) with in vitro oosporein overproduction, rapid colony growth rate, high tolerance to cell wall disturbance by Congo red (day 8), and low LT50 and LC50 values attributed to their hypervirulence. However, unlike the WT, these three mutants exhibited less tolerance to certain chemical cell stressors (menadione, NaCI, Congo red day 4) along with lower blastospore production by day 3 of fermentation. According to the heatmap plot (Fig. 8B), the dendrogram assembled for strains indicatedthat mutants ΔBbsmr1_3 and ΔBbsmr1_5 are more similar to each other than to ΔBbsmr1 _38, but all these mutants are highly divergent from the WT based on 11 pleiotropic and virulence variables, previously selected by the PCA.Discussion

[0205] A precise, efficient, and affordable synthetic CRISPR-Cas9-RNP system was successfully implemented in the broad-insect pathogen B. bassiana and resulted in 93.2% transformation efficiency by disrupting the endogenous transcription factor Bbsmrl, a gene encoding a negative regulator for oosporein biosynthesis. Notably, the resultant mutants displayed phenotypes with overproduction of the red-pigmented metabolite oosporein, increased germination rate on the insect cuticle, and greater cuticle infectivity of blastospores when applied to insects, resulting in enhanced virulence. Interestingly, the hypervirulence of these mutants were also positively correlated with an accelerated colony growth rate and tolerance to cell wall disturbance by Congo red. Whole genome sequencing analysis revealed that this CRISPR- Cas9-RNP transformation system yielded accurate and site-specific gene disruption with no significant off-target mutations identified within the fungal genome. Hence, our CRISPR-Cas9 system based on RNP delivery reduces the risk of off-target mutations and minimizes the risk of altering genes adjacent to the target region. Corroborating the findings from Fan et al.

[0013] , the disruption of the Bbsmrl transcription factor in the B. bassiana genome was further confirmed through gene expression profiles, including 9 OpS genes that revealed strong upregulation of OpS3, which in turn (positively) regulates the rest of the OpS gene cluster, except OpS11 and OpS12. A similar gene disruption transformation protocol via CRISPR-Cas9 with preassembled RNP was previously implemented for the cotton fungal pathogen Fusarium oxysporum with high transformation efficiency, demonstrating that gene disruption of the FoBIKI encoding a polyketide synthase resulted in the absence of the pigment bikaverin

[0045] . This study underscores the first evidence of an entomopathogenic fungus modified by CRISPR-Cas9-RNP to develop hypervirulent strains, optionally with overproduction of oosporein. These enhanced strains demonstrate increased insecticidal activity, offering promisingpotential for pest biocontrol programs.

[0206]

[0207] Making use of the CRISPR-Cas9-RNP transformation strategy, we demonstrated thatB. bassiana blastospores are significantly more infective, and kill G. mellonella larvae faster than aerial conidia, corroborating previous data obtained with other insect hosts [24-28]. This cell type formed by entomopathogenic fungi under submerged cultivation and inside the infected host, holds a great promise to replace aerial conidia as the active ingredient for the industrial development of commercial fungal biopesticides for arthropod pest control. Hence, all the virulence bioassays with the ΔBbsmr1 mutants were performed using blastospores as the main inoculum source. Six of the eight ΔBbsmr1 mutants displayed superior virulence in relation to the parental WT, indicating virulence bioassays are important to identify the most virulent fungal phenotypes.

[0208] Another important approach is to eliminate the heterokaryon phenotypes by selecting single-spored mutants in order to obtain homokaryons with having a single nucleus carrying the mutation, thus rendering consistent phenotypic results. Among eight mutants screened against G. mellonella larvae, three highly virulent engineered homokaryon strains (e.g., ΔBbsmr1_3, ΔBbsmr1_5 and ΔBbsmr1_38) exhibited strong virulence to G. mellonella larvae, killing these insects more quickly (up to a 43% reduction in LT50.90) and more efficiently lethal, thereby requiring lower inoculum loads (>2 log-fold reduction in LC50) than the parental counterpart. These mutant strains were capable of killing the entire insect cohort in the experiments in less than 4 days post-inoculation, indicating remarkable virulence. In contrast to our findings, Fan et al.

[0013] only described the virulence of a single mutant strain of ΔBbsmr1 based on the LT50, and found that this mutant exhibited less pronounced virulence after topically applying 1 x 107conidia / mL that led to 100% mortality of G. mellonella larvae after 5 days with only ~20% reduction in LT50 in relation to the WT parent. Although oosporein has been claimed not to be directly involved in virulence of B. bassiana [13,20] and a defective Bbsmrl mutants according to the present invention depicted hypervirulence with overproduction of oosporein, the enhanced virulence could be related to othermechanisms unlocked by this gene mutation. There are several possible explanations for these data. First, we observed that these mutants germinated much faster on the insect cuticle than the WT parent, thus suggesting the involvement of enhanced activity of cuticle-degrading enzymes during the cuticle penetration. Another option is the expression of other secondary metabolites and enzymes during the infection stage in the hemolymph where the mutant also formed earlier free-floating in vivo hyphal bodies along with the overproduction of oosporein in infected insects, thus efficiently evading the insect immune system and accelerating the insect mortality. Once inside the host, another options concerns the overproduction of oosporein triggered by the disruption of Bbsmrl, and this metabolite could play a synergistic role with the rapid formation of hyphal bodies in accelerating the host immune evasion, and consequently increasing mortality levels in a faster fashion.

[0209] Interestingly, 2-3 days post-inoculation of G. mellonella larvae during the host colonization stage, ΔBbsmr1 mutants formed numerous blastospores in the host hemolymph, whereas blastospores were absent in the hemolymph from larvae infected with the parental WT. This indicated the B. bassiana mutants were able to propagate the yeast-like budding blastospores in the host hemocoel at an earlier stage of infection than the WT, an important trait associated with enhanced virulence

[0022] . In addition, we performed epifluorescence microscopy that revealed blastospores from deficient Bbsmrl strains germinating faster on the larva cuticle than blastospores of the parental WT, which concurs with an earlier observation of accelerated in vitro spore germination by ΔBbsmr1 strains

[0036] . Another phenotypic feature displayed by these mutants regards their ability to turn cadavers into pinkish or reddish sooner after death than cadavers infected with the WT. This observation suggests that earlier host death could be associated with overproduction of oosporein in infected insects by hypervirulent ΔBbsmr1 strains.

[0210] Surprisingly, the application of CRISPR-Cas9 technology in fungal biocontrol agents of agricultural importance is still in its infancy and awaits full development in the near future as new knowledge is gathered about their genomes and gene functions coupled to affordable gene editing technologies. For instance, Chen et al.

[0030] used uridine auxotrophy and URA5as a selectable marker with a blastospore-based transformation system to establish a highly efficient, low false-positive, and cost-effective CRISPR-Cas9- mediated gene editing system in B. bassiana. In our study, we made attempts to transform blastospores instead of protoplasts of B. bassiana but were not successful, but instead protoplasts of B. bassiana were successfully transformed through our CRISPR-Cas9-RNP system. Other filamentous entomopathogenic fungi exploited for biocontrol strategies in pest control may be edited using this flexible and effective CRISPR-Cas9-RNP system, and may contribute to generating novel genetically improved strains for the biological control market.

[0211] In the present invention, virulence of the ΔBbsmr1 mutants outperformed the cpf-overexpression strains not only in terms of lower LT50 but also by having a lower lethal dose required to kill the same host insect. Another important aspect regarding fungal virulence is the ability of ΔBbsmr1 mutants to speed up the formation and proliferation of blastospores in the insect hemocoel compared with the parental WT. This facilitated formation and proliferation of hyphal bodies or blastospores in host hemocoel was also noticed by Mou et al.

[0015] , and this trait is strongly linked with the ability of the fungus to colonize the host and induce host mummification and death, and agrees with previous studies

[0022] . Although not investigated here, we suspect that the high virulence attribute to the ΔBbsmr1 mutants may be linked to increased activity of secreted proteases, chitinases, and antioxidant enzymes crucial for the collapse of the insect immune defense, acceleration of hemocoel localization, in vivo proliferation, and probable overexpression of other secondary metabolites during fungal colonization in host hemocoel, leading to faster killing and reduced lethal inoculum loads of the mycopathogen.

[0212] Oosporein is a high value bioactive molecule with important applications in cell therapy to combat proliferation of cancer cells as well as harbouring potential antifungal and antibacterial activities against plant pathogens

[0018] . Hence, having mutant strains with the capacity to overproduce this biomolecule using inexpensive culture medium after only a few days of fermentation represents a step toward its economically large-scale production. The overproduction of oosporein by B. bassiana mutants has the potential to beused as a natural eco-friendly biofungicide against economically important plant fungal pathogens, such as Fusarium oxysporum f. sp. cubense

[0058] and Giberella moniliformis

[0059] . Notably, we identified three deficient Bbsmrl mutants capable of overproducing oosporein, in the range of 33 to 68 ppm, in only 2 days of fermentation, whereas the WT cultures resulted in no detectable oosporein during in vitro growth. Comparatively, our B. bassiana ΔBbsmr1 _38 mutant was considered highly productive for this metabolite reaching up to 118 ppm after 4 days of cultivation, whereas WT strain PQ2 of B. bassiana from another study only reached its production peak after 7 days of cultivation yielding 183 ppm

[0050] . Genetic improvement for overexpression of fungal secondary metabolites represents an important strategy toward the expansion and diversification of these bioactive compounds for use as agricultural biopesticides. In this sense, CRISPR-Cas9 can contribute to unlocking novel secondary metabolites in entomopathogenic fungi by broadening their biochemical repertoire for exploitation in biological control of agricultural pests

[0021] . This can be done by precisely editing endogenous genes rather than integrating in the fungus genome exogenous DNA for heterologous expression, which may facilitate the regulatory process of registering non- transgenic improved fungal strains for use in biological control programs tackling plant pests and diseases.

[0213] The technology for cost-effective mass production of B. bassiana blastospores via submerged liquid fermentation using large-scale bioreactors has been established and is available for industrial exploitation, offering advantages over traditional solid-substrate fermentation methods for production of aerial conidia [27,28,60,61]. Therefore, combining the powerful tool based on CRISPR-Cas9 gene editing technology targeting endogenous genes involved in fungal secondary metabolism pathways, with the use of fast-acting blastospores as the primary active ingredient, presents a promising approach to enhance the efficiency of entomopathogenic fungi as next generation biocontrol agents in agriculture. Furthermore, this genetic engineering approach will pave the way for the development of novel commercial fungal strains with desired phenotypic traits meeting key industrial needs in a rapid and cost- effective manner.Table 1. Oligonucleotides used in this invention.Code Primer name Sequence (5’ - 3’) ReferencePrimers for CRISPR / Cas9-sgRNA vector gRNA Protospacer 1 TCACTACACCCCAATATCAGGGG This study sgRNA ssDNA AAGCTAATACGACTCACTATAGG This studyTCACTACACCCCAATATCAGGTT TTAGAGCTAGAAATAGCAAGPrimers for repair template vector of donor DNABBA_0 AZF1 sg8 CGGCCTACAACTCGCATCCGGC This study4866 Gen KO-F TCCTCCCACCTTCACTACACCCC A ATATGAATTCATGCCAGTTGTTC CAZF1 sg8 GTGGGCGAAGGGCTGTGATACG This study Gen KO-R GCACATATTGGAAAGCATTAGG C CCCTGGAGGATCCTCTAGAAAG AAGGPrimers for diagnostic PCRGenetici Gent-F GAATGAACTGCAGGACGAGG This study n cassette Gent-R CGGCCAI I I I CCACCATGAT This studyBbsmrl Bbsmr1-F CCACCTCAAAGTCCCCATCT This study Bbsmrl -RCCACGTATGCCATCCCAAAG This studyPrimers to evaluate gene expression in RT-qPCRBbsmrl Bbsmrl -F CAGCTTGGCAATATGAAGAC Fan et ai. 2017Bbsmr1-R AACATGGGGTAACGGCTGCTG Fan et al. 2017OpS7 OpS7-F CACTACCTGCCCTTTCCG Fan etal.2017OpS7-R CCGTGGTGTACTCCCTGTAA Fan et al.2017OpS6 OpS6-F CTGGAGATTAAGAGGGTGCT Fan etal.2017OpS6-R TGTAGTGCGGGACAAAGG Fan etal.2017OpS5 OpS5-F TCTGTAGCGGCTGAAATT Fan etal.2017OpS5-R TTGCTCGTAGTAGTTGGTGT Fan etal.2017OpS4 OpS4-F GACGGCGTGGCTGTGATA Fan etal.2017OpS4-R CAGTCGTAGGATGATGCGATAT Fan etal.2017OpS3 OpS3-F AAACAATAAGGCAGTTGGAGA Fan etal.2017OpS3-R GATGTCACTTGGCGGTTG Fan etal.2017OpS2 OpS2-F CAAGAGGCGAGGAACAGC Fan etal.2017OpS2-R CATACCAGACCACCATAGACG Fan etal.2017OpS12 OpS12-F TTGGAGACAAAGGTGGAAATCG Fanetai.2017OpS12-R ACGGCAAACGCAGACAGG Fanetai.2017OpS11 OpS11-F CATCCCGTCCCTCAACCA Fan etal.2017OpS11-R TCCGTCTCCGCATCCAAC Fan etal.2017Adin qAct-F GGCAACATTGTCATGTCTGG Fanetai.2017 qAct-R TTTGCTGGAAGGTGGATAGG Fan etal.2017

[0214] All products disclosed and claimed herein can be made and performed without undue experimentation in light of this disclosure. Although the products of this invention have been described in terms of the preceding illustrative embodiments, it will be evident to those skilled in the art that variations, changes, modifications, and alterations can be applied to the compositions described herein without departing from the true concept, essence, and scope of the disclosure. More specifically, it will be apparent that certain agents that are chemically and physiologically related can be substituted for the agents described herein while the same or similar results would be achieved. All such substitutes and similar modifications apparent to those skilled in the art are considered to be within the essence, scope, and concept of the invention as defined by the appended claims.

[0215] All publications and patent documents published in the specification are incorporated herein by reference in their entirety as if each individual publication or patent application were specifically or individually designated for incorporation by reference.REFERENCES1. Gullino ML, Albales R, Al-Jboory I, Angelotti F, Chakraborty S, Garrett KA, Hurley BP, Juroszek P, Makkouk K, Stephenson T. Scientific review of the impact of climate change on plant pests: a global challenge to prevent and mitigate plant pest risks in agriculture, forestry and ecosystems. Rome: FAO: IPCC, 2021 ; 72p. doi: 10.4060 / cb4769en2. Pathak VM, Verma VK, Rawat BS, Kaur B, Babu N, Sharma A, Dewali S, Yadav M, Kumari R, Singh S, Mohapatra A, Pandey V, Rana N, Cunill JM. Current status of pesticide effects on environment, human health and it’s eco-friendly management as bioremediation: A comprehensive review. Front Microbiol. 2022; 13: 962619. doi: 10.3389 / fmicb.2022.962619.3. Sabarwal A, Kumar K, Singh RP. Hazardous effects of chemical pesticides on human health- Cancer and other associated disorders. Environ Toxicol Pharmacol. 2018; 63: 103-114. doi: 30 10.1016 / j.etap.2018.08.018.4. Glare T, Caradus J, Gelernter W, Jackson T, Keyhani N, Kohl J, Marrone P, Morin L, Stewart A. Have biopesticides come of age? Trends Biotechnol. 2012; 30(5): 250-258. doi: 10.1016 / j.tibtech.2012.01.0035. Pimentel D, Perkins JH. Pest Control: Cultural and Environmental Aspects. CRC Press; 2019.6. Whalon ME, Mota-Sanchez D, Hollingworth RM. Global Pesticide Resistance in Arthropods. In: Whalon ME, Mota-Sanchez D, Hollingworth RM, editors. CABI; 2008. p. 5- 31.7. Root Analysis. Agricultural Biologicals Market. 2024. Available from: https: / / www.rootsanalysis.com / reports / agricultural-biologicals- market.html.8. Mascarin GM, Lopes RB, Delalibera Junior I, Fernandes EKK, Luz C, Faria M. Current status and perspectives of fungal entomopathogens used for microbial control of arthropod pests in Brazil. J Invertebr Pathol. 2019; 165:46-53. doi: 10.1016 / j.jip.2018.01.001.9. Lovett B, St. Leger RJ. Genetically engineering better fungalbiopesticides. Pest Manag Sci. 2017; 74:781-789. doi: 10.1002 / ps.4734.10. Gibson DM, Donzelli BGG, Krasnoff SB, Keyhani NO. Discovering the secondary metabolite potential encoded within entomopathogenic fungi. Nat Prod Rep. 2014; 31:1287- 1305. doi: 10.1039 / C4NP00054D.11. Pedrini N. The entomopathogenic fungus Beauveria bassiana shows its toxic side within insects: expression of genes encoding secondary metabolites during pathogenesis. J Fungi. 2022; 8:488. doi: 10.3390 / jof8050488.12. Zhang L, Fasoyin OE, Molnar I, Xu Y. Secondary metabolites from hypocrealean entomopathogenic fungi: Novel bioactive compounds. Nat Prod Rep. 2020; 37:1181-1206. doi: 10.1039 / C9NP00065H13. Fan Y, Liu X, Keyhani NO, Tang G, Pei Y, Zhang W, et al. Regulatory cascade and biological activity of Beauveria bassiana oosporein that limits bacterial growth after host death. Proc Natl Acad Sci USA. 2017; 114(9):E1586. doi: 10.1073 / pnas.1616543114.14. St. Leger RJ, Wang C. Genetic engineering of fungal biocontrol agents to achieve greater efficacy against insect pests. Appl Microbiol Biotechnol. 2010; 85:901-907. doi: 30 10.1007 / s00253-009-2306-z.15. Mou YN, Ren K, Tong SM, Ying SH, Feng MG. Fungal insecticidal activity elevated by non-risky markerless overexpression of an endogenous cysteine-free protein gene in Beauveria bassiana. Pest Manag Sci. 2022; 78(7):3164-3172. doi: 10.1002 / ps.6946.16. Ma M, Luo J, Li C, Eleftherianos I, Zhang W, Xu L. A life-and-death struggle: interaction of insects with entomopathogenic fungi across various infection stages. Front Immunol. 2024; 14:1329843. doi:10.3389 / fimmu.2023.132984317. Boucias DG, Zhou Y, Huang S, Keyhani NO. Microbiota in insect fungal pathology. Appl Microbiol Biotechnol. 2018; 102(14):5873-5888. doi: 10.1007 / S00253-018-9089-z.18. Wang H, Peng H, Li W, Cheng P, Gong M. The toxins of Beauveriabassiana and the strategies to improve their virulence to insects. Front Microbiol. 2021 ; 12:705343. doi: 10.3389 / fmicb.2021.705343.19. Butt TM, Coates CJ, Dubovskiy IM, Ratcliffe NA. Entomopathogenic fungi: new insights into host-pathogen interactions. Adv Genet. 2016; 94:307-364. doi: 10.1016 / bs.adgen.2O16.01.006.20. Feng P, Shang Y, Kai C, Wang C. Fungal biosynthesis of the bibenzoquinone oosporein to evade insect immunity. Proc Natl Acad Sci USA. 2015; 112:11365-11370. doi: 10.1073 / pnas.1503200112.21. Oliveira LR, Gongalves AR, Quintela ED, Colognese L, Cortes MVCB, Filippi MCC. Genetic engineering of filamentous fungi: prospects for obtaining fourth-generation biological products. Appl Microbiol. 2024; 4:794- 810. doi: 10.3390 / applmicrobiol4020055.22. Zhang AX, Mouhoumed AZ, Tong SM, Ying SH, Feng MG. BrIA and AbaA govern virulence-required dimorphic switch, conidiation, and pathogenicity in a fungal insect pathogen. mSystems. 2019; 4(4). doi: 10.1128 / mSystems.OO140-1923. Alkhaibari AM, Carolino AT, Bull JC, Samuels Rl, Butt TM. Differential pathogenicity of Metarhizium blastospores and conidia against larvae of three mosquito species. J Med Entomol. 2017; 54:696-704. doi: 10.1093 / jme / tjw223.24. Bernardo CC, Barreto LP, Silva CSR, Luz C, Arruda W, Fernandes EKK. Conidia and 25 blastospores of Metarhizium spp. and Beauveria bassiana s.l.: their development during the infection process and virulence against the tick Rhipicephalus microplus. Ticks Tick Borne Dis. 2018; 9:1334-1342. doi: 10.1016 / j.ttbdis.2O18.06.001.25. Correa B, da Silveira-Duarte V, Silva DM, Mascarin GM, Delalibera Jr I. Comparative analysis of blastospore production and virulence of Beauveria bassiana and Cordyceps fumosorosea against soybean pests. BioControl. 2020; 65:323-337. doi: 10.1007 / s10526-020- 09999-6.26. Lopes RB, Souza TAD, Mascarin GM, Souza DA, Bettiol W, Souza HR, et al. Akanthomyces diversity in Brazil and their pathogenicity to plant-sucking insects. J Invertebr Pathol. 2023; 200:107955. doi:10.1016 / j.jip.2O23.107955.27. Mascarin GM, Jackson MA, Kobori NN, Behle RW, Delalibera Junior I. Liquid culture fermentation for rapid production of desiccation tolerant blastospores of Beauveria bassiana and Isaria fumosorosea strains. J Invertebr Pathol. 2015a; 127:11-20. doi: 10.1016 / j.jip.2014.12.001.28. Mascarin GM, Jackson MA, Kobori NN, Behle RW, Dunlap CA,Delalibera Junior I. Glucose concentration alters dissolved oxygen levels in liquid cultures of Beauveria bassiana and affects formation and bioefficacy of blastospores. Appl Microbiol Biotechnol. 2015b; 99:6653-6665. doi: 10.1007 / S00253-015-6620-3.29. Vega FE, Jackson MA, McGuire MR. Germination of conidia and blastospores of Paecilomyces fumosoroseus on the cuticle of the silverleaf whitefly, Bemisia argentifolii. Mycopathologia. 1999; 47:33-35. doi: 10.1023 / A: 1007011801491.30. Chen J, Lai Y, Wang L, Zhai S, Zou G, Zhou Z, et al. CRISPR / Cas9- mediated efficient genome editing via blastospore-based transformation in entomopathogenic fungus Beauveria bassiana. Sci Rep. 2017; 8:45763. doi: 10.1038 / srep45763.31. Davis KA, Sampson JK, Panaccione DG. Genetic reprogramming of the ergot alkaloid pathway of Metarhizium brunneum. Appl Environ Microbiol. 2020; 86(19). doi: 10.1128 / AEM.01251 -20.32. Oliveira TC. Metodologias para a geragao de mutantes funcionais em Metarhizium anisopliae: CRISPR / Cas9 e RNAi. Masters Thesis (in Portuguese). UFRGS; 2016. Available from: https: / / lume.ufrgs.br / handle / 10183 / 150695.33. Bilgo E, Lovett B, Fang W, Bende N, King GF, Diabate A, et al. Improved efficacy of an arthropod toxin expressing fungus against insecticideresistant malaria-vector mosquitoes. Sci Rep. 2017; 7:3433. doi: 10.1038 / S41598-017-03399-0.34. Zeng S, Lin Z, Yu X, Zhang J, Zou Z. Expressing parasitoid venomprotein VRF1 in an entomopathogen Beauveria bassiana enhances virulence toward cotton bollworm Helicoverpa armigera. Appl Environ Microbiol. 2023; 89. doi: 10.1128 / aem.00705-23.35. Cortes MVCB, Barbosa ET, Oliveira MIS, Maciel LHR, Lobo- Junior M, Contesini FJ, Filippi MCC, Silva-Lobo VL. Trichoderma harzianum marker-free strain construction based on efficient CRISPR / Cas9 recyclable system: A helpful tool for the study of biological control agents. Biol Control. 2023; 184:105281. doi: 10.1016 / j.biocontrol.2023.105281.36. Chen JF, Liu Y, Tang GR, Jin D, Chen X, Pei Y, Fan YH. The secondary metabolite regulator, BbSmrl , is a central regulator of conidiation via the BrIA-AbaA-WetA pathway in Beauveria bassiana. Environ Microbiol. 2021 ; 23(2):810-825. doi: 10.1111 / 1462-2920.15155.37. Me Namara L, Dolan SK, Walsh JMD, Stephens JC, Glare TR, Kavanagh K, Griffin CT. Oosporein, an abundant metabolite in Beauveria caledonica, with a feedback induction mechanism and a role in insect virulence. Fungal Biol. 2019; 123:601-610. doi: 10.1016 / j.funbio.2019.01.004.38. Qin Y, Ying SH, Chen Y, Shen ZC, Feng MG. Integration of insecticidal protein Vip3Aa1 into Beauveria bassiana enhances fungal virulence to Spodoptera litura larvae by cuticle and per os infection. Appl Environ Microbiol. 2010; 76(14) 4611^4618. doi: 10.1128 / AEM.00302-10.39. Wang C, St. Leger RJ. A scorpion neurotoxin increases the potency of a fungal insecticide. Nat Biotechnol. 2007; 25:1455-1456. doi: 10.1038 / nbt1357.40. Xiao G, Ying SH, Zheng P, Wang ZL, Zhang S, Xie XQ, Shang Y, St. Leger RJ, Zhao GP, Wang C, Feng MG. Genomic perspectives on the evolution of fungal entomopathogenicity in Beauveria bassiana. Sci Rep. 2012; 2:483. doi: 10.1038 / srep00483.41. Grigoriev IV, Roman N, Sajeet H, Kuo A, Ohm R, Otillar R, Riley R, Salamov A, Zhao X, Korzeniewski F, Smirnova T, Nordberg H, Dubchak I, Shabalov I. MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Res. 2014; 42-704. doi: 10.1093 / nar / gkt1183.42. Stemmer M, Thumberger T, del Sol Keyer M, Wittbrodt J, Mateo JL. CCTop: an intuitive, flexible and reliable CRISPR / Cas9 target prediction tool. PLoS One. 2015; 10(4). doi: 10.1371 / journal.pone.0124633.43. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Sbding J, Thompson JD, Higgins DG. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2011 ; 7:539. doi: 10.1038 / msb.2011.75.44. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.45. Wang Q, Cobine PA, Coleman JJ. Efficient genome editing in Fusarium oxysporum based on CRISPR / Cas9 ribonucleoprotein complexes. Fungal Genet Biol. 2018; 117:21-29. doi: 10.1016 / j.fgb.2018.05.003.46. Pokhrel A, Seo S, Wang Q, Coleman J J. Targeted gene disruption via CRISPR / Cas9 ribonucleoprotein complexes in Fusarium oxysporum. In: Coleman JJ, editor. Fusarium Wilt: Methods and Protocols. Methods in Molecular Biology, vol. 2391. 2021. doi: 10.1007 / 978-1- 0716-1795-3_7.47. Cortes-Maldonado L, Marcial-Quino J, Gomez-Manzo S, Fierro F,Tomasini A. A method for the extraction of high quality fungal RNA suitable for RNA-seq. J Microbiol Methods. 2020; 170:105855. doi:10.1016Zj.mimet.2020.105855.48. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25:402-408. doi: 10.1006 / meth.2001.126249. Watanabe M, Lee K, Goto K, Kumagai S, Sugita-Konishi Y, Hara- Kudo Y. Rapid and effective DNA extraction method with bead grinding for a large amount of fungal DNA. J Food Prot. 2010; 73(6): 1077-1084. doi: 10.4315 / 0362-028X-73.6.1077.50. Lara-Juache HR, Avila-Hernandez JG, Rodriguez-Duran LV, Michel MR, Wong-Paz JE, Muniz-Marquez DB, Veana F, Aguilar-Zarate M, Ascacio-Valdes JA, Aguilar-Zarate P. Characterization of a biofilm bioreactor designed for the single-step production of aerial conidia and oosporein byBeauveria bassiana PQ2. J Fungi. 2021 ; 7(8):582. doi: 10.3390 / jof7080582.51. Guo CT, Luo XC, Tong SM, Zhou Y, Ying SH, Feng MG. FluG and FluG-like FlrA coregulate manifold gene sets vital for fungal insect-pathogenic lifestyle but not involved in asexual development. mSystems. 2022; 7(4). doi: 10.1128 / msystems.00318-22.52. Ritz C, Baty F, Streibig JC, Gerhard. Dose-response analysis using R. PLoS One. 2015; 10: e0146021. doi: 10.1371 / journal.pone.0146021.53. Kassambara A, Kosinski M, Biecek P, Fabian S. Package ‘survminer’. Drawing Survival Curves using ‘ggplot2’ (R package version 0.4.9); 2017.54. Jackson C. flexsurv: A Platform for Parametric Survival Modeling in R. J Stat Softw 2016; 70(8): 1-33. doi: 10.18637 / jss.v070.i08.55. Lenth RV. Emmeans: Estimated marginal means, aka leastsquares means [Computer software manual], 2020. Available online: http: / / cran.project.org / package=emmeans (R package version 1.4.1).56. Kassambara A, Mundt F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R Package Version1.0.7; 2020. https: / / CRAN . R-project.org / package=factoextra.57. GR Warnes, B Bolker, L Bonebakker, R Gentleman, W Huber, A Liaw, et al. gplots: Various R programming tools for plotting data. R package version 2; 2009; (4), 1.58. Mascarin GM, Marinho-Prado JS, Assalin MR, Martins LG, Braga ES, Tasic L, Dita M, Lopes RB. Natural occurrence of Beauveria caledonica, pathogenicity to Cosmopolites sordidus, and antifungal activity against Fusarium oxysporum f. sp. cubense. Pest Manag Sci. 2022; 78(11):4458— 4470. doi: 10.1002 / ps.7063.59. Avila-Hernandez JG, Aguilar-Zarate P, Carrillo-lnungaray ML, Michel MR, Wong-Paz JE, Muniz-Marquez DB, Rojas-Molina R, Ascacio- Valdes JA, Martinez-Avila GCG. The secondary metabolites from Beauveria bassiana PQ2 inhibit the growth and spore germination of Gibberellamoniliformis LIA. Braz J Microbiol. 2022; 53(1): 143— 152. doi: 10.1007 / s42770- 021-00668-z.60. Mascarin GM, Jackson MA. Stable fungal blastospores and methods for their production, stabilization, and use. WO2016044091 A1; 2016.61. Mascarin GM, Jackson MA, Behle RW, Kobori NN, Delalibera Junior I. Improved shelf life of dried Beauveria bassiana blastospores using convective drying and active packaging processes. Appl Microbiol Biotechnol. 2016; 100(19): 8359-8370. doi: 10.1007 / s00253-016- 7597-2.

Claims

1. CLAIMS1. A genetically engineered fungus comprising a genetic modification, wherein said genetic modification is selected from the group consisting of:(i) a genetic modification that partially or completely suppresses expression of the Bbsmrl gene; and(ii) a genetic modification that partially or completely suppresses the activity of the AZF1 protein.

2. The genetically engineered fungus of claim 1 , wherein the fungus is an oosporein producing fungus.

3. The genetically engineered fungus of claim 1 or 2, wherein the fungus is from a genus selected from the group consisting of Acremonium spp., Arcopilus spp., Beauveria spp., Blackwellomyces spp., Chaetomium spp., Cochliobolus spp., Corniculantispora spp., Lecanicillium spp., Oospora spp., Phlebia spp. and Tremella spp..

4. The genetically engineered fungus of any one of the preceding claims, wherein the fungus is from a species selected from the group consisting of Acremonium alabamense, A. alternatum, A. cavaraeanum, A. chrysogenum, A. falciforme, A. kiliense, A. recifei, A. strictum, A. zeae, Arcopilus amazonicus, A. aureus, A. cu preus, A. flavigenus, A. fusiformis, A. turgidopilosus, Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Chaetomium atrobrunneum, C. aureum, C. bostrychodes, C. cochliodes, C. crispatum, C. cupreum, C. elatum, C. funicola, C. globosum, C. indicum, C. murorum, C. thermophilum, Cochliobolus akaii, C. bicolor, C. carbonum, C. cymbopogonis, C. cynodontis, C. eleusines, C. geniculatus, C. hawaiiensis, C. heterostrophus, C. kusanoi, C. lunatus, C. miyabeanus, C. nisikadoi, C. pallescens, C. sativus, C. spicifer, C. victoriae, Corniculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L antillanum,L araneicola, L coprophilum, L evansii, L flavidum, L fusisporum, L gracile, L kalimantanense, L lecanii, L longisporum, L muscarium, L nodulosum, L saksenae, L tenuipes, Oospora colorans, Phlebia acerina, P. centrifuga, P. cocci neofu Iva, P. h yd noidea, P. incarnata, P. livida, P. mellea, P. radiata, P. rufa, P. subochracea, P. tremellosa, Tremella aurantia, T. encephala, T. foliacea, T. fuciformis, T. mesenterica, T. mycophaga, T. simplex.

5. The genetically engineered fungus of any one of the preceding claims, wherein the genetic modification leads to the derepression a gene cluster associated with oosporein production, thereby increasing oosporein production.

6. The genetically engineered fungus of any one of the preceding claims, wherein the fungus is entomopathogenic fungus.

7. The genetically engineered entomopathogenic fungus of claim6, wherein the fungus has increased virulence and / or enhanced fungal fitness.

8. The genetically engineered entomopathogenic fungus of claim7, wherein the entomopathogenic fungus is selected from the group consisting of Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Corniculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L antillanum, L araneicola, L coprophilum, L evansii, L flavidum, L fusisporum, L gracile, L kalimantanense, L lecanii, L longisporum, L muscarium, L nodulosum, L saksenae, L tenuipes.

9. The genetically engineered entomopathogenic fungus of claim8, wherein the entomopathogenic fungus is Beauveria bassiana.

10. The genetically engineered fungus of any one of the preceding claims, wherein the AZF1 protein comprises an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity with an amino acid sequence selected from the groupconsisting of SEQ ID NOs: 1 and 3-16.11 . The genetically engineered fungus of any one of the preceding claims, wherein the Bbsmrl gene comprises a nucleotide sequence having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %,82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%,95%, 96%, 97%, 98%, 99% and 100% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and 17-26, or degenerated sequences thereof encoding the same amino acid sequences.

12. The genetically engineered fungus of any one of the preceding claims, wherein the genetic modification is produced via gene editing, gene modification, gene silencing or mutagenesis.

13. The genetically engineered fungus of any one of the preceding claims, wherein genetic modification is a deletion, insertion, or substitution of one or more nucleotides in the promoter region, in the 5'UTR region, in the coding region, or in the 3'UTR region of the native gene.

14. The genetically engineered entomopathogenic fungus of claim 12 or 13, wherein the gene editing is introduced via a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) or CRISPR / Cas system mediated deletion.

15. The genetically engineered entomopathogenic fungus of any one of claims 12 to 14, wherein the gene editing is introduced via a CRISPR / Cas system mediated deletion.

16. The genetically engineered entomopathogenic fungus of claim 12, wherein the gene silencing is an RNA-mediated gene silencing.

17. The genetically engineered entomopathogenic fungus of any one of claims 1 to 16, wherein the fungus comprises a further genetic modification increasing expression of one of more of genes involved in the production of oosporein.

18. A composition or product comprising a genetically engineered entomopathogenic fungus of one of claims 1 to 17.

19. The composition of claim 18, wherein said composition is a biopesticide for pest control, preferably wherein said composition comprises blastopores.

20. A kit comprising:(a) a genetically engineered entomopathogenic fungus of any one of claims 1 -16; and / or(b) a composition or product of claim 17.21 . A method for producing a fungus with enhanced production of oosporein, virulence and / or entomopathogenic performance comprising culturing the genetically engineered fungus of any one of claims 1 to 17.

22. A method for enhancing the virulence and biocontrol performance of entomopathogenic fungi, comprising introducing a genetic modification into said fungi, wherein said genetic modification is selected from the group consisting of:(i) a genetic modification that partially or completely suppresses expression of the native Bbsmrl gene; and(ii) a genetic modification that partially or completely suppresses the activity of the AZF1 protein.

23. A method for enhancing the production of oosporein in fungi, comprising introducing a genetic modification into said fungi, wherein said genetic modification is selected from the group consisting of:(i) a genetic modification that partially or completely suppresses expression of the Bbsmrl gene; and(ii) a genetic modification that partially or completely suppresses the activity of the AZF1 protein.

24. The method of claim 22 or 23, wherein the fungus is an oosporein producing fungus.

25. The method of any one of claims 22 to 24, wherein the fungus is from a genus selected from the group consisting of Acremonium spp., Arcopilus spp., Beauveria spp., Blackwellomyces spp., Chaetomium spp., Cochliobolus spp., Corniculantispora spp., Lecanicillium spp., Oospora spp., Phlebia spp. and Tremella spp..

26. The method of any one of claims 22 to 25, wherein the fungus is from a species selected from the group consisting of Acremonium alabamense, A. alternatum, A. cavaraeanum, A. chrysogenum, A. falciforme, A. kiliense, A. recifei, A. strictum, A. zeae, Arcopilus amazonicus, A. aureus,ZV cupreus, A. flavigenus, A. fusiformis, A. turgidopilosus, Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia, Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Chaetomium atrobrunneum, C. aureum, C. bostrychodes, C. cochliodes, C. crispatum, C. cupreum, C. elatum, C. funicola, C. globosum, C. indicum, C. murorum, C. thermophilum, Cochliobolus akaii, C. bicolor, C. carbonum, C. cymbopogonis, C. cynodontis, C. eleusines, C. geniculatus, C. hawaiiensis, C. heterostrophus, C. kusanoi, C. lunatus, C. miyabeanus, C. nisikadoi, C. pallescens, C. sativus, C. spicifer, C. victoriae, Corniculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L antillanum, L araneicola, L coprophilum, L evansii, L flavidum, L fusisporum, L gracile, L kalimantanense, L lecanii, L longisporum, L muscarium, L nodulosum, L saksenae, L tenuipes, Oospora colorans, Phlebia acerina, P. centrifuga, P. cocci neofu Iva, P. hydnoidea, P. incarnata, P. Hvida, P. mellea, P. radiata, P. rufa, P. subochracea, P. tremellosa, Tremella aurantia, T. encephala, T. foliacea, T. fuciformis, T. mesenterica, T. mycophaga, T. simplex.

27. The method of claim 22 to 26, wherein the genetic modification leads to the derepression a gene cluster associated with oosporein production, thereby increasing oosporein production.

28. The method of any one of claims 22 to 27, wherein the fungus is entomopathogenic fungus.

29. The method of claim 28, wherein the fungus has increased virulence and enhanced fungal fitness.

30. The method of any one of claims 22 to 29, wherein the entomopathogenic fungus is selected from the group consisting of Beauveria alba, B. amorpha, B. arenaria, B. asiatica, B. australis, B. bassiana, B. blattidicola, B. brongniartii, B. caledonica, B. diapheromeriphila, B. hoplocheli, B. kipukae, B. Hi, B. malawiensis, B. medogensis, B. pseudobassiana, B. rubra, B. sangayensis, B. sinensis, B. sobolifera, B. sungii, B. varroae, B. vermiconia,Blackwellomyces aurantiacus, B. calendulinus, B. cardinalis, B. lateris, B. minutus, B. pseudomilitaris, B. roseostromatus, Corniculantispora aranearum, C. dimorpha, C. psalliotae, Lecanicillium acerosum, L antillanum, L araneicola, L coprophilum, L evansii, L flavidum, L fusisporum, L gracile, L kalimantanense, L lecanii, L longisporum, L muscarium, L nodulosum, L saksenae, L tenuipes.

31. The method of any one of claims 22 to 30, wherein the entomopathogenic fungus is Beauveria bassiana.

32. The method of any one of claims 22 to 31 , wherein the AZF1 protein comprises an amino acid sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 and 3-16.

33. The method of any one of claims 22 to 32, wherein the Bbsmrl gene comprises a nucleotide sequence having at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NO: 2 and 17-26, or degenerated sequences thereof encoding the same amino acid sequences.

34. The method of any one of claims 22 to 33, wherein the genetic modification is produced via gene editing, gene modification, gene silencing or mutagenesis.

35. The method of any one of claims 22 to 34, wherein genetic modification is a deletion, insertion, or substitution of one or more nucleotides in the promoter region, in the 5'UTR region, in the coding region, or in the 3'UTR region of the native gene.

36. The method of claim 34 or 35, wherein the gene editing is introduced via a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) or CRISPR / Cas system mediated deletion.

37. The method of any one of claims 34 to 36, wherein the geneediting is introduced via a CRISPR / Cas system mediated deletion.

38. The method of claim 37, wherein the gene silencing is an RNA- mediated gene silencing.

39. A method for controlling a pest, the method comprising applying or delivering the genetically engineered entomopathogenic fungus of any one of claims 1 to 17 or the composition of claim 18 or 19 to a pest, a crop or a substrate subject to a pest, preferably a substrate wherein a crop will be cultivated.

40. The method of claim 39, wherein the pest is a plant pest.41 . The method of claim 39, wherein the pest is a nematode.

42. The method of claim 41 , wherein the nematode is selected from the group consisting of Meloidogyne spp., Heterodera, Globodera spp., Pratylenchus spp., Rotylenchulus spp.

43. The method of claim 39, wherein the pest is an arthropod pest.

42. The method of claim 39, wherein the arthropod pest is an insect pest.

43. The method of claim 42, wherein the insect pest is selected from the group consisting of an Aphidian pest, a Coleopteran pest, a Dipteran pest, an Hemipteran pest, a Lepidopteran pest, an Orthopteran pest, a Thysanopteran pest and mite pest.

44. The method of claim 43, wherein the insect pest is selected from the group consisting of Aedes spp. (Mosquitoes), Anopheles spp. (Mosquitoes), Anthonomus grandis (Boll Weevil), Aphis gossypii (Cotton Aphid), Bemisia tabaci (Silverleaf Whitefly), Blissus spp. (Chinch Bugs), Coccus viridis (Green Scale), Cosmopolites sordidus (Banana Weevil), Culex spp. (Mosquitoes), Cydia pomonella (Codling Moth), Diaphorina citri (Asian Citrus Psyllid), Frankliniella occidentalis (Western Flower Thrips), Galleria mellonella (Greater Wax Moth), Halyomorpha halys (Brown Marmorated Stink Bug), Helicoverpa armigera (Cotton Bollworm I Old World Bollworm), Hypothenemus hampei (Coffee Berry Borer), Leptinotarsa decemlineata (Colorado Potato Beetle), Lygus spp. (Tarnished Plant Bug), Macrosiphoniella sanborni (Chrysanthemum Aphid), Melolontha melolontha (Cockchafer), Myzus persicae (Green Peach Aphid), Myzus spp. (Aphids), Ostrinia nubilalis(European Corn Borer), Paysandisia archon (Palm Moth), Pianococcus citri (Citrus Mealybug), Plutella xylostella (Diamondback Moth), Saissetia spp. (Scale insects), Sitophilus spp. (Grain Weevils), Spodoptera spp. (Armyworms), Thaumetopoea pityocampa (Pine Processionary), and Trialeurodes vaporariorum (Greenhouse Whitefly)45. The method of claim 43, wherein the mite pest is selected from the group consisting of Panonychus spp, Tetranychus urticae, (Two-spotted Spider Mite) and Varroa destructor (Varroa Mite).

46. Use of the genetically engineered entomopathogenic fungus of any one of claims 1 -17 for the manufacture of a composition, kit or product for controlling a pest.

47. A seed treated with a genetically engineered entomopathogenic fungus of any one of claims 1 to 17 or composition of claim 18 or 19.