Enhanced knockdown efficiency through the shrna constructs targeting distinct genes
By employing a plasmid with dual shRNA constructs targeting distinct soybean SVTP genes, the method optimizes protein trafficking and production of casein proteins in soybean plants, overcoming interference and degradation issues, resulting in improved yield and purity.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MOZZA FOODS INC
- Filing Date
- 2025-11-17
- Publication Date
- 2026-05-21
AI Technical Summary
Existing methods for producing casein proteins in transgenic plants face challenges in achieving commercially viable production levels due to interference from native plant proteins and inefficient protein trafficking, leading to degradation of heterologous proteins like caseins in soybean systems.
The use of a plasmid containing two distinct shRNA constructs targeting different soybean SVTP genes (Glyma.02G268600 and Glyma.14G048800) to downregulate native plant proteins, optimizing protein trafficking pathways and enhancing the expression and accumulation of casein proteins in soybean plants.
This approach significantly enhances the production and purification efficiency of casein proteins by reducing interference from endogenous proteins, allowing for higher yields and purer casein isolation, addressing the limitations of single shRNA constructs and traditional protein trafficking patterns.
Smart Images

Figure US2025055825_21052026_PF_FP_ABST
Abstract
Description
[0001] DocketNo. 713.006.004. PCT
[0002] International Patent Application
[0003] ENHANCED KNOCKDOWN EFFICIENCY THROUGH THE SHRNA CONSTRUCTS TARGETING DISTINCT GENES
[0004] Inventor(s): Cory Tobin, PhD
[0005] Assignee: Mozza Foods, Inc.
[0006] 1927 Zonal Avenue
[0007] Los Angeles, CA 90033
[0008] a Delaware Corporation
[0009] DocketNo. 713.006.004. PCT
[0010] Entity: Small business concern Docket No. 713.006.004. PCT
[0011] ENHANCED KNOCKDOWN EFFICIENCY THROUGH THE SHRNA CONSTRUCTS TARGETING DISTINCT GENES
[0012] CROSS-REFERENCE INFORMATION
[0013] The present application claims priority to U. S. Provisional Patent Application Serial No.
[0014] 63 / 721,420, filed on November 15, 2024; U. S. Provisional Patent Application Serial No.
[0015] 63 / 721,424, filed on November 15, 2024; and U. S. Provisional Patent Application Serial No.
[0016] 63 / 721,426, filed on November 15, 2024, each of which are incorporated in their respective entirety.
[0017] SEQUENCE LISTING INFORMATION
[0018] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 713006004PCT_SEQ_LIST.xml, which is 48 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety.
[0019] TECHNICAL FIELD
[0020] The methods and compositions relate to genetic manipulation and RNA interference (RNAi) technology, specifically to the use of short hairpin RNA (shRNA) constructs for the purpose of downregulating the expression of target genes in plants, with a focus on soybean. More particularly, the methods and compositions describe a method where a plasmid containing two distinct shRNA constructs, each targeting different genes, is more effective at downregulating one or both of the target genes than a plasmid containing a single shRNA construct targeting just one gene; and genetic modification of protein trafficking pathways, specifically targeting SVTP genes (Soybean Vesicular Trafficking Pathway genes) involved in vesicular transport and protein sorting mechanisms. Docket No. 713.006.004. PCT
[0021] BACKGROUND
[0022] Casein micelles, which account for more than 80% of the protein in bovine milk, are essential components in dairy products, particularly cheese. Currently, these proteins are obtained exclusively from the mammary glands of dairy cows and other ruminants through industrial-scale farming operations. This production method presents significant environmental and ethical challenges - dairy farms contribute substantially to greenhouse gas emissions, consume disproportionate amounts of water resources, and often involve practices that compromise animal welfare, including dehorning, routine forced insemination, and premature calf separation.
[0023] There is a critical need for sustainable alternatives, particularly plant-based systems capable of producing biologically active casein proteins at industrial scale. However, expressing functional milk proteins in plants has proven challenging, with previous attempts failing to achieve commercially viable production levels. A key impediment has been the difficulty of efficiently expressing heterologous proteins while managing interference from native plant proteins.
[0024] The production of industrially valuable proteins in plant-based expression systems has emerged as an attractive alternative to traditional microbial and mammalian cell culture systems. Plants offer numerous advantages as protein production platforms, including scalability, reduced risk of contamination with human pathogens, and lower production costs. Among the proteins of significant commercial interest are milk proteins, particularly caseins, which have diverse applications in food science, nutrition, and industrial processes.
[0025] Casein proteins, traditionally sourced from mammalian milk, possess unique structural and functional properties that make them valuable for various applications. These properties include their ability to form micelles, their excellent emulsification characteristics, and their nutritional value as a source of essential amino acids. The growing demand for dairy proteins, coupled with increasing interest in sustainable and animal-free protein production, has driven efforts to produce casein proteins in alternative expression systems.
[0026] The cellular machinery involved in protein trafficking and molecular sorting plays a fundamental role within eukaryotic cells. This machinery is particularly crucial in the endosomal network, where it mediates the selective retrieval and transport of proteins between cellular compartments. Docket No. 713.006.004. PCT
[0027] SVTP genes encode essential regulators in vacuolar and endosomal sorting processes across eukaryotic organisms, from yeast to plants and mammals.
[0028] In plant systems, SVTP genes and related protein trafficking components have been extensively studied in model organisms such as Arabidopsis thaliana, where they demonstrate critical functions in protein sorting, recycling, and trafficking pathways. These components play a particularly important role in directing proteins to their appropriate cellular destinations, including the lytic vacuole, where protein degradation occurs. This protein trafficking system is especially relevant for the expression and accumulation of heterologous proteins in transgenic plants.
[0029] Within the soybean genome, multiple distinct SVTP genes have been identified. These genes show strong sequence conservation with their homologs from other species, suggesting a similar crucial role in protein trafficking pathways. The presence of these genes in soybean presents an opportunity for genetic modification to enhance protein production, particularly for valuable proteins such as caseins.
[0030] Casein proteins, traditionally produced in mammalian milk, are of significant commercial interest due to their nutritional value and industrial applications. When expressed in transgenic soybean systems, these proteins are typically encapsulated within vesicles and may be directed to the lytic vacuole through protein trafficking pathways, potentially leading to their degradation. This trafficking pattern presents a significant challenge for achieving high levels of casein accumulation in transgenic soybean plants.
[0031] Previous studies have established the fundamental importance of protein trafficking regulation in plant systems. While these prior studies have established the fundamental role of protein trafficking pathways in model systems like Arabidopsis, the present invention represents the first targeted manipulation of SVTP genes in soybeans specifically for enhancing protein accumulation.
[0032] RNA interference (RNAi) technology, particularly through the use of short hairpin RNA (shRNA) constructs, has emerged as a powerful tool for modulating gene expression in plant biotechnology. While conventional approaches typically employ single shRNA constructs targeting individual genes, this method has shown limited efficacy in complex protein expression systems. Docket No. 713.006.004. PCT
[0033] The methods and compositions address these challenges by reducing the expression of specific plant proteins that interfere with casein purification, thereby improving the efficiency of casein production in transgenic soybean plants. This approach represents a novel strategy for optimizing heterologous protein production through host organism engineering, with potential applications beyond casein production to other valuable proteins.
[0034] The methods and compositions additionally demonstrate that combining multiple distinct shRNA constructs in a single plasmid, each targeting different native plant genes including GY1, GY4, CG2, and L0X1.3, achieves significantly enhanced knockdown efficiency compared to singleconstruct approaches. This strategic downregulation of native plant proteins creates an optimized cellular environment for casein protein expression and accumulation, resulting in products that are more readily isolable and purifiable.
[0035] The methods and compositions, by identifying and targeting the two distinct soybean SVTP genes (Glyma.02G268600 and Glyma.14G048800), are additionally directed to modifying protein trafficking pathways in an economically important crop species. Unlike previous work that focused on understanding the natural function of these trafficking components, this invention leverages that understanding to deliberately alter protein trafficking patterns, creating a new approach for enhancing the accumulation of valuable heterologous proteins such as caseins in soybean. This strategic modification of cellular protein trafficking represents a significant advance in the field of plant protein production, offering potential solutions to long-standing challenges in the expression and accumulation of commercially important proteins in transgenic plants.
[0036] SUMMARY
[0037] The methods and compositions disclosed herein are for optimizing the production and purification of transgenic casein proteins in genetically modified soybean plants. The methods and compositions specifically address challenges in heterologous casein protein expression by reducing or eliminating endogenous Casein-Processing Interfering Proteins (CPIPs), defined as proteins that demonstrate binding affinity for either casein proteins or common purification matrices used in casein isolation procedures. CPIPs include calcium-dependent membrane-binding Docket No. 713.006.004. PCT
[0038] proteins such as annexins, oxidative enzymes such as lipoxygenases, and other proteins that measurably interact with either casein or protein purification matrices under standard isolation conditions.
[0039] Genetic modification strategies for both the introduction of transgenic casein and the reduction of CPIPs can be achieved through RNA interference (RNAi) approaches utilizing hairpin RNA constructs, CRISPR / Cas9-mediated genome editing for targeted gene knockouts, or other sequence-specific nuclease systems for genetic modification. The targeted reduction or elimination of expression focuses on genes encoding CPIPs, thereby reducing interference in downstream processing steps.
[0040] The resulting modified soybean plants demonstrate both expression of transgenic casein and reduced levels of CPIPs, enabling more efficient production and purification of the target casein proteins. This dual modification approach represents a significant advancement in the field of plant-based protein production systems, with applications in both research and industrial settings where high-purity casein protein is desired. The methods and compositions provide solutions for improving the yield and purity of transgenic casein while reducing processing costs and complexity.
[0041] The discovery that a plasmid containing two distinct shRNA constructs, each targeting different genes, results in more effective downregulation of one or both of the targeted genes compared to a plasmid containing a single shRNA construct. For example, an shRNA targeting the LOX 1.3 gene showed negligible knockdown when used alone, but when combined with an shRNA targeting the GY1 gene, the LOX 1.3 gene expression was reduced by approximately 50%. In contrast, when combined with an shRNA targeting the CG2 gene, there was no significant reduction in LOX 1.3 expression, despite using the same LOX 1.3 sequence. There was also no significant suppression of LOX 1.3 expression by the GY1 shRNA construct alone.
[0042] This multi-target shRNA approach could be applied to various gene targets in plants, offering an efficient means of simultaneously silencing multiple genes or enhancing the knockdown of a specific gene. Docket No. 713.006.004. PCT
[0043] Some aspects of the disclosure provide: (1) targeting genes selected from GY1, GY4, CG2, and L0X1.3 via a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39, thereby (2) modifying expression levels of gene products from encoding GY1, GY4, CG2, and L0X1.3, in the plant, thereby (3) leading to higher levels of expression of milk proteins, such as caseins, in: (a) plants and (b) food products that comprise the a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39.
[0044] In a variant, a nucleic acid molecule comprises a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41.
[0045] In a variant, SEQ ID NO: l is a sense sequence for targeting a gene, wherein the gene is GY 1.
[0046] In a variant, SEQ ID NO: 2 is an antisense sequence for targeting a gene, wherein the gene is GY 1.
[0047] In a variant, SEQ ID NO: 3 is a sense sequence for targeting a gene, wherein the gene is CG2.
[0048] In a variant, SEQ ID NO: 4 is an antisense sequence for targeting a gene, wherein the gene is CG2.
[0049] In a variant, SEQ ID NO: 5 is a sense sequence for targeting a gene, wherein the gene is LOX1.3.
[0050] In a variant, SEQ ID NO: 6 is an antisense sequence for targeting a gene, wherein the gene is LOX1.3.
[0051] In a variant, SEQ ID NO: 7 comprises a sensing sequence, intron, and antisense sequences in a functional short hairpin RNA for targeting a gene, wherein the gene is GY1 and a gene, wherein the gene is LOX 1.3 Docket No. 713.006.004. PCT
[0052] In a variant, SEQ ID NO: 8 comprises a sensing sequence, intron, and antisense sequences in a functional short hairpin RNA for targeting a gene, wherein the gene is CG2 and a gene for encoding L0X1.3
[0053] In a variant, SEQ ID NO: 9 comprises a sensing sequence, intron, and antisense sequences in a functional short hairpin RNA for targeting a gene, wherein the gene is GY1, a gene, wherein the gene is CG2, and a gene, wherein the gene is L0X1.3
[0054] In a variant, SEQ ID NO: 10 is a sense sequence that is 180 base pairs for targeting a gene, wherein the gene is GY1.
[0055] In a variant, SEQ ID NO: 11 is an antisense sequence that is 180 base pairs for targeting a gene, wherein the gene is GY 1.
[0056] In a variant, SEQ ID NO: 12 is a sense sequence that is 120 base pairs for targeting a gene, wherein the gene is GY1.
[0057] In a variant, SEQ ID NO: 13 is an antisense sequence that is 120 base pairs for targeting a gene, wherein the gene is GY 1.
[0058] In a variant, SEQ ID NO: 14 is a sense sequence that is 90 base pairs for targeting a gene, wherein the gene is GY1.
[0059] In a variant, SEQ ID NO: 15 is an antisense sequence that is SEQ ID NO: 15 is 90 base pairs for targeting a gene, wherein the gene is GY1.
[0060] In a variant, SEQ ID NO: 16 is a sense sequence that is 90 base pairs for targeting a gene, wherein the gene is GY1.
[0061] In a variant, SEQ ID NO: 17 is an antisense sequence that is 90 base pairs for targeting a gene, wherein the gene is GY 1.
[0062] In a variant, SEQ ID NO: 18 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY1.
[0063] In a variant, SEQ ID NO: 19 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY 1. Docket No. 713.006.004. PCT
[0064] In a variant, SEQ ID NO: 20 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY1.
[0065] In a variant, SEQ ID NO: 21 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY 1.
[0066] In a variant, SEQ ID NO: 22 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY1.
[0067] In a variant, SEQ ID NO: 23 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is GY 1.
[0068] In a variant, SEQ ID NO: 24 is a sense sequence that is 150 base pairs for targeting a gene, wherein the gene is CG2.
[0069] In a variant, SEQ ID NO: 25 is an antisense sequence that is 150 base pairs for targeting a gene, wherein the gene is CG2.
[0070] In a variant, SEQ ID NO: 26 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2.
[0071] In a variant, SEQ ID NO: 27 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2.
[0072] In a variant, SEQ ID NO: 28 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2.
[0073] In a variant, SEQ ID NO: 29 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2.
[0074] In a variant, SEQ ID NO: 30 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2.
[0075] In a variant, SEQ ID NO: 31 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is CG2. Docket No. 713.006.004. PCT
[0076] In a variant, SEQ ID NO: 32 is a sense sequence that is 150 base pairs for targeting a gene, wherein the gene is LOX1.3.
[0077] In a variant, SEQ ID NO: 33 is an antisense sequence that is 150 base pairs for targeting a gene, wherein the gene is LOX 1.3.
[0078] In a variant, SEQ ID NO: 34 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX1.3.
[0079] In a variant, SEQ ID NO: 35 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX1.3.
[0080] In a variant, SEQ ID NO: 36 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX1.3.
[0081] In a variant, SEQ ID NO: 37 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX 1.3.
[0082] In a variant, SEQ ID NO: 38 is a sense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX1.3.
[0083] In a variant, SEQ ID NO: 39 is an antisense sequence that is 60 base pairs for targeting a gene, wherein the gene is LOX 1.3.
[0084] In a variant, SEQ ID NO: 40 comprises a sensing sequence, intron, and antisense sequences in a non-functional short hairpin RNA for targeting GY1, CG2, and LOX1.3
[0085] In a variant, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 are functional in expressing caseins. Docket No. 713.006.004. PCT
[0086] In a variant, the caseins are (a) SI -alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) SI -alpha casein and beta casein; (f) SI -alpha casein and S2-alpha casein; (g) SI -alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) SI -alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) SI -alpha casein, S2-alpha casein, and kappa casein; (n) SI -alpha casein, S2-alpha casein, and beta casein; and (o) SI -alpha casein, S2-alpha casein, beta casein, and kappa casein..
[0087] In a variant, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 are each isolated and codon optimized.
[0088] In variant, a method for modifying one or more plant cells to increase a purity level of a protein heterologous to the one or more plant cells, comprises: obtaining SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 in an isolated and codon optimized state; adding SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID Docket No. 713.006.004. PCT
[0089] NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 in the isolated and codon optimized state, into the one or more plant cells; responsive to adding SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 into the one or more the plant cells, integrating SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 with genetic contents of the one or more plant cells; and responsive to integrating SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41 with the genetic contents of the one or more plant cells, performing silencing of one or more of genes, wherein a gene of the one or more genes encodes for GY1, a gene of the one or more genes encodes for GY4, a gene of the one or more genes encodes for CG2, and a gene of the one or more genes encodes for LOX 1.3
[0090] In a variant, the one or more plant cells are soybean. Docket No. 713.006.004. PCT
[0091] In a variant, the protein heterologous to the one or more plant cells is casein, egg white protein, or casein and egg white protein.
[0092] In a variant, the casein is (a) SI -alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) SI -alpha casein and beta casein; (f) SI -alpha casein and S2-alpha casein; (g) SI -alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) SI -alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) SI -alpha casein, S2-alpha casein, and kappa casein; (n) SI -alpha casein, S2-alpha casein, and beta casein; and (o) SI -alpha casein, S2-alpha casein, beta casein, and kappa casein.
[0093] In a variant, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41, each contain functional short hairpin RNA targeting a gene, wherein the gene is GY1, a gene, wherein the gene is CG2, and a gene, wherein the gene is LOX1.3, thereby modifying levels of expression of GY1, levels of expression of CG2, and levels of expression of LOX1.3, respectively.
[0094] In a variant, a plant comprises: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, or SEQ ID NO: 41; and casein in a micelle. Docket No. 713.006.004. PCT
[0095] In a variant, SEQ ID NO: 40 and SEQ ID NO: 41 contain non -functional short hairpin RNA and SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39 each contain a respective functional short hairpin RNA.
[0096] In a variant, the respective functional short hairpin RNA of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39, each correspond to modified levels of GY1, CG2, and / or LOX1.3 in the micelle, in comparison to the non-functional short hairpin RNA of SEQ ID NO: 40 or SEQ ID NO: 41.
[0097] In a variant, a gene is selected from GY1, GY4, CG2, and LOX1.3, wherein the gene is targeted by a nucleotide selected from SEQ ID NO: 1-SEQ ID NO: 39.
[0098] In a variant, a method for modifying expression levels of gene products, comprises: obtaining SEQ ID NO: 1 - SEQ ID NO: 39 in an isolated and codon optimized state; adding SEQ ID NO: 1 - SEQ ID NO: 39 in the isolated and codon optimized state, into one or more plant cells; integrating SEQ ID NO: 1 - SEQ ID NO: 39 with a genome within the one or more plant cells; and performing CRISPR on two or more genes selected from GY1, GY4, CG2, and LOX1.3.
[0099] In a variant, a method for modifying expression levels of gene products, comprises: obtaining SEQ ID NO: 1 - SEQ ID NO: 39 in an isolated and codon optimized state; adding SEQ ID NO: 1 - SEQ ID NO: 39 in the isolated and codon optimized state, into a seed; adding a promoter to the Docket No. 713.006.004. PCT
[0100] seed, wherein the promoter is selected from the group consisting of: PfFAD3-l, Glycinin, and Lei; integrating SEQ ID NO: 1 - SEQ ID NO: 39 with a genome within the seed; and performing knockdown of two or more genes selected from GY1, GY4, CG2, and L0X1.3.
[0101] In a variant, a method for silencing genes in an organism, comprises: obtaining SEQ ID NO: 1 -SEQ ID NO: 39 in an isolated and codon optimized state; adding SEQ ID NO: 1 - SEQ ID NO: 39 in the isolated and codon optimized state, into the organism; integrating SEQ ID NO: 1 - SEQ ID NO: 39 with a genome within the organism; and targeting two or more genes selected from GY1, GY4, CG2, and L0X1.3, via a gene silencing technique, thereby increasing expression levels of casein protein, wherein the casein protein is contained within the micelle, in a purified state.
[0102] In a variant, the gene silencing technique comprises: knockdown, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), virus-induced gene silencing (VIGS), antisense oligonucleotide therapy, genomic imprinting, and RNA-directed DNA methylation.
[0103] In a variant, a plant or plant cell, comprises: a nucleotide selected from SEQ ID NO: 1 - SEQ ID NO: 39; casein in a micelle; and one or more seeds, wherein the one or more seeds contain suppressed pathways associated with genes regulating oxidation of lipids and modified expression levels of GY1 and CG2, wherein said pathways and said modified expression levels of GY1 and CG2 reside solely in the one or more seeds.
[0104] In a variant, composition comprises: a nucleotide selected from SEQ ID NO: 1 - SEQ ID NO: 39; casein produced in a plant or plant cell, wherein plant or plant cell comprises a suppressed pathways associated with genes regulating oxidation of lipids and modified expression levels of GY1 and CG2; and a micelle contained within the seed, wherein the micelle encapsulates the casein.
[0105] The methods and compositions also enhance protein accumulation in soybean plants through targeted modification of the cellular protein trafficking pathway.
[0106] Specifically, approaches for modifying the expression or function of SVTP genes to optimize protein accumulation, particularly of heterologous proteins such as caseins, that encompasses several key aspects, below. Docket No. 713.006.004. PCT
[0107] First, the methods and compositions are reducing or eliminating the expression of SVTP genes in soybean plants. This reduction can be achieved through various molecular techniques, including but not limited to RNA interference (RNAi), antisense RNA expression, CRISPR / Cas9-mediated gene editing, or other gene silencing approaches. Two identified SVTP genes in soybeans (Glyma.02G268600 and Glyma.l4G048800) are targeted, either individually or in combination.
[0108] Second, the methods and compositions describe specific genetic constructs designed for SVTP gene modification. These include carefully designed shRNA sequences that can effectively target SVTP gene transcripts for degradation, as well as CRISPR guide RNA sequences and associated components for precise genetic modification. The methods and compositions include optimized genetic elements such as promoters, enhancers, and regulatory sequences that enable effective expression of these constructs in soybean plants.
[0109] Third, the methods and compositions are generating transgenic soybean plants with modified SVTP gene expression. These methods include techniques for introducing the genetic constructs into soybean cells, selecting successfully modified plants, and regenerating whole plants from transformed cells. The methods and compositions also encompass screening and identifying plants with optimal levels of SVTP gene modification.
[0110] Fourth, the methods and compositions are expressing heterologous proteins, particularly caseins, in soybean plants with modified SVTP gene expression. This includes strategies for introducing casein genes or other proteins of interest into SVTP-modified plants and approaches for optimizing their expression and accumulation. The methods and compositions provide specific genetic constructs and expression systems designed to work synergistically with SVTP gene modification.
[0111] Fifth, the methods and compositions are analyzing and characterizing protein accumulation in modified plants. This encompasses techniques for quantifying protein levels, assessing protein stability and localization, and measuring the efficiency of protein production in SVTP-modified plants compared to conventional systems.
[0112] A key aspect of the methods and compositions is the ability to redirect protein trafficking pathways by modifying SVTP gene function. By reducing SVTP gene expression, the methods and compositions disrupt the normal trafficking of proteins to lytic vacuoles, where they would Docket No. 713.006.004. PCT
[0113] typically be degraded. This modification results in increased accumulation of desired proteins within the plant cells, potentially improving the yield and efficiency of protein production in transgenic soybean systems.
[0114] The methods and compositions also are optimizing the balance between SVTP gene modification and plant viability. Since complete elimination of SVTP gene function might affect plant health, the methods and compositions include approaches for achieving partial reduction of SVTP gene activity that maximizes protein accumulation while maintaining plant vigor and productivity.
[0115] Furthermore, the methods and compositions encompass scaling up protein production using SVTP gene-modified plants, including strategies for maintaining stable genetic modifications across generations and optimizing growth conditions for maximum protein yield. This includes electing and propagating elite lines that combine high protein production with robust agronomic performance.
[0116] INCORPORATION BY REFERENCE
[0117] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.
[0118] BRIEF DESCRIPTION OF THE DRAWINGS
[0119] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0120] The figures showing embodiments of the system are semi-diagrammatic, and not to scale and, particularly, some of the dimensions are for the clarity of presentation and are shown exaggerated in the figures. Similarly, although the views in the figures for ease of description generally show Docket No. 713.006.004. PCT
[0121] similar orientations, this depiction in the figures is arbitrary for the most part. Generally, the methods and compositions can be operated in any orientation.
[0122] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0123] Fig. l is a functional block diagram of the transfection process and resulting micelle.
[0124] Fig. 2 through 9 show gene expression analysis from multi-target shRNA experiments. Fig. 3 demonstrates the differential knockdown efficiency of L0X1.3 when targeted in combination with different genes. When L0X1.3 shRNA was combined with GY1 shRNA (plasmid pMOZ3321), L0X1.3 expression was reduced compared to control levels. In contrast, Fig. 4 shows that when the same L0X1.3 shRNA sequence was combined with CG2 shRNA (plasmid pMOZ3322), no significant reduction in L0X1.3 expression was observed, despite using identical L0X1.3 targeting sequences in both constructs. These results demonstrate an unexpected synergistic effect specific to certain shRNA combinations, where the presence of GY1 -targeting shRNA enhanced the knockdown efficiency of L0X1.3, while CG2 -targeting shRNA did not produce this enhancement. The data is represented as relative gene expression levels normalized to control samples, with error bars indicating standard deviation from multiple experimental replicates.
[0125] DETAILED DESCRIPTION
[0126] In the methods and compositions, endogenous Casein-Processing Interfering Proteins (CPIPs), such as oxidases (e.g., lipoxygenases (LOX)), can be present in the recombinantly expressed casein protein fractions, as isolated from plasmid transformed plants. Soybean Vesicular Trafficking Pathway (SVTP) can traffic recombinantly expressed casein proteins to lytic vacuoles that degrade said protein trafficked to the lytic vacuoles. CPIPs and SVTP are therefore interfering with yield and / or purity of recombinantly expressed casein proteins. All the plasmids herein can express recombinant casein in plants. There are plasmids that comprise functional shRNA in RNA interference (RNAi) mechanisms, thereby performing the knockdown of genes expressing CPIPs and / or genes in the SVTP, such as: pMOZ nos. 3332, 3319, 3320, 3333, 3321, 3334, 3322, 3336, Docket No. 713.006.004. PCT
[0127] 3324, 3337, 3325, 3196, 3168, 3169, 3170, 3171, 3172, 3173, 3174, 3420, and 3421. There are plasmids that comprise non-functional shRNA for RNAi, such as pMOZ nos. 3431, 3418, and 3419, as controls. In contrast to the control, successful dual gene targeting via knocking down was demonstrated by: pMOZ nos. 3332, 3319, 3320, 3333, 3321, 3334, 3322, 3336, 3324, 3337, 3325, 3196, 3168, 3169, 3170, 3171, 3172, 3173, 3174, 3420, and 3421. Knocking down of two or more target genes is performed using dual gene targeting by, for example, a single expression cassette containing multiple distinct shRNA constructs that are functional for RNAi. The said cassette is inserted into plants, thereby transfecting said plants with (1) nucleotides for expressing recombinant casein; and (2) shRNA constructs that invoke a RNAi mechanism. This leads to increased casein accumulation in plants either: directly, by suppressing CPIPs (e.g., LOX) to enable more efficient purification of recombinantly expressed casein; or indirectly, by modifying SVTP genes to route casein away from lytic vacuoles to prevent degradation of recombinantly expressed casein.
[0128] Methods and compositions are provided for enhancing the production and purification of transgenic casein in plants through the targeted reduction of Casein-Processing Interfering Proteins (CPIPs). CPIPs are endogenous plant proteins that demonstrate binding affinity for either casein proteins or common purification matrices used in casein isolation procedures, thereby interfering with efficient casein recovery. The methods and compositions encompass genetic modification strategies, including RNA interference and genome editing approaches, to reduce the expression of CPIPs such as annexins and lipoxygenases. Transgenic plants with reduced CPIP expression demonstrate improved casein purification efficiency and product purity. The methods and compositions include methods for identifying CPIPs, constructing genetic modification vectors, generating modified plants, and purifying transgenic casein from said plants. Also provided are nucleic acid constructs, transformed plant cells, and purified casein compositions with reduced CPIP contamination.
[0129] CPIPs are defined as endogenous plant proteins that demonstrate binding affinity for either casein proteins or common purification matrices used in casein isolation procedures. CPIPs can be identified through various methods including protein-protein interaction studies using purified casein as bait, affinity chromatography using standard protein purification resins, coimmunoprecipitation studies, yeast two-hybrid screening, mass spectrometry analysis of protein Docket No. 713.006.004. PCT
[0130] complexes, and surface plasmon resonance analysis. In one embodiment, CP IPs are identified by their ability to co-purify with casein under standard isolation conditions. In another embodiment, CPIPs are identified by their direct binding to purification matrices commonly used for casein isolation, such as ion exchange resins, hydrophobic interaction media, or affinity chromatography supports.
[0131] The methods and compositions encompass multiple approaches for reducing CPIP expression. In one embodiment, hairpin RNA constructs targeting CPIP genes are designed and introduced into soybean plants. These constructs may include sense and antisense sequences derived from target CPIP genes, with intron spacers of varying lengths. The expression of these constructs can be driven by different promoter systems and terminated with various terminator sequences. Selection markers may be included to facilitate transformation processes.
[0132] Alternative embodiments utilize CRISPR / Cas systems for targeted gene modification. These approaches may employ single guide RNA designs targeting CPIP genes or multiple guide RNAs for simultaneous targeting of several CPIPs. Various Cas enzyme variants may be employed, including but not limited to Cas9 and Casl2. The methods and compositions also encompass other genome editing approaches, such as TALENs designed to target CPIP genes, zinc finger nucleases, base editing systems, and prime editing approaches.
[0133] The methods and compositions include various expression strategies for transgenic casein production. Promoter systems may include constitutive promoters such as CaMV 35S, seedspecific promoters, inducible promoter systems, tissue-specific promoters, and synthetic promoter designs. Subcellular targeting strategies may include cytosolic expression, protein body targeting, vacuolar targeting, ER retention, or alternative organelle targeting.
[0134] Multiple transformation approaches are encompassed by the methods and compositions, including Agrobacterium-mediated transformation, biolistic transformation, protoplast transformation, in planta transformation methods, and tissue culture-based approaches. The methods and compositions include various methods for selecting and screening modified plants, including molecular screening methods for CPIP reduction, protein-based screening approaches, selection marker systems, high-throughput screening methods, and phenotypic screening approaches. Docket No. 713.006.004. PCT
[0135] Various purification strategies are described within the scope of the methods and compositions, including ion exchange chromatography, hydrophobic interaction chromatography, affinity chromatography, size exclusion chromatography, mixed-mode chromatography, and alternative separation technologies.
[0136] Several specific embodiments are described in detail. In one embodiment, the methods and compositions involve simultaneous introduction of hairpin RNA constructs targeting multiple CPU’s along with casein expression cassettes, selection markers, and appropriate regulatory elements. Another embodiment involves a sequential modification approach, beginning with CRISPR-mediated knockout of CPIPs, followed by selection of lines with reduced CPIP expression, and subsequent transformation with casein expression constructs. A third embodiment utilizes tissue-specific expression strategies, combining seed-specific promoters for casein expression with constitutive promoters for CPIP reduction and targeted protein accumulation strategies.
[0137] The methods and compositions include methods for optimizing CPIP reduction levels, casein expression levels, purification conditions, processing parameters, and scale-up procedures. Various analytical methods are described for protein quantification, activity assays, structural analysis, purity assessment, and quality control procedures.
[0138] Throughout the various embodiments, optimization may focus on the reduction of CPIP expression while maintaining plant vigor, maximizing casein expression and accumulation, and improving the efficiency of downstream processing steps. The methods and compositions may be practiced in various combinations and permutations of the elements described above, and is not limited to the specific examples provided. One skilled in the art will recognize that various modifications and alternatives fall within the scope of the methods and compositions.
[0139] As used herein, CPIPs (Casein-Processing Interfering Proteins) means endogenous plant proteins that demonstrate measurable binding affinity for either casein proteins or common purification matrices used in casein isolation procedures, wherein said proteins interfere with the efficient isolation, recovery, or purification of transgenic casein. CPIPs include, but are not limited to, calcium-dependent membrane-binding proteins such as annexins (exemplified by the soybean annexin encoded by GLYMA.l 1G153800), oxidative enzymes such as lipoxygenases Docket No. 713.006.004. PCT
[0140] (exemplified by the soybean lipoxygenase 3 encoded by GLYMA.15G036300), and other proteins that form stable or transient complexes with casein or non-specifically bind to chromatographic media under standard protein purification conditions, thereby reducing the purity or yield of the isolated casein product. The defining characteristic of a CPIP is its ability to co-purify with casein or compete with casein for binding sites on purification matrices, as demonstrated by proteinprotein interaction studies, co-immunoprecipitation, affinity chromatography, or other protein binding assays known in the art.
[0141] In certain embodiments, the methods and compositions provide for sequential reduction of multiple CPIPs through iterative rounds of genetic modification. This stepwise approach allows for assessment of the contribution of individual CPIPs to purification interference and enables optimization of the reduction strategy for each target protein. For example, initial modifications may target highly abundant CPIPs such as seed storage proteins, followed by subsequent modifications targeting proteins with strong binding affinity for casein or purification matrices.
[0142] The methods and compositions further encompass combinatorial approaches to CPIP reduction and casein expression enhancement. In one embodiment, CPIP reduction is combined with overexpression of molecular chaperones or protein-folding facilitators to improve casein stability and yield. In another embodiment, the expression of protein trafficking factors is modified to optimize the subcellular localization of transgenic casein while minimizing interactions with CPIPs during protein extraction and processing.
[0143] Alternative embodiments include the development of modified purification matrices or chromatography conditions specifically designed to minimize CPIP interference. These approaches may involve surface modification of chromatography resins, development of novel ligand chemistries, or implementation of selective elution strategies that exploit differences in binding characteristics between casein and CPIPs.
[0144] The methods and compositions also provide methods for identifying and characterizing novel CPIPs through comparative proteomics approaches. In one embodiment, protein extracts from wild-type and casein-expressing plants are analyzed using quantitative proteomics to identify proteins that show altered abundance or modification states in response to casein expression. This information can be used to identify additional CPIP targets and optimize reduction strategies. Docket No. 713.006.004. PCT
[0145] Spatial separation strategies represent another embodiment of the methods and compositions. These approaches involve targeting casein accumulation to specific subcellular compartments or tissues where CPIP interference is minimized. For example, casein may be directed to protein storage vacuoles, specialized protein bodies, or specific tissue types where problematic CPIPs are naturally absent or present at reduced levels.
[0146] The methods and compositions further encompass the development of modified casein variants engineered to minimize interactions with CPIPs while maintaining desired functional properties. These modifications may include surface charge alterations, hydrophobicity modifications, or structural changes that reduce CPIP binding while preserving casein micelle formation and other important characteristics.
[0147] Alternative embodiments include the use of inducible expression systems for both casein production and CPIP reduction. These systems may employ chemical inducers, environmental triggers, or developmental cues to coordinate the timing of casein accumulation with CPIP reduction, thereby optimizing protein production and purification efficiency.
[0148] The methods and compositions also provide methods for screening and selecting plant lines with naturally reduced levels of CPIPs or variants of CPIPs with reduced interference properties. These approaches may involve analysis of germplasm collections, screening of mutagenized populations, or evaluation of tissue-specific expression patterns to identify genetic backgrounds optimal for casein production.
[0149] In certain embodiments, the methods and compositions include the development of computational models for predicting CPIP-casein interactions and optimizing reduction strategies. These models may incorporate protein structural information, binding affinity data, expression levels, and purification parameters to guide the selection of CPIP targets and design of reduction approaches.
[0150] The methods and compositions further encompass methods for stabilizing casein production across multiple generations while maintaining reduced CPIP expression. These approaches may involve careful selection of integration sites, use of insulator sequences, or implementation of selective breeding strategies to ensure stable inheritance of both the casein expression and CPIP reduction traits. Docket No. 713.006.004. PCT
[0151] In various embodiments, the methods of the methods and compositions achieve different levels of casein purity in the final product. In one embodiment, the purified transgenic casein protein comprises less than 10% by weight of contaminating plant proteins. In other embodiments, the purified transgenic casein protein comprises less than 7.5%, less than 5%, less than 4%, less than 3%, or less than 2.5% by weight of contaminating plant proteins. In more stringent embodiments, the purified transgenic casein protein comprises less than 2%, less than 1.75%, less than 1.5%, less than 1.25%, or less than 1% by weight of contaminating plant proteins. In yet more stringent embodiments, the purified transgenic casein protein comprises less than 0.75%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1% by weight of contaminating plant proteins. In particularly stringent embodiments, the purified transgenic casein protein comprises less than 0.075%, less than 0.05%, less than 0.025%, less than 0.01%, less than 0.005%, or less than 0.001% by weight of contaminating plant proteins. These purity levels can be achieved through various combinations of CPIP reduction strategies and purification methods described herein. In certain embodiments, multiple rounds of purification may be employed to achieve the highest purity levels, while in other embodiments, targeted reduction of specific CPIPs enables achievement of desired purity levels in fewer purification steps. The purity levels can be determined using standard analytical methods including, but not limited to, gel electrophoresis, HPLC analysis, mass spectrometry, or immunological detection methods. The reduction in contaminating plant proteins may be measured relative to total protein content or specifically with respect to CPIP content in the final purified product.
[0152] In various embodiments, the methods and compositions achieve different levels of enzymatic contamination in the final product, as measured by residual enzyme activity. In one embodiment, the purified transgenic casein protein comprises less than 1000 pmol of lipoxygenase activity per minute per gram of purified casein protein (U / g) when measured at 25°C using linoleic acid as substrate. In other embodiments, the purified transgenic casein protein comprises less than 500 U / g, less than 100 U / g, less than 50 U / g, less than 10 U / g, or less than 5 U / g of lipoxygenase activity. In particularly stringent embodiments, the purified transgenic casein protein comprises less than 1 U / g, less than 0.5 U / g, less than 0.1 U / g, or less than 0.01 U / g of lipoxygenase activity. Lipoxygenase activity can be measured using standard spectrophotometric assays monitoring the formation of conjugated dienes from linoleic acid substrate at 234 nm. One unit (U) of lipoxygenase activity is defined as the amount of enzyme that catalyzes the formation of 1 pmol Docket No. 713.006.004. PCT
[0153] of hydroperoxide per minute under standard assay conditions (pH 7.0, 25°C). Similar measurements can be made for other enzymatic CPIPs, such as measuring annexin activity through calcium-dependent phospholipid binding assays or membrane association studies. The reduction in enzymatic activity may be measured relative to purified casein from control plants or relative to standardized enzyme preparations. These activity levels can be achieved through various combinations of CPIP reduction strategies and purification methods described herein.
[0154] Methods and compositions are also provided for enhanced gene silencing in plants using plasmids containing multiple distinct shRNA constructs. A plasmid containing two different shRNA constructs, each targeting different genes, demonstrates unexpected synergistic effects in downregulating target gene expression. For example, when an shRNA targeting the LOX 1.3 gene is combined with an shRNA targeting the GY 1 gene in soybean, the combination achieves approximately 48% knockdown of LOX 1.3 expression, whereas neither construct alone shows significant knockdown. This synergistic effect is specific to certain shRNA combinations, as demonstrated by the lack of enhanced knockdown when the same LOX 1.3 shRNA is combined with an shRNA targeting the CG2 gene. The methods and compositions provide improved methods for gene silencing in plants through strategic combinations of distinct shRNA constructs.
[0155] The methods and compositions are directed to enhanced gene silencing in plants through strategic combinations of shRNA constructs. The methods and compositions particularly relate to plasmids containing multiple distinct shRNA sequences, each targeting different endogenous genes, which demonstrate unexpected synergistic effects in knockdown efficiency.
[0156] The methods and compositions employ carefully designed plasmids containing two or more distinct shRNA sequences, with each sequence targeting different endogenous genes. Each shRNA construct comprises a sense strand sequence, an intron sequence, and an antisense strand sequence, forming a hairpin loop structure capable of inducing RNA interference in transformed plant cells.
[0157] Initial validation experiments were conducted in soybean using several plasmid designs. A control plasmid, pMOZ3418, containing shRNA targeting only the LOX 1.3 gene, demonstrated negligible knockdown when used alone, serving as a baseline for comparison. In contrast, a dualtarget plasmid (pMOZ3321) containing shRNA sequences targeting both LOX 1.3 and GY 1 genes Docket No. 713.006.004. PCT
[0158] demonstrated a remarkable and unexpected synergistic effect, achieving 48% knockdown of LOX 1.3 expression. This represented a significant improvement over the single-target approach.
[0159] To further investigate the specificity of this synergistic effect, another dual-target plasmid (pMOZ3322) was constructed containing shRNA sequences targeting both LOX 1.3 and CG2 genes. Notably, this combination showed no significant knockdown of LOX 1.3 expression, despite using identical LOX 1.3 targeting sequences. This differential response demonstrates that the enhancement of knockdown efficiency is not simply additive but depends on specific gene target combinations.
[0160] The plasmids were designed to ensure stable expression of shRNA constructs, efficient processing of hairpin structures, and minimal interference between multiple targeting sequences. Careful consideration was given to promoter selection for sustained expression. The constructs were delivered into soybean cells using Agrobacterium-mediated transformation following standard protocols for soybean cell transformation. Expression analysis was conducted using RT-qPCR quantification of target mRNA levels, with results compared against appropriate control samples.
[0161] Vector design incorporated optimal parameters for sense and antisense sequences, strategic placement of intron sequences, and verification of proper hairpin loop formation. The promoter selection and overall vector architecture were optimized to ensure stable integration and expression in plant cells. This careful attention to vector design parameters proved crucial for achieving the observed synergistic effects in gene silencing.
[0162] The observed enhancement of knockdown efficiency when combining specific shRNA targets represents a significant advancement in plant biotechnology. This discovery not only provides a more effective method for gene silencing but also suggests new possibilities for optimizing protein expression in plant systems through strategic manipulation of multiple endogenous genes. The specificity of the synergistic effect, as demonstrated by the differential results between different shRNA combinations, opens new avenues for fine-tuned control of gene expression in plant biotechnology applications.
[0163] Certain aspects of the disclosure have other steps or elements in addition to or in place of those mentioned above. The steps or elements will become apparent to those skilled in the art from a Docket No. 713.006.004. PCT
[0164] reading of the following detailed description when taken with reference to the accompanying drawings.
[0165] While some embodiments of the methods and compositions have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the methods and compositions. It should be understood that various alternatives to the embodiments of the methods and compositions described herein may be employed in practicing the methods and compositions. It is intended that the following claims define the scope of the methods and compositions and that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0166] The following embodiments are described in sufficient detail to enable those skilled in the art to make and use the methods and compositions. It is to be understood that other embodiments would be evident based on the present disclosure, and that system, process, or mechanical changes can be made without departing from the scope of an embodiment of the present disclosure.
[0167] In the following description, numerous specific details are given to provide a thorough understanding of the methods and compositions. However, it will be apparent that the methods and compositions can be practiced without these specific details. In order to avoid obscuring an embodiment of the present disclosure, some well-known techniques, system configurations, and process steps are not disclosed in detail. Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure.
[0168] In the compositions herein, nucleotide sequences can be obtained, isolated, and codon optimized, which are at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID Docket No. 713.006.004. PCT
[0169] NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, and SEQ ID NO: 41.
[0170] In the compositions herein, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39 each contain functional short hairpin RNA (shRNA) for targeting one or more genes selected from GY1, GY4, CG2, and LOX1.3, thereby modifying expression levels of the gene products from encoding GY1, GY4, CG2, and LOX 1.3.
[0171] In the compositions herein, SEQ ID NO: 40 and SEQ ID NO: 41 contains non -functional short hairpin (shRNA) for targeting one or more genes selected from GY1, GY4, CG2, and LOX1.3, thereby being insufficient in modifying expression levels of the gene products from encoding GY1, GY4, CG2, and LOX1.3
[0172] In the compositions herein, sense, intron, and antisense sequences shRNA are designed to target one endogenous gene in soybean, thereby providing different levels of knockdown, based on the polynucleotide sequences in a plasmid cassette. When used individually or in combination with other shRNA sequences, the efficiency of RNA interference is observably varied and shRNA is targeting one or more endogenous soybean genes, thereby modifying expression levels of gene products from encoding the one or more soybean genes, wherein the genes are selected from GY1, GY4, CG2, and LOX1.3.
[0173] In the compositions herein, the plasmid cassettes, based on: (i) size of shRNA and (ii) sense, intron, and antisense sequences shRNA functionality in targeting the one or more soybean genes selected from GY1, GY4, CG2, and LOX1.3, are: (i) L0 plasmids; (ii) scrambled control plasmids, with 90 base pairs; (iii) different multi shRNA plasmids; (iv) scrambled control plasmids, with 200 or 300 Docket No. 713.006.004. PCT
[0174] base pairs; (v) GY1 plasmids; (vi) CG2 plasmids; and (vii) L0X1.3 plasmids. The qPCR tag primers in the plasmid cassettes are noted in Table 1.
[0175] Table 1: qPCR tag primers
[0176] Label Attached Target Forward Reverse
[0177] used Gene Sequence primer primer
[0178] 1 GY1 RNAi 206 207
[0179] tag 1
[0180] 2 RNAi 49 52
[0181] tag 2
[0182] 3 CG2 RNAi 120 119
[0183] tag 3
[0184] 4 GFP RNAi 210 213
[0185] tag 4
[0186] 5 GY4 RNAi 75 215
[0187] tag 5
[0188] 6 L0X3 RNAi 71 74
[0189] tag 6
[0190] 7 RNAi GFP F GFP R
[0191] tag 7
[0192]
[0193] In the compositions herein, LO plasmids have shRNA targeting multiple genes selected from GY1, GY4, CG2, and LOX1.3; wherein the sense sequence of shRNA for targeting GY1 is SEQ ID NO: 1, the antisense sequence of shRNA for targeting GY1 is SEQ ID NO: 2, the sense sequence of shRNA for targeting CG2 is SEQ ID NO: 3, the antisense sequence of shRNA for targeting CG2 is SEQ ID NO: 4; the sense sequence of shRNA for targeting L0X1.3 is SEQ ID NO: 5, and the antisense sequence of shRNA for targeting L0X1.3 is SEQ ID NO: 6.
[0194] Table 2: LO Plasmid
[0195] Gene targets and size of base pairs in
[0196] Plasmid No. shRNA
[0197] 3273 GY1-100 CG2-100 LOX3-100 shRNA
[0198]
[0199] Docket No. 713.006.004. PCT
[0200] 3272 GY1-100 CG2-100 GY4-100 shRNA
[0201] 3271 GY1-100 GY4-100 shRNA
[0202] 3270 CG2-100 LOX3-100 shRNA
[0203] 3269 GY1-100 LOX3-100 shRNA
[0204] 3268 GY1-150 CG2-150 shRNA
[0205] 3267 CG2-100 GY1-100 shRNA
[0206] 3266 GY1-100 CG2-100 shRNA
[0207]
[0208] In the compositions herein, scrambled control plasmids, with 90 base pairs, have no shRNA. Table 3: scrambled control plasmids, with 90 base pairs
[0209] Plasmid Number of
[0210] No. base pairs
[0211] 3337 12209 [L2] scramble control GY1+CG2+LOX1.3
[0212] 3336 11614 [L2] scramble control GY1+CG2+GY4
[0213] 3335 8937 [L2] scramble control GY1+GY4
[0214] 3334 11145 [L2] scramble control CG2+LOX 1.3
[0215] 3333 9532 [L2] scramble control GY1+LOX1.3
[0216] 3332 10592 [L2] scramble control GY1+CG2
[0217]
[0218] In the compositions herein, the different multi shRNA plasmids have shRNA targeting multiple genes selected from GY 1, GY4, CG2, and LOX1.3, which have the structure of a GFP containing tag, as denoted in parenthesis in Table 4, which is appended to two or more gene targets and size of base pairs in shRNA, as denoted in braces in Table 4, which is appended to two or more gene target tags in parenthesis in Table 4. In Plasmid No. 3321, the sense, intron, and antisense Docket No. 713.006.004. PCT
[0219] sequences of shRNA for targeting GY1 and L0X1.3 is SEQ ID NO: 7. In Plasmid No. 3322, the sense, intron, and antisense sequences of shRNA for targeting CG2 and L0X1.3 is SEQ ID NO: 8. In Plasmid No. 3325, the sense, intron, antisense sequences of shRNA for targeting GY1, CG2 and L0X1.3 is SEQ ID NO: 9.
[0220] Table 4: different multi shRNA plasmids
[0221] Number
[0222] PLASMID of base (GFP tag) {Gene targets and size of base pairs in shRNA} (gene target NO. pairs tags)
[0223] 3326 10798 ([L2] GFP tag4) {GY1-100 CG2-100 shRNA} (GY1 tagl CG2 tag3) ([L2] GFP tag4) {GY1-100 CG2-100 LOX3-100 shRNA} (GY1 tagl 3325 12615 CG2 tag3 LOX3 tag6)
[0224] ([L2] GFP tag4) {GY1-100 CG2-100 GY4-100 shRNA} (GY1 tagl 3324 12020 CG2 tag3 GY4 tag5)
[0225] 3323 9143 ([L2] GFP tag4) {GY1-100 GY4-100 shRNA} (GY1 tagl GY4 tag5) ([L2] GFP tag4) {CG2-100 LOX3-100 shRNA} (CG2 tag3 LOX3 3322 11351 tag6)
[0226] ([L2] GFP tag4) {GY1-100 LOX3-100 shRNA} (GY1 tagl LOX3 3321 9738 tag6)
[0227] 3320 10998 ([L2] GFP tag4) {GY1-150 CG2-150 shRNA} (GY1 tagl CG2 tag3) 3319 10798 ([L2] GFP tag4) {CG2-100 GY1-100 shRNA} (GY1 tagl CG2 tag3)
[0228]
[0229] In the compositions herein, scrambled control plasmids, with 90 base pairs, have no shRNA.
[0230] Table 5: scrambled control plasmids, with 90 base pairs
[0231] Number
[0232] Plasmid of base
[0233] No. pairs
[0234] 3413 12615 [L2] 300bp scramble control GY1+CG2+LOX1.3
[0235]
[0236] Docket No. 713.006.004. PCT
[0237] 3412 12020 [L2] 300bp scramble control GY1+CG2+GY4
[0238] 3411 9143 [L2] 200bp scramble control GY1+GY4
[0239] 3410 11351 [L2] 200bp scramble control CG2+LOX1.3
[0240] 3409 9738 [L2] 200bp scramble control GY1+LOX1.3
[0241] 3408 10798 [L2] 200bp scramble control GY1+CG2
[0242] 3432 10998 [L2] 300bp scramble control GY1+CG2
[0243]
[0244] In the compositions herein, the expression levels of gene products from encoding GY1, GY4, CG2, and L0X1.3 are modified, when Plasmid No. 3319, 3320, 3321, 3322, 3323, 3324, 3325, and 3326, which each contain functional shRNA, are inserted into a plant cell, to target GY1, GY4, CG2, and LOX1.3 as: Group 1 (GY1, CG2), where Plasmid No. 3319 and 3320 contain functional shRNA which target each gene in Group 1, and the control is Plasmid No. 3332; Group 2 (GY1, LOX1.3), where Plasmid No. 3321 contains functional shRNA which targets each gene in Group 2, and the control is Plasmid No. 3333; Group 3 (CG2, LOX1.3), where Plasmid No. 3322 contains functional shRNA which targets each gene in Group 3, and the control is Plasmid No. 3334; Group 4 (GY1, GY4), where Plasmid No. 3323 contains functional shRNA which targets each gene in Group 4, and the control is Plasmid No. 3335; Group 5 (GY1, CG2, GY4) where Plasmid No.
[0245] 3324 contains functional shRNA which targets each gene in Group 5, and the control is Plasmid No. 3336; and Group 6 (GY1, CG2, LOX1) where Plasmid No. 3325 contains functional shRNA which targets each gene in Group 6, and the control is Plasmid No. 3337.
[0246] In the compositions herein, Plasmid No. 3333 and 3334, each contain SEQ ID NO: 41, which has non-functional shRNA is targeting genes in Group 1, Group 2, Group 3, Group 4, Group 5, and / or Group 6; Plasmid No. 3321 contains SEQ ID NO: 7, which has functional shRNA is targeting GY1 and LOX1.3, thereby modifying expression of levels of gene products from encoding GY1 and LOX1.3; Plasmid No. 3322 contains SEQ ID NO: 8, which has functional shRNA is targeting CG2 and LOX1.3, thereby modifying expression of levels of gene products from encoding CG2 and LOX1.3; and Plasmid No. 3325 contains SEQ ID NO: 9, which has functional shRNA is targeting GY1, CG2, and LOX1.3, thereby modifying expression of levels of gene products from Docket No. 713.006.004. PCT
[0247] encoding GY1, CG2, and L0X1.3. The level of gene expression was calculated by RT-qPCR (see Fig. 2, Fig. 3, Fig. 4, Fig. 5, Fig. 6, and Fig. 7). Unexpectedly, a shRNA sequence designed to target a specific gene, LOX 1.3 gene (see Fig. 8), can provide a completely different knockdown efficiency, when combined with two different shRNA gene sequences. When shRNA was designed for GY1 and LOX 1.3 target genes, SEQ ID NO: 7 provided an efficiency knockdown of the LOX 1.3 target of almost 50%. When shRNA was designed for LOX1.3 and CG2, SEQ ID NO: 8 provided an efficiency of knockdown of the LOX1. 3 target of almost 0%. To emphasize the surprise, the sequence for LOX 1.3 shRNA is the same in both Plasmid No. 3321 and 3322.
[0248] In the compositions herein, Plasmid No. 3168 - 3174 of GY1 plasmids have shRNA targeting multiple genes selected from GY1, GY4, CG2, and LOX1.3. which have the structure of a GFP containing tag, as denoted in parenthesis in Table 6, which is appended to a GY1 gene targets and size of base pairs in shRNA, as denoted in braces in Table 6, which is appended to a GY1 gene target tag in parenthesis in Table 6. In Plasmid No. 3168, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 10 and SEQ ID NO: 11, respectively, which are each 180 base pairs. In Plasmid No. 3169, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 12 and SEQ ID NO: 13, respectively, which are each 120 base pairs. In Plasmid No. 3170, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 14 and SEQ ID NO: 15, respectively, which are each 90 base pairs. In Plasmid No. 3171, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 16 and SEQ ID NO: 17, respectively, which are each 90 base pairs. In Plasmid No. 3172, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 18 and SEQ ID NO: 19, respectively, which are each 60 base pairs. In Plasmid No. 3173, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 20 and SEQ ID NO: 21, respectively, which are each 60 base pairs. In Plasmid No. 3174, the sense and antisense sequences of shRNA for targeting GY1 are SEQ ID NO: 22 and SEQ ID NO: 23, respectively, which are each 60 base pairs. Plasmid No. 3196 in Table 6 is the control, which contains SEQ ID NO: 40. As shown in Fig. 8, the 60 bp shRNA (Plasmid No. 3172. 3173, and 3174), works as effectively as 180 bp shRNA (Plasmid No. 3168), with respect to knockdown of GY 1.
[0249] Table 6: GY1 plasmids Docket No. 713.006.004. PCT
[0250] PLASMID NO. (GFP containing tag) { GY 1 gene target and
[0251] size of base pairs in shRNA} (GY1 target tag)
[0252] 3196
[0253] (CONTROL = GmFLC ([L2] GFP tag4) GmFLC B scrambled shRNA
[0254] B scrambled shRNA) (GY1 tagl)
[0255] 3174 ([L2] GFP tag4) {GY1 shRNA 60bp (C)}
[0256] (GY1 tagl)
[0257] 3173 ([L2] GFP tag4) {GY1 shRNA 60bp (B)}
[0258] (GY1 tagl)
[0259] 3172 ([L2] GFP tag4) {GY1 shRNA 60bp (A)}
[0260] (GY1 tagl)
[0261] 3171 ([L2] GFP tag4) {GY1 shRNA 90bp (B)}
[0262] (GY1 tagl)
[0263] 3170 ([L2] GFP tag4) {GY1 shRNA 90bp (A)}
[0264] (GY1 tagl)
[0265] 3169 ([L2] GFPtag4) {GY1 shRNA 120bp} (GY1
[0266] tagl)
[0267] 3168 ([L2] GFPtag4) {GY1 shRNA 180bp} (GY1
[0268] tagl)
[0269]
[0270] In the compositions herein, Plasmid No. 3414 - 3417 of CG2 plasmids have shRNA targeting multiple genes selected from GY1, GY4, CG2, and L0X1.3. which have the structure of a GFP containing tag, as denoted in parenthesis in Table 7, which is appended to a CG2 gene target and size of base pairs in shRNA, as denoted in braces in Table 7, which is appended to a CG2 gene target tag in parenthesis in Table 7. In Plasmid No. 3414, the sense and antisense sequences of shRNA for targeting CG2 are SEQ ID NO: 24 and SEQ ID NO: 25, respectively, which are each 150 base pairs. In Plasmid No. 3415, the sense and antisense sequences of shRNA for targeting CG2 are SEQ ID NO: 26 and SEQ ID NO: 27, respectively, which are each 60 base pairs. In Plasmid No. 3416, the sense and antisense sequences of shRNA for targeting CG2 are SEQ ID NO: 28 and SEQ ID NO: 29, respectively, which are each 60 base pairs. In Plasmid No. 3417, the Docket No. 713.006.004. PCT
[0271] sense and antisense sequences of shRNA for targeting CG2 are SEQ ID NO: 30 and SEQ ID NO: 31, respectively, which are each 60 base pairs. Plasmid No. 3430 in Table 7 is the control, which contains SEQ ID NO: 40.
[0272] Table 7: CG2 plasmids
[0273] PLASMID NO. (GFP containing tag) {CG2 gene target and size of base pairs in shRNA} (CG2 target tag)
[0274] 3430 (CONTROL =
[0275] GmFLC B scrambled
[0276] shRNA) ([L2] GFP tag4) GmFLC B scrambled shRNA (CG2 tag3)
[0277] 3417
[0278] ([L2] GFP tag4) {CG2 shRNA 60bp (C)} (CG2 tag3)
[0279] 3416
[0280] ([L2] GFP tag4) {CG2 shRNA 60bp (B)} (CG2 tag3)
[0281] 3415
[0282] ([L2] GFP tag4) {CG2 shRNA 60bp (A)} (CG2 tag3)
[0283] 3414
[0284] ([L2] GFP tag4) {CG2 shRNA 150bp} (CG2 tag3)
[0285]
[0286] In the compositions herein, Plasmid No. 3418 - 3421 of CG2 plasmids have shRNA targeting multiple genes selected from GY1, GY4, CG2, and LOX1.3. which have the structure of a GFP containing tag, as denoted in parenthesis in Table 8, which is appended to a LOX1.3 gene target and size of base pairs in shRNA, as denoted in braces in Table 8, which is appended to a LOX3 (orLOX1.3) gene target tag in parenthesis in Table 8. In Plasmid No. 3418, the sense and antisense sequences of shRNA for targeting LOX1.3 are SEQ ID NO: 32 and SEQ ID NO: 33, respectively, which are each 150 base pairs. In Plasmid No. 3419, the sense and antisense sequences of shRNA for targeting LOX1.3 are SEQ ID NO: 34 and SEQ ID NO: 35, respectively, which are each 60 base pairs. In Plasmid No. 3420, the sense and antisense sequences of shRNA for targeting LOX1.3 are SEQ ID NO: 36 and SEQ ID NO: 37, respectively, which are each 60 base pairs. Plasmid No.
[0287] 3421, the sense and antisense sequences of shRNA for targeting LOX1.3 are SEQ ID NO: 38 and Docket No. 713.006.004. PCT
[0288] SEQ ID NO: 39, respectively, which are each 60 base pairs. Plasmid No. 3431 in Table 7 is the control, which contains SEQ ID NO: 40. Based on the expression levels of gene products, such as lipoxygenase, when encoding for the LOX1.3 gene, the shRNA in Plasmid No. 3418, 3419, or 3431 is not knocking down the LOX1.3 gene. While low transformation efficiency could have been a factor, Plasmid No. 3325 has the sense, intron, antisense sequences of shRNA for targeting GY1, CG2, and LOX1.3 as SEQ ID NO: 9.
[0289] Table 8: LOX1.3
[0290] PLASMID NO.
[0291] (GFP containing tag) {LOX1.3 gene target and size of base pairs in shRNA} (LOX 1.3 target tag)
[0292] 3431
[0293] (CONTROL =
[0294] GmFLC B
[0295] scrambled
[0296] shRNA) [L2] GFP tag4 GmFLC B scrambled shRNA (LOX3 tag6 )
[0297] 3421
[0298] ([L2] GFP tag4) {LOX3 shRNA 60bp (C)} (LOX3 tag6) 3420
[0299] ([L2] GFP tag4) {LOX3 shRNA 60bp (B)} (LOX3 tag6) 3419
[0300] ([L2] GFP tag4) {LOX3 shRNA 60bp (A)} (LOX3 tag6) 3418
[0301] ([L2] GFP tag4) {LOX3 shRNA 150bp }(LOX3 tag6)
[0302]
[0303] In the compositions herein, the incorporation of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID Docket No. 713.006.004. PCT
[0304] NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the plant genome can lead to an integration of an aforementioned nucleotide sequence (i.e., one of SEQ ID NO: 1 - SEQ ID NO: 39) into the plant genome. SEQ ID NO: 1 - SEQ ID NO: 39 each contain functional short hairpin RNA (shRNA) for targeting one or more genes selected from GY1, GY4, CG2, and L0X1.3, can modify expression levels of the gene products from encoding GY1, GY4, CG2, and L0X1.3 into a plant cell.
[0305] Stated another way, integration of Y (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39) into the plant genome via a corresponding inserted plasmid can lead to expression of casein proteins in the plant cell. The expressed casein proteins reside within micelles (i.e., a colloid containing dispersed particles that are insoluble in a liquid phase medium which be modulated into a supramolecular assembly containing non-covalent interactions between the dispersed particles and liquid phase); and wherein the plant cell is: (i) an in vitro environment; or (ii) within the seeds, leaf, stems, roots, or other parts of the plant, such as a soybean plant. Plasmids containing X (SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 42) can lead to expression of casein in a plant, when X from a corresponding plasmid is integrated into the plant genome. However, knockdown of two or more gene targets is not observed, when said plasmid comprises X, wherein X does not contain functional shRNA. Plasmids containing Y (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39) can lead to expression of casein in a plant, when Y from a corresponding plasmid is integrated into the plant genome. Docket No. 713.006.004. PCT
[0306] However, knockdown of two or more gene targets, which leads to increased expression levels of casein, can be observed, when said plasmid comprises Y, wherein Y does contain functional shRNA.
[0307] In the compositions herein, the expressed casein protein and calcium phosphate can be the dispersed particles in liquid-state water in the micelle that forms in the plant cells. Prior to the integration of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the genome of the plant cell, the plant cells are absent of the capability of expressing casein protein, whereas the integration of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the genome of the plant cell, the micelle can form in the plant cell, wherein the micelle contains casein proteins.
[0308] In the compositions herein, a plasmid, vector, Gblock, or other type of delivery vehicle, with optional excipient components (e.g., encapsulation, micelles, emulsions, or liquid phase solutions) can provide a structural framework for delivering SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, Docket No. 713.006.004. PCT
[0309] SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the plant cell, which modifies properties of the plant cell, thereby incorporating SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the plant cell. The structural framework can be a cargo system that releases SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, into the plant cell, via: (i) physical changes (e.g., dissolution of an emulsion); (ii) biochemical conversions e.g., transcription of circular DNA molecule); or (iii) chemical reactions (e.g., formation of peptide bonds, cleavage of peptide bonds, organo-catalysis, and transition metal mediated processes). When released from the structural framework, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, can be inserted into the plant cell to modify properties of the plant cell, such as: increasing expression levels of casein; forming micelles which contain: (i) the casein and (ii) other gene products that have been expressed via encoding of a gene. However, these other gene products, such as expression levels of lipoxygenase is modified, and Docket No. 713.006.004. PCT
[0310] more particularly the expression level of lipoxygenase can be reduced by up to 50%, when: LOX1.3, CG2, and GY1 are targeted by SEQ ID NO: 9, LOX1.3 and CG2 are targeted by SEQ ID NO: 8, and LOX1.3 and GY1 are targeted by SEQ ID NO: 7.
[0311] One of the other gene products is lipoxygenase, such as LOX1.3, which is expressed when encoding for the LOX1.3 gene. Lipoxygenase can catalyze the formation of reaction oxygen species that lead to oxidation degradation products (e g., oxidation of unsaturated fatty acids) associated with rancid notes and bleaching effects in cheese and other food compositions. Other gene products can be Glycinin, which is the major seed storage protein of soybean, that results from encoding the GY1 gene; and a transmembrane protein, which is about 330 kDa, that results from encoding the CG2 gene. SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 can contact or interact two or more genes selected from LOX1.3, GY1, and CG2, where the presence of multiple genes can change the functional efficiency of the functional shRNA in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9. A shRNA unit in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 may be preferred in a complex that may form, when SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 targets two or more genes selected from LOX1.3, GY1, and CG2, while another shRNA acts as a supporter.
[0312] In the compositions herein, knockdown of a gene, such as LOX1.3, GY1, and CG2, can be an experimental technique that reduces expression of LOX1.3, GY1, and CG2 in a plant, yeast, or bacterium. The reduction in expression of the one or more genes, such as annexin or LOX3, can occur either through genetic modification or by treatment with a reagent, such as a circular DNA, short DNA, or RNA oligonucleotide, wherein the circular DNA, short DNA, or RNA oligonucleotide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, that has a sequence complementary to either gene or an mRNA transcript. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, Docket No. 713.006.004. PCT
[0313] SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39 can be stably integrated into the genome of the organism, in which SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39is inserted into.
[0314] In the compositions herein, knockdown can be an experimental technique used for silencing genes. The silencing of the genes can also be achieved by CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) techniques, such as: CRISPR interference (CRISPRi), which is a dead Cas9 nuclease (dCas9) and single-guide RNA (sgRNA) to block RNA polymerase and inhibit gene transcription; DNA double strand break (DSB) repair, which can directly silence genes by inserting or deleting a few nucleotides, which are then repaired by non-homologous end join (EHEJ); CRISPR / Cas genome editing, which can replace undesirable genes or overexpress genes using a DNA donor and homologue-directed repair (HDR); and translational repression (CR1SPR5), which can silence genes through translational repression, that is independent of RNA degradation.
[0315] In the compositions, silencing genes can be achieved via other experimental techniques, other than knockdown of genes or CRISPR, such as: virus-induced gene silencing (VIGS), which can carry a gene fragment of the target gene, such as viral vectors like tobacco rattle virus (TRV); antisense oligonucleotide therapy, which uses antisense RNA to bind to mRNA and to prevent translation into proteins that cause diseases; genomic imprinting, which silences a gene inherited from either parent; and RNA-directed DNA methylation, which can be an epigenetic gene silencing Docket No. 713.006.004. PCT
[0316] phenomenon that uses siRNAs to transactivate RISC, wherein RISC regulates gene silencing through homologous DNA methylation.
[0317] In the compositions herein, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, contains functional short hairpin RNA (shRNA). While a shRNA sequence is designed to target a specific gene, LOX 1.3 gene provide a completely different knockdown efficiency when combined with two different shRNA gene sequences. When shRNA was designed for GY1 and LOX 1.3 target genes it provided approximately 50% knockdown of LOX 1.3 target. On the other hand, when used with CG2 the efficiency of knockdown was almost 0%. To emphasize the surprise, the sequence for LOX 1.3 shRNA was the same in Plasmid No. 3321 and 3322.
[0318] In the compositions herein, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39, can be used as vehicles that insert into a genome, leading to transformation of a plant. This leads to recombination casein formation, followed by post-translational modification and in vivo formation of micelles containing the caseins. There is an inner matrix and outer matrix of the micelle, wherein the outer matrix is enriched in kappa casein and the inner matrix contains calcium and phosphate ions (see Fig. 1), such that the outer and inner matrices are contained within fatty acid / lipid microstructure. Exclusive formation of casein, phosphate, and calcium in a micelle is not feasible, as there are proteins present besides caseins. Docket No. 713.006.004. PCT
[0319] In the compositions herein, responsive to performing knockdown of said genes for encoding for annexin, the plants transfected with a polynucleotide selected from SEQ ID NO: 1 - SEQ ID NO: 39 (i.e., the integration of a polynucleotide of SEQ ID NO: 1 - SEQ ID NO: 39 into the plant) can exhibit: (i) modified expression levels of gene products in the plant, via (ii) a multi-gene targeting approach, along with (iii) increased expression levels of casein proteins in the plant, wherein the casein proteins can be: (a) Sl-alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) Sl-alpha casein and beta casein; (f) Sl-alpha casein and S2-alpha casein; (g) Sl-alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) Sl-alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) Sl-alpha casein, S2-alpha casein, and kappa casein; (n) Sl-alpha casein, S2-alpha casein, and beta casein; and (o) Sl-alpha casein, S2-alpha casein, beta casein, and kappa casein.
[0320] In the compositions herein, responsive to performing knockdown of said genes for encoding for L0X1.3, the plants transfected with SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 (i.e., the integration of SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9 into the plant) can exhibit: (i) de-metalation of iron from L0X1.3 in the plant, which prevents the formation of reactive oxygen species, such as ferric superoxide, that lead to lipid oxidation of unsaturated fatty acids associated with rancid notes and bleaching effects, along with (ii) increased expression levels of casein proteins in the plant, wherein the casein proteins can be: (a) Sl-alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) Sl-alpha casein and beta casein; (f) Sl-alpha casein and S2-alpha casein; (g) Sl-alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) Sl-alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) Sl-alpha casein, S2-alpha casein, and kappa casein; (n) Sl-alpha casein, S2-alpha casein, and beta casein; and (o) Sl-alpha casein, S2-alpha casein, beta casein, and kappa casein.
[0321] In the compositions herein, shRNA, as contained in SEQ ID NO: 1 - SEQ ID NO: 39, can be an artificial RNA molecule with a tight hairpin turn for silencing target gene expression of L0X1.3, GY1, and / or CG2, via an RNA interference. The shRNA can be expressed by a vector or plasmid inserted into a plant cell, thereby transfecting the plant cell with SEQ ID NO: 1, which can lead to Docket No. 713.006.004. PCT
[0322] the suppression of lipoxygenase expression (L0X1.3), while: (i) modifying levels of expression of GY1 and / or CG2; and (ii) increasing expression levels of casein in the micelle, in the plant cell.
[0323] In the compositions herein, micelles can form when inserting a nucleotide sequence of SEQ ID NO: 1 - SEQ ID NO: 39, into a plant or a plant cell, in the presence of seed specific promoters, such that pathways associated with genes regulating phospholipid binding or facilitating lipid oxidation in the seed, respectively, are suppressed, thereby increasing purity levels of casein, which is contained in the formed micelles. The micelles can reside exclusively / solely within the seed, where pathways facilitating lipid oxidation are suppressed, while modifying expression levels of GY1 and / or CG2, and increasing expression of caseins, wherein the micelles encapsulate the casein.
[0324] In the compositions herein, the micelles, which form in the seed, when inserting a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 41, into a plant or a plant cell, in the presence of seed specific promoters, such that pathways associated with genes facilitating lipid oxidation in the seed are suppressed, while modifying expression levels of GY1 and / or CG2 can be modulated and isolated more readily than the micelles, which form in other parts of the plants containing suppressed pathways associated with genes facilitating lipid oxidation in the seed are suppressed, while modifying expression levels of GY1 and / or CG2. The micelle containing caseins in the seeds have an encapsulating layer that can protect the caseins from degradation, while being dislodged from the seeds. This leads to a composition containing: seed tissue, casein in the micelle, suppressed pathways associated with genes facilitating lipid oxidation, wherein said pathways reside solely in the seed tissue, and a genome integrated with a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 41. SEQ ID NO: 1 - SEQ ID NO: 39 each contain functional shRNA for targeting genes that encode for L0X1.3, thereby performing a knockdown of the L0X1.3, thereby reducing expression levels of L0X1.3, while also modifying expression levels of GY1 and / or CG2, via a multi-gene targeting mechanism. SEQ ID NO: 40 and SEQ ID NO. 41 contain nonfunctional shRNA, which cannot target gene, via a multi -gene target mechanism
[0325] In the compositions herein, knockdown of two or more genes selected from LOX1.3, GY1, and CG2, in a plant, one or more plant cells, or soybean one or more seeds by a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39 can suppress pathways associated with genes facilitating lipid oxidation in the seed, while also modifying expression levels of GY 1 and / or CG2, Docket No. 713.006.004. PCT
[0326] via a multi-gene targeting mechanism, within said plant, said one or more plant cells, or said one or more seeds. Casein, which is contained in the formed micelles, can be expressed in said plant, said one or more plant cells, or said one or more seeds. The micelles can reside exclusively / solely within the seed, where the pathways associated with genes regulating phospholipid binding or facilitating lipid oxidation are suppressed, wherein the micelles encapsulate the casein in said plant, said one or more plant cells, or said one or more seeds, wherein said plant, said one or more plant cells, or said one or more seeds are soybean.
[0327] In the compositions herein, a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39 can target two or more genes selected from L0X1.3, GY1, and CG2, in, for example, soybean seeds, during knockdown, which suppresses lipid oxidation specifically within the soybean seeds, while also modifying expression levels of GY1 and / or CG2, via a multi -gene targeting mechanism. The lipid oxidation in the soybean seed can be suppressed, during knockdown, by the application of one or more of the following promoters specific to soybean, into the tissue of soybean seeds: PfFAD3-l, Glycinin, and Lei, which are driven by seed specific native or synthetic elements of soybean seeds, not in the soybean plant. A nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39 can target two or more genes selected from L0X1.3, GY1, and CG2, in the presence of the promoters comprising one or more of PfFAD3-l; Glycinin; and Lei, indicating that the production of alpha-Linolenic acid; the inductive effects of asparagine, proline, and glutamine; and production of lectin, respectively, do not impede a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39 can target two or more genes selected from L0X1.3, GY1, and CG2.
[0328] In the compositions herein, a nucleotide sequence selected from SEQ ID NO: 1 - SEQ ID NO: 39 can increase the expression of egg white ovalbumin (Gallus gallus'), in addition to the increased expression of caseins and increased purity level of caseins, via the suppression of or lipid oxidation, when targeting two or more genes selected from L0X1.3, GY1, and CG2, in, for example, a plant cell. When genes encoding for L0X1.3, GY1, and / or CG2 are silenced, a signal can be sent to the expression cassettes for encoding egg white ovalbumin, disclosed in United States Patent Application No. 18 / 202,098, filed on May 25, 2023, which is hereby incorporated in its entirety, wherein the expression cassettes are inserted into the plant cell, and thereby integrated DocketNo. 713.006.004. PCT
[0329] into the genome of the plant cell. The signal sent to the expression cassettes for encoding egg white ovalbumin can trigger the production of egg white ovalbumin in the plant cell.
[0330] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 can be nucleic acids that do not comprise at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, or at least 46 of the sequences selected from the group consisting of GGTACC, ACCGGT, GGGCCC, GTGCAC, GGCGCGCC, GGTACC, CCTAGG, GGATCC, AGATCT, CACGTC, ATCGAT, TTCGAA, ATCGAT, CGGCCG, GAGCTC, GAATTC, GATATC, AAGCTT, GTTAAC, GGTACC, ACGCGT, CCATGG, CATATG, GCTAGC, GCGGCCGC, ATGCAT, TTAATTAA, CTCGAG, GGGCCC, CTGCAG, CGATCG, CAGCTG, GAGCTC, CCGCGG, GTCGAC, CCCGGG, TACGTA, ACTAGT, GCATGC, CTCGAG, CCCGGG, TCTAGA, CTCGAG, CCCGGG, GGTCTC and GAAGAC.
[0331] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 can be used, and therefore comprised within a food composition, such as a dairy product, which contains one or more plant molecules selected from a plant protein, sugar, or deoxyribonucleic acid.
[0332] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 used for the knockdown of two or more genes selected from LOX1.3, GY1, and CG2, via multi-gene targeting, thereby increasing expression of caseins, and increasing the purity level of caseins in the micelles, wherein the caseins comprise one or more of: Sl-alpha casein, S2-alpha casein, beta casein, and kappa casein and wherein said caseins can be bovine, buffalo, goat, sheep and camels, yaks, horses, reindeer, and donkey proteins.
[0333] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 used for the knockdown of two or more genes selected from LOX1.3, GY1, and CG2, via multi-gene targeting, thereby increasing expression of caseins, and increasing the purity level of caseins in the micelles, wherein the caseins can be free of, essentially free of, or not comprise a detectable amount of: a-lactalbumin or 0- Docket No. 713.006.004. PCT
[0334] lactoglobulin; free of lactoferrin; free of transferrin; free of serum album; free of lysozyme; free of lactoperoxidase; free of immunoglobulin-A; and / or free of lipase.
[0335] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by one or more restriction enzymes. For example, the nucleotide sequences provided herein do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by one or more the following restriction digestion enzymes: Acc65I (GGTACC), Agel (ACCGGT), Apal (GGGCCC), ApaLI (GTGCAC), Asci (GGCGCGCC), Asp718I (GGTACC), Avril (CCTAGG), BamHI (GGATCC), Bglll (AGATCT), BmgBI (CACGTC), BspDI (ATCGAT), BstBI (TTCGAA), Clal (ATCGAT), EagI (CGGCCG), Ecl 13611 (GAGCTC), EcoRI (GAATTC), EcoRV (GATATC), Hindlll (AAGCTT), Hpal (GTTAAC), Kpnl (GGTACC), Mlul (ACGCGT), Ncol (CCATGG), Ndel (CATATG), Nhel (GCTAGC), Notl (GCGGCCGC), Nsil (ATGCAT), PacI (TTAATTAA), PaeR7I (CTCGAG), PspOMI (GGGCCC), PstI (CTGCAG), Pvul (CGATCG), PvuII (CAGCTG), SacI (GAGCTC), SacII (CCGCGG), Sall (GTCGAC), Smal (CCCGGG), SnaBI (TACGTA), Spel (ACTAGT), SphI (GCATGC), Tlil (CTCGAG), TspMI (CCCGGG), Xbal (TCTAGA), Xhol (CTCGAG), Xmal (CCCGGG).
[0336] In some cases, the nucleotide sequences provided herein do not comprise one or more of the nucleotide sequences in the list above. In some cases, the nucleotide sequences provided herein do not comprise any of the nucleotide sequences in the list above. In some cases, the nucleotide sequences provided herein do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by Eco31I (z.c., Bsal, Bso31I, BspTNI) or Bpil (z.c., BbsI, BpuAI, BstV2I). In some cases, the nucleotide sequences provided herein do not comprise nucleotide sequences GGTCTC or GAAGAC. In the composition herein, SEQ ID NO: 1 - SEQ ID NO: 39 can each be codon-optimized for a plant, wherein the plant can be any one of the following, for example, angiosperms and gymnosperms such as Arabidopsis, potato, tomato, tobacco, alfalfa, lemice, carrot, strawberry, sugar beet, cassava, sweet potato, soybean, lima bean, pea, chick pea, maize (com), turf grass, wheat, rice, barley, sorghum, oat, oak, eucalyptus, walnut, palm and duckweed a well as fern and moss. In some aspects, the nucleotide sequences provided herein are codon-optimized for a plant, wherein the plant is a monocot, a dicot, or a vascular plant reproduced from spores such as fern or a nonvascular plant such as moss, liverwort, hornwort, and algae. In some aspects, the nucleotide Docket No. 713.006.004. PCT
[0337] sequences provided herein are codon -optimized for a di cot plant, include for example Arabidopsis, tobacco, tomato, potato, sweet potato, cassava, alfalfa, lima bean, pea, chick pea, soybean, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, squash, daisy, quinoa, buckwheat, mung bean, cow pea, lentil, lupin, peanut, fava bean, French beans, mustard, or cactus. In some aspects, the nucleotide sequences provided herein are codon-optimized for a monocot plant, including for example, turf grass, maize (corn), rice, oat, wheat, barley, sorghum, orchid, iris, lily, onion, palm, and duckweed. In some cases, the nucleotide sequences provided herein are codon-optimized for a soybean (z.e., glycine max).
[0338] In the compositions herein, SEQ ID NO: 1 - SEQ ID NO: 39 can contribute to new protein folding patterns compared to the wild type variant, due to the impact of codon changes on the rate of protein synthesis. In some embodiments, changes in codon usage enhance the stability and localization of mRNA, optimizing the quantity and positioning of protein synthesis. In some embodiments, the variability of tRNA availability across organisms aligns with the introduced codons, prompting unique translation dynamics. In some embodiments, the modified codon usage enriches traditional patterns of gene expression by affecting the regulatory sequences of DNA and RNA. In some embodiments, changes in codon usage provide an additional dimension to post-translational modifications vital to protein function by introducing alterations in translation speed and timing.
[0339] In the compositions herein, a food composition (such as a dairy product) can comprise: a casein protein, as obtained from transfection of a plant by SEQ ID NO: 1 - SEQ ID NO: 39, and a nucleic acid molecule comprising SEQ ID NO: 1 - SEQ ID NO: 39.
[0340] In the compositions herein, a food composition (such as a dairy product) can comprise: a first nucleic acid molecule comprising SEQ ID NO: 1 - SEQ ID NO: 39; and a second nucleic acid molecule comprising SEQ ID NO: 1 - SEQ ID NO: 39.
[0341] Methods and compositions are also provided for enhancing protein accumulation in plants through modification of protein trafficking pathways. The methods comprise modifying the expression or activity of SVTP genes (Soybean Vesicular Trafficking Pathway genes) involved in vacuolar and endosomal sorting. The modification may be achieved through RNA interference targeting SVTP transcripts or through genome editing of SVTP genes. In soybean plants, SVTP Docket No. 713.006.004. PCT
[0342] genes are targeted either individually or in combination. The modified plants exhibit reduced trafficking of proteins to the lytic vacuole, resulting in enhanced accumulation of proteins of interest. The methods are particularly useful for increasing the yield of heterologous proteins, such as milk proteins, in transgenic plants. The methods and compositions include modified plants, plant cells, genetic constructs, and methods for protein production using these modifications.
[0343] The methods and compositions are enhancing protein accumulation in soybean plants through modification of SVTP genes. The methods and compositions particularly relate to methods for increasing the accumulation of heterologous proteins, such as caseins, by altering cellular protein trafficking pathways. While the methods and compositions are primarily described in relation to soybean plants, the methods and principles described herein may be applicable to other plant species where protein accumulation is desired.
[0344] SVTP genes function as critical mediators of protein trafficking within plant cells. In unmodified soybean plants, SVTP proteins facilitate the transport of various proteins, including potentially valuable heterologous proteins, to the lytic vacuole where they may be degraded. This natural trafficking pathway can significantly reduce the accumulation of desired proteins, particularly when expressing heterologous proteins such as caseins in transgenic soybean systems.
[0345] The methods and compositions provide multiple approaches for modifying SVTP gene expression or function. In one embodiment, RNA interference (RNAi) technology is employed to reduce SVTP gene expression. Specifically designed short hairpin RNA (shRNA) sequences targeting the SVTP transcripts are introduced into soybean cells. These shRNA sequences are designed to target conserved regions of both SVTP genes (Glyma.02G268600 and Glyma.l4G048800) simultaneously, or may be designed to target the genes individually. The ability to target individual genes provides flexibility in modulating the degree of SVTP suppression and may be useful in studying the specific roles of each gene.
[0346] In a preferred embodiment of the methods and compositions, the shRNA construct designated as pMOZ3655 contains specific sequences targeting SVTP genes. This construct includes carefully designed complementary regions that form a hairpin structure when expressed, triggering the cellular RNAi machinery to reduce SVTP transcript levels. The construct may be operably linked Docket No. 713.006.004. PCT
[0347] to constitutive promoters such as the CaMV 35S promoter, or to tissue-specific or inducible promoters depending on the desired expression pattern. Alternative promoters may include seedspecific promoters such as the P-conglycinin promoter, the glycinin promoter, or the oleosin promoter, which can direct expression specifically in soybean seeds where protein accumulation is most desired.
[0348] In another embodiment, CRISPR / Cas9-mediated genome editing is employed to modify the SVTP genes. This approach involves designing guide RNA sequences specifically targeting the SVTP genomic loci. The guide RNAs are designed to direct the Cas9 endonuclease to create doublestrand breaks at specific locations within the SVTP genes, leading to modifications through non-homologous end joining (NHEJ) or homology-directed repair (HDR) mechanisms. Alternative nucleases such as Cpfl (Cast 2a), base editors, or prime editors may also be employed for precise genetic modifications.
[0349] The methods and compositions encompass methods for generating transgenic soybean plants incorporating these genetic modifications. Soybean transformation may be accomplished through various methods known in the art, including but not limited to Agrobacterium-mediated transformation, particle bombardment, or other suitable transformation methods. Following transformation, modified plants are selected using appropriate selection markers and regenerated through tissue culture techniques. Selection markers may include antibiotic resistance genes, herbicide resistance genes, or visual markers such as fluorescent proteins.
[0350] Alternative transformation methods may include in planta transformation techniques, electroporation of protoplasts, or other emerging transformation technologies. The choice of transformation method may depend on the specific requirements of the modification strategy and the available resources.
[0351] The modified plants are characterized by reduced expression or function of SVTP genes, which results in altered protein trafficking patterns within the plant cells. This modification is expected to reduce the trafficking of proteins to the lytic vacuole, thereby increasing the accumulation of desired proteins within the cell. The methods and compositions particularly benefit the production of heterologous proteins, such as caseins, which may otherwise be subject to degradation in the Docket No. 713.006.004. PCT
[0352] lytic vacuole. The altered trafficking patterns may be visualized using fluorescently tagged proteins or other cellular imaging techniques.
[0353] In alternative embodiments, the methods and compositions provide methods for combining SVTP gene modification with other genetic modifications that enhance protein accumulation. These may include modifications to other components of the protein trafficking machinery, enhancement of protein synthesis pathways, or reduction of other protein degradation mechanisms. The combination of multiple modifications may result in synergistic effects on protein accumulation.
[0354] The methods and compositions are for expressing various heterologous proteins in SVTP -modified soybean plants. While casein proteins are specifically described, the methods may be applied to other valuable proteins such as pharmaceutical proteins, industrial enzymes, or other milk proteins. The choice of protein may depend on the intended application and market demands.
[0355] In specific embodiments involving casein expression, different casein variants may be expressed either individually or in combination. These may include a-sl casein, a-s2 casein, P-casein, and K-casein. The casein genes may be introduced into the modified plants through standard transformation techniques, either simultaneously with or subsequent to SVTP gene modification. The casein proteins may be targeted to various cellular compartments through the use of appropriate targeting sequences, with the reduced SVTP function helping to prevent their degradation.
[0356] The degree of SVTP gene modification may be optimized to balance protein accumulation with plant viability. Complete elimination of SVTP function may not be necessary or desirable, as some level of protein trafficking may be important for normal plant function. The methods and compositions therefore include methods for achieving partial reduction of SVTP activity, such as through the use of inducible promoters or weak constitutive promoters. Alternative approaches may include the use of tissue-specific promoters, developmentally regulated promoters, or chemically inducible systems.
[0357] Various methods may be employed to quantify the effectiveness of SVTP gene modification and its impact on protein accumulation. These may include RNA analysis techniques such as RT-PCR or RNA-seq to measure SVTP transcript levels, protein analysis methods such as Western blotting Docket No. 713.006.004. PCT
[0358] or mass spectrometry to measure protein levels, and microscopy techniques to analyze protein localization and trafficking patterns within the modified cells. Alternative analytical methods may include proteomics approaches, metabolomics analysis, or high-throughput screening techniques.
[0359] The modified plants may be propagated through standard breeding techniques to develop lines with stable genetic modifications. Selection of elite lines may be based on various criteria including protein accumulation levels, plant vigor, and agronomic performance. The methods and compositions include methods for maintaining and propagating these elite lines while preserving the desired genetic modifications and protein production characteristics. Alternative breeding strategies may include marker-assisted selection, genomic selection, or rapid cycling breeding approaches.
[0360] The methods and compositions comprise scaling up protein production using the modified plants. This may include optimizing growth conditions, harvesting techniques, and protein extraction methods to maximize protein yield from the modified plants. The methods may be adapted for various scales of production, from laboratory-scale experiments to commercial-scale protein production. Alternative production systems may include greenhouse cultivation, vertical farming, or field production depending on regulatory requirements and production needs.
[0361] Protein extraction and purification methods may vary depending on the specific protein being produced and its intended use. These may include aqueous extraction, organic solvent extraction, or other suitable methods. The extraction methods may be optimized to maintain protein stability and functionality while maximizing yield. Alternative purification strategies may include chromatographic techniques, membrane filtration, or other separation methods appropriate for the specific protein product.
[0362] The methods and compositions also encompass methods for optimizing protein extraction and processing from the modified plants. These may include modifications to traditional protein extraction protocols to account for altered protein localization in the modified plants. Alternative extraction methods may be developed to maximize protein recovery while maintaining protein quality and functionality. Docket No. 713.006.004. PCT
[0363] Quality control methods are provided to ensure consistency and stability of protein production in the modified plants. These may include molecular characterization of the genetic modifications, protein quality assessments, and stability testing. Alternative quality control measures may include functional assays, structural analysis, or other appropriate analytical methods depending on the specific protein being produced.
[0364] DEFINITIONS
[0365] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “comprising”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”
[0366] Use of absolute or sequential terms, for example, “will,” “will not,” “shall,” “shall not,” “must,” “must not,” “first,” “initially,” “next,” “subsequently,” “before,” “after,” “lastly,” and “finally,” are not meant to limit scope of the present embodiments disclosed herein but as exemplary.
[0367] These and other valuable aspects of the embodiments of the present disclosure consequently further the state of the technology to at least the next level. While the disclosure has been described in conjunction with a specific best mode, it is to be understood that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the descriptions herein. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the scope of the included claims. All matters set forth herein or shown in the accompanying drawings are to be interpreted in an illustrative and non-limiting sense.
[0368] As used herein, the phrases “at least one”, “one or more”, and “and / or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and / or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together. Docket No. 713.006.004. PCT
[0369] Any systems, methods, software, and platforms described herein are modular and not limited to sequential steps. Accordingly, terms such as “first” and “second” do not necessarily imply priority, order of importance, or order of acts.
[0370] As used herein, the term “about” or the symbol
[0371]
[0372] when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and the number or numerical range may vary from, for example, from 1% to 10% of the stated number or numerical range. Unless otherwise indicated by context, the term “about” refers to ±10% of a stated number or value.
[0373] As used herein, the term “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “approximately” can mean within 1 or more than 1 standard deviation, per the practice in the given value. Where particular values are described in the application and claims, unless otherwise stated the term “approximately” should be assumed to mean an acceptable error range for the particular value.
[0374] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0375] All ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, and so forth. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, and the like. All languages such as “up to,” “at least,” Docket No. 713.006.004. PCT
[0376] “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
[0377] Whenever the term “at least,” “greater than,” “greater than or equal to”, or a similar phrase precedes the first numerical value in a series of two or more numerical values, the term “at least,” “greater than,” “greater than or equal to” or similar phrase applies to each of the numerical values in that series of numerical values. For example, “at least 1, 2, or 3” is equivalent to “at least 1, at least 2, and / or at least 3.”
[0378] Whenever the term “no more than,” “less than,” “less than or equal to,” “no greater than,” “at most,” or a similar phrase, precedes the first numerical value in a series of two or more numerical values, the term “no more than,” “less than,” “less than or equal to,” “no greater than,” “at most,” or similar phrase applies to each of the numerical values in that series of numerical values. For example, “less than 3, 2, or 1” is equivalent to “less than 3, less than 2, and / or less than 1.”
[0379] As used herein, the following meanings apply unless otherwise specified. The word “may” or “can” is used in a permissive sense (z.e., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). The words “include”, “including”, and “includes” and the like mean including, but not limited to. The singular forms “a,” “an,” and “the” include plural referents. Thus, for example, reference to “an element” includes a combination of two or more elements, notwithstanding use of other terms and phrases for one or more elements, such as “one or more.” The phrase “at least one” includes “one”, “one or more”, “one or a plurality” and “a plurality”. The term “or” is, unless indicated otherwise, non-exclusive, z.e., encompassing both “and” and “or.” The term “any of’ between a modifier and a sequence means that the modifier modifies each member of the sequence. So, for example, the phrase “at least any of 1, 2 or 3” means “at least 1, at least 2 or at least 3”. The term "consisting essentially of refers to the inclusion of recited elements and other elements that do not materially affect the basic and novel characteristics of a claimed combination. Docket No. 713.006.004. PCT
[0380] As used herein, a “vector” is a plasmid comprising operably linked polynucleotide sequences that facilitate expression of a coding sequence in a particular host organism (e.g., a bacterial expression vector or a plant expression vector). Polynucleotide sequences that facilitate expression in prokaryotes can include, e.g., a promoter, an enhancer, an operator, and a ribosome binding site, often along with other sequences. Eukaryotic cells can use promoters, enhancers, termination and polyadenylation signals and other sequences that are generally different from those used by prokaryotes.
[0381] As used herein, the term "casein micelles" are micelles comprising casein proteins. Examples of casein micelles are described in United States Patent Application No. 16 / 741,680 (Patent No. US11326176), filed on January 13, 2020, titled “Recombinant micelle and method of in vivo assembly,” and in United States Patent Application No. 17 / 826,021 filed on May 26, 2022, both incorporated herein by reference in its entirety. Recombinant casein micelles can be made in vivo or in vitro using the methods described therein. United States Patent Application No. 17 / 826,021 (United States Patent Application US20220290167A1), titled “Recombinant micelle and method of in vivo assembly” teaches vectors and sequences for making recombinant casein proteins and micelles, which is incorporated herein by reference in its entirety.
[0382] As used herein, the term “milk” means a liquid composition that contains soluble casein micelles and where the weight of soluble casein micelles is equal to or greater than 1% of the total protein weight in the composition.
[0383] U. S. Patent No. 11457649 describes a substitute dairy food, and U. S. Patent Application No.
[0384] 16 / 862,011 (Publication No. US20210010017A1) describes food compositions comprising a milk protein, both of which are incorporated herein by reference in their entirety.
[0385] As used herein, the term “dairy characteristic” means a characteristic selected from one of the following characteristics of a dairy food: adhesiveness, airiness, appearance, aroma, binding, chewdown, chewiness, coagulation, cohesiveness, compactness, creaminess, crispiness, crumbliness, density, elasticity, emulsification, fattiness, firmness, flavor, foaminess, graininess, greasiness, hardness, handling, juiciness, leavening, mouthcoating, mouthfeel, richness, roughness, slipperiness on tongue, smoothness, springiness, structure, taste, tenderness, texture, thickness, uniformity, and wetness. Docket No. 713.006.004. PCT
[0386] In some aspects, the current disclosure provides food products and food product substitutes comprising the nucleic acids disclosed herein. Contemplated food products include dairy products or products that resemble a dairy product (i.e., dairy product substitutes). The term “dairy product” as used herein refers to milk (e.g., whole milk (at least 3.25% milk fat), partly skimmed milk (from 1% to 2% milk fat), skim milk (less than 0.2% milk fat), cooking milk, condensed milk, flavored milk, goat milk, sheep milk, dried milk, evaporated milk, milk foam), and products derived from milk, including but not limited to yogurt (e.g., whole milk yogurt (at least 6 grams of fat per 170 g), low-fat yogurt (between 2 and 5 grams of fat per 170 g), nonfat yogurt (0.5 grams or less of fat per 170 g), Greek yogurt (strained yogurt with whey removed), whipped yogurt, goat milk yogurt, Labneh (labne), sheep milk yogurt, yogurt drinks (e.g., whole milk Kefir, low-fat milk Kefir), Lassi), cheese (e.g., whey cheese such as ricotta; pasta filata cheese such as mozzarella; semi-soft cheese such as Havarti and Muenster; medium-hard cheese such as Swiss and Jarlsberg; hard cheese such as Cheddar and Parmesan; washed curd cheese such as Colby and Monterey Jack; soft ripened cheese such as Brie and Camembert; fresh cheese such as cottage cheese, feta cheese, cream cheese, and curd; processed cheese; processed cheese food; processed cheese product; processed cheese spread; enzyme-modulated cheese; cold-pack cheese), dairy-based sauces (e.g., fresh, frozen, refrigerated, or shelf stable), dairy spreads (e.g., low-fat spread, low-fat butter), cream (e.g., dry cream, heavy cream, light cream, whipping cream, half-and-half, coffee whitener, coffee creamer, sour cream, creme fraiche), frozen confections (e.g., ice cream, smoothie, milk shake, frozen yogurt, sundae, gelato, custard), dairy desserts (e.g., fresh, refrigerated, or frozen), butter (e.g., whipped butter, cultured butter), dairy powders (e.g., whole milk powder, skim milk powder, fat-filled milk powder (i.e., milk powder comprising plant fat in place of all or some animal fat), infant formula, milk protein concentrate (i.e., protein content of at least 80% by weight), milk protein isolate (i.e., protein content of at least 90% by weight), whey protein concentrate, whey protein isolate, demineralized whey protein concentrate, demineralized whey protein concentrate, beta. -lactoglobulin concentrate, beta. -lactoglobulin isolate, alpha-lactalbumin concentrate, alpha-lactalbumin isolate, glycomacropeptide concentrate, glycomacropeptide isolate, casein concentrate, casein isolate, nutritional supplements, texturizing blends, flavoring blends, coloring blends), ready -to-drink or ready -to-mix products (e.g., fresh, refrigerated, or shelf stable dairy protein beverages, weight loss beverages, nutritional beverages, sports recovery beverages, and energy drinks), puddings, gels, chewables, crisps, and bars. As used herein, the Docket No. 713.006.004. PCT
[0387] term “food product substitute” (e.g., “dairy product substitute”) refers to a food product that resembles a conventional food product (e.g., can be used in place of the conventional food product). Such resemblance can be due to any physical, chemical, or functional attribute. In some embodiments, the resemblance of the food product provided herein to a conventional food product is due to a physical attribute. Non-limiting examples of physical attributes include color, shape, mechanical characteristics (e.g, hardness, G' storage modulus value, shape retention, cohesion, texture (i.e., mechanical characteristics that are correlated with sensory perceptions (e.g., mouthfeel, fattiness, creaminess, homogenization, richness, smoothness, thickness), viscosity, and crystallinity. In some embodiments, the resemblance of the food product provided herein and a conventional food product is due to a chemical / biological attribute. Non-limiting examples of chemical attributes include nutrient content (e.g., type and / or amount of amino acids (e.g., PDCAAS score), type and / or amount of lipids, type and / or amount of carbohydrates, type and / or amount of minerals, type and / or amount of vitamins), pH, digestibility, shelf-life, hunger and / or satiety regulation, taste, and aroma. In some embodiments, the resemblance of the food product provided herein to a conventional food product is due to a functional attribute. Non-limiting examples of functional attributes include gelling / agglutination behavior (e.g., gelling capacity (i.e., time required to form a gel (i.e., a protein network with spaces filled with solvent linked by hydrogen bonds to the protein molecules) of maximal strength in response to a physical and / or chemical condition (e.g., agitation, temperature, pH, ionic strength, protein concentration, sugar concentration, ionic strength)), agglutination capacity (i.e., capacity to form a precipitate (i.e., a tight protein network based on strong interactions between protein molecules and exclusion of solvent) in response to a physical and / or chemical condition), gel strength (i.e., strength of gel formed, measured in force / unit area (e.g., pascal (Pa))), water holding capacity upon gelling, syneresis upon gelling (i.e., water weeping over time)), foaming behavior (e.g., foaming capacity (i.e., amount of air held in response to a physical and / or chemical condition), foam stability (i.e., half-life of foam formed in response to a physical and / or chemical condition), foam seep), thickening capacity, use versatility (i.e., ability to use the food product in a variety of manners and / or to derive a diversity of other compositions from the food product; e.g., ability to produce food products that resemble milk derivative products such as yoghurt, cheese, cream, and butter), and ability to form protein dimers. Docket No. 713.006.004. PCT
[0388] Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.
[0389] As used herein, the term “recombinant” refers to nucleic acids or proteins formed by laboratory methods of genetic recombination (e.g., molecular cloning) to bring together genetic material from multiple sources, creating sequences that would otherwise not be found in the genome. Recombinant proteins may be expressed in vivo in various types of host cells, including plant cells, bacterial cells, fungal cells, avian cells, and mammalian cells. Recombinant proteins may also be generated in vitro. As used herein, the term “tagged protein” refers to a recombinant protein that includes additional peptides that are not part of the native protein and that remain after post-translational processing.
[0390] As used herein, the term “milk solids” refers to the powder that would be left after milk is dried out and the water is removed.
[0391] As used herein, the phrase “essentially free of’ is used to indicate the indicated component, if present, is present in an amount that does not contribute, or contributes only in a de minimus fashion, to the properties of the composition. In various embodiments, where a composition is essentially free of a particular component, the component is present in less than a functional amount. In various embodiments, the component may be present in trace amounts. Particular limits will vary depending on the nature of the component, but may be, for example, selected from less than 10% by weight, less than 9% by weight, less than 8% by weight, less than 7% by weight, less than 6% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, less than 1% by weight, less than 0.5% by weight, less than 0.1% by weight, or less than 0.05% by weight, or less than 0.01% by weight.
[0392] As used herein, the term "stably expressed" refers to expression and accumulation of a protein in a plant cell over time. As an example, a recombinant protein may accumulate because it is not degraded by endogenous plant proteases. As a further example, a recombinant protein is considered to be stably expressed in a plant if it is present in the plant in an amount of 1% or higher per total protein weight of soluble protein extractable from the plant. Docket No. 713.006.004. PCT
[0393] As used herein, the term “a detectable amount” refers to an amount of a composition (e.g., a molecule) that can be detected using the most sensitive analytical techniques up to date, including for example, liquid chromatography methods (e.g, reverse phase HPLC, size exclusion, normal phase chromatography), mass spectrometry (e.g., electrospray tandem mass spectrometry, and electrospray FT-ICR mass spectrometry), or a combination of analytical techniques (e.g., liquid chromatography -tandem mass spectrometry (LC- MS / MS)). In some cases, a detectable amount is at a concentration above 10-2 mol / L, 10-3 mol / L, 10-4 mol / L, 10-5 mol / L, 10-6 mol / L, 10-7 mol / L, 10-8 mol / L, 10-9 mol / L, or 10-10 mol / L.
[0394] As used herein, the term “naturally occurring” means without genetic modification. For example, a naturally occurring ratio of two plant proteins means a ratio of the two plant proteins found in a plant e.g., plant seed), where the plant is not genetically modified to manipulate the expression levels of the two proteins.
[0395] As used herein, the term “recombinant” refers to nucleic acids or proteins formed by laboratory methods of genetic recombination (e.g., molecular cloning) to bring together genetic material from multiple sources, creating sequences that would otherwise not be found in the genome. Recombinant proteins may be expressed in vivo in various types of host cells, including plant cells, bacterial cells, fungal cells, avian cells, and mammalian cells. Recombinant proteins may also be generated in vitro. As used herein, the term “tagged protein” refers to a recombinant protein that includes additional peptides that are not part of the native protein and that remain after post-translational processing.
[0396] Definition of standard chemistry terms may be found in reference works, including but not limited to, Carey and Sundberg “Advanced Organic Chemistry 4th Ed.” Vols. A (2000) and B (2001), Plenum Press, New York.
[0397] As used herein, the term “homogenous” means uniform structure or composition throughout, such that individual components (e.g., probiotics, particles) cannot be separately observed with the naked eye.
[0398] As used herein, the term "plant" includes whole plant, plant organ, plant tissues, and plant cell and progeny of same, but is not limited to angiosperms and gymnosperms such as Arabidopsis, potato, tomato, tobacco, alfalfa, lemice, carrot, strawberry, sugarbeet, cassava, sweet potato, soybean, lima Docket No. 713.006.004. PCT
[0399] bean, pea, chick pea, maize (com), turf grass, wheat, rice, barley, sorghum, oat, oak, eucalyptus, walnut, palm, and duckweed as well as fern and moss. Thus, a plant may be a monocot, a dicot, a vascular plant reproduced from spores such as fern or a nonvascular plant such as moss, liverwort, hornwort, and algae. The term "plant," as used herein, also encompasses plant cells, seeds, plant progeny, propagule whether generated sexually or asexually, and descendants of any of these, such as cuttings or seed. Plant cells include suspension cultures, callus, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds, and microspores. Plants may be at various stages of maturity and may be grown in liquid or solid culture, or in soil or suitable media in pots, greenhouses, or fields. As used herein, the term “plant protein” refers to a protein that is at least 70% homologous to a protein that naturally occurs in a plant.
[0400] As used herein, the term “dicof ’ refers to a flowering plant whose embryos have two seed leaves or cotyledons. Examples of dicots include Arabidopsis, tobacco, tomato, potato, sweet potato, cassava, alfalfa, lima bean, pea, chick pea, soybean, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, squash, daisy, quinoa, buckwheat, mung bean, cow pea, lentil, lupin, peanut, fava bean, French beans, mustard, or cactus.
[0401] As used herein, the term “monocot” refers to a flowering plant whose embryos have one cotyledon or seed leaf. Examples of monocots include turf grass, maize (corn), rice, oat, wheat, barley, sorghum, orchid, iris, lily, onion, palm, and duckweed.
[0402] As used herein, the term "transgenic plant" means a plant that has been transformed with one or more exogenous nucleic acids. " Transformation" refers to a process by which a nucleic acid is stably integrated into the genome of a plant cell. " Stably transformed" refers to the permanent, or non-transient, retention, expression, or a combination thereof of a polynucleotide in and by a cell genome. A stably integrated polynucleotide is one that is a fixture within a transformed cell genome and can be replicated and propagated through successive progeny of the cell or resultant transformed plant. Transformation can occur under natural or artificial conditions using various methods. Transformation can rely on any method for the insertion of nucleic acid sequences into a prokaryotic or eukaryotic host cell, including Agrobacterium-mediated transformation as illustrated in U. S. Pat. Nos. 5,159,135; 5,824,877; 5,591,616 and 6,384,301, all of which are incorporated herein by reference in its entirety. Methods for plant transformation also include microprojectile bombardment as illustrated in U. S. Pat. Nos. 5,015,580; 5,550,318; 5,538,880; Docket No. 713.006.004. PCT
[0403] 6,153,812; 6,160,208; 6,288,312 and 6,399,861, all of which are incorporated herein by reference in its entirety. Recipient cells for the plant transformation include meristem cells, callus, immature embryos, hypocotyls explants, cotyledon explants, leaf explants, and gametic cells such as microspores, pollen, sperm and egg cells, and any cell from which a fertile plant can be regenerated, as described in U. S. Pat. Nos. 6,194,636;6,232,526; 6,541,682 and 6,603,061 and U. S. Patent Application publication US 2004 / 0216189 Al, all of which are incorporated herein by reference in its entirety.
[0404] Additional methods and concepts related to codon optimization are described in U. S. Patent Application publication US20200024327A1 (Optimized factor viii gene) to Tan et al and in U. S. Pat. No. US9427003 (Synthetic genes) to Larrinua et al, both of which are incorporated herein by reference in its entirety.
[0405] As used herein, the term “in-vitro” means outside a living organism.
[0406] As used herein, the term “fusion protein” refers to a protein comprising at least two constituent proteins that are encoded by separate genes, and that have been joined so that they are transcribed and translated as a single polypeptide.
[0407] Certain aspects of the disclosure have other steps or elements in addition to or in place of those mentioned above. The steps or elements will become apparent to those skilled in the art from a reading of the following detailed description when taken with reference to the accompanying drawings.
[0408] While some embodiments of the methods and compositions have been shown and described herein, those skilled in the art would recognize that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the methods and compositions. Various alternatives to the embodiments of the methods and compositions described herein may be employed in practicing the methods and compositions.
[0409] As used herein, 'SVTP genes' (Soybean Vesicular Trafficking Pathway genes) refers to a family of genes in Glycine max that encode proteins involved in the regulation of intracellular protein transport and vacuolar sorting. This family includes, but is not limited to, Glyma.02G268600 and Docket No. 713.006.004. PCT
[0410] Glyma.14G048800, as well as their homologs, variants, and functionally equivalent genes in Glycine max or other plant species. SVTP genes are characterized by their conserved role in mediating protein trafficking between cellular compartments, particularly in pathways involving protein transport to and from vacuolar structures. The encoded SVTP proteins function as components of cellular machinery that determines the fate and localization of other proteins within the cell.
[0411] EXAMPLES
[0412] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.
[0413] EXAMPLE 1: Identification of Casein-Processing Interfering Proteins Through CoPurification Analysis
[0414] To identify potential CPIPs, affinity purification experiments were performed using anti-FLAG antibody-conjugated magnetic agarose beads. Protein extracts from soybean tissue expressing FLAG-tagged casein were incubated with the anti-FLAG beads under standard purification conditions. After washing, bound proteins were eluted using an elution buffer to release the FLAG-tagged casein and any co-purifying proteins. The eluted protein fraction, containing both the casein and associated endogenous soybean proteins, was analyzed by mass spectrometry to identify proteins that associate with casein during purification procedures. Table 9 presents the identified proteins and their relevant characteristics.
[0415] The proteins co-purifying with casein were characterized using standard mass spectrometry parameters. Accession numbers refer to unique identifiers in the UniProt protein database. Protein coverage (%) indicates the percentage of the protein sequence detected through peptide matches. The number of peptides represents total peptide sequences matching to the protein, while unique peptide counts pertain to only those sequences specific to that protein. PSMs (Peptide Spectrum Matches) indicate the total number of identified peptide spectra for the protein, providing a Docket No. 713.006.004. PCT
[0416] measure of identification confidence. The molecular weight (MW) is given in kilodaltons (kDa). Gene symbols represent the standard genetic nomenclature for each protein. Protein abundance is expressed in arbitrary units derived from label-free quantification using MSI peak intensities, normalized to total ion current.
[0417] Table 9: Endogenous Soybean Proteins Associated with Casein Under Standard Isolation Conditions
[0418] Abu ndan # Gene ce # Unique MW Sym 1182 Accession Description % Coverage # Peptides PSMs Peptides in kDa bol 469
[0419] Beta-conglycinin
[0420] alpha' subunit
[0421] OS=Glycine max
[0422] OX=3847 GN=CG- 9.08 P11827 1 PE=1 SV=2 44 21 99 17 72.2 CG-1 E+08
[0423] Beta-conglycinin
[0424] alpha subunit 1
[0425] OS=Glycine max
[0426] OX=3847 GN=CG- 2.76 P0DO16 3 PE=1 SV=1 46 25 84 18 70.3 CG-3 E+09
[0427] Glycinin G4
[0428] OS=Glycine max
[0429] OX-3847
[0430] GN=GY4 PE=1 7.74 P02858 SV=2 62 23 61 18 63.8 GY4 E+08
[0431] Cupin type-1 6.61 I1L860 domain-containing 46 17 53 12 58 E+08
[0432]
[0433] Docket No. 713.006.004. PCT
[0434] protein OS=Glycine
[0435] max OX=3847
[0436] GN=GLYMA_10G
[0437] 028300 PE=4 SV=1
[0438] Glycinin G2
[0439] OS=Glycine max
[0440] OX=3847
[0441] GN=GY2 PE=1 1.60 P04405 SV=2 45 16 51 11 54.4 GY2 E+09
[0442] Glycinin G1
[0443] OS=Glycine max
[0444] OX=3847
[0445] GN=GY1 PE=1 5.37 P04776 SV=2 34 11 49 7 55.7 GY1 E+08
[0446] Cupin type-1
[0447] domain-containing
[0448] protein (Fragment)
[0449] OS=Glycine max
[0450] OX=3847
[0451] A0A0R0 GN=GLYMA_13G 5.12 GM VI 123500 PE=3 SV=1 62 19 46 10 55.1 E+08
[0452] Cupin type-1
[0453] domain-containing
[0454] protein OS=Glycine
[0455] max OX=3847
[0456] GN=GLYMA_02G 6.50 I1JF86 145700 PE=4 SV=2 35 13 42 8 57.8 E+07
[0457]
[0458] Docket No. 713.006.004. PCT
[0459] Lipoxygenase
[0460] OS=Glycine max
[0461] OX=3847
[0462] GN=547774 PE=2 5477 5.45 I1M596 SV=1 20 15 24 12 97.2 74 E+07
[0463] Glycinin A3B4
[0464] (Plasmid
[0465] pSPGD41)
[0466] (Fragment)
[0467] OS=Glycine soja
[0468] OX=3848 PE=3 5.88 Q7M211 SV=1 68 9 22 2 21.3 E+07
[0469] Uncharacterized
[0470] protein OS=Glycine
[0471] max OX=3847 1.98 C6T488 PE=2 SV=1 32 6 21 5 24.1 E+08
[0472] Uncharacterized
[0473] protein OS=Glycine
[0474] max OX=3847
[0475] GN=547838 PE=3 5478 4.29 I1KPN3 SV=1 23 13 20 7 73.4 38 E+07
[0476] Chaperonin
[0477] CPN60-2,
[0478] mitochondrial 1008 OS=Glycine max 1854 3.97 I1LCI1 OX=3847 25 12 16 1 61.4 4 E+07
[0479]
[0480] Docket No. 713.006.004. PCT
[0481] GN=100818544
[0482] PE=3 SV=1
[0483] Lipoxygenase
[0484] OS=Glycine max
[0485] OX=3847 GN=Lx3 3.91 B3TDK6 PE=3 SV=1 17 12 16 12 96.7 Lx3 E+07
[0486] Annexin
[0487] OS=Glycine max
[0488] OX=3847 1008 A0A0R4J GN= 100806472 0647 1.13 4L3 PE=3 SV=1 31 11 16 11 35.9 2 E+08
[0489] Elongation factor 1- alpha OS=Glycine
[0490] max OX=3847 1007 A0A0R0E GN=100785429 8542 1.38 SZ8 PE=3 SV=1 28 9 15 1 49.2 9 E+08
[0491] Lipoxygenase
[0492] OS=Glycine max
[0493] OX=3847PE=1 5.66 B3TDK4 SV=1 13 8 15 5 94.4 E+06
[0494] Glycinin G3
[0495] OS=Glycine max
[0496] OX=3847
[0497] GN=GY3 PE=1 1.87 P11828 SV=1 23 6 13 3 54.2 GY3 E+06
[0498]
[0499] Docket No. 713.006.004. PCT
[0500] Beta-conglycinin
[0501] beta subunit 2
[0502] OS=Glycine max
[0503] OX=3847 GN=CG- 5.78 F7J077 4PE=1 SV=1 19 7 12 4 50.4 CG-4 E+06
[0504] Elongation factor 1- alpha OS=Glycine
[0505] max OX=3847 1007 A0A0R4J GN= 100776330 7633 7.72 4C3 PE=3 SV=1 25 8 11 1 49.5 0 E+06
[0506] Glyceraldehyde-3- phosphate
[0507] dehydrogenase
[0508] OS=Glycine max
[0509] OX=3847 1007 GN= 100783902 8390 2.56 I1KC70 PE=3 SV=1 30 7 9 2 36.7 2 E+07
[0510] Protein disulfideisomerase
[0511] OS=Glycine max
[0512] OX=3847
[0513] GN=PDIL-1 PE=3 PDIL 1.18 B1Q2X4 SV=1 20 7 9 1 58.6 -1 E+07
[0514] Uncharacterized 1007 protein OS=Glycine 9823 1.11 I1KYW3 max OX=3847 19 3 8 3 22.6 9 E+07
[0515]
[0516] Docket No. 713.006.004. PCT
[0517] GN= 100798239
[0518] PE=4 SV=1
[0519] Uncharacterized
[0520] protein OS=Glycine
[0521] max OX=3847
[0522] GN=GLYMA_09G 2.09 K7LEQ5 185500 PE=4 SV=1 21 5 7 5 26.6 E+07
[0523] Kunitz-type trypsin
[0524] inhibitor KTI1
[0525] OS=Glycine max
[0526] OX=3847 1003 GN=100305855 0585 2.81 C6SWW4 PE=2 SV=1 31 4 7 3 22.4 5 E+07
[0527] Sucrose synthase
[0528] OS=Glycine max
[0529] OX=3847
[0530] GN=GLYMA_17G 9.67 K7MJY8 045800 PE=3 SV=1 7 4 6 3 92.1 E+06
[0531] Glucose-6- phosphate 1- dehydrogenase
[0532] OS=Glycine max
[0533] OX=3847 1007 A0A0R0F GN=100793462 9346 9.38 M59 PE=3 SV=1 11 4 6 4 59.2 2 E+06
[0534]
[0535] Docket No. 713.006.004. PCT
[0536] Beta-amylase
[0537] OS=Glycine max
[0538] OX=3847 1007 GN=100787580 8758 3.99 I1LRU3 PE=3 SV=1 16 6 6 6 56 0 E+06
[0539] P24 oleosin isoform
[0540] B OS=Glycine max
[0541] OX=3847 PE=2 1.94 P29531 SV=1 15 3 6 2 23.4 E+07
[0542] Stress-induced
[0543] protein SAM22
[0544] OS=Glycine max
[0545] OX=3847 GN=PR- PR- 2.52 P26987 10 PE=1 SV=1 32 3 6 3 16.8 10 E+07
[0546] Uncharacterized
[0547] protein OS=Glycine
[0548] max OX=3847 1008 GN= 100802570 0257 4.96 I1N675 PE=4 SV=1 32 4 5 4 40.5 0 E+06
[0549] ADP-ribosylation
[0550] factor OS=Glycine
[0551] max OX=3847
[0552] A0A0R0 GN=GLYMA_02G 5.94 KXC5 009600 PE=3 SV=1 26 4 5 4 25.7 E+06
[0553]
[0554] Docket No. 713.006.004. PCT
[0555] EFIBgamma class
[0556] glutathione S- transferase
[0557] OS=Glycine max
[0558] OX=3847 1007 GN=100787125 8712 3.59 C6TNT2 PE=2 SV=1 10 4 5 4 47.6 5 E+06
[0559] Lectin OS=Glycine
[0560] max OX=3847
[0561] GN=LE1 PE=1 1.62 P05046 SV=1 10 2 5 2 30.9 LEI E+07
[0562] Serpin B12
[0563] OS=Homo sapiens
[0564] OX-9606 SER GN=SERPINB12 PINB 2.03 Q96P63 PE=1 SV=1 19 5 5 5 46.2 12 E+07
[0565] Glycosyltransferase
[0566] OS=Glycine max
[0567] OX=3847 1007 GN= 100790111 9011 5.15 I1MAV4 PE=3 SV=1 14 5 5 5 54 1 E+06
[0568] Cell division cycle
[0569] protein 48 homolog
[0570] OS=Glycine max
[0571] OX=3847 1007 GN= 100798680 9868 1.92 I1JXA0 PE=4 SV=1 5 4 5 2 90.8 0 E+06
[0572]
[0573] Docket No. 713.006.004. PCT
[0574] Actin- 17
[0575] OS=Dictyostelium
[0576] discoideum
[0577] OX=44689
[0578] GN=actl7 PE=3 1.60 Q554S6 SV=1 8 3 5 1 41.5 act 17 E+07
[0579] 40S ribosomal
[0580] protein S 11 N- terminal domaincontaining protein
[0581] OS=Glycine max
[0582] OX=3847 1007 GN= 100784140 8414 7.61 I1MU00 PE=3 SV=1 21 3 5 3 17.8 0 E+06
[0583] Alcohol
[0584] dehydrogenase
[0585] OS=Glycine max
[0586] OX=3847 1008 A0A0R0J GN=100801918 0191 7.05 L19 PE=3 SV=1 8 3 4 2 41 8 E+06
[0587] Cell division cycle
[0588] protein 48 homolog
[0589] OS=Glycine max
[0590] OX=3847 1007 GN= 100791603 9160 4.95 I1JPP3 PE=4 SV=1 5 3 4 1 89.6 3 E+05
[0591]
[0592] Docket No. 713.006.004. PCT
[0593] Tr-type G domaincontaining protein
[0594] OS=Glycine max
[0595] OX=3847 1008 GN= 100804251 0425 8.22 I1KU21 PE=3 SV=1 5 4 4 4 94 1 E+06
[0596] Tubulin alpha chain
[0597] OS=Glycine max
[0598] OX=3847 1007 GN= 100796371 9637 1.77 I1N898 PE=3 SV=1 9 3 4 1 49.9 1 E+06
[0599] Ribosomal protein
[0600] L14e domaincontaining protein
[0601] OS=Glycine max
[0602] OX=3847 1008 GN=100817659 1765 7.87 K7K5S3 PE=3 SV=1 10 2 4 2 20.3 9 E+06
[0603] Seed maturation
[0604] protein PM30
[0605] OS=Glycine max
[0606] OX=3847
[0607] GN=PM30 PE=2 PM3 1.61 Q9XET0 SV=1 26 4 4 4 15.1 0 E+07
[0608] 60S ribosomal 1007 protein L4 C- 8682 7.43 I1L8R1 terminal domain- 13 4 4 4 44.7 8 E+06
[0609]
[0610] Docket No. 713.006.004. PCT
[0611] containing protein
[0612] OS=Glycine max
[0613] OX=3847
[0614] GN=100786828
[0615] PE=3 SV=1
[0616] Formate
[0617] dehydrogenase,
[0618] mitochondrial
[0619] OS=Glycine max
[0620] OX=3847 1007 GN= 100794313 9431 6.02 C6T9Z5 PE=2 SV=1 18 4 4 4 42.8 3 E+06
[0621] 34 kDa maturing
[0622] seed protein
[0623] OS=Glycine max
[0624] OX=3847 GN=P34 9.26 064458 PE=2 SV=1 14 3 4 3 42.7 P34 E+06
[0625] Oleosin
[0626] OS=Glycine max
[0627] OX=3847 1003 GN= 100301903 0190 7.38 I1JUP4 PE=3 SV=1 23 2 4 1 17.8 3 E+06
[0628] Sucrose synthase
[0629] OS=Glycine max
[0630] OX=3847 1008 GN= 100802045 0204 2.02 K7MZJ0 PE=3 SV=1 6 3 3 2 92.2 5 E+06
[0631]
[0632] Docket No. 713.006.004. PCT
[0633] RRM domaincontaining protein
[0634] OS=Glycine max
[0635] OX=3847 1007 GN= 100796543 9654 1.74 K7LP96 PE=4 SV=1 16 2 3 2 16.6 3 E+06
[0636] 60S ribosomal
[0637] protein L27
[0638] OS=Glycine max
[0639] OX=3847 1005 GN= 100527246 2724 3.41 C6T3R4 PE=2 SV=1 14 2 3 2 15.7 6 E+06
[0640] DEAD-box ATP- dependent RNA
[0641] helicase 56
[0642] OS=Glycine max
[0643] OX=3847 1007 A0A0R0J GN= 100796232 9623 4.45 KX7 PE=4 SV=1 7 3 3 3 48.2 2 E+06
[0644] Alcohol
[0645] dehydrogenase 1
[0646] OS=Glycine max
[0647] OX=3847
[0648] A0A0R4J GN=GLYMA_13G 4.74 4U4 035200 PE=3 SV=1 6 2 3 1 41.1 E+06
[0649]
[0650] Docket No. 713.006.004. PCT
[0651] Ribosomal protein
[0652] L5 eukaryotic C- terminal domaincontaining protein
[0653] OS=Glycine max
[0654] OX=3847 1007 GN= 100785668 8566 2.49 I1M3C1 PE=3 SV=1 15 3 3 2 34 8 E+06
[0655] Bowman-Birk
[0656] serine protease
[0657] inhibitors family
[0658] domain-containing
[0659] protein OS=Glycine
[0660] max OX=3847 2.76 C6SVL8 PE=2 SV=1 14 2 3 2 13.1 E+07
[0661] Bet v I / Major latex
[0662] protein domaincontaining protein
[0663] OS=Glycine max
[0664] OX=3847 1005 GN= 100527097 2709 1.47 C6T3A2 PE=2 SV=1 30 3 3 3 16.7 7 E+07
[0665] Malate synthase
[0666] OS=Glycine max
[0667] OX=3847
[0668] GN=GLYMA_17G 2.88 I1MUM7 128000 PE=3 SV=1 6 3 3 3 64.3 E+06
[0669]
[0670] Docket No. 713.006.004. PCT
[0671] 40S ribosomal
[0672] protein S3a
[0673] OS=Glycine max
[0674] OX=3847 1008 GN= 100813273 1327 2.01 C6TI64 PE=2 SV=1 13 2 2 2 29.7 3 E+06
[0675] Calreticulin
[0676] OS=Glycine max
[0677] OX=3847 1000 GN= 100037475 3747 2.80 I1LB53 PE=3 SV=1 5 2 2 2 49.9 5 E+06
[0678] 40S ribosomal
[0679] protein S6
[0680] OS=Glycine max
[0681] OX=3847 PE=2 1.08 C6TEU3 SV=1 9 2 2 2 28.4 E+06
[0682] Glu S.griseus
[0683] protease inhibitor
[0684] OS=Glycine max
[0685] OX=3847 1005 GN= 100527215 2721 1.01 C6T3N0 PE=2 SV=1 26 2 2 2 7.6 5 E+07
[0686] Oleosin
[0687] OS=Glycine max
[0688] OX=3847
[0689] GN=GLYMA_06G 2.63 K7KTR9 078700 PE=3 SV=1 18 2 2 1 22.6 E+07
[0690]
[0691] Docket No. 713.006.004. PCT
[0692] Ribosomal protein
[0693] L6 alpha-beta
[0694] domain-containing
[0695] protein OS=Glycine
[0696] max OX=3847
[0697] GN=GLYMA_04G 1.61 I1JYG3 226900 PE=3 SV=1 17 2 2 1 21.7 E+06
[0698] Dehydrin
[0699] OS=Glycine max
[0700] OX=3847 1008 GN= 100816984 1698 8.84 C6TAX7 PE=2 SV=1 9 2 2 2 24.2 4 E+05
[0701] Oleosin
[0702] OS=Glycine max
[0703] OX=3847 1003 GN= 100306353 0635 3.85 C6SZ13 PE=2 SV=1 12 2 2 2 15.8 3 E+06
[0704] Translation
[0705] elongation factor
[0706] EFIB beta / delta
[0707] subunit guanine
[0708] nucleotide exchange
[0709] domain-containing
[0710] protein OS=Glycine
[0711] max OX=3847 1007 A0A0R0J GN= 100777627 7762 3.77 198 PE=3 SV=1 14 2 2 2 25 7 E+06
[0712]
[0713] Docket No. 713.006.004. PCT
[0714] Ribosomal protein
[0715] L5 eukaryotic C- terminal domaincontaining protein
[0716] OS=Glycine max
[0717] OX=3847PE=2 3.38 C6TL04 SV=1 6 2 2 1 34.1 E+06
[0718] Oleosin
[0719] OS=Glycine max
[0720] OX=3847
[0721] GN=GLYMA_19G 1.41 I1N747 063400 PE=3 SV=1 10 2 2 1 23.6 E+07
[0722] 60S ribosomal
[0723] protein Lil
[0724] OS=Glycine max
[0725] OX=3847
[0726] A0A0R0J GN=GLYMA_06G 3.22 NS2 317400 PE=3 SV=1 9 2 2 2 22.9 E+06
[0727] Ribosomal protein
[0728] L6 alpha-beta
[0729] domain-containing
[0730] protein OS=Glycine
[0731] max OX=3847 1008 GN=100810611 1061 2.42 C6TJH2 PE=2 SV=1 17 2 2 1 21.7 1 E+06
[0732]
[0733] Docket No. 713.006.004. PCT
[0734] Calreticulin
[0735] OS=Glycine max
[0736] OX=3847 1008 GN= 100811997 1199 6.34 I1NF03 PE=3 SV=1 5 2 2 2 52 7 E+05
[0737] RuBisCO large
[0738] subunit-binding
[0739] protein subunit
[0740] beta, chloroplastic
[0741] OS=Pisum sativum
[0742] OX=3888 PE=1 1.67 P08927 SV=2 4 2 2 2 62.9 E+06
[0743] Glutathione
[0744] peroxidase
[0745] OS=Glycine max
[0746] OX=3847 PE=2 1.11 C6SZK3 SV=1 23 2 2 2 18.4 E+06
[0747] Ribosomal protein
[0748] L10e / L16 domaincontaining protein
[0749] OS=Glycine max
[0750] OX=3847 1007 GN= 100779884 7988 5.88 I1MZN4 PE=3 SV=1 8 2 2 2 29.8 4 E+06
[0751] 60S ribosomal
[0752] protein L3 1.43 C6THR0 OS=Glycine max 6 2 2 2 44.4 E+06
[0753]
[0754] Docket No. 713.006.004. PCT
[0755] OX-3847 PE-2
[0756] SV=1
[0757] Proteasome subunit
[0758] alpha type
[0759] OS=Glycine max
[0760] OX=3847 PE=2 3.79 C6SW82 SV=1 11 2 2 2 26 E+06
[0761] 40S ribosomal
[0762] protein S7
[0763] OS=Glycine max
[0764] OX=3847 1005 GN=100527680 2768 3.28 C6T530 PE=2 SV=1 16 2 2 2 22 0 E+06
[0765] Dehydrin
[0766] OS=Glycine max
[0767] OX=3847PE=2 2.18 C6SVM2 SV=1 27 2 2 2 17.4 E+06
[0768] Glutaredoxin- dependent
[0769] peroxi redoxin
[0770] OS=Glycine max
[0771] OX=3847
[0772] A0A0R0I GN=GLYMA_09G 2.81 AF2 192800 PE=3 SV=1 6 1 2 1 17.4 E+06
[0773]
[0774] Docket No. 713.006.004. PCT
[0775] 60S ribosomal
[0776] protein L35
[0777] OS=Glycine max
[0778] OX=3847 1003 GN=100305671 0567 4.76 C6SW56 PE=2 SV=1 7 1 2 1 14.3 1 E+06
[0779] Uncharacterized
[0780] protein OS=Glycine
[0781] max OX=3847 1007 GN= 100778706 7870 1.33 I1M397 PE=4 SV=1 3 1 1 1 45.6 6 E+06
[0782] 60S ribosomal
[0783] protein L24
[0784] OS=Prunus avium
[0785] OX=42229
[0786] GN=RPL24 PE=2 RPL 1.87 Q9FUL4 SV=1 4 1 1 1 21.3 24 E+06
[0787] 60S ribosomal
[0788] protein L7a
[0789] OS=Glycine max
[0790] OX=3847 1007 GN= 100792324 9232 1.38 I1LIV8 PE=3 SV=1 3 1 1 1 29.4 4 E+06
[0791] Acyl -coenzyme A
[0792] oxidase 1008 OS=Glycine max 1082 7.04 I1J9T7 OX=3847 1 1 1 1 82 9 E+05
[0793]
[0794] Docket No. 713.006.004. PCT
[0795] GN- 100810829
[0796] PE=3 SV=2
[0797] GTP binding
[0798] protein OS=Glycine
[0799] max OX=3847 1.20 Q39861 PE=2 SV=1 5 1 1 1 24 E+06
[0800] Uncharacterized
[0801] protein OS=Glycine
[0802] max OX=3847
[0803] GN=GLYMA_15G 1.62 K7MBV6 167400 PE=3 SV=1 4 1 1 1 31.9 E+06
[0804] 11 -beta- hydroxy steroid
[0805] dehydrogenase-like
[0806] 5 OS=Glycine max
[0807] OX=3847 1007 GN= 100780731 8073 4.98 C6T871 PE-2 SV=1 3 1 1 1 40.1 1 E+05
[0808] Proteasome subunit
[0809] alpha type
[0810] OS=Glycine max
[0811] OX=3847 1007 GN= 100799108 9910 1.65 C6TH59 PE=2 SV=1 6 1 1 1 25.6 8 E+06
[0812] Heat shock protein 8.94 B6EBD7 90-1 OS=Glycine 2 1 1 1 80.4 E+08
[0813]
[0814] Docket No. 713.006.004. PCT
[0815] max OX-3847
[0816] PE=2 SV=1
[0817] Hl 5 domaincontaining protein
[0818] OS=Glycine max
[0819] OX=3847 1007 GN=100795994 9599 2.93 I1L8A9 PE=3 SV=1 3 1 1 1 30.9 4 E+05
[0820] 60S ribosomal
[0821] protein LI 8a
[0822] OS=Glycine max
[0823] OX=3847 1003 GN= 100306174 0617 2.07 C6SYA5 PE=2 SV=1 4 1 1 1 21.3 4 E+06
[0824] RRM domaincontaining protein
[0825] OS=Glycine max
[0826] OX-3847 1007 GN= 100799124 9912 1.71 C6TJN7 PE=2 SV=1 6 1 1 1 28.1 4 E+06
[0827] Uncharacterized
[0828] protein OS=Glycine
[0829] max OX=3847 1005 GN=100500648 0064 2.87 C6T2D3 PE=2 SV=1 3 1 1 1 23.5 8 E+06
[0830]
[0831] Docket No. 713.006.004. PCT
[0832] UspA domaincontaining protein
[0833] OS=Glycine max
[0834] OX=3847 1008 GN= 100804300 0430 1.27 I1JFX0 PE=4 SV=1 14 1 1 1 20.7 0 E+06
[0835] Uncharacterized
[0836] protein OS=Glycine
[0837] max OX=3847 1007 GN=100795875 9587 1.49 I1LPN7 PE=4 SV=1 11 1 1 1 18.8 5 E+06
[0838] Tubulin beta chain
[0839] OS=Glycine max
[0840] OX-3847 PE-2 2.27 C6TH12 SV=1 3 1 1 1 51.5 E+05
[0841] Uncharacterized
[0842] protein OS=Glycine
[0843] max OX=3847 1008 GN= 100812268 1226 9.82 I1MQG3 PE=4 SV=1 15 1 1 1 22.2 8 E+05
[0844] 60S ribosomal
[0845] protein L 13
[0846] OS=Glycine max
[0847] OX=3847 PE=2 1.27 C6SYZ4 SV=1 10 1 1 1 26.8 E+06
[0848]
[0849] Docket No. 713.006.004. PCT
[0850] Protein disulfide
[0851] isomerase family
[0852] OS=Glycine max
[0853] OX=3847
[0854] GN=GmPDIM GmP 9.51 A9CPA7 PE=2 SV=1 5 1 1 1 47.6 DIM E+05
[0855] FAD / NAD(P)- binding domaincontaining protein
[0856] OS=Glycine max
[0857] OX=3847 1008 GN= 100813980 1398 1.53 C6TNF9 PE=2 SV=1 4 1 1 1 39.1 0 E+06
[0858] Proteasome subunit
[0859] beta OS=Glycine
[0860] max OX=3847 1.14 C6SY64 PE=2 SV=1 12 1 1 1 24.5 E+06
[0861] Bet v I / Major latex
[0862] protein domaincontaining protein
[0863] OS=Glycine max
[0864] OX=3847 1005 GN= 100527201 2720 5.06 C6T3L5 PE=2 SV=1 8 1 1 1 16.9 1 E+06
[0865] Isoflavone synthase 1.66 Q5DP49 2 OS=Glycine max 3 1 1 1 59.3 E+06
[0866]
[0867] Docket No. 713.006.004. PCT
[0868] OX-3847 PE-3
[0869] SV=1
[0870] 60S acidic
[0871] ribosomal protein
[0872] PO OS=Glycine
[0873] max OX=3847 1007 GN= 100777482 7748 8.81 C6TGA6 PE=2 SV=1 6 1 1 1 34.2 2 E+05
[0874] 26 S proteasome
[0875] non-ATPase
[0876] regulatory subunit 2
[0877] homolog
[0878] OS=Glycine max
[0879] OX=3847 1007 GN- 100799779 9977 8.00 I1KEY6 PE=3 SV=1 1 1 1 1 97.3 9 E+05
[0880] 40 S ribosomal
[0881] protein S15
[0882] OS=Glycine max
[0883] OX=3847 1008 GN= 100801408 0140 5.81 I1KNN1 PE=3 SV=1 8 1 1 1 17.6 8 E+05
[0884] Ribosomal
[0885] L28e / Makl6
[0886] domain-containing 1.02 C6T0W1 protein OS=Glycine 7 1 1 1 16.9 E+06
[0887]
[0888] Docket No. 713.006.004. PCT
[0889] max OX-3847
[0890] PE=2 SV=1
[0891] Chaperonin
[0892] CPN60-2,
[0893] mitochondrial
[0894] OS=Glycine max
[0895] OX=3847 1008 GN= 100820546 2054 I1NHW4 PE=3 SV=1 26 12 14 1 61.2 6
[0896] Protein disulfideisomerase
[0897] OS=Glycine max
[0898] OX=3847 1007 GN= 100788687 8868 I1KAB7 PE-3 SV=1 22 7 9 1 56.1 7
[0899] Glyceraldehyde-3- phosphate
[0900] dehydrogenase
[0901] OS=Glycine max
[0902] OX=3847
[0903] GN=GAPC1 PE=2 GAP Q2I0H4 SV=1 25 6 9 1 36.7 Cl
[0904] Actin-2
[0905] 0 S=Dib othri ocepha
[0906] lus dendriticus ACT P53456 OX=28845 21 5 9 1 41.7 2
[0907]
[0908] Docket No. 713.006.004. PCT
[0909] GN-ACT2 PE-2
[0910] SV=1
[0911] Actin (Fragment)
[0912] OS=Spodoptera
[0913] littoral is OX=7109
[0914] Q11212 PE=2 SV=1 45 5 8 1 18
[0915] Gly ceraldehy de-3 - phosphate
[0916] dehydrogenase
[0917] OS=Glycine max
[0918] OX=3847
[0919] GN=GLYMA_04G
[0920] I1JXG9 193400 PE=3 SV=1 27 6 8 1 36.7
[0921] Elongation factor 1- alpha-A
[0922] 0 S= Schizosaccharo
[0923] myces pombe
[0924] (strain 972 / ATCC
[0925] 24843) OX=284812
[0926] GN=tefl01 PE=1 teflO P0CT53 SV=1 13 6 7 1 49.6 1
[0927] Actin
[0928] OS=Scherffelia
[0929] dubia OX=3190
[0930] 065314 PE=2 SV=1 12 4 6 1 41.8
[0931]
[0932] Docket No. 713.006.004. PCT
[0933] KH domaincontaining protein
[0934] akap-1
[0935] OS=Caenorhabditis
[0936] elegans OX=6239
[0937] GN=akap-l PE=3 akap- Q09285 SV=2 3 1 2 1 96.4 1
[0938] 60S ribosomal
[0939] protein L23
[0940] OS=Glycine max
[0941] OX=3847 1008 GN=100811636 1163 C6T0H9 PE=2 SV=1 25 2 2 2 15 6
[0942] CobW / HypB / UreG
[0943] nucleotide-binding
[0944] domain-containing
[0945] protein OS=Glycine
[0946] max OX=3847
[0947] GN=547551 PE=2 5475 C6T9B1 SV=1 11 2 2 2 31.4 51
[0948] Transketolase
[0949] OS=Homo sapiens
[0950] OX=9606
[0951] GN=TKT PE=1
[0952] P29401 SV=3 5 2 2 2 67.8 TKT
[0953] APH domainI1L0W9 containing protein 1 1 2 1 85.2
[0954]
[0955] Docket No. 713.006.004. PCT
[0956] OS=Glycine max
[0957] OX=3847
[0958] GN=GLYMA_09G
[0959] 042000 PE=3 SV=2
[0960] Ig kappa chain V- VI region NQ2-6.1
[0961] OS=Mus musculus
[0962] OX= 10090 PE=2
[0963] P04945 SV=1 15 1 2 1 11.7
[0964] Alpha-2- macroglobulin
[0965] OS=Homo sapiens
[0966] OX=9606
[0967] GN=A2M PE=1
[0968] P01023 SV=3 2 2 2 2 163.2 A2M
[0969] Acetyltransferase
[0970] component of
[0971] pyruvate
[0972] dehydrogenase
[0973] complex
[0974] OS=Glycine max
[0975] OX=3847 1008 GN= 100804938 0493 I1KH71 PE=3 SV=1 2 1 2 1 59.4 8
[0976] Ribosomal protein
[0977] L2 C-terminal
[0978] C6TDL5 domain-containing 8 2 2 2 28.1
[0979]
[0980] Docket No. 713.006.004. PCT
[0981] protein OS=Glycine
[0982] max OX=3847
[0983] PE=2 SV=1
[0984] Chaperonin GroEL
[0985] OS=Delftia
[0986] acidovorans (strain
[0987] DSM 14801 / SPH- 1) OX=398578
[0988] GN=groEL PE=3 groE A9BXL3 SV=1 7 2 2 2 57.1 L
[0989] Nascent
[0990] polypeptide- associated complex
[0991] subunit alpha,
[0992] muscle-specific
[0993] form OS=Mus
[0994] musculus
[0995] OX= 10090
[0996] GN=NacaPE=l
[0997] P70670 SV=2 1 1 1 1 220.4 Naca
[0998] 60S ribosomal
[0999] protein L3
[1000] OS=Homo sapiens
[1001] OX=9606
[1002] GN=RPL3 PE=1 RPL P39023 SV=2 5 1 1 1 46.1 3
[1003]
[1004] Docket No. 713.006.004. PCT
[1005] Three prime repair
[1006] exonuclease 2
[1007] OS=Homo sapiens
[1008] OX=9606
[1009] GN=TREX2 PE=1 TRE Q9BQ50 SV=2 4 1 1 1 25.9 X2
[1010] C4H OS=Glycine
[1011] max OX=3847
[1012] C5IWL6 PE=2 SV=1 2 1 1 1 58
[1013] Deoxyhypusine
[1014] hydroxylase
[1015] OS=Emericella
[1016] nidulans (strain
[1017] FGSC A4 / ATCC
[1018] 38163 / CBS 112.46
[1019] / NRRL 194 /
[1020] Ml 39) OX=227321
[1021] GN=lial PE=3
[1022] Q5AW32 SV=1 9 1 1 1 36.6 lial
[1023] Calmodulin-like
[1024] protein 3 OS=Homo
[1025] sapiens OX=9606
[1026] GN=CALML3 CAL P27482 PE=1 SV=2 11 1 1 1 16.9 ML3
[1027] Histidine 1007 kinase / HSP90-like 7997 I1MC31 ATPase domain- 1 1 1 1 97.3 6
[1028]
[1029] Docket No. 713.006.004. PCT
[1030] containing protein
[1031] OS=Glycine max
[1032] OX=3847
[1033] GN=100779976
[1034] PE=3 SV=1
[1035] Eukaryotic
[1036] translation initiation
[1037] factor 5 A
[1038] OS=Glycine max
[1039] OX=3847PE=2
[1040] C6SXH6 SV=1 8 1 1 1 17.5
[1041] 60S ribosomal
[1042] protein L13
[1043] OS=Glycine max
[1044] OX-3847 1008 GN=100805957 0595 I1JVU2 PE=3 SV=1 12 1 1 1 23.9 7
[1045] A-kinase anchor
[1046] protein SPHKAP
[1047] OS=Rattus
[1048] norvegicus
[1049] OX=10116
[1050] GN=Sphkap PE=1 Sphk P0C6C0 SV=1 0 1 1 1 184.3 ap
[1051] Thioredoxin 1008 domain-containing 0922 I1KXE7 protein OS=Glycine 2 1 1 1 64.2 4
[1052]
[1053] Docket No. 713.006.004. PCT
[1054] max OX-3847
[1055] GN= 100809224
[1056] PE=3 SV=1
[1057] Fructosebisphosphate
[1058] aldolase C
[1059] OS=Homo sapiens
[1060] OX=9606
[1061] GN=ALDOC PE=1 ALD P09972 SV=2 6 1 1 1 39.4 OC
[1062] Aspartate
[1063] aminotransferase,
[1064] cytoplasmic
[1065] OS=Pan troglodytes
[1066] OX-9598
[1067] GN=GOT1 PE=2 GOT A5A6K8 SV=1 5 1 1 1 46.2 1
[1068] Proteasome subunit
[1069] beta type-7 OS=Sus
[1070] scrofa OX=9823
[1071] GN=PSMB7 PE=2 PSM A1XQU1 SV=2 4 1 1 1 30 B7
[1072] Ig kappa chain V
[1073] region Mem5
[1074] (Fragment)
[1075] P84750 OS=Mus musculus 7 1 1 1 13.2
[1076]
[1077] Docket No. 713.006.004. PCT
[1078] OX- 10090 PE=1
[1079] SV=1
[1080] Insulin-degrading
[1081] enzyme OS=Homo
[1082] sapiens OX=9606
[1083] GN=IDE PE=1
[1084] P14735 SV=4 1 1 1 1 117.9 IDE
[1085] Immunoglobulin
[1086] kappa variable 3D- 11 OS=Homo
[1087] sapiens OX=9606 IGK A0A0A0 GN=IGKV3D-11 V3D- MRZ8 PE=3 SV=6 8 1 1 1 12.6 11
[1088] Glutamine
[1089] synthetase
[1090] OS=Homo sapiens
[1091] OX=9606
[1092] GN-GLUL PE=1 GLU P15104 SV=4 2 1 1 1 42 L
[1093] Isocitrate
[1094] dehydrogenase
[1095] [NADP]
[1096] 0 S=C ory neb acteriu
[1097] m glutamicum
[1098] (strain ATCC
[1099] 13032 / DSM
[1100] P50216 20300 / BCRC 2 1 1 1 80 icd
[1101]
[1102] Docket No. 713.006.004. PCT
[1103] 11384 / JCM 1318 /
[1104] LMG3730 /
[1105] NCIMB 10025)
[1106] OX= 196627
[1107] GN=icd PE=1
[1108] SV=1
[1109] Ribosomal protein
[1110] S13 / S15 N-terminal
[1111] domain-containing
[1112] protein OS=Glycine
[1113] max OX=3847
[1114] C6T9Q3 PE=2 SV=1 11 1 1 1 17.2
[1115] 12- oxophytodi enoate
[1116] reductase 3
[1117] OS=Solanum
[1118] lycopersicum
[1119] OX=4081
[1120] GN=OPR3 PE=1 OPR Q9FEW9 SV=1 3 1 1 1 43.5 3
[1121] V-type proton
[1122] ATPase catalytic
[1123] subunit A OS=Bos
[1124] taurus OX=9913 ATP GN=ATP6V1A 6V1 P31404 PE=1 SV=2 2 1 1 1 68.3 A
[1125]
[1126] Docket No. 713.006.004. PCT
[1127] Lysosomal
[1128] protective protein
[1129] OS=Homo sapiens
[1130] OX=9606
[1131] GN=CTSA PE=1 CTS P10619 SV=2 2 1 1 1 54.4 A
[1132] Proteasome subunit
[1133] alpha type
[1134] OS=Glycine max
[1135] OX=3847 1008 GN= 100820387 2038 I1K1X5 PE=3 SV=1 7 1 1 1 28.7 7
[1136] 40S ribosomal
[1137] protein S26
[1138] OS=Glycine max
[1139] OX=3847 1003 GN=100305706 0570 C6SWA5 PE=2 SV=1 7 1 1 1 14.9 6
[1140] Parkinson disease
[1141] protein 7 homolog
[1142] OS=Bos taurus
[1143] OX=9913
[1144] GN-PAR. K7 PE=2 PAR Q5E946 SV=1 8 1 1 1 20 K7
[1145] 60S ribosomal 1004 protein L32-1 9984 C6SXB4 OS=Glycine max 10 1 1 1 15.6 6
[1146]
[1147] Docket No. 713.006.004. PCT
[1148] OX-3847
[1149] GN= 100499846
[1150] PE=2 SV=1
[1151] Tropomyosin- 1,
[1152] isoforms 33 / 34
[1153] OS=Drosophila
[1154] melanogaster
[1155] OX=7227 GN=Tml
[1156] P49455 PE=2 SV=2 2 1 1 1 54.6 Tml
[1157] Ig gamma-2A chain
[1158] C region,
[1159] membrane-bound
[1160] form OS=Mus
[1161] musculus
[1162] OX- 10090
[1163] GN=Igh-la PE=1 Igh- P01865 SV=3 4 1 1 1 43.9 la
[1164] GTP-binding
[1165] protein ypt5
[1166] O S= C ol 1 et otri chum
[1167] musicola
[1168] OX=2175873
[1169] A0A8H6J GN=CMUS01_l 14
[1170] YB3 12 PE=4 SV=1 5 1 1 1 24
[1171] WD REPEAT S R 1007 EGION domain7820 C6TJD3 containing protein 7 1 1 1 35.7 5
[1172]
[1173] Docket No. 713.006.004. PCT
[1174] OS=Glycine max
[1175] OX=3847
[1176] GN=100778205
[1177] PE=2 SV=1
[1178] 6-phosphogluconate
[1179] dehydrogenase,
[1180] decarboxylating
[1181] OS=Glycine max
[1182] OX=3847 1007 A0A0R0E GN=100799034 9903 HR6 PE=3 SV=1 3 1 1 1 59.3 4
[1183] Threonine— tRNA
[1184] ligase 2,
[1185] cytoplasmic
[1186] OS=Xenopus
[1187] tropicalis OX=8364
[1188] GN=tars3 PE=2
[1189] Q0V9S0 SV=1 1 1 1 1 93.3 tars3
[1190] Purine nucleoside
[1191] phosphorylase
[1192] OS=Homo sapiens
[1193] OX=9606 GN=PNP
[1194] P00491 PE=1 SV=2 6 1 1 1 32.1 PNP
[1195] 60S ribosomal
[1196] protein LIO
[1197] 0 S=Enceph alitozoo RPL Q8SR96 n cuniculi (strain 4 1 1 1 25 10
[1198]
[1199] Docket No. 713.006.004. PCT
[1200] GB-M1)
[1201] OX=284812
[1202] GN=RPL10 PE=1
[1203] SV=1
[1204] Amino acid
[1205] permease 6
[1206] OS=Arabidopsis
[1207] thaliana OX=3702
[1208] GN=AAP6 PE=1 AAP P92934 SV=1 4 1 1 1 53 6
[1209] 60S ribosomal
[1210] protein L30
[1211] 0 S=Ophiophagus
[1212] hannah OX=8665
[1213] GN=RPL30 PE=3 RPL P67884 SV=2 10 1 1 1 12.8 30
[1214] Sulfotransferase
[1215] 2B1 OS-Homo
[1216] sapiens OX=9606
[1217] GN=SULT2B1 SUL 000204 PE=1 SV=2 4 1 1 1 41.3 T2B1
[1218] Protein POF1B
[1219] OS=Homo sapiens
[1220] OX=9606
[1221] GN=POF1B PE=1 POF Q8WVV4 SV=3 2 1 1 1 68 IB
[1222]
[1223] Docket No. 713.006.004. PCT
[1224] Peroxisomal 3- ketoacyl-CoA
[1225] thiolase
[1226] OS=Glycine max
[1227] OX=3847 1001 GN=100170734 7073 B0M1A9 PE=2 SV=1 2 1 1 1 48.6 4
[1228] Catalase OS=Homo
[1229] sapiens OX=9606
[1230] GN=CAT PE=1
[1231] P04040 SV=3 2 1 1 1 59.7 CAT
[1232] 40S ribosomal
[1233] protein S24
[1234] OS=Glycine max
[1235] OX=3847 1008 GN= 100802918 0291 C6TAW2 PE=2 SV=1 11 1 1 1 15.8 8
[1236] peptidylprolyl
[1237] isomerase
[1238] OS=Glycine max
[1239] OX=3847 PE=2
[1240] C6SV88 SV=1 20 1 1 1 15.9
[1241] Galectin-3-binding
[1242] protein OS=Homo
[1243] sapiens OX=9606 LGA GN=LGALS3BP LS3 Q08380 PE=1 SV=1 2 1 1 1 65.3 BP
[1244]
[1245] Docket No. 713.006.004. PCT
[1246] Ig heavy chain V
[1247] region IR2
[1248] OS=Rattus
[1249] norvegicus
[1250] OX=10116 PE=4
[1251] P01805 SV=1 6 1 1 1 16
[1252] Carbohydrate
[1253] kinase PfkB
[1254] domain-containing
[1255] protein OS=Glycine
[1256] max OX=3847 1008 GN=100812560 1256 K7LT57 PE=3 SV=1 4 1 1 1 37.4 0
[1257] Ribosomal protein
[1258] L15 OS=Glycine
[1259] max OX=3847 1007 GN=100798324 9832 C6SV78 PE=2 SV=1 5 1 1 1 24.1 4
[1260] Immunoglobulin
[1261] kappa variable 3D- 15 OS=Homo
[1262] sapiens OX=9606 IGK A0A087 GN=IGKV3D-15 V3D- WSY6 PE=3 SV=6 8 1 1 1 12.5 15
[1263] Keratin, type I
[1264] cytoskeletal 10 KRT 1.76 P13645 OS=Homo sapiens 37 18 103 18 58.8 10 E+09
[1265]
[1266] Docket No. 713.006.004. PCT
[1267] OX-9606
[1268] GN=KRT10 PE=1
[1269] SV=6
[1270] Keratin, type II
[1271] cytoskeletal 1
[1272] OS=Homo sapiens
[1273] OX=9606
[1274] GN=KRT1 PE=1 KRT 2.68 P04264 SV=6 27 18 52 13 66 1 E+09
[1275] Keratin, type I
[1276] cytoskeletal 9
[1277] OS=Homo sapiens
[1278] OX=9606
[1279] GN=KRT9 PE=1 KRT 1.94 P35527 SV=3 31 13 30 13 62 9 E+08
[1280] Keratin, type II
[1281] cytoskeletal 2
[1282] epidermal
[1283] OS=Homo sapiens
[1284] OX=9606
[1285] GN=KRT2 PE=1 KRT 1.09 P35908 SV=2 32 14 18 11 65.4 2 E+08
[1286] Keratin, type II
[1287] cytoskeletal 6C
[1288] OS=Homo sapiens KRT 1.17 P48668 OX=9606 17 11 16 6 60 6C E+08
[1289]
[1290] Docket No. 713.006.004. PCT
[1291] GN-KRT6C PE=1
[1292] SV=3
[1293] Keratin, type II
[1294] cytoskeletal 5
[1295] OS=Bos taurus
[1296] OX=9913
[1297] GN=KRT5 PE=1 KRT 1.28 Q5XQN5 SV=1 13 8 13 2 62.9 5 E+07
[1298] Keratin, type I
[1299] cytoskeletal 17
[1300] OS=Pan troglodytes
[1301] OX=9598
[1302] GN=KRT17 PE=2 KRT 1.04 A5A6M0 SV=1 16 6 11 3 48.1 17 E+08
[1303] Keratin, type I
[1304] cytoskeletal 14
[1305] OS=Homo sapiens
[1306] OX-9606
[1307] GN=KRT14 PE=1 KRT 2.62 P02533 SV=4 14 5 7 3 51.5 14 E+06
[1308] Keratin, type I
[1309] cytoskeletal 23
[1310] OS=Mus musculus
[1311] OX= 10090
[1312] GN=Krt23 PE=1 Krt2 1.21 Q99PS0 SV=1 4 2 5 1 48 3 E+06
[1313]
[1314] Docket No. 713.006.004. PCT
[1315] Keratin, type I
[1316] cytoskeletal 16
[1317] OS=Homo sapiens
[1318] OX=9606
[1319] GN=KRT16 PE=1 KRT 5.58 P08779 SV=4 12 4 5 3 51.2 16 E+06
[1320] Keratin, type II
[1321] cytoskeletal 75
[1322] 0S=Mus musculus
[1323] 0X= 10090
[1324] GN=Krt75 PE=1 Krt7 Q8BGZ7 SV=1 9 3 4 1 59.7 5
[1325] Keratin, type II
[1326] cytoskeletal 78
[1327] OS=Homo sapiens
[1328] OX=9606
[1329] GN=KRT78 PE=1 KRT 3.49 Q8N1N4 SV=2 5 2 4 2 56.8 78 E+06
[1330] Keratin, type I
[1331] cytoskeletal 18
[1332] OS=Scyliorhinus
[1333] stellaris OX=68454
[1334] GN=krt18 PE=1 3.58 057611 SV=1 2 1 3 1 46.8 krt18 E+07
[1335]
[1336] EXAMPLE 2: Reduction of Multiple CPIPs Through Sequential CRTSPR-Mediated Gene Editing Docket No. 713.006.004. PCT
[1337] A sequential gene editing strategy was employed to generate soybean lines with reduced expression of multiple CPIPs. Initial transformations targeted the GLYMA.l 1G153800 gene encoding an annexin protein previously identified as a significant CPIP. Soybean cultivar Williams 82 were transformed using Agrobacterium-mediated delivery of a vector containing Cas9 and a guide RNA targeting the first exon of GLYMA.l 1G153800.
[1338] Primary transformants were screened using PCR amplification and sequencing of the target region to identify plants carrying frameshift mutations. Plants containing confirmed null mutations were grown to maturity and seeds collected. Homozygous mutant lines were identified in the T1 generation through segregation analysis and confirmed by sequencing.
[1339] Selected homozygous annexin mutant lines underwent a second round of transformation to target the GLYMA.l 5G036300 gene encoding lipoxygenase 3. The same Cas9 system was employed with a new guide RNA specific to the lipoxygenase target. Double mutant lines were identified and confirmed using the same screening approach.
[1340] Protein extracts from wild-type, single mutant, and double mutant lines were analyzed using standardized casein purification procedures to quantify the relative contribution of each CPIP to purification interference. Analysis included quantification of total protein yield and purity using Bradford assays and SDS-PAGE. Western blot analysis was performed to confirm reduction of target CPIPs, followed by mass spectrometry analysis of co-purifying proteins. The specific activity and recovery efficiency for casein purification was determined under standardized conditions.
[1341] The double mutant lines showing optimal reduction in CPIP interference were selected for final transformation with a casein expression construct. The construct contained a codon-optimized bovine aS 1 -casein gene under control of the soybean beta-conglycinin promoter, with KDEL sequence for ER retention.
[1342] Casein expression and purification efficiency were evaluated in the resulting triple-transformed plants. Expression levels of casein in seed tissue were measured using quantitative protein assays. The efficiency of protein extraction from seed tissue was determined under standardized conditions. Overall purification yield and purity were assessed using analytical chromatography Docket No. 713.006.004. PCT
[1343] and gel electrophoresis. Residual CPIPs in purified casein preparations were monitored using targeted proteomics approaches. The functional properties of the purified casein were characterized using standard dairy protein analytical methods.
[1344] This sequential modification approach was expected to result in plant lines showing significantly improved casein purification efficiency compared to lines expressing casein in a wild-type background. The contribution of each genetic modification to the final phenotype was clearly documented through the stepwise analysis process.
[1345] To identify potential CPIPs, affinity purification experiments were performed using magnetic agarose beads conjugated with casein as the capture ligand. Wild-type soybean protein extracts were incubated with the casein-conjugated beads under standard purification conditions. Copurifying proteins were eluted and analyzed by mass spectrometry to identify endogenous soybean proteins that demonstrate specific or non-specific association with casein during purification procedures. Table 9 disclosed the identified proteins and their relevant characteristics.
[1346] EXAMPLE 3: Development of RNA Interference-Mediated CPIP Reduction System with Tissue-Specific Expression
[1347] A multi-target RNA interference approach was developed to simultaneously reduce expression of multiple CPIPs in developing soybean seeds. The RNAi construct was designed to target conserved regions of both the GLYMA.11G153800 annexin gene family and the GLYMA.15G036300 lipoxygenase gene family (i.e., at least 90% sequence identity to said gene families). The construct further incorporated sense and antisense fragments of each target separated by a soybean intron sequence, in combination with SEQ ID NO: 43, SEQ ID NO: 44, or SEQ ID NO: 45, to facilitate efficient functional short hairpin RNA formation.
[1348] Expression of the RNAi construct (SEQ ID NO: 43, SEQ ID NO: 44, or SEQ ID NO: 45) was driven by the strong seed-specific beta-conglycinin promoter to restrict CPIP reduction to developing seeds where casein accumulation occurs. The construct included the phaseolin terminator sequence and a bar selectable marker gene for transformed plant selection. The complete expression cassette was assembled in a binary vector suitable for Agrob acterium-mediated transformation. Docket No. 713.006.004. PCT
[1349] Soybean transformation was performed using the half-seed transformation method with Agrobacterium strain EHA101. Putative transformants were selected on glufosinate-containing media and regenerated through tissue culture. Primary transformants were screened by PCR to confirm presence of the RNAi construct. RNA samples from developing seeds were analyzed using quantitative RT-PCR to measure target transcript reduction.
[1350] Selected lines showing strong reduction in target CPIP transcripts were transformed with a second construct expressing bovine aS 1 -casein. The casein expression cassette utilized the glycinin promoter for seed-specific expression and included a signal peptide sequence for protein body targeting. The construct also contained a hygromycin resistance gene for selection of double transformants.
[1351] Seeds from resulting transgenic lines were analyzed for both CPIP reduction and casein accumulation. Protein extracts were prepared from mature seeds and subjected to various analytical procedures. The abundance of target CPIPs were measured using targeted proteomics approaches. Casein expression levels were quantified through protein-specific immunoassays. The efficiency of casein extraction and purification were evaluated using standardized protocols.
[1352] Purification procedures employed a combination of precipitation and chromatographic steps optimized for the modified protein composition of the transgenic seeds. Initial fractionation used calcium-mediated precipitation to exploit the calcium-binding properties of casein. Subsequent purification utilized ion exchange chromatography under conditions selected to minimize nonspecific protein binding. The purity and yield of isolated casein was determined through multiple analytical methods.
[1353] The functional properties of purified casein from the transgenic plants were characterized through various assays. Micelle formation capacity was assessed using light scattering techniques. Protein stability was evaluated under different temperature and pH conditions. The ability to form proper protein-protein interactions was measured using standard dairy protein functional assays.
[1354] This tissue-specific RNAi approach was expected to achieve effective reduction of multiple CPIPs while minimizing potential impacts on general plant growth and development. The coordinated Docket No. 713.006.004. PCT
[1355] expression of the RNAi construct with casein accumulation resulted in improved protein recovery and purity compared to constitutive CPIP reduction strategies.
[1356] EXAMPLE 4: Selective Breeding Approach Combined with Marker-Assisted CPIP Reduction
[1357] A non-transgenic approach for CPIP reduction was developed through screening of natural soybean germplasm variants combined with marker-assisted breeding. Initial screening began with a diverse collection of 500 soybean accessions from the USDA germplasm repository. These lines were evaluated for natural variation in CPIP abundance using a high-throughput protein profiling method.
[1358] Protein extracts from mature seeds of each accession were analyzed using targeted mass spectrometry to quantify the relative abundance of known CPIPs, including annexins and lipoxygenases. Lines showing naturally reduced levels of multiple CPIPs were identified and characterized through detailed proteomics analysis. The genetic basis for reduced CPIP abundance was investigated through genome sequencing and comparative genomic analysis.
[1359] Selected low-CPIP lines were crossed with elite soybean varieties possessing desirable agronomic traits. The Fl hybrid plants were self-pollinated to generate segregating F2 populations. Molecular markers were developed based on identified genetic variations associated with reduced CPIP levels. These markers were used to select F2 plants combining low CPIP traits with favorable agronomic characteristics.
[1360] Selected F2 plants were advanced through single-seed descent to develop near-isogenic lines differing primarily in CPIP content. The resulting lines were characterized for protein composition, agronomic performance, and compatibility with standard casein purification procedures. Lines showing stable inheritance of reduced CPIP traits were selected for transformation with the casein expression construct.
[1361] Transformation of selected low-CPIP lines were performed using a casein expression vector containing a codon-optimized bovine aS 1 -casein gene. The expression cassette incorporated the native signal peptide sequence to direct the protein through the secretory pathway. Transgenic plants were regenerated and screened for casein expression levels. Docket No. 713.006.004. PCT
[1362] Comparative analysis was performed between casein-expressing plants in standard and low-CPIP genetic backgrounds. The efficiency of protein extraction and purification was evaluated using industrial-scale processing conditions. Specific parameters to be measured included total protein recovery, purification efficiency, and product purity. The functional properties of casein purified from each genetic background was thoroughly characterized.
[1363] Economic analysis of the purification process was conducted to quantify improvements in processing efficiency. Factors including extraction buffer requirements, chromatography resin lifetime, and product yield were evaluated. The stability of the low-CPIP trait across different environments were assessed through multi -location field trials.
[1364] This breeding-based approach was expected to generate soybean lines with inherently lower levels of problematic CPIPs, providing a non-transgenic strategy for improving casein purification efficiency. The selected lines demonstrated stable inheritance of the desired traits while maintaining agronomic performance suitable for commercial production.
[1365] EXAMPLE 5: Evaluation of Oxidative Stability in Low-Lipoxygenase Transgenic Casein Preparations
[1366] The impact of residual lipoxygenase activity on the oxidative stability of plant-derived casein was assessed through accelerated stability studies. Purified casein preparations from wild-type and CPIP-reduced transgenic lines were analyzed for their susceptibility to oxidative degradation under controlled conditions.
[1367] Casein samples were purified from three experimental groups: control plants (wild-type background), single CRISPR knockout targeting lipoxygenase 3, and double CRISPR knockout targeting both lipoxygenase 3 and a second major lipoxygenase isoform. Initial characterization measured residual lipoxygenase activity using the standard spectrophotometric assay with linoleic acid substrate at 234 nm. Samples were standardized to equivalent casein concentrations (10 mg / mL) in phosphate buffer (pH 7.0). Aliquots were stored at 4°C, 25°C, and 37°C under normal atmosphere for stability assessment.
[1368] At predetermined timepoints (0, 1, 3, 7, 14, and 28 days), samples were analyzed for several key parameters. Formation of lipid oxidation products was measured through multiple complementary Docket No. 713.006.004. PCT
[1369] methods. Primary oxidation products (e.g., organic hydroperoxides that are prone to degradation to aldehydes or oxygenated hydrocarbons) were quantified using the ferric thiocyanate method, while secondary oxidation products (aldehydes) were assessed through the TBARS assay. Volatile organic compounds were analyzed using headspace GC-MS to provide a comprehensive profile of oxidation products.
[1370] Protein modification markers were evaluated to assess the structural integrity of the casein proteins. Carbonyl content was measured through DNPH derivatization, while free sulfhydryl content was determined using Ellman's reagent. Cross-linked protein aggregates were analyzed by SDS-PAGE, and tryptophan fluorescence spectra were collected to monitor changes in protein conformation.
[1371] Functional properties of the casein preparations were characterized through multiple approaches. Surface hydrophobicity was measured using the ANS probe method. Calcium -binding capacity was determined through standard binding assays. Micelle formation ability was assessed using dynamic light scattering, and emulsification properties were evaluated through standard food chemistry protocols.
[1372] The contribution of residual lipoxygenase to oxidative degradation was confirmed through addition of specific inhibitors (e.g., nordihydroguaiaretic acid) to control samples. The relationship between initial lipoxygenase activity and oxidation markers were analyzed using regression analysis.
[1373] Samples with lipoxygenase activity below 10 U / g were expected to show greater than 90% reduction in hydroperoxide formation rate and greater than 80% reduction in TBARS values compared to control samples. These low-lipoxygenase samples were also expected to maintain native tryptophan fluorescence, preserve calcium-binding capacity, and demonstrate stable micelle formation throughout the storage period.
[1374] Temperature dependence studies were expected to reveal minimal oxidation across all samples at 4°C, while storage at 25°C showed significant differentiation between high and low LOX samples. Accelerated studies at 37°C demonstrated maximum protection against oxidation in samples with reduced LOX activity. Time course analysis established a linear relationship between LOX activity Docket No. 713.006.004. PCT
[1375] and oxidation rate, with a clear threshold effect observed at approximately 10 U / g LOX activity. Samples maintaining LOX activity below this threshold were expected to show substantially extended shelflife.
[1376] This comprehensive analysis established the mechanistic relationship between residual lipoxygenase activity and casein stability, validating the functional significance of the 10 U / g specification limit. The results demonstrated that maintaining lipoxygenase activity below this threshold was critical for preventing oxidative degradation and maintaining the functional properties of plant-derived casein proteins during storage and processing.
[1377] Example 6: Synergistic Effects of Combined shRNA Constructs on Gene Silencing in Soybean Cells
[1378] To demonstrate the efficacy and unexpected properties of the multi-target RNA interference system, a series of plasmid constructs were generated and tested in soybean cells. The experimental constructs included plasmid pMOZ3418 containing shRNA targeting LOX 1.3, plasmid pMOZ3419 containing an alternative shRNA sequence targeting LOX 1.3, plasmid pMOZ3321 containing a dual -targeting construct with shRNAs against both GY1 and LOX 1.3, and plasmid pMOZ3322 containing shRNAs targeting both CG2 and LOX 1.3. A control plasmid (pMOZ3431) containing a non-functional shRNA sequence was also constructed to serve as a negative control.
[1379] The experimental protocol involved Agrobacterium-mediated transformation of soybean cells with the aforementioned plasmid constructs. Following transformation, total RNA was extracted from the transformed cells and reverse transcribed to complementary DNA (cDNA). Target gene expression levels were subsequently quantified using reverse transcription quantitative polymerase chain reaction (RT-qPCR), with knockdown efficiency calculated by comparing messenger RNA (mRNA) levels to those in cells transformed with the negative control plasmid.
[1380] Analysis of the experimental results revealed an unexpected and advantageous interaction between specific shRNA combinations. The dual-targeting construct containing shRNAs against GY1 and LOX 1.3 (pMOZ3321) achieved a significant reduction in LOX 1.3 expression, demonstrating approximately 48% knockdown efficiency. In contrast, and quite surprisingly, the combination of CG2 and LOX 1.3 shRNAs (pMOZ3322) showed no detectable reduction in LOX 1.3 expression, Docket No. 713.006.004. PCT
[1381] despite utilizing identical LOX 1.3 targeting sequences. This differential response suggests a previously unknown synergistic interaction between specific shRNA combinations that significantly influences knockdown efficiency.
[1382] The methods and compositions provided several notable advantages in the field of RNA interference-based gene silencing. The demonstrated ability to achieve enhanced knockdown efficiency through specific shRNA combinations represents a significant improvement over existing single-target approaches. Furthermore, the capacity to simultaneously target multiple genes while maintaining or enhancing knockdown efficiency offers particular utility in agricultural biotechnology applications, such as trait modification and disease resistance development. The observed specificity of the synergistic effect between certain shRNA combinations may also contribute to reduced off-target effects, thereby increasing the precision and reliability of gene silencing applications.
[1383] These findings suggested that the optimization of multi-target RNAi strategies; and careful selection and combination of shRNA constructs can significantly impact the effectiveness of gene silencing approaches. The unexpected synergistic effects observed with specific shRNA combinations represented a novel advancement in the field and provide a foundation for developing more efficient gene silencing technologies.
[1384] Example 7: Analysis of Gene Expression Patterns in Multi-Target shRNA Systems
[1385] Gene expression analysis was conducted using multi-target shRNA experiments to evaluate the synergistic effects of combined shRNA constructs. Soybean cells were transformed with various plasmid constructs using Agrobacterium-mediated transformation. The experimental groups included: (1) a control group with non-functional shRNA (SEQ ID NO: 40, SEQ ID NO: 41, or SEQ ID NO: 2); (2) cells transformed with plasmid pMOZ3321 containing both LOX1.3 and GY1 shRNA sequences; (3) cells transformed with plasmid pMOZ3418 containing only LOX1.3 shRNA; and (4) cells transformed with plasmid pMOZ3322 containing both LOX1.3 and CG2 shRNA sequences.
[1386] Following transformation and selection, total RNA was extracted from the transformed cells and reverse transcribed to complementary DNA (cDNA). Target gene expression levels were Docket No. 713.006.004. PCT
[1387] quantified using reverse transcription quantitative polymerase chain reaction (RT-qPCR). Expression data was normalized to housekeeping genes and presented as relative expression levels compared to the control group.
[1388] The analysis revealed a significant reduction in L0X1.3 expression when the L0X1.3 shRNA is combined with GY1 shRNA in plasmid pMOZ3321. In contrast, when the same L0X1.3 shRNA sequence is used alone in plasmid pMOZ3418, no significant reduction in L0X1.3 expression was observed, despite using identical L0X1.3 targeting sequences. Additionally, when L0X1.3 shRNA was combined with CG2 shRNA in plasmid pMOZ3322, no significant knockdown was detected.
[1389] These results demonstrated an unexpected synergistic effect specific to certain shRNA combinations, where the presence of GY1 -targeting shRNA enhanced the knockdown efficiency of L0X1.3, while CG2 -targeting shRNA does not produce this enhancement.
[1390] EXAMPLE 8: Generation and Characterization of SVTP-Modified Soybean Plants
[1391] This example demonstrated the generation and characterization of soybean plants with modified SVTP gene expression.
[1392] Soybean plants (cultivar Williams 82) were transformed with the shRNA construct pMOZ3655 targeting SVTP genes using Agrobacterium-mediated transformation, wherein the pMOZ3655 construct contained an shRNA sequence (SEQ ID NO: 46) designed to target conserved regions of both Glyma.02G268600 and Glyma.14G048800. The construct was driven by the CaMV 35S promoter and included a bar gene cassette for selection of transformed plants.
[1393] Transformed plants were selected on glufosinate-containing media and regenerated through tissue culture. The presence and integrity of the transgene were confirmed through PCR and DNA sequencing. Expression levels of SVTP genes were quantified using RT-qPCR, with primers specific to each SVTP homolog. Plants showing significant reduction in SVTP transcript levels (>80% reduction compared to wild-type) were selected for further analysis.
[1394] Selected TO plants were grown to maturity in greenhouse conditions. Leaf tissue samples were collected at various developmental stages to monitor SVTP expression levels and assess protein Docket No. 713.006.004. PCT
[1395] trafficking patterns. Protein trafficking was analyzed using fluorescently tagged marker proteins and confocal microscopy. The accumulation of endogenous storage proteins was measured using protein extraction and quantification methods.
[1396] T1 seeds were collected and screened for the presence of the transgene. Homozygous lines were identified through segregation analysis. These lines were characterized for several key parameters. The analysis included measurement of SVTP transcript levels in various tissues and examination of protein trafficking patterns using fluorescent markers. The plants were evaluated for general growth characteristics and development throughout their life cycle. Comprehensive analysis of seed protein content and composition were performed using standard analytical methods. The lines underwent thorough assessment of their agronomic performance under greenhouse conditions.
[1397] The most promising lines, showing stable SVTP suppression and normal growth characteristics, were selected for subsequent protein expression studies. These plants formed the foundation for developing improved soybean lines with enhanced protein accumulation capacity.
[1398] EXAMPLE 9: Expression of Casein Proteins in SVTP-Modified Soybean Plants
[1399] This example demonstrated the expression and accumulation of casein proteins in soybean plants with modified SVTP gene expression.
[1400] SVTP -modified soybean lines generated as described above were transformed with expression constructs encoding bovine a-sl casein. The casein coding sequence were: codon-optimized for expression in soybean and placed under the control of the P-conglycinin promoter for seed-specific expression. The construct included an ER retention signal sequence to promote protein accumulation in the endoplasmic reticulum, and a hygromycin resistance gene for selection of transformed plants.
[1401] Transformation was performed using particle bombardment of embryogenic cultures derived from the SVTP-modified soybean lines. Following selection on hygromycin-containing media, transformed plants were regenerated and grown to maturity in greenhouse conditions. The presence and integrity of both the SVTP modification and the casein transgene were confirmed through molecular analysis. Docket No. 713.006.004. PCT
[1402] Developing seeds were collected at various stages of maturity (20, 25, 30, and 35 days after flowering) to analyze casein protein accumulation. Protein extraction was performed using a modified protocol designed to maximize recovery of recombinant proteins. The extracted proteins were analyzed by SDS-PAGE and Western blot using antibodies specific to a-sl casein. Protein quantification was performed using ELISA, and the subcellular localization of the casein protein was examined using immunoelectron microscopy.
[1403] The stability of casein accumulation was evaluated across multiple generations. T1 and T2 seeds were analyzed for casein content, and lines showing consistent high-level expression were selected. These seeds were evaluated for total protein content, protein composition, and various quality parameters including moisture content, protein solubility, and functional properties.
[1404] Protein extraction and purification methods were optimized using mature seeds from high-expressing lines. Various extraction buffers and conditions were tested to maximize protein recovery while maintaining protein stability. The extractability and purity of the recombinant casein were assessed using chromatographic methods. The biological activity and structural integrity of the purified casein protein were evaluated through standard analytical techniques.
[1405] Selected lines showing stable, high-level casein accumulation were characterized for agronomic performance, including seed yield, seed size, germination rate, and overall plant development. Plants showing both high casein expression and acceptable agronomic characteristics were selected for further development and potential scale-up studies.
[1406] EXAMPLE 10: Optimization of SVTP Gene Suppression Using Inducible Systems
[1407] This example demonstrated the development and characterization of an inducible system for controlled suppression of SVTP genes in soybean.
[1408] An estrogen-inducible expression system was constructed containing the SVTP -targeting shRNA sequence from pMOZ3655 under the control of an estradiol-responsive promoter. The construct included the human estrogen receptor (hER) transcriptional regulatory elements and a constitutively expressed hER DNA binding domain fusion protein. The system was designed to activate shRNA expression upon treatment with estradiol, allowing temporal control of SVTP gene suppression. Docket No. 713.006.004. PCT
[1409] Soybean plants were transformed with this inducible construct using Agrobacterium -mediated transformation. Transformed plants were selected using phosphinothricin resistance and regenerated through tissue culture. The presence and integrity of the inducible system components were verified through PCR and sequencing analysis. Multiple independent transformation events were analyzed to identify lines with stable integration and minimal background expression.
[1410] The functionality of the inducible system was evaluated by treating transformed plants with different concentrations of estradiol (0, 5, 10, 20, and 50 pM) at various developmental stages. Leaf tissue samples were collected at multiple time points following treatment to monitor SVTP transcript levels using RT-qPCR. The kinetics of SVTP suppression and its reversibility were characterized by monitoring gene expression over a time course following estradiol application and withdrawal.
[1411] The effect of controlled SVTP suppression on protein trafficking and accumulation was analyzed using fluorescently tagged marker proteins. Plants were treated with optimized estradiol concentrations during seed development, and the impact on seed protein content and composition were evaluated. The relationship between the timing of SVTP suppression and protein accumulation were determined through systematic analysis of treated plants.
[1412] The optimized inducible system was used to study the effects of SVTP suppression during specific developmental windows. Seeds from treated plants were collected and analyzed for protein content, seed weight, and germination capacity. The system was evaluated for any potential effects on plant growth, development, and stress responses under greenhouse conditions.
[1413] The most effective induction parameters, including estradiol concentration, timing of application, and duration of treatment, were determined based on the combination of SVTP suppression efficiency and seed protein accumulation. Selected lines showing consistent, controlled response to induction were used for subsequent studies of protein trafficking mechanisms and heterologous protein expression.
[1414] EXAMPLE 11: Assembly and Accumulation of Engineered Casein Micelles in SVTP-Modified Soybeans Docket No. 713.006.004. PCT
[1415] This example demonstrated the co-expression and assembly of multiple casein proteins to form stable protein structures in SVTP-modified soybean seeds.
[1416] SVTP -modified soybean lines showing optimal protein accumulation characteristics were transformed with a multi-gene construct encoding four major bovine caseins (a-sl, a-s2, P, and K-casein). Each casein gene was codon-optimized for soybean expression and placed under the control of separate seed-specific promoters. The construct included the P-conglycinin promoter driving a-sl casein, the glycinin promoter driving a-s2 casein, the lectin promoter driving P-casein, and the oleosin promoter driving K-casein expression. Each casein sequence included appropriate targeting signals to direct the proteins to the secretory pathway.
[1417] The transformation vector was designed to include unique spacer sequences between each expression cassette to minimize potential recombination events. The construct was introduced into SVTP-modified soybean lines using Agrobacterium-mediated transformation (SEQ ID NO: 46). Transformed plants were selected using a combination of herbicide resistance and fluorescent marker screening. Successfully transformed plants were regenerated and grown to maturity under controlled greenhouse conditions.
[1418] Developing seeds were collected at regular intervals to analyze the expression patterns of each casein protein. The temporal and spatial coordination of casein protein expression were evaluated using immunolocalization techniques with casein-specific antibodies. The formation of casein protein structures was monitored using transmission electron microscopy combined with immunogold labeling. The size distribution and morphology of assembled protein structures were characterized using dynamic light scattering and electron microscopy.
[1419] Protein extraction procedures were optimized to isolate intact protein structures from mature seeds. Various extraction conditions, including different pH values, ionic strengths, and calcium concentrations, were evaluated to maintain the stability of the assembled proteins. The composition and stoichiometry of the assembled structures were analyzed using analytical ultracentrifugation and mass spectrometry. The calcium-binding properties and thermal stability of the assembled proteins were characterized using standard physicochemical techniques. Docket No. 713.006.004. PCT
[1420] The functionality of the assembled casein structures was evaluated through analysis of their stability during seed storage and protein extraction. The ability of the structures to maintain their integrity during various processing conditions was assessed. The influence of different storage conditions on protein stability and functionality was determined through extended storage studies at various temperatures and humidity levels.
[1421] Seeds showing successful assembly of stable protein structures were propagated to evaluate the heritability and consistency of the trait. The impact of protein structure assembly on seed development, germination, and plant growth was assessed. Lines showing stable inheritance of the trait and maintaining normal agronomic characteristics were selected for further development and potential commercial applications.
[1422] EXAMPLE 12: Enhanced Casein Stability Through Calcium Co-expression in SVTP-Modified Soybeans
[1423] This example demonstrated a strategy for enhancing casein micelle stability through co-expression of a calcium transport protein in SVTP-modified soybean seeds expressing caseins.
[1424] SVTP -modified soybean lines expressing the four major caseins were transformed with a construct encoding a calcium transport protein (CAX1) modified to target the protein storage vacuoles. The construct included a seed-specific glycinin promoter and a modified signal sequence designed to enhance calcium accumulation in protein storage compartments. The objective was to create a calcium-enriched environment that promotes stable casein micelle formation and assembly.
[1425] The transformation construct included the modified CAX1 gene along with a selectable marker for hygromycin resistance. Following Agrobacterium-mediated transformation, transformed plants were selected on hygromycin-containing media and regenerated through tissue culture. The presence and expression of both the casein genes and the calcium transporter were verified through molecular analysis.
[1426] Developing seeds were analyzed for calcium content using atomic absorption spectroscopy at various stages of development. The spatial distribution of calcium in seed tissues was mapped using electron microscopy combined with energy-dispersive X-ray spectroscopy. The co Docket No. 713.006.004. PCT
[1427] localization of calcium with assembled casein structures was evaluated using fluorescent calcium indicators and immunofluorescence microscopy.
[1428] The impact of enhanced calcium levels on casein micelle assembly was assessed through multiple analytical approaches. The size and stability of casein micelles were characterized using dynamic light scattering and analytical ultracentrifugation. The internal structure of the micelles was examined using small-angle X-ray scattering. The calcium sensitivity and thermal stability of the assembled micelles were evaluated under various environmental conditions.
[1429] Protein extraction and purification protocols were optimized to maintain the integrity of the calcium-stabilized casein micelles. Various extraction buffers containing different calcium concentrations were tested to determine optimal conditions for micelle stability. The functional properties of the extracted micelles, including their emulsification capacity and heat stability, were characterized using standard food chemistry techniques.
[1430] Seeds from selected lines showing optimal calcium levels and stable casein micelle formation were propagated to evaluate trait stability across generations. The impact of enhanced calcium accumulation on seed development and germination was assessed. Lines demonstrating stable inheritance of both enhanced calcium levels and proper casein micelle assembly, while maintaining normal agronomic characteristics, were selected for further development. Docket No. 713.006.004. PCT
[1431] EXAMPLE 8: Generation and Characterization of SVTP-Modified Soybean Plants
[1432] This example demonstrated the generation and characterization of soybean plants with modified SVTP gene expression.
[1433] Soybean plants (cultivar Williams 82) were transformed with the shRNA construct pMOZ3655 targeting SVTP genes using Agrobacterium-mediated transformation. The construct contained an shRNA sequence (SEQ ID NO: 46) designed to target conserved regions of both Glyma.02G268600 and Glyma.14G048800. The construct was driven by the CaMV 35S promoter and included a bar gene cassette for selection of transformed plants.
[1434] Transformed plants were selected on glufosinate-containing media and regenerated through tissue culture. The presence and integrity of the transgene were confirmed through PCR and DNA sequencing. Expression levels of SVTP genes were quantified using RT-qPCR, with primers specific to each SVTP homolog. Plants showing significant reduction in SVTP transcript levels (>80% reduction compared to wild-type) were selected for further analysis.
[1435] Selected TO plants were grown to maturity in greenhouse conditions. Leaf tissue samples were collected at various developmental stages to monitor SVTP expression levels and assess protein trafficking patterns. Protein trafficking was analyzed using fluorescently tagged marker proteins and confocal microscopy. The accumulation of endogenous storage proteins was measured using protein extraction and quantification methods.
[1436] T1 seeds were collected and screened for the presence of the transgene. Homozygous lines were identified through segregation analysis. These lines were characterized for several key parameters. The analysis included measurement of SVTP transcript levels in various tissues and examination of protein trafficking patterns using fluorescent markers. The plants were evaluated for general growth characteristics and development throughout their life cycle. Comprehensive analysis of seed protein content and composition were performed using standard analytical methods. The lines underwent thorough assessment of their agronomic performance under greenhouse conditions.
[1437] The most promising lines, showing stable SVTP suppression and normal growth characteristics, were selected for subsequent protein expression studies. These plants formed the foundation for developing improved soybean lines with enhanced protein accumulation capacity. Docket No. 713.006.004. PCT
[1438] EXAMPLE 9: Expression of Casein Proteins in SVTP-Modified Soybean Plants
[1439] This example demonstrated the expression and accumulation of casein proteins in soybean plants with modified SVTP gene expression.
[1440] SVTP-modified soybean lines generated as described above were transformed with expression constructs encoding bovine a-sl casein. The casein coding sequence were: codon-optimized for expression in soybean and placed under the control of the P-conglycinin promoter for seed-specific expression. The construct included an ER retention signal sequence to promote protein accumulation in the endoplasmic reticulum, and a hygromycin resistance gene for selection of transformed plants.
[1441] Transformation was performed using particle bombardment of embryogenic cultures derived from the SVTP-modified soybean lines. Following selection on hygromycin-containing media, transformed plants were regenerated and grown to maturity in greenhouse conditions. The presence and integrity of both the SVTP modification and the casein transgene were confirmed through molecular analysis.
[1442] Developing seeds were collected at various stages of maturity (20, 25, 30, and 35 days after flowering) to analyze casein protein accumulation. Protein extraction was performed using a modified protocol designed to maximize recovery of recombinant proteins. The extracted proteins were analyzed by SDS-PAGE and Western blot using antibodies specific to a-sl casein. Protein quantification was performed using ELISA, and the subcellular localization of the casein protein was examined using immunoelectron microscopy.
[1443] The stability of casein accumulation was evaluated across multiple generations. T1 and T2 seeds were analyzed for casein content, and lines showing consistent high-level expression were selected. These seeds were evaluated for total protein content, protein composition, and various quality parameters including moisture content, protein solubility, and functional properties.
[1444] Protein extraction and purification methods were optimized using mature seeds from high-expressing lines. Various extraction buffers and conditions were tested to maximize protein recovery while maintaining protein stability. The extractability and purity of the recombinant Docket No. 713.006.004. PCT
[1445] casein were assessed using chromatographic methods. The biological activity and structural integrity of the purified casein protein were evaluated through standard analytical techniques.
[1446] Selected lines showing stable, high-level casein accumulation were characterized for agronomic performance, including seed yield, seed size, germination rate, and overall plant development. Plants showing both high casein expression and acceptable agronomic characteristics were selected for further development and potential scale-up studies.
[1447] EXAMPLE 10: Optimization of SVTP Gene Suppression Using Inducible Systems
[1448] This example demonstrated the development and characterization of an inducible system for controlled suppression of SVTP genes in soybean.
[1449] An estrogen-inducible expression system was constructed containing the SVTP -targeting shRNA sequence from pMOZ3655 under the control of an estradiol-responsive promoter. The construct included the human estrogen receptor (hER) transcriptional regulatory elements and a constitutively expressed hER DNA binding domain fusion protein. The system was designed to activate shRNA expression upon treatment with estradiol, allowing temporal control of SVTP gene suppression.
[1450] Soybean plants were transformed with this inducible construct using Agrobacterium-mediated transformation. Transformed plants were selected using phosphinothricin resistance and regenerated through tissue culture. The presence and integrity of the inducible system components were verified through PCR and sequencing analysis. Multiple independent transformation events were analyzed to identify lines with stable integration and minimal background expression.
[1451] The functionality of the inducible system was evaluated by treating transformed plants with different concentrations of estradiol (0, 5, 10, 20, and 50 pM) at various developmental stages. Leaf tissue samples were collected at multiple time points following treatment to monitor SVTP transcript levels using RT-qPCR. The kinetics of SVTP suppression and its reversibility were characterized by monitoring gene expression over a time course following estradiol application and withdrawal. Docket No. 713.006.004. PCT
[1452] The effect of controlled SVTP suppression on protein trafficking and accumulation was analyzed using fluorescently tagged marker proteins. Plants were treated with optimized estradiol concentrations during seed development, and the impact on seed protein content and composition were evaluated. The relationship between the timing of SVTP suppression and protein accumulation were determined through systematic analysis of treated plants.
[1453] The optimized inducible system was used to study the effects of SVTP suppression during specific developmental windows. Seeds from treated plants were collected and analyzed for protein content, seed weight, and germination capacity. The system was evaluated for any potential effects on plant growth, development, and stress responses under greenhouse conditions.
[1454] The most effective induction parameters, including estradiol concentration, timing of application, and duration of treatment, were determined based on the combination of SVTP suppression efficiency and seed protein accumulation. Selected lines showing consistent, controlled response to induction were used for subsequent studies of protein trafficking mechanisms and heterologous protein expression.
[1455] EXAMPLE 11: Assembly and Accumulation of Engineered Casein Micelles in SVTP-Modified Soybeans
[1456] This example demonstrated the co-expression and assembly of multiple casein proteins to form stable protein structures in SVTP-modified soybean seeds.
[1457] SVTP -modified soybean lines showing optimal protein accumulation characteristics were transformed with a multi-gene construct encoding four major bovine caseins (a-sl, a-s2, P, and K-casein). Each casein gene was codon-optimized for soybean expression and placed under the control of separate seed-specific promoters. The construct included the -conglycinin promoter driving a-sl casein, the glycinin promoter driving a-s2 casein, the lectin promoter driving P-casein, and the oleosin promoter driving K-casein expression. Each casein sequence included appropriate targeting signals to direct the proteins to the secretory pathway.
[1458] The transformation vector was designed to include unique spacer sequences between each expression cassette to minimize potential recombination events. The construct was introduced into SVTP -modified soybean lines using Agrobacterium-mediated transformation (SEQ ID NO: 46). Docket No. 713.006.004. PCT
[1459] Transformed plants were selected using a combination of herbicide resistance and fluorescent marker screening. Successfully transformed plants were regenerated and grown to maturity under controlled greenhouse conditions.
[1460] Developing seeds were collected at regular intervals to analyze the expression patterns of each casein protein. The temporal and spatial coordination of casein protein expression were evaluated using immunolocalization techniques with casein-specific antibodies. The formation of casein protein structures was monitored using transmission electron microscopy combined with immunogold labeling. The size distribution and morphology of assembled protein structures were characterized using dynamic light scattering and electron microscopy.
[1461] Protein extraction procedures were optimized to isolate intact protein structures from mature seeds. Various extraction conditions, including different pH values, ionic strengths, and calcium concentrations, were evaluated to maintain the stability of the assembled proteins. The composition and stoichiometry of the assembled structures were analyzed using analytical ultracentrifugation and mass spectrometry. The calcium-binding properties and thermal stability of the assembled proteins were characterized using standard physicochemical techniques.
[1462] The functionality of the assembled casein structures was evaluated through analysis of their stability during seed storage and protein extraction. The ability of the structures to maintain their integrity during various processing conditions was assessed. The influence of different storage conditions on protein stability and functionality was determined through extended storage studies at various temperatures and humidity levels.
[1463] Seeds showing successful assembly of stable protein structures were propagated to evaluate the heritability and consistency of the trait. The impact of protein structure assembly on seed development, germination, and plant growth was assessed. Lines showing stable inheritance of the trait and maintaining normal agronomic characteristics were selected for further development and potential commercial applications.
[1464] EXAMPLE 12: Enhanced Casein Stability Through Calcium Co-expression in SVTP-Modified Soybeans Docket No. 713.006.004. PCT
[1465] This example demonstrated a strategy for enhancing casein micelle stability through co-expression of a calcium transport protein in SVTP-modified soybean seeds expressing caseins.
[1466] SVTP -modified soybean lines expressing the four major caseins were transformed with a construct encoding a calcium transport protein (CAX1) modified to target the protein storage vacuoles. The construct included a seed-specific glycinin promoter and a modified signal sequence designed to enhance calcium accumulation in protein storage compartments. The objective was to create a cal ci um-enriched environment that promotes stable casein micelle formation and assembly.
[1467] The transformation construct included the modified CAX1 gene along with a selectable marker for hygromycin resistance. Following Agrobacterium-mediated transformation, transformed plants were selected on hygromycin-containing media and regenerated through tissue culture. The presence and expression of both the casein genes and the calcium transporter were verified through molecular analysis.
[1468] Developing seeds were analyzed for calcium content using atomic absorption spectroscopy at various stages of development. The spatial distribution of calcium in seed tissues was mapped using electron microscopy combined with energy-dispersive X-ray spectroscopy. The colocalization of calcium with assembled casein structures was evaluated using fluorescent calcium indicators and immunofluorescence microscopy.
[1469] The impact of enhanced calcium levels on casein micelle assembly was assessed through multiple analytical approaches. The size and stability of casein micelles were characterized using dynamic light scattering and analytical ultracentrifugation. The internal structure of the micelles was examined using small-angle X-ray scattering. The calcium sensitivity and thermal stability of the assembled micelles were evaluated under various environmental conditions.
[1470] Protein extraction and purification protocols were optimized to maintain the integrity of the calcium-stabilized casein micelles. Various extraction buffers containing different calcium concentrations were tested to determine optimal conditions for micelle stability. The functional properties of the extracted micelles, including their emulsification capacity and heat stability, were characterized using standard food chemistry techniques. Docket No. 713.006.004. PCT
[1471] Seeds from selected lines showing optimal calcium levels and stable casein micelle formation were propagated to evaluate trait stability across generations. The impact of enhanced calcium accumulation on seed development and germination was assessed. Lines demonstrating stable inheritance of both enhanced calcium levels and proper casein micelle assembly, while maintaining normal agronomic characteristics, were selected for further development.
[1472] Vectors: Multigene vectors, such as the plasmids described above, were isolated, wherein the vectors expressed the coding regions for the following proteins: (1) bovine a-Sl-casein (Uniprot accession # P02662), (2) green fluorescent protein (GFP, Uniprot accession # P42212), 3) bovine 0-casein (Uniprot accession # P02666), (4) bovine K-casein (Uniprot accession # P02668), and (5) bovine FAM20C kinase (uniprot accession number # F1MXQ3). The vectors were plasmids (pMOZ nos. 3332, 3319, 3320, 3333, 3321, 3334, 3322, 3336, 3324, 3337, 3325, 3196, 3168, 3169, 3170, 3171, 3172, 3173, 3174, 3431, 3418, 3419, 3420, and 3421) assembled using the modular cloning system MoClo (Engler, Carola, Mark Youles, Ramona Gruetzner, Tim-Martin Ehnert, Stefan Werner, Jonathan D. G. Jones, Nicola J. Patron, and Sylvestre Marillonnet. “A Golden Gate Modular Cloning Toolbox for Plants.” ACS Synthetic Biology 3, no. 11 (November 21, 2014): 839-43. https: / / doi.org / 10.1021 / sb4001504). All proteins were expressed under constitutively active, seed specific, or synthetic plant promoters, with a subset of these proteins possessing translationally-fused epitope tags and / or target-peptide sequences on their C-termini.
[1473] Caseins: Gene sequences that encode for bovine a-Sl -casein (P02662), bovine -casein (P02666), and bovine K-casein (P02668) were derived from Uniprot and modified to include
[1474] (AGTTCG)(GATTACAAAGATGACGACGATAAG)(CATCATCACCATCACCAC)(CATGA TGAGTTG) in the C-terminus. The first sequence encodes for a two-serine spacer that functions to provide enough space for each casein protein to properly fold without steric hindrance or interference from other tags. The second and third sequences encode for two affinity purification tags (flag-tag and 6-Histidine tag) that are commonly used for protein identification and purification. The fourth sequence encodes for an HDEL target peptide that functions to retain soluble casein proteins in the endoplasmic reticulum (ER). Additionally, an N-terminus signal peptide, gmGlycininl (GY1, P04776), was added to all three caseins in order to target them towards the ER and vacuoles. Recombinant casein sequences were expressed under the Docket No. 713.006.004. PCT
[1475] constitutive AtuMas promoter and 5’ untranslated region (UTR) (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC287101 / ).
[1476] E. coli transformation: The plasmids, above, were each transformed into a Lucigen Ecloni 10G bacterium using the following chemical transformation protocol. First, Lucigen Ecloni 10G E.coli thermo-competent cells were thawed on ice for approximately 5 minutes. Then, competent cells were spiked with 1 pg-100 ng of plasmid DNA and left to incubate on ice for 10 minutes. Once complete, the plasmid-bacterial mixture was heat shocked at 42°C for 90 seconds and immediately replaced on ice for 5 minutes. Afterwards, transformed cells were mixed with lOOpl of liquid broth (LB) and cultured in a 37°C shaker set to 225 rpm for 45 minutes. Following incubation, cultured bacteria was plated on LB agar plates with the appropriate antibiotic for selection (1:1000 concentration) and left to further incubate overnight in a 37°C growth chamber.
[1477] High throughput blue-white selection: Following overnight incubation, plates were checked for bacterial colony growth. To increase recombinant bacteria selection, a MoClo compatible bluewhite selection system was used. In brief, blue-white selection plasmid vectors carry the “lacZ” operon sequence within their multiple cloning site. In the absence of recombinant DNA, the lacZ operon will enable a biochemical reaction that turns the colony blue. Whereas, when recombination occurs, lacZ operon activity will be disrupted leaving the colony to be white. For each cloning reaction, at least two white colonies were chosen for further verification.
[1478] Plasmid selection and verification: Picked colonies were placed in 5 mLs of LB plus their respective selection antibiotic (1: 1000 concentration) and cultured overnight in a 37°C shaker (225 rpm). Once cloudy, plasmids were purified out of bacteria using the NucleoSpin miniprep kit (Takara bio inc.). Then, each plasmid was digested using the appropriate restriction enzymes in order to confirm the presence of a DNA insert and sent for sanger and nanopore sequencing to confirm sequence correctness. Colonies containing the correct plasmids were made into frozen 20% glycerol stocks.
[1479] Electroporation into agrobacterium: The completed plasmids were each transformed into a respective EHA105 electrocompetent agrobacterium cell. To achieve this, 30ng of the purified plasmid was mixed into ice-thawed electrocompetent cells and swiftly transferred into a prechilled 0.2 cm Gene pulser cuvette. The cuvette was then loaded into an electroporation chamber Docket No. 713.006.004. PCT
[1480] and given an electric pulse of 2.5kV. The resulting transformed cells were mixed with 500 pl of LB and left to culture in a 28°C shaking incubator (120rpm) for 2-4 hours. Afterwards, cultured cells were plated onto LB agar plates containing the appropriate antibiotic selection media and placed in a 28°C incubator for two days. Once colonies formed, a minimum of three were picked for further verification via purification, digestion, and sequencing.
[1481] Transient agrobacterium transformation into zygotic soy embryos: Zygotic soybeans were transiently transformed using agrobacterium. Specifically, a 5mL starter culture of agrobacterium, which contains the plasmid, was started from either a glycerol stock or bacterial colony and incubated for two days in a 28°C shaker (120rpm). Once cloudy, the 5mL starter culture was used to inoculate a larger 200mL overnight culture.
[1482] Bacteria preparation: Large plasmid agrobacterium cultures were spun down in a large centrifuge at 3400g for 10 minutes. The supernatant was then removed and the remaining agrobacterium pellet was resuspended in 30mL of LCCM. Post resuspension, the agrobacterium was centrifuged at 3400g for 6 minutes, and then subjected to one more round of supernatant removal, pellet resuspension and centrifugation. After the final spin down, the remaining supernatant was removed and the bacterial pellet was resuspended in lOmL of LCCM. An OD600 measurement was then taken and the agrobacterium solution was diluted to a final concentration of 1.4 OD600. The resulting agrobacterium solution was spiked with fresh acetosyringone (lOOpM final concentration) and subsequently incubated at room temperature while shaking (120rpm) for 1-2 hours.
[1483] Seed sterilization and preparation: During the agrobacterium incubation period, pods were picked from soy plants containing 8-10 mm embryos (~8 weeks old) and sterilized by the following method: 70% ethanol bath for 30 seconds, 10% bleach bath for 10 minutes, three sequential sterilized deionized water bath for 5 minutes each. After sterilization, seeds were aseptically removed from their pods, dissected from their seed coats, and split in half.
[1484] Explant inoculation: Once agrobacterium cultures finished incubating, silwet-77 (0.03% v / v) was added and mixed until dissolved. Then, 30 cotyledon halves (15 explants) were placed in the agrobacterium culture (which contained the vectors), and sonicated for 20 seconds at a 20% amplitude with 5s / l / s on / off pulse cycles. The contact of the cotyledon halves and the Docket No. 713.006.004. PCT
[1485] agrobacterium culture (which contained the vectors) allowed for the suppression of autophagy in the cotyledon. After sonication, explants were vacuum infiltrated for 5 minutes and left to incubate for two hours on a room temperature rotator.
[1486] Plating explants: Explants were removed from bacterial culture and placed flat down (adaxial side down) on SCCM plates with a layer of sterile filter paper. Plates were then wrapped with micropore tape and incubated for 3 days in a dark 24°C chamber.
[1487] Washing explants: After plants incubated in the dark for 3 days, they were washed three times for five minutes each with sterile water containing Rif, Carb+Cef. Then, they were replated on SCCM plates containing filter paper and left to incubate in a dark 24°C chamber for another 7-9 days.
[1488] Protein Crude Extraction: Roughly 40 plates containing the plasmids - transformed cotyledons were flash frozen in liquid nitrogen and crushed into a fine powder. Then, 100 grams of powder was measured out and mixed with a tris protein extraction buffer (50 mM Tris, 300 mM KC1, 0.5% Tween-20, 3.65% glycerol, Sigma plant protease inhibitor, pH 8.6). The resulting mixture rotated for 1 hour at 4°C and then spundown at 1300rpm for 30 minutes at 4°C.
[1489] Casein purification: Crude protein extract was first clarified using a,45pm filter. Then, the sample was mixed with nickel resin, rotated at 4°C for 4 hours, and subsequently centrifuged for 2 minutes at 1000g. After centrifugation, the supernatant was removed and the remaining sample was washed with a wash buffer (50mM Tris base, 300mM KCL, 20mM imidazole, pH 7.4). To remove impurities, the wash step was repeated four times. After the last wash, the proteins were rotated in an elution buffer at 4°C for 15 minutes. Then, they were centrifuged at 700g for two minutes. The supernatant was saved for later analysis and the elution step was repeated another four times.
[1490] Casein characterization: To confirm successful purification of the caseins, the first three elution samples were run on a BioRad TGX AnykD Mini Protean SDS-PAGE gel and blotted (Western blot) with antibodies against FLAG to check for the presence of the caseins, whereby: “WT” is wildtype control. “Flag” is a positive control for flag tag. “Wl” is wash 1. “El” (elution 1), “E2” (elution 2) and “E3” (elution 3) are serial elution. This blot was compared to the initial flow through and wash supernatants, which were expected to have minimal FLAG detection. Positive bands were enriched in the elution samples and present at the expected size of 27kDa. As Docket No. 713.006.004. PCT
[1491] all three caseins have Flag tag, mass spectrometry was used to confirm the presence of all three proteins.
Claims
Docket No. 713.006.
004. PCTCLAIMS1. A recombinant plant cell comprising a nucleic acid molecule selected from SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9, wherein said molecule comprises a dual-gene targeting construct that suppresses the expression of at least one Casein-Processing Interfering Protein (CPIP) gene, thereby enhancing accumulation of a recombinant casein protein in said plant cell.
2. A genetically modified plant capable of expressing a recombinant casein protein, wherein the plant is modified to comprise: (a) a nucleic acid sequence selected from SEQ ID NO: 1 through SEQ ID NO: 39, which suppresses expression of two CPIP genes selected from GY1, CG2, or L0X1.3; or (b) SEQ ID NO: 46, which reduces the activity of two genes in the Soybean Vesicular Trafficking Pathway (SVTP).
3. A method for optimizing the production of recombinant casein protein, comprising:transforming a plant cell with a genetic construct comprising a nucleic acid sequence for expressing said casein protein; and introducing an RNAi mechanism comprising:a nucleic acid sequence selected from SEQ ID NO: 1 through SEQ ID NO: 39, or SEQ ID NO: 43, SEQ ID NO: 44, and SEQ ID NO: 45 to suppress two or more CPIP genes, thereby increasing accumulation of the recombinant casein expressed in the plant cell; ora nucleic acid that is SEQ ID NO: 46 to knockdown two or more genes implicated in SVTP, thereby preventing degradation of recombinant casein expressed in the plant cell.
4. A method for enhancing transgenic casein production in plants comprising: reducing expression of at least one Casein-Processing Interfering Protein (CPIP) in a plant, wherein said CPIP demonstrates binding affinity for either casein or purification matrices used in casein isolation; and expressing a transgenic casein protein in said plant.
5. The method of claim 4, wherein reducing expression of said CPIP comprises introducing a nucleic acid construct encoding an RNA interference molecule targeting said CPIP.Docket No. 713.006.
004. PCT6. The method of claim 5, wherein said RNA interference molecule comprises a hairpin RNA structure.
7. The method of claim 4, wherein reducing expression of said CPIP comprises introducing a CRISPR-Cas nuclease system targeting a gene encoding said CPIP.
8. The method of claim 4, wherein said CPIP is selected from the group consisting of annexins, lipoxygenases, and combinations thereof.
9. The method of claim 8, wherein said CPIP comprises a soybean annexin encoded by GLYMA.11G153800 or a soybean lipoxygenase 3 encoded by GLYMA.15G036300.
10. A transgenic plant produced by the method of claim 4.
11. A method of purifying transgenic casein from a plant comprising: providing a transgenic plant having reduced expression of at least one CPIP and expressing a transgenic casein protein; and isolating said transgenic casein protein using a protein purification matrix.
12. The method of claim 11, wherein said protein purification matrix is selected from the group consisting of ion exchange resins, hydrophobic interaction media, and affinity chromatography supports.
13. A nucleic acid construct comprising: a first polynucleotide sequence encoding a transgenic casein protein; and a second polynucleotide sequence encoding an RNA interference molecule targeting at least one CPIP.
14. The nucleic acid construct of claim 13, further comprising at least one regulatory sequence operably linked to said first polynucleotide sequence, said second polynucleotide sequence, or both.
15. A method of identifying a CPIP comprising: contacting a plant protein extract with either purified casein or a protein purification matrix; isolating proteins that bind to said casein or said purification matrix; and identifying said proteins using protein analysis techniques.Docket No. 713.006.
004. PCT16. A transformed plant cell comprising: a first genetic modification reducing expression of at least one CPIP; and a second genetic modification enabling expression of a transgenic casein protein.
17. A method of improving casein yield from transgenic plants comprising: identifying at least one CPIP that reduces casein purification efficiency; reducing expression of said CPIP in a transgenic plant expressing casein; and purifying casein from said plant.
18. A composition comprising: transgenic casein protein purified from a plant having reduced expression of at least one CPIP, wherein said purified transgenic casein protein has reduced contamination with said CPIP compared to casein purified from a plant having normal expression of said CPIP.
19. The composition of claim 18, wherein said purified transgenic casein protein comprises less than 0.5% by weight of contaminating plant proteins.
20. The composition of claim 18, wherein said purified transgenic casein protein comprises less than 100 units of lipoxygenase activity per gram of purified casein protein.
21. The composition of claim 20, wherein the less than 100 units of lipoxygenase activity per gram of the purified casein protein corresponds to a fatty acid profile in a micelle, wherein the micelle is purified to yield the casein protein.
22. The composition of claim 18, wherein said purified transgenic casein protein comprises less than 10 U / g of lipoxygenase activity, wherein one unit (U) of lipoxygenase activity is defined as the amount of enzyme that catalyzes the formation of 1 pmol of hydroperoxide per minute at 25 °C.
23. The composition of claim 21, wherein the fatty acid profile in the micelle contains nonoxidized fatty acids, thereby suppressing formation of fatty acid degradation products leading to rancid off-notes.
24. A plasmid comprising two or more distinct RNA constructs, each targeting a different gene, wherein the combination of each of the shRNA constructs results in enhancedDocket No. 713.006.
004. PCTdownregulation of at least one of the target genes as compared to a plasmid containing any one, but only one, of the two or more distinct shRNA constructs.
25. A plasmid according to claim 24, wherein the plasmid contains at least one construct targeting at least one gene G1 and not G2, and at least one different construct targeting at least one different gene G2, and not Gl, where the combination of shRNA constructs results in greater downregulation of Gl than a plasmid containing only one or more of the shRNA constructs that target Gl.
26. The plasmid of claim 24 where Gl is soybean LOX 1.3 gene and G2 is soybean GY1 gene, and wherein the combination of the shRNA constructs results in greater than 2% knockdown of LOX 1.3 gene expression.
27. A method for increasing downregulation of the expression of a target gene in a plant, comprising transforming the plant with two or more different shRNA constructs each targeting one or more genes (Gl, G2, G3, Gx), with at least one construct targeting at least one gene Gl and not G2, and at least one different construct targeting at least one different gene G2 and not Gl.
28. The method of claim 27, wherein the plant is soybean.
29. A method for enhancing protein accumulation in a plant, comprising: modifying the expression or activity of at least one SVTP gene in said plant, wherein said modification results in reduced trafficking of proteins to the lytic vacuole.
30. A method for producing a modified plant with enhanced protein accumulation capacity, comprising: introducing into a plant cell a genetic construct capable of reducing expression or activity of at least one SVTP gene; regenerating a plant from said plant cell; and selecting a plant exhibiting reduced SVTP activity.
31. The method of claim 30, wherein said genetic construct comprises: a nucleic acid sequence encoding an RNA interference molecule targeting at least one SVTP gene, wherein said RNA interference molecule comprises a sequence complementary to at least a portion of an SVTP gene transcript.Docket No. 713.006.
004. PCT32. The method of claim 30, wherein said genetic construct comprises: a CRISPR / Cas nuclease system comprising at least one guide RNA targeting at least one SVTP gene.
33. A method for producing a heterologous protein in a plant, comprising: modifying the expression or activity of at least one SVTP gene in said plant; introducing a nucleic acid sequence encoding said heterologous protein into said plant; and expressing said heterologous protein in said plant with reduced SVTP activity.
34. The method of claim 33, wherein said heterologous protein is a milk protein.
35. The method of claim 34, wherein said milk protein is selected from the group consisting of asl casein, as2 casein, casein, K casein, and combinations thereof.
36. A modified plant cell comprising: a genetic modification that reduces expression or activity of at least one SVTP gene, wherein said modification results in enhanced accumulation of at least one protein.
37. A transgenic plant comprising: a modified SVTP gene, wherein said modification reduces SVTP activity and results in altered protein trafficking within cells of said plant.
38. The transgenic plant of claim 37, wherein said plant is a soybean plant and said modification targets at least one SVTP gene selected from the group consisting of Glyma.02G268600, Glyma.14G048800, and combinations thereof.
39. A method for reducing protein degradation in a plant cell, comprising: modifying a protein trafficking pathway gene to reduce trafficking of proteins to the lytic vacuole, wherein said protein trafficking pathway gene is an SVTP gene.
40. An expression system for enhanced protein production in plants, comprising: a first genetic construct capable of reducing SVTP activity; and a second genetic construct comprising a nucleic acid sequence encoding a protein of interest.
41. The expression system of claim 40, wherein: said first genetic construct comprises an RNA interference molecule targeting at least one SVTP gene; and said second genetic constructDocket No. 713.006.
004. PCTcomprises a promoter operably linked to said nucleic acid sequence encoding said protein of interest.
42. A method for increasing protein yield in a plant, comprising: reducing the expression or activity of at least one SVTP gene in said plant; expressing a protein of interest in said plant; and extracting said protein of interest from said plant, wherein said reduced SVTP activity results in increased yield of said protein of interest compared to a plant with wild-type SVTP activity.
43. A plant tissue culture comprising: plant cells comprising a modified SVTP gene, wherein said modification reduces SVTP activity and enhances accumulation of at least one protein in said plant cells.