Extracellular vesicle-microbead complexes

By using antibody-coated microbeads and electroporation, the method addresses EV heterogeneity and inefficiencies, achieving efficient, targeted delivery of therapeutic agents in EV complexes with improved purity and reduced processing time.

WO2026112132A1PCT designated stage Publication Date: 2026-05-28JOHNS HOPKINS UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-11-19
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

Existing methods for producing extracellular vesicle (EV) complexes face challenges in achieving targeted delivery due to EV heterogeneity, inefficiencies in purification and loading processes, and scalability issues, leading to heterogeneous populations and potential immunogenicity.

Method used

A method involving the use of antibody-coated magnetic microbeads to selectively capture EVs, combined with electroporation for cargo loading, followed by RNase treatment and freezing to enhance purity, streamlining the process and achieving specific EV populations.

Benefits of technology

This approach reduces processing time and cost, enhances purity, and enables efficient, targeted delivery of therapeutic agents, such as miRNA, by producing EV complexes with consistent surface protein profiles suitable for clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025056093_28052026_PF_FP_ABST
    Figure US2025056093_28052026_PF_FP_ABST
Patent Text Reader

Abstract

Methods of producing a material comprising a population of extracellular vesicles (EVs) complexes through providing a sample comprising a population or subpopulation of EVs of interest, enhancing said population of EVs of interest over other components of said sample, through use of a substrate, to provide an enhanced precursor material, and applying an electroporation process to said enhanced precursor material to combine a cargo agent with at least a portion of said EVs of interest to provide said material comprising said population of extracellular vesicle complexes.
Need to check novelty before this filing date? Find Prior Art

Description

Applicant Ref.: 02240616954EXTRACELLULAR VESICLE-MICROBEAD COMPLEXESCROSS-REFERENCE OF RELATED APPLICATION

[0001] This application claims priority to U. S. Provisional Application No 63 / 722,443 filed November 19, 2024; the entire content of which is hereby incorporated by reference.BACKGROUND1. Technical Field

[0002] The currently claimed embodiments of the present invention relate to methods of producing extracellular vesicle complexes and the extracellular vesicle complexes produced.2, Discussion of Related Art

[0003] Extracellular vesicles (EVs), membrane-bound nanoparticles secreted by all cells, play an important role in the transport of biomolecules, including proteins, nucleic acids, and lipids, between cells, making them promising candidates for therapeutic delivery. (1) Their ability to carry nucleic acids while protecting contents from degradation, coupled with reduced toxic side effects and off-target cargo accumulation compared to synthetic nanoparticles, positions EVs as advantageous delivery vehicles. (2, 3) EVs surpass synthetic lipid nanoparticles in effectiveness due to their unique native surface proteins facilitating tissue targeting and immune evasion. (4)

[0004] However, EVs exhibit inherent heterogeneity in size, structure, and molecular signatures due to diverse biogenesis pathways and cell origins. (5) Consequently, unlocking the full potential of EVs for targeted delivery faces challenges in selecting EVs with specific surface proteins for delivery specificity and loading them precisely. (6 8) Conventional EV purification methods involve the removal of the supernatant containing contaminants. The gold standard method, ultracentrifugation, while yielding high quantities of EVs, necessitates a high-speed centrifuge with a significant cost, along with processing times extending to several hours.Moreover, EVs obtained through ultracentrifugation exhibit heterogeneous surface profiles. (16)Applicant Ref.: 02240616954Alternative technologies offering cost-effective and faster EV purification, such as polymer precipitations, size-exclusion chromatography, or ultrafiltration, still result in heterogeneous EV populations. (3, 14, 16) Furthermore, none of these methods can be seamlessly integrated with EV loading mechanisms. Consequently, the separate processes of purification and subsequent EV loading significantly extend overall process time and lower efficiency. (4,5)

[0005] While some studies have investigated immunopurification of protein-specific EV subpopulations to characterize distinct EV subpopulations and biomarkers, these efforts have not prioritized engineering unique populations of EVs for drug delivery systems. (15, 17 — 19) Additionally, the utilization of EVs for clinical applications continues to be hampered by scalability, repeatability, and quality control challenges due to the inherent heterogeneity of EVs and co-isolation of non-EV molecules that may induce immunogenicity in therapeutic applications (4,5) Therefore, there remains a need for improved methods of producing extracellular vesicle complexes.SUMMARY

[0006] A method of producing material comprising a population of extracellular vesicle (EV) complexes according to an embodiment of the current invention includes providing a sample comprising a population of EVs of interest, enhancing said population of EVs of interest over other components of said sample to provide an enhanced precursor material, and applying an electroporation process to said enhanced precursor material to combine a cargo agent with at least a portion of said EVs of interest to provide said material comprising said population of extracellular vesicle (EV) complexes, wherein said enhancing said population of EVs of interest comprises providing a substrate that selectively attaches with said EVs of interest, wherein said substrate is a plurality of microbeads coated with a capture agent that binds selectively to said EVs of interest, wherein said EV complexes comprise said EVs of interest, said cargo agent and said microbeads, wherein said capture agent is an antibody that binds to a surface protein on said EVs of interest, wherein said surface protein is selected from the group consisting of CD81, CD63, CD47, and CD54, wherein said cargo agent comprises at least one of a nucleic acid, a protein, a drug molecule, or a quantum dot, wherein said nucleic acid is selected from the group consisting of microRNA (miRNA), small interfering RNA (siRNA), and DNA, and w'herein said method further comprises treating said enhanced precursor material with a blocking agent priorApplicant Ref.: 02240616954to applying said electroporation process to reduce non-specific binding of said cargo agent, wherein said blocking agent is polyA carrier RNA, and wherein said method further comprises treating said material comprising said population of EV complexes with RNase following said electroporation process to remove unloaded cargo agent and freezing said material comprising said population of EV complexes to enhance purity by eliminating residual cargo agent.

[0007] A population of extracellular vesicle complexes according to an embodiment of the current invention can include material produced by said method.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] FIG. 1 provides a schematic illustration of the streamlined electroporation method for loading surface-protein specific EVs with miRNA.

[0009] FIGS. 2A-2D: Characterization of unsorted EVs and CD81+EVs (a) Protein enrichment in HEK-293 cell lysates and EV pellet isolated through polymer precipitation, (b) Western blot analysis of CD8T EVs on EMCs and the respective eluate, (c) successful immunoprecipitation of CD8 V EVs on microbeads through fluorescent staining, (d) expression of U6 in CD81 EVs relative to vesicular protein.

[0010] FIGS. 3A-3C: Comparison of strategies to remove unloaded residual miRNA. (a) EVs washed and incubated with various concentrations of RNase in the absence of electroporation, (b) Electroporation performance of unsorted EVs. (c) Electroporation performance of CD81!EMCs with post-electroporation freezing.

[0011] FIGS. 4A-4C: Optimization and stability of loaded EVs. (a) electroporation performance of CD8T EMCs with addition of RNase, cRNA and freezing compared to unsorted EVs. (4b) EV integrity after freezing as quantified by percentage of endogenous U6 remaining. (c) Western blot analysis quantifying the effects on protein content in unsorted EVs and CD81+EMCs as a result of electroporation and freezing.

[0012] FIG. 5: Primer efficiencies for U6, cel-miR-67 and ath-miR159a determined using standard curves created from serial dilutions of RNA.

[0013] FIG. 6A-6B: Full blots and Ponceau S total protein stain corresponding to FIG. 2.Applicant Ref.: 02240616954

[0014] FIG. 7A-7B: Western blot analysis of the effects of freezing, electroporation and the addition of miRNA and cRNA on EV protein content,

[0015] FIGS. 8A-8C: Strategies for minimizing non-specific binding, (a) Relative expression of residual unloaded cargo miRNA under varying washing conditions, (b) Testing various cRNA concentrations and incubation times, (c) Fold decreases in miRNA between fresh and frozen samples.

[0016] FIG. 9: Full blots corresponding to FIG. 4.DETAILED DESCRIPTION

[0017] Some embodiments of the current invention are discussed in detail below. In describing embodiments, specific terminology is employed for the sake of clarity. However, the invention is not intended to be limited to the specific terminology so selected. A person skilled in the relevant art will recognize that other equivalent components can be employed, and other methods developed, without departing from the broad concepts of the present invention. All references cited anywhere in this specification are incorporated by reference as if each had been individually incorporated.

[0018] The term “extracellular vesicle” or “EV” refers generally to a membrane-bound nanoparticle secreted by cells that carries biomolecules including, but not limited to, proteins, nucleic acids and lipids. It can include but is not limited to, exosomes, microvesicles and apoptotic bodies.

[0019] The term “EV-microbead complex” or “EMC” refers generally to a composite structure formed by the conjugation of one or more extracellular vesicles with a microbead, typically through antibody-antigen interactions between antibodies on the microbead surface and surface proteins on the extracellular vesicles.

[0020] The term “microbead” means a spherical or substantially spherical particle having a diameter of at least 0.1 micrometers (pm) and less than about 200 pm. Microbeads may be composed of polystyrene, latex, magnetic materials, or other suitable materials and may be coated with antibodies or other antigens.

[0021] The term “surface protein-specific EV” means an extracellular vesicle that expresses a particular surface protein marker, such as CD81, CD63, CD9 or other tetraspanins or membrane proteins and can be selectively isolated based on that surface protein.Applicant Ref.: 02240616954

[0022] The term “cargo molecule” or “cargo” refers to a therapeutic or diagnostic molecule to be loaded into extracellular vesicles, including but not limited to microRNA (miRNA), DNA, proteins, peptides, small molecule drugs and imaging agents.

[0023] The term “electroporation” refers generally to a technique that uses electrical pulses to create temporary pores in cells or vesicle membranes, thereby facilitating the entry of cargo molecules into the interior of the extracellular vesicles.

[0024] The term “immunoprecipitation” refers to a technique for isolating and concentrating a specific molecule or particle from a mixture by using and antibody that specifically binds to that molecule or particle, typically through attachment of the antibody to a solid support such as a microbead.

[0025] The term “blocking agent” or “carrier RNA” means a nucleic acid molecule such as, polyA RNA (cRNA), added to reduce non-specific binding of cargo molecules to surfaces during the loading process.

[0026] The term “about” when used in connection with a numerical value means the value is ± 10% of the stated value.

[0027] In an embodiment of the current invention, we describe the use of surface protein-specific EV-microbead complexes (EMCs) for streamlined cargo loading into targeted extracellular vesicle subpopulations through electroporation. FIG. 1 provides a schematic illustration of the streamlined electroporation method for loading surface-protein specific EVs with miRNA We show that protein-specific EV subpopulations can be selectively isolated, loaded with cargo molecules, and purified using magnetic microbeads as carriers throughout the process, eliminating the need for multiple isolation and loading steps. In an embodiment, we used antibody-coated magnetic microbeads to capture CD81+EVs, combined electroporation-based loading with carrier RNA blocking and RNase treatment to achieve high purity loaded EVs. In some embodiments, we also employed freezing in RNase solution to enhance cargo elimination while preserving EV integrity. However, the general concepts of the current invention are not limited to only CD81 or only magnetic microbeads. We characterized the loaded EVs according to some embodiments through Western blot analysis, fluorescent staining, and quantitative PCR measurements. We developed a streamlined workflow for producing protein-specific therapeutic-loaded EVs with reduced processing time and enhanced purity suitable for targeted delivery applications. However, this is an example according to anApplicant Ref.: 02240616954embodiment of the current invention to facilitate the description and explanation of some concepts of the invention. The general concepts of this invention are not limited to this, and the other examples described in detail.

[0028] In some embodiments, a method of producing material comprising a population of extracellular vesicle (EV) complexes includes providing a sample comprising a population of EVs of interest, enhancing the population of EVs of interest over other components of the sample to provide an enhanced precursor material, and applying an electroporation process to the enhanced precursor material to combine a cargo agent with at least a portion of the EVs of interest. The sample can be obtained from cell culture conditioned media, biological fluids, or other sources containing EVs. In some embodiments, enhancing the population of EVs includes isolating EVs through polymer-based precipitation, ultrafiltration, ultracentrifugation, or size exclusion chromatography. As shown in FIG. 2A, protein enrichment can be observed in HEK-293 cell lysates and EV pellet isolated through polymer precipitation.

[0029] The cargo agent can include, but is not limited to, microRNA (miRNA), small interfering RNA (siRNA), messenger RNA (mRNA), DNA, proteins, peptides, small molecule drugs, or imaging agents. The electroporation process applies electric field strengths typically ranging from about 1000 V / cm to about 3000 V / cm to facilitate cargo internalization into the EVs.

[0030] In some embodiments, a method of producing protein-specific subpopulations of extracellular vesicles includes obtaining a sample comprising a heterogeneous population of extracellular vesicles, contacting the sample with a plurality of magnetic microbeads coated with antibodies targeting specific markers to form EV-microbead complexes (EMCs), incubating the EMCs with a carrier RNA, combining the EMCs with a cargo molecule in an electroporation buffer, applying an electroporation process to load the cargo molecule into the EVs, and contacting the EMCs with an RNase solution to remove unloaded cargo molecules.

[0031] In particular embodiments, the specific marker is a cellular surface protein. The cellular surface protein is selected from CD81, CD63, CD9, or other tetraspanins or membrane proteins. FIGS. 2A-2D provide characterization of unsorted EVs and CD8 E EVs. Specifically, FIG. 2B provides Western blot analysis of CDS T EVs on EMCs and the respective eluate, demonstrating successful capture of surface protein-specific EVs. FIG. 2C demonstrates successful immunoprecipitation of CD811EVs on microbeads through fluorescent staining.Applicant Ref.: 02240616954

[0032] The magnetic microbeads can have diameters ranging from about 0.1 micrometers to about 200 micrometers and are typically composed of polystyrene or other suitable materials with magnetic cores. The carrier RNA functions as a blocking agent to minimize non-specific binding of cargo molecules to surfaces. In some embodiments, the carrier RNA is polyA RNA (cRNA) added at concentrations ranging from about 10 to about 50 pg / mL and incubated for about 3 to about 10 minutes at room temperature prior to electroporation. (See, FIG. 8B, for example).

[0033] FIGS. 3A-3C illustrate comparison of strategies to remove unloaded residual cargo miRNA. As shown in FIG. 3A, EVs can be washed and incubated with various concentrations of RNase in the absence of electroporation. FIG. 3B illustrates electroporation performance of unsorted EVs, while FIG. 3C illustrates electroporation performance of CD8 I EMCs with the cumulative effects of RNase, cRNA blocking, and post-electroporation freezing.

[0034] In some embodiments, the ratio of EV protein to cargo molecule is optimized for loading efficiency For unsorted EVs, each electroporation aliquot contains approximately 1 to about 5 pg of vesicular protein and about 100 to about 1000 ng of cargo molecule. For EMCs with surface protein-specific EV subpopulations, approximately 1 × 105to about 5 × 105EMCs are combined with cargo molecules in electroporation buffer. After electroporation, samples are promptly transferred to collection tubes containing EDTA to prevent nucleic acid aggregation. Both unsorted EVs and EMCs are incubated on ice for a recovery period, typically about 30 to about 60 minutes, to allow membrane resealing and cargo retention.

[0035] Following electroporation, EMCs are subjected to RNase treatment to eliminate residual unloaded cargo molecules. In some embodiments, the EMCs are magnetically pelleted and resuspended in RNase solution at concentrations ranging from about 50 to about 500 pg / mL. The EMCs are incubated in the RNase solution for about 1 to about 5 minutes at room temperature, then magnetically pelleted again.

[0036] In some embodiments, the method further includes freezing the EMCs in the RNase solution at temperatures of about -20°C or lower. As demonstrated in FIGS. 4A-4C, optimization and stability of loaded EVs can be enhanced through various processing conditions.FIG. 4A depicts electroporation performance of CD81+EMCs with addition of RNase, cRNA, and freezing compared to unsorted EVs. Freezing provides cumulative effects for cargo elimination while EVs protect their internalized cargo from freeze-degradation. After freezing,Applicant Ref.: 02240616954the EVs can be thawed and the EMCs collected by magnetic separation FIG. 4 illustrates strategies for minimizing non-specific binding, showing the impact of various washing conditions (FIG. 8A), cRNA concentrations and incubation times (FIG. 8B), and fold decrease in miRNA between fresh and frozen samples (FIG. 8C).

[0037] Following purification, the loaded EVs can be eluted from the microbeads. In some embodiments, elution is achieved through mechanical disruption, chemical treatment, or enzymatic digestion. The eluted EVs retain their integrity and surface protein profiles throughout the loading and purification process.

[0038] EV integrity is assessed by measuring expression of endogenous genes such as U6 small nuclear RNA. As illustrated in FIG.2D, expression of U6 in CD81+EVs can be quantified relative to vesicular protein FIG. 4B illustrates EV integrity after freezing as quantified by percentage of endogenous gene U6 remaining. Surface marker stability is investigated through analysis of protein composition using Western blot or other analytical techniques. FIG. 4C provides Western blot analysis of the effects of electroporation and freezing on unsorted EVs and CD81+EMCs protein content.

[0039] In various embodiments, CD81+EMCs preserve substantial protein content with minimal degradation compared to unsorted EVs under identical processing conditions. FIG. 6 provides full blots and Ponceau S total protein stain corresponding to FIG. 2. FIG. 7A-7B depicts Western blot analysis of the effect of freezing, electroporation, and the addition of miRNA and cRNA on EV protein content. FIG. 9 provides full blots corresponding to FIG. 4, while FIG. 6 depicts Western blot analysis and densitometry of effects of freezing, electroporation, and RNA addition on EV protein expression.

[0040] FIG. 5 provides primer efficiencies for U6, cel-miR-67, and ath-miR1 9a determined using standard curves created from serial dilutions of RNA. These primer efficiency data enable accurate quantification of cargo loading and retention through quantitative PCR-based methods. The methods enable comprehensive characterization of loaded EVs through multiple analytical techniques including Western blotting, fluorescent microscopy, flow cytometry, and quantitative PCR. Each technique provides complementary information about EV surface protein profiles, cargo loading efficiency, and structural integrity.

[0041] The methods described herein provide several advantages for EV research and therapeutic development. The streamlined process reduces time, capital expenditure, and laborApplicant Ref.: 02240616954cost by combining purification and loading into a single efficient workflow As illustrated throughout FIGS. 2-4, processing time for washing steps is reduced to approximately 3 minutes per wash using magnetic microbead manipulation, significantly shorter than traditional methods requiring 20 minutes to multiple hours per wash.

[0042] The methods enable production of therapeutic-loaded EVs with specific surface protein profiles, enhancing targeted delivery capabilities. Selective loading of EVs exhibiting particular surface profiles improves cargo delivery efficiency to specific cell types or tissues. The use of microbeads as carriers throughout the process enables enhanced throughput and multiplexing of protein targets for screening and engineering of protein-specific EV subpopulations.

[0043] Surface protein-specific loaded EVs produced by these methods find applications in targeted therapeutic delivery for various disease applications, including but not limited to cancer treatment, wound healing, cardiovascular disease, neurological disease, and inflammatory conditions. The versatility of electroporation enables loading of various cargo molecules including small RNA, siRNA, miRNA, DNA, proteins, quantum dots, and drug molecules.

[0044] In some embodiments, the methods can be scaled for large-scale production of clinical-grade loaded EVs. The magnetic separation approach facilitates automation and high-throughput processing. Multiple EV subpopulations can be processed in parallel using microbeads coated with different antibodies, enabling comparative studies of delivery efficiency across EV subpopulations

[0045] While the embodiments described above and illustrated in FIGS. 1-4 utilize magnetic microbeads and CD81 as the target surface protein, the general concepts of the current invention are not limited to these specific implementations. Other surface proteins, other types of microbeads, and other cargo molecules can be employed without departing from the broad concepts of the invention.

[0046] In some embodiments, non-magnetic microbeads can be used with alternative separation methods such as centrifugation or filtration. In some embodiments, multiple surface proteins are targeted simultaneously using microbeads coated with multiple antibodies or using mixtures of microbeads with different antibody coatings.Applicant Ref.: 02240616954RESULTSPurification and detection of unsorted EVs and CD81+EVs

[0047] The enrichment of EVs from HEK-293 cell culturing media through polymer precipitation was confirmed by total protein assay and immunoblotting techniques. The average vesicular protein mass for EV isolates from 2.00 ± 0.18x107 cells was 81.9 ± 3.12 pg. Figure 2a shows comparable expression levels of CD81 and P-actin in both HEK-293 cells and EVs harvested from the cell culture media. Despite loading an identical protein amount (30 pg / lane), the expression patterns of proteins commonly used as western blot loading controls for cells and EVs, p-actin and CD81, respectively, were reversed. Specifically, the lane loaded with proteins from EVs exhibited high CD81 and minimal P-actin, while the HEK-293 cell lysate had significantly higher P-actin expression with hardly detectable CD81. Western blotting further confirmed the presence of CD81 in both CD81+EMCs and unsorted EVs (vesicular protein) (FIG. 2B) The immunoprecipitation eluate (i.e. the unbound EVs) had lower expression of CD81, indicating successful extraction CD8U EVs from the unsorted EV population and saturation of the microbead binding capacity. CD63, another tetraspanin commonly expressed in EVs, was also detected and observed to be highly enriched in the microbead-bound CD81+EVs. In addition to Western blotting, the successful visualization of CD81’ EVs through fluorescence microscopy confirmed the extraction of the surface protein-specific EVs using anti-CD8I coated microbeads (FIG 2B.). When stained with a fluorescent universal EV dye, CD81+EMCs had strong fluorescence signal, while the EV-absent microbeads, incubated only with anti-CD81 antibody, had no fluorescence.

[0048] In addition to protein characterization, we utilized U6, a small nuclear RNA (snRNA), as a reference gene for normalization of EV amounts in RT-PCR analysis. (28,31 33) U6 expression levels correlated with the number of CD8T EMCs, validating its effectiveness as an endogenous control (FIG.2D). Notably, 1.6 x 105 CD8H- EMCs demonstrated significant difference in U6 expression and was comparable to 3 pg of unsorted EVs, which aligns with the mass of vesicular protein used in previous studies. (11,24,25)RNase incubation of EVs after electroporation improves removal of unloaded miRNA

[0049] After electroporation, the loaded EVs underwent a purification step to remove any residual, unloaded miRNA FIG.3A illustrates the impact of the number of washes and washingApplicant Ref.: 02240616954buffer compositions on residual miRNA removal. As sequential washing in PBS was not sufficient for both unsorted EVs and CD81+EMCs in eliminating residual miRNA, we utilized RNase A to degrade any unloaded RNA. (21,34) to enhance the purity of the loaded EVs.Increasing the number of washes in RNase from 1 to 3 before RNase incubation had no significant effect on the removal of unloaded miRNA. As expected, a 20-minute incubation in RNase A sufficiently reduced residual miRNA for samples incubated with EVs without electroporation, particularly for the unsorted EVs, compared to EVs washed excessively in PBS. Nonetheless, increasing the RNase concentration from 50 to 500 pg / mL did not affect a significant change in unloaded miRNA. Moreover, the observed high variance in unsorted EVs incubated in RNase A may be a consequence of miRNA resistance to complete degradation by RNase. (35,36) Thus, we decided to wash miRNA-loaded EVs once in 200 pg / mL RNase A followed by a 20-minute incubation in 200 pg / mL RNase A because under these conditions RNA removal for CD81+EMCs outperformed unsorted EVs. Importantly, we did not observe any degradation of the internal control gene, U6, levels after RNase treatment, even for the highest RNase concentration (500 pg / mL), indicating that the RNA content internalized in EVs was not harmed by RNase incubation for 20 minutes at concentrations of <500 pg / mL.Carrier RNA minimizes non-specific binding on antibody coated microbeads

[0050] Upon further investigation to uncover the cause of less effective residual RNA removal in CD8U EMC samples (FIG. 3A), we discovered that the use of affinity-based EV extractions via antibody-coated microbeads leads to non-specific binding of miRNA to the microbead surfaces. This results in undesired variations and reduced effectiveness of residual miRNA removal, adversely affecting the accurate quantification of internalized miRNA. A separate investigation of antibody-coated microbeads, both alone and with EV conjugation, revealed that miRNA binds more to the bare antibody-coated microbead surface, absent of EVs, as compared to the microbead surface coated with EVs (FIG. 5). Washing with RNase A and a subsequent prolonged incubation in RNase A was not sufficient to completely remove nonspecifically bound miRNA for CD81+EMCs.

[0051] To address non-specific binding of miRNA to antibody-coated microbead surface, leading to potential false positive signals of cargo miRNA, we implemented poly A carrier RNAApplicant Ref.: 02240616954(cRNA). This carrier RNA, rich in adenine nucleotides compared to the cargo miRNA (cel-miR-67), effectively minimizes non-specific binding by preferentially binding to the microbeads before cargo miRNA is added. (37) FIG. 8B shows the resulting reduction in non-specific binding of cargo miRNA enhances the detection reliability of loaded miRNA. We tested various cRNA concentrations and incubation times to determine the optimal cRNA condition to minimize nonspecific binding of cargo miRNA to microbead surface. For CD81 EMCs, a brief 5 minute incubation of a low concentration of 25 pg / mL of cRNA proved to be the most effective at reducing non-specific binding of miRNA, as well as having the lowest variance. Additionally, it was not necessary to remove the excess cRNA after the incubation and before adding cargo miRNA and performing electroporation.

[0052] During the short incubation (<5 minutes), cRNA selectively binds to exposed antibody coated microbead surfaces, blocking sites where electroporation cargo miRNA could otherwise bind. As shown in FIG. 3C, the inclusion of cRNA reduced the expression levels and variance of cargo miRNA at 0 V for CDS I EMCs, signifying substantial electroporation performance for 200 V and 600 V. Conversely, for unsorted EVs, electroporation performance did not benefit from adding cRNA compared to the condition where loaded-EVs were simply incubated in RNase (FIG. 3B)Freezing enhances purity of both loaded CD81+and unsorted EVs

[0053] We assessed the impact of freezing on the purity of electroporated EVs by subjected them to non-regulated harsh storage conditions of -20°C for 3 days in 200 µg / mL RNase. CD81+EMCs with the EVs still bound to microbeads and unsorted EVs were frozen immediately after RNase incubation to exploit the ability of EVs to protect their contents during freezing, while leaving unencapsulated RNA exposed to freeze degradation.As depicted in Figure 3b and c, freezing led to a substantial enhancement in electroporation performance for 200 V (1 kV / cm) and 600 V (3 kV / cm) for CD81+EMCs and unsorted EVs after freezing. A closer analysis of miRNA loading efficiency, shown in FIG. 8C, further revealed the efficacy of freezing in removing residual miRNA without compromising electroporation-loaded miRNA. Notably, freezing the 0 V samples (i.e., non -electroporated) resulted in a greater reduction of unloaded residual cargo miRNA than freezing 600 V samples, suggesting that EVs protected electroporation-loaded miRNA from freeze-degradation.Applicant Ref.: 02240616954

[0054] Furthermore, CD81+ EMCs exhibited a more significant reduction in miRNA expression level for 0 V than unsorted EVs, affirming the successful use of freezing as a strategy to improve EV purity by eliminating residual cargo miRNA that non-specifically binds to the microbeads. With the exception of the 200 V condition for unsorted EVs, freezing reduced the variance in relative expression for all conditions as shown in FIGS. 3B and FIGS. 3C.Consequently, freezing the CD81+ EMCs after electroporation enhanced the purity of the final loaded-EV product and minimized variance in electroporation performance measurement, improving the accuracy of evaluating electroporation performance.

[0055] FIG. 4 shows the electroporation performance for CD81+EMCs under optimized conditions using RNase, cRNA, and freezing as compared to conventional methods of unsorted EVs with no additional residual miRNA removal approaches. The cRNA effectively increased purity of electroporated CD81+EMCs by reducing non-specific binding of cargo miRNA, and the subsequent freezing selectively destroyed remaining RNA, allowing accurate quantification of actual miRNA internalized in EVs. On the contrary, unsorted EVs did not benefit significantly from these additional approaches. Remarkably, with the addition of cRNA and freezing, electroporation performance for CD81+EVs on microbeads proved to be comparable, with the added benefit of lower variance, to the conventional method for unsorted EVs electroporationStability of EV biomarkers

[0056] Preserving the integrity and surface protein profiles of loaded EVs are essential to preserve their functionality and utilize them as targeted therapeutic carriers. In evaluating the stability of EV surface markers, we investigated the impact of electroporation, cRNA-addition, and freezing on the EVs native protein composition. The EV integrity after freezing was assessed by measuring the expression of the endogenous gene, U6, for frozen samples as compared to fresh samples (FIG. 4B). On average, unsorted EVs retained 47 ± 2.2% while CD81+ EMCs retained 54 ± 4.0% of U6 expression after freezing. Across all conditions, regardless of electric field strength and presence of cRNA, there was no significant differences (p>0.05) in amount of preserved U6 after freezing (FIG. 4B).

[0057] We also examined the protein stability in EVs through immunoblotting.Electroporation of unsorted EV and CD81+EMCs alone did not decrease expression of CD81,Applicant Ref.: 02240616954however the addition of exogenous RNA (cRNA and cel-mir-67) did decrease CD81 expression, but more so for unsorted EVs than CD81 + EMCs (approximately 28% and 15% for unsorted EVs and CD81+EMCs respectively) (FIG. 7A). We also measured the cumulative effects of RNA presence, electroporation, and freezing on protein expression through immunoblotting, shown in FIG. 4C Interestingly, freezing unsorted EVs reduced CD81 expression by about 29%, but CD81+ EMCs did not experience a reduction in CD81 expression under the same freezing conditions. Similarly, electroporation reduced the CD81 expression for unsorted EVs by about 35%, while CD81+ EMCs had consistent CD81 expression. Additionally, our process for electroporation loading and purification processes did not affect the observed protein size for any conditions, indicating that proteins did not undergo structural changes. Overall, under the same freezing and electroporation parameters, CD81+EMCs preserved their protein content better than unsorted EVs, with minimal degradation.DISCUSSION

[0058] We have described and established an innovative method for engineering protein-specific subpopulations of EVs loaded with miRNA through electroporation. Our approach exploits the benefits of affinity capture by utilizing microbeads as carriers of CD81 -enriched EVs. This streamlined process not only demonstrates cargo loading efficiency comparable to conventional electroporation, but also addresses challenges associated with affinity-based EV purification.

[0059] The surface protein components of EVs play pivotal role in their functionality, influencing their pharmacokinetics, targetability, and cargo internalization. (4) Our affinity-based EV selection approach, utilizing anti-CD81 -coated magnetic microbeads, streamlines the production of therapeutic-loaded EV production. This method combines purification and loading process into a single, efficient workflow, eliminating the need for post-loading purification of EV sub-populations. The result is a faster and cost-effective approach, reducing processing time to approximately 3 minutes per wash - significantly shorter than traditional methods such as ultrafiltration (>20 minutes per wash), ultracentrifugation (1 hour per wash), or polymer precipitation (12+ hours per wash).

[0060] The use of anti-CD81 -coated magnetic microbeads as selective EV carriers throughout EV harvesting, miRNA loading, and engineered EV purification enhances the speedApplicant Ref.: 02240616954and efficiency of the overall process This fast workflow allows for rigorous, repetitive washings, enhancing the purity of the loaded EVs, A high purity final EV product minimizes the potential for contamination from non-target EVs biomolecules, thereby reducing the risk of off-target toxicity. (5,14)

[0061] In tandem with our affinity-based EV -purification method, we chose electroporation as the exogenous molecular loading mechanism for selected EVs.Electroporation has proven to be a versatile method for loading EVs with a broad range of biomolecules, including small RNA (24,40), DNA, (25) and drug molecules, (22) with many studies optimizing the EV and RNA concentration, electric field strength, and electroporation buffers. (22,24) Furthermore, EVs have been shown to successfully deliver a wide range molecules with therapeutic outcomes, including siRNA, (9,40,41) miRNA, (21,32) and drugs. (42,43) In particular, miRNAs, which control protein expression impacting disease pathology and are natural cargo in EVs, have prompted interest in loading functional exogenous miRNA into EVs for therapeutic applications. (2) Exogenous miRNAs delivered into EVs through electroporation have demonstrated tumor suppressing capabilities, (44) promotion of angiogenesis to address diabetic wound healing, (45) myocardial ischemia, (32) and brain ischemia, (33) and regulate inflammatory activation. (34) Engineered EVs also show great promise for treating neurological diseases, such as Parkinson’s disease, due to their ability to penetrate the blood-brain barrier. (46,47)

[0062] Our findings reveal that physical sequential washing in PBS is ineffective in removing residual miRNA non-specifically bound to both unsorted EVs and CD81+ EMCs. While RNase sufficiently reduced unloaded miRNA for unsorted EVs, RNase was not adequate for CD81+EMCs, due to non-specific binding of non-internalized cargo miRNA to the antibody-coated microbeads. Despite efforts involving washing with RNase and additional extended RNase incubation, residual cargo miRNA levels remained in EMC samples both with and without electroporation. The persistence of this unloaded miRNA, irrespective of washing time or RNase concentrations, is attributed to excessive molecule-protein interactions between EMC samples and RNA, as well as miRNA resistance to complete degradation by RNase. (35,36) In principle, antibody-coated microbeads should selectively immobilize EVs with the binding target on their surface. However, in practice, such microbeads interact extensively with various biomolecules abundant in biological solutions, introducing non-specific interactions. (48) TheApplicant Ref.: 02240616954utilization of affinity capture for engineering EVs introduces a specificity challenge that cannot be resolved simply through excessive washing and incubation with RNase.

[0063] To address this issue, we implemented a novel procedure involving the addition of carrier RNA (cRNA) and post-electroporation freezing. The adenine-rich carrier RNA minimized nonspecific binding of cargo miRNA to the exposed microbeads surfaces. We found that a brief 5-minute incubation with cRNA minimally changes processing complexity for CD81+EMCs compared to unsorted EVs, while significantly enhancing the purity. Freezing the engineered EVs for prolonged storage provides an added benefit of further enhancing the purity of the final EV product. Previous studies have demonstrated that electroporation with cargo RNA does not affect the protein content of the EVs, as well as the native miRNA content. (21) EVs have also been shown to protect encapsulated RNA contents for at least 30 minutes of incubation in RNase. (49) Similarly, our finding indicates that CD81+EVs retain their characteristic protein markers and protect their miRNA contents after electroporation with carrier RNA and RNase treatment, and even after the freezing-storage. By overcoming inevitable challenges of affinity-based purification, we achieved production of highly purified, miRNA-loaded EVs with selective surface protein and low variance.

[0064] While our study provides a valuable means for the efficient loading and purification of EVs, it is essential to acknowledge certain limitations. Our focus in this study was simplifying the entire process of engineering EVs, including EV selection, miRNA loading, and improving the final purity of EVs, rather than investigating the effects of EV concentration, miRNA concentration, or the EV to miRNA ratio, which have been reported on extensively. (11,21-24) We tested our systems loading efficiency for widely accepted electroporation conditions, and we anticipate further improvements in electroporation performance when optimizing other important parameters, such as the number, type, and duration of electric pulses. (22,25)

[0065] Further possibility for optimization remains regarding the freeze storage conditions. For example, freezing at -80°C or introducing snap freezing may reduce damage to EVs, which could improve the survival of intact EVs, while also preventing leakage of loaded miRNA cargo. (50,51) Additionally, transient EV membrane permeation during freezing could allow RNase molecules to leak into EVs and decrease internal miRNA content. While we observed no reduction in endogenous RNA expression (U6) with the addition of RNase, but theApplicant Ref.: 02240616954introduction of freezing did reduce U6 expression. This degradation could be addressed with digestion or removal of RNase prior to EV freezing, a process that is made simple with the use of microbead carriers of EV s. While some EV degradation is expected after freezing, the effects of freezing may have been more pronounced in the analysis of U6 based on some evidence that U6 decreases after freeze-thaw cycles, possibly due to its relatively long length. (52) Ultimately however, there remains a lack of consensus around universal EV endogenous control genes, (28,53) but U6 continues to be commonly used for analysis of EV loading. (21,32,33,45)

[0066] This proof-of-concept demonstration for encapsulating miRNA into protein-specific subpopulations of EVs suggests a streamlined strategy for loading and purifying EVs. Clinically relevant target proteins and therapeutic RNAs can be substituted for CD81 and cel-miR-67. For example, certain EV membrane proteins, such as CD47, have been shown to improve EV evasion of the immune system, thereby improving delivery of EV contents to tumor tissue (9,10) Additionally, EVs can be modified with surface proteins and ligands to further improve targeting capabilities. (3,40,54) Despite some progress, the use engineered surface ligands and proteins on nanoparticles have repeatedly failed in clinical translation, likely due to increased nanoparticle clearance from circulation and prevention of entry into target tissues for delivery of therapeutics. (4) With their similar structure to lipid nanoparticles, EVs engineered with many targeting membrane modifications may face the same fate of clinical failure, suggesting the importance of exploiting the native surface protein in EVs.

[0067] Similarly, miRNAs expansive role in gene regulation make them prominent candidates for EV-mediated delivery. Specifically, miRNAs, such as miR-31, miR-451, (21) and miR-26a (55) have been used to suppress tumor cell proliferation, while other such as miR-155, miR-939, and miR-223 / 142 (56-58) regulate inflammation. Other miRNAs have been used for promotion of angiogenesis (32,33,45) and neurological diseases such as Parkinson’s. (46,47) Beyond miRNA, therapeutic molecules including siRNA, DNA, proteins, and drugs, have been loaded into EVs with electroporation. (59,60) EV engineering through electroporation with therapeutic cargo holds great potential for clinical applications, owing to the versatility of potential cargo molecules.

[0068] Integration of our rapid EV production method with microfluidic microparticle manipulation techniques and a gentle mechanism to elute loaded EVs from microbeads is expected to significantly enhance the throughput of therapeutic EV production (61,17) The useApplicant Ref.: 02240616954of microparticles with different sizes or internalized fluorescent labels corresponding to distinctive EV-targeting antibodies allows for multiplexing, enabling the processing of various EVs expressing different surface markers in a single loading step and subsequent segregation of microbeads.MATERIALS AND METHODSIsolation and Enrichment of CD81+EVs

[0069] A polymer-based precipitation kit (System Biosciences, EXOTC50A-1) was employed to initially isolate and concentrate the unsorted total population of extracellular vesicles (EVs) from HEK-293 cells by following the manufacturer's instructions. HEK-293 cells were purchased from ATCC and cultured at 37°C and 5% CO2 in DMEM (Gibco, 11995073) supplemented with 1% Penicillin-Streptomycin (Gibco, 15070063) and 10% exosome-depleted FBS (Gibco, A2720801), HEK-293 cells were cultured in 8 mL of media in a 75 cm2flask for 72 hours to reach a concentration of 2×107cells / mL. The resulting 8 mL of cell culture conditioned media were centrifuged for 15 minutes at 3000 × g at room temperature to remove cell debris The supernatant was then combined with 2 mL ExoQuick-TC and stored upright at 4°C overnight. The mixture was centrifuged for 30 minutes at 2000 × g at room temperature to pellet EVs. After aspirating the supernatant, the pellet was centrifuged for another 5 minutes at 2000 × g. The EV pellet was resuspended in 150 pL of cold, RNase-free PBS (Thermo Fisher Scientific, AM9625) and used immediately or stored at -20°C.

[0070] The BCA Protein Assay (Thermo Fisher Scientific, 23227) was used to quantify the total vesicular protein concentrations in the EV pellets by following the manufacturer's protocol (See FIGS. 2A-2D). CD81+EVs were further extracted from the isolated EVs by immunoprecipitation. An aliquot of isolated EVs containing 200 pg of vesicular proteins were conjugated with 6.4 × 105polystyrene microbeads coated with anti-CD81 antibodies (CD81 ExoFlow Capture Kit, System Biosciences, EXOFLOW400A-1) following the manufacturer protocol. This conjugation process resulted in the formation of CD81 / EV-Microbead Complexes (EMCs). The EVs were stained with Exo-FITC, fluorescent molecules conjugated to universal extracellular vesicle binding proteins (System Biosciences, EXOFLOW400A-1) according to the manufacturer protocol. EMCs were imaged on an inverted microscope (Nikon, Eclipse Ti2) equipped with a white light source (Lumencor, Sola Light Engine) and filter cubes capable of fluorescence imaging, and a camera (Photometries, Cool SNAP DYNO). BrightfieldApplicant Ref.: 02240616954images were taken with an exposure time of 28 ms and fluorescent images were taken with an exposure time of 1 s (See FIGS. 2A-2D).Electroporation-Mediated miRNA Loading into Unsorted and CD81+ EVs

[0071] To demonstrate miRNA loading ability via electroporation into EVs, both unsorted EVs and CD81 + EMCs were subjected to electroporation using cel-miR-67-3p mimic (Thermo Fisher Scientific, 4464066, Assay ID: MC10867) as the cargo molecule as mentioned in FIG. 1. The EV protein to miRNA ratio, electric field strengths, and the presence of a blocking additive were considered to identify optimal loading conditions using electroporation (See FIGS. 3A-3C). EV and miRNA mixtures were prepared in a total volume of 450 pL of electroporation buffer (Gene Pulser Electroporation Buffer, Bio-Rad, 1652676) in a single microcentrifuge tube Subsequently, the mixture was aliquoted into electroporation cuvettes, with 50 pL for each replicate of each electroporation condition.

[0072] For unsorted EVs, each aliquot under different conditions contained approximately 3 pg of vesicular protein and 500 ng of miRNA, following previously reported ratios. For EMCs with CD81 EV subpopulation, approximately 1.6 × 105EMCs, initially incubated with 50 pg of vesicular protein, were combined with 500 ng of miRNA in the electroporation buffer. For both unsorted EVs and CD81+ EMCs, a total volume of 50 pL was added to a 0.2 cm cuvette (Bio-Rad, 1652082) for electroporation at various voltages, resulting in electroporation electric fields of 0 V / cm (0 V), 1000 V / cm (200 V), 3000 V / cm (600 V), using the Eppendorf Eporator (Eppendorf, 4309000027).

[0073] The electroporated unsorted EVs and CD81+ EMCs were promptly transferred out of their respective cuvettes into individual microcentrifuge tubes containing 5 mM EDTA to prevent nucleic acid aggregation. The cuvettes were promptly washed with 50 pL TE buffer (Thermo Fisher Scientific, AM9858) to recover any remaining sample. Both unsorted EVs and CD81+ EMCs were incubated on ice for 45 minutes.Applicant Ref.: 02240616954Name Sequence Specie' Accession Number Caenorhabditiscel-miR-67-3p GCAAACCUCCUAGAAAGAGUAGA MI0000078elegansath-miR-159a UUUGGAUUGAAGGGAGCUCUA Arabidopsis MI0000189GTGCTCGCTTCGGCAGCACATATAU6 snRNA CTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGG Human NR_004394ATGACACGCAAATTCGTGAAGCGTTCCATATTTTTable 1. Detailed information on the utilized in the current inventionRefining EV Purity Through Residual miRNA Elimination

[0074] To ensure robust purity of loaded EVs, a comprehensive three-pronged approach was employed to eliminate residual miRNA not internalized into the EV s during electroporation loading. First, poly A carrier RNA (cRNA) (Qiagen, 1017647) was introduced into the electroporation buffer prior to electroporation to block non-specific binding on antibody-coated microbeads. cRNA was added at a final concentration of 25 pg / mL to 200 pL of unsorted EVs or CD81+EMCs in electroporation buffer and incubated for 5 minutes at room temperature. Next, 45 pL of cargo miRNA at an initial concentration of 0.1 pg / pL and additional 200 pL electroporation buffer was added to complete the EV-miRNA 450 pL mixture prior to electroporation.

[0075] Second, a meticulous RNase-based strategy involved washing and a subsequent 20-minute incubation in RNase to remove and destroy unloaded cargo miRNA (either cel-miR-67 or ath-miR159a). For CD8T EMCs, the magnetic microbeads coated with electroporated EVs (EMCs) were pelleted using a magnetic stand and resuspended in 200 pL of 200 pg / mL RNase A (Thermo Fisher Scientific, EN0531). A working solution of 200 pg / mL RNase was created by dissolving 240 pL of RNase A with a stock concentration of 10 mg / mL in 12 mL TE buffer. EMCs were incubated for 3 minutes in RNase at room temperature and then pelleted on the magnetic stand again.

[0076] For unsorted EVs, unloaded miRNA was removed by ultrafiltration through a 100 kDa MWCO centrifugal filter unit (Millipore Sigma, UFC210024). 125 pL of the miRNA-loaded EV containing electroporation buffer, diluted in 1 mL of PBS, were centrifuged in the centrifugal filter unit at 7000 × g for 15 minutes. The final unsorted EVs were concentrated to aApplicant Ref.: 02240616954volume of approximately 20 µL, which was then resuspended and washed in a total volume of 200 µL containing 200 µg / mL RNase. After one wash in 200 µg / mL of RNase, CD81+EMCs were pelleted again on a magnetic stand, while unsorted EVs were concentrated with a centrifugal filter. Both samples were then resuspended in 200 µL of 200 µg / mL RNase and incubated at room temperature for 20 minutes on a rotating rack.

[0077] Third, the electroporated EVs were subjected to freezing at -20°C in RNase for 3 days to investigate the cumulative effects of prolonged frozen storage on miRNA elimination and EV integrity. As a comparison, not-frozen control samples were prepared by promptly adding 150 µL lysis buffer (Qiagen, 217204) after the 20 minutes RNase incubation to neutralize the RNase, readying EVs for subsequent miRNA purification.Quantification of Electroporated miRNA via RT-PCR

[0078] The loaded miRNA was extracted from EVs using the miRNeasy Serum / Plasma Advanced Kit (Qiagen, 217204), following the manufacturer's protocol. After miRNA extraction, the miRNA underwent reverse transcription using Taqman MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 4366596), followed by PCR according to the manufacturer protocol (See Table 1. And FIG. 5). As mentioned in FIG. 2D, U6 was selected as a reference gene for normalizing loaded cel-miR-67 in EV samples. For samples without EVs, where U6 is absent (e.g., microbeads with no captured EVs), ath-miR159a served as a miRNA extraction spike-in control (Thermo Fisher Scientific, 4464066, Assay ID: MC10332) for PCR normalization.

[0079] The corresponding primers used for reverse transcription and PCR amplifications were purchased from Thermo Fisher Scientific (4427975) and used without modification. The primer amplification efficiencies, calculated from standard curves, were as follows: cel-miR-67, 89% (Etarget = 1.89), ath-miR159a, 89% (Espike-in = 1.89), and U6, 102% (Eref= 2.02). PCR was performed using TaqMan Universal Master Mix II (Thermo Fisher Scientific, 4440040).Statistical Analysis and qPCR Quantification

[0080] The relative expression of the cargo miRNA to internal or spike-in controls was calculated using quantitative PCR methods. For samples with endogenous reference genes (EVs containing U6), the standard 2‘ACTmethod was used, where:Applicant Ref.: 02240616954Relative Expression = 2‘, CT-l:"-ci'CT>re!)where CT, target is the cycle threshold of the target miRNA (cel-miR-67) and CT, ref is the cycle threshold of the reference gene (U6).

[0081] For samples analyzed with the Pfaffl method, which accounts for differences in primer amplification efficiencies between the target and reference genes, the following equation was used:Ratio =(Etarget)ΔCTtarget / (Eref)ΔCTrefwhere E is the primer amplification efficiency (calculated as E = 10’"1 s,ope)from the standard curve), and ACT represents the difference in cycle thresholds between control and treatment conditions.

[0082] For samples without EV s where U6 is absent, the spike-in control ath-miR159a was used for normalization using similar calculations:Relative Expression =(Etarget)AC 1‘tar8etI (Espike-in)ACI'spike"ul

[0083] To ensure data integrity, the inter-quartile range method was implemented for outlier identification. Analysis of variance (ANOVA) with Tukey's multiple comparisons test was performed to assess statistical significance between groups. Statistical significance was defined as follows: no significance (n.s.) p>0.05; *p<0.05; **p<0.01; ***p<0.001; and ****p<0.0001. Mean values are expressed as mean ± SEM unless otherwise stated.EV Protein Composition and Integrity Verification via Western Blot

[0084] The composition and integrity of tetraspanins proteins (CD81 and CD63), the internal EV protein (Alix), and the ubiquitous cellular protein (P-actin) in tested EV samples were assessed by western blot. EV s were lysed in RIP A buffer (Thermo Fisher Scientific, 89900) with 100x protease inhibitor (Thermo Fisher Scientific, 78440), followed by three rounds of sonication for 5 minutes each, with vortex mixing after each sonication. After lysis, the protein concentration of lysates was measured using the BCA Protein Assay (Thermo Fisher Scientific, 23227).Applicant Ref.: 02240616954

[0085] Undiluted lysates were prepared with 4× LDS sample buffer (Thermo Fisher Scientific, NP0007) and 10x reducing agent (Thermo Fisher Scientific, NP0009), Samples were heated for 10 minutes at 70°C, briefly centrifuged, and then loaded into 4-12% Bis-Tris gels (Thermo Fisher Scientific, NP0321). Lanes are loaded with equivalent amount of protein or number of EMCs and their eluate, as noted in their respective figures. Gel electrophoresis was performed with MES SDS Running Buffer (Thermo Fisher Scientific, NP0002) at a voltage of 200 V for 35 minutes. Subsequent transfer to a PVDF membrane was performed using transfer buffer (Thermo Fisher Scientific, NP0006I) for 1 hour at 30 V.

[0086] Membranes underwent three 5-minute washes at room temperature on a rocker with TBS-Tween20 Buffer (Thermo Fisher Scientific, 28360). The membranes w’ere blocked for 1 hour at room temperature and then incubated overnight at 4°C on a rocker with the respective antibodies diluted in SuperBlock Blocking Buffer (Thermo Fisher Scientific, 37536). After primary antibody incubation, the membranes were again washed 3 times in TBS-T and then incubated on a rocker for 1 hour at room temperature with the secondary antibody. Primary antibodies used were anti-CD63 (1:1000, Santa Cruz Biotechnology, sc-5275), anti-CD81 (1:1000, Santa Cruz Biotechnology, sc-166029), anti-Alix (1:1000, Cell Signaling Technology, 2171), and anti-P-actin (1:1000, Santa Cruz Biotechnology, sc-47778). Secondary antibodies used were HRP conjugated sheep anti-mouse IgG (1:5000, Jackson ImmunoResearch, 515-035- 003).Applicant Ref.: 02240616954References and Notes:1. Witwer KW, Wolfram J. Extracellular vesicles versus synthetic nanoparticles for drug delivery. Nat Rev Mater. 2021 Jan 7;6(2): 103-6.2. Munir J, Yoon JK, Ryu S. Therapeutic miRN A- Enriched Extracellular Vesicles: Current Approaches and Future Prospects. Cells. 2020 Oct 11;9(10):2271.3. Walker S, Busatto S, Pham A, Tian M, Suh A, Carson K, et al. Extracellular vesicle-based drug delivery systems for cancer treatment. Theranostics. 2019;9(26):8001-17.4. Wolfram J, Ferrari M. Clinical cancer nanomedicine. Nano Today. 2019 Apr;25:85-98.5. Ghodasara A, Raza A, Wolfram J, Salomon C, Popat A. Clinical Translation of Extracellular Vesicles, Adv Healthcare Materials. 2023 Nov;12(28):2301010.6. Bie N, Yong T, Wei Z, Gan L, Y ang X. Extracellular vesicles for improved tumor accumulation and penetration. Advanced Drug Delivery Reviews. 2022 Sep;188: 114450.7. Shao J, Zaro J, Shen Y. Advances in Exosome-Based Drug Delivery and Tumor Targeting: From Tissue Distribution to Intracellular Fate. IJN. 2020 Nov; Volume 15:9355-71.8. De Abreu RC, Fernandes H, Da Costa Martins PA, Sahoo S, Emanueli C, Ferreira L. Native and bioengineered extracellular vesicles for cardiovascular therapeutics. Nat Rev Cardiol. 2020 Nov, 17(11):685-97.9. Kamerkar S, LeBleu VS, Sugimoto H, Yang S, Ruivo CF, Melo SA, et al. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature. 2017 Jun;546(7659):498- 503.10. Kooijmans SAA, Vader P, Schiffelers RM. Tumour-bound RNA-laden exosomes. Nat Biomed Eng. 2017 Aug; 1(8): 634 -6.11. Mendt M, Kamerkar S, Sugimoto H, McAndrews KM, Wu CC, Gagea M, et al. Generation and testing of clinical-grade exosomes for pancreatic cancer. JCI Insight. 2018 Apr19;3(8):e99263.Applicant Ref.: 0224061695412 Yong T, Zhang X, Bie N, Zhang H, Zhang X. Li F, et al. Tumor exosome-based nanoparticles are efficient drug carriers for chemotherapy. Nat Commun. 2019 Aug 23;10(l):3838.13. Qiao L, Hu S, Huang K, Su T, Li Z, V ndergriff A, et al. Tumor cell-derived exosomes home to their cells of origin and can be used as Trojan horses to deliver cancer drugs. Theranostics. 2020;10(8):3474-87.14 Zeng Y, Qiu Y, Jiang W, Shen J, Yao X, He X, et al. Biological Features of Extracellular Vesicles and Challenges. Front Cell Dev Biol. 2022 Jun 24;10:816698. 15. De Jong OG, Kooijmans SAA, Murphy DE, Jiang L, Evers MJW, Sluijter JPG, et al. Drug Delivery with Extracellular Vesicles: From Imagination to Innovation. Acc Chem Res. 2019 Jul16;52(7): 1761-70.16. Xu D, Di K, Fan B, Wu J, Gu X, Sun Y, et al. MicroRNAs in extracellular vesicles: Sorting mechanisms, diagnostic value, isolation, and detection technology. Front Bioeng Biotechnol. 2022 Oct 17; 10:948959.17. Allelein S, Medina-Perez P, Lopes ALH, Rau S, Hause G, Kolsch A, et al. Potential and challenges of specifically isolating extracellular vesicles from heterogeneous populations. Sci Rep. 2021 Jun 2;11(1): 11585.18. Wiklander OPB, Bostancioglu RB, Welsh JA, Zickler AM, Murke F, Corso G, et al.Systematic Methodological Evaluation of a Multiplex Bead-Based Flow Cytometry Assay for Detection of Extracellular Vesicle Surface Signatures. Front Immunol. 2018 Jun 13;9: 1326.19. Koliha N, Wiencek Y, Heider U, Jungst C, Kladt N, Krauthauser S, et al. A novel multiplex bead-based platform highlights the diversity of extracellular vesicles. J of Extracellular Vesicle 2016 Jan;5(l):29975. 20. Antes T, Kevin Kwei, Fangting Wu. Methods for microvesicle isolation and selective removal. US9005888B2, 2015.21. Pomatto MAC, Bussolati B, D'Antico S, Ghiotto S, Tetta C, Brizzi MF, et al. Improved Loading of Plasma-Derived Extracellular Vesicles to Encapsulate Antitumor miRNAs.Molecular Therapy - Methods & Clinical Development. 2019 Jun; 13: 133-44.Applicant Ref.: 0224061695422 Lennaard AJ, Mamand DR, Wiklander RJ, El Andaloussi S, Wiklander OPB. Optimised Electroporation for Loading of Extracellular Vesicles with Doxorubicin. Pharmaceutics. 2021 Dec 24;14(1):38.23. Lamichhane TN, Jay SM. Production of Extracellular Vesicles Loaded with Therapeutic Cargo. Methods Mol Biol. 2018;1831:37-47.24. Kooijmans SAA, Stremersch S, Braeckmans K, de Smedt SC, Hendrix A, Wood MJA, et al. Electroporation-induced siRNA precipitation obscures the efficiency of siRNA loading into extracellular vesicles. Journal of Controlled Release. 2013 Nov;172(l):229-38.25. Lamichhane TN, Raiker RS, Jay SM. Exogenous DNA Loading into Extracellular Vesicles via Electroporation is Size-Dependent and Enables Limited Gene Delivery. Mol Pharmaceutics.2015 Oct 5; 12(10)3650-7.26. Kinoshita T, Yip KW, Spence T, Liu FF. MicroRNAs in extracellular vesicles: potential cancer bi omarkers. J Hum Genet. 2017 Jan;62(l):67-74.27. Shi J. Considering Exosomal miR-21 as a Biomarker for Cancer. JCM. 2016 Mar 29,5(4):42.28. Crossland RE, Norden J, Bibby LA, Davis J, Dickinson AM Evaluation of optimal extracellular vesicle small RNA isolation and qRT-PCR normalisation for serum and urine. Journal of Immunological Methods. 2016 Feb;429:39-49.29. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. 2001 May l;29(9):45e-4530. Lasser C, Eldh M, Lotvall J. Isolation and Characterization of RNA-Containing Exosomes. JoVE. 2012 Jan 9;(59):3037.31. Donati S, Ciuffi S, Brandi ML. Human Circulating miRNAs Real-time qRT-PCR-based Analysis: An Overview of Endogenous Reference Genes Used for Data Normalization. IJMS. 2019 Sep 5;20(18):4353.Applicant Ref.: 0224061695432 Ma T, Chen Y, Chen Y, Meng Q, Sun J, Shao L, et al MicroRNA-132, Delivered by Mesenchymal Stem Cell-Derived Exosomes, Promote Angiogenesis in Myocardial Infarction, Stem Cells International. 2018 Sep 9;2018: 1—11.33. Yang J, Zhang X, Chen X, Wang L, Yang G. Exosome Mediated Delivery of miR-124 Promotes Neurogenesis after Ischemia. Molecular Therapy - Nucleic Acids. 2017 Jun;7:278-87.34. Momen-Heravi F, Balaj L, Alian S, Mantel PY, Halleck AE, Trachtenberg AJ, et al. Current methods for the isolation of extracellular vesicles Biological Chemistry. 2013 Oct l;394(10): 1253-62.35. Lam JKW, Chow MYT, Zhang Y, Leung SWS. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy - Nucleic Acids. 2015;4:e252.36. Layzer JM, Mccaffrey AP, Tanner AK, Huang Z, Kay MA, Sullenger BA. In vivo activity of nuclease-resistant siRNAs. RNA. 2004 May,10(5):766-71.37. Helm M, Lyko F, Motorin Y. Limited antibody specificity compromises epitranscriptomic analyses. Nat Commun. 2019 Dec 11; 10(1 ) 5669.38. Jeyaram A, Jay SM. Preservation and Storage Stability of Extracellular Vesicles for Therapeutic Applications. AAPS J. 2018 Jan;20(l):l.39. Glinge C, Clauss S, Boddum K, Jabbari R, Jabbari J, Risgaard B, et al. Stability of Circulating Blood-Based MicroRNAs - Pre-Analytic Methodological Considerations. Calin G, editor. PLoS ONE 2017 Feb 2; 12(2):e016796940. Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJA. Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr;29(4):341-5.41. Xu L, Faruqu FN, Lim YM, Lim KY, Liam-Or R, Walters AA, et al. Exosome-mediated RNAi of PAK4 prolongs survival of pancreatic cancer mouse model after loco-regional treatment. Biomaterials. 2020 Sep; 120369.Applicant Ref.: 0224061695442 Bagheri E, Abnous K, Farzad SA, Taghdisi SM, Ramezani M, Alibolandi M. Targeted doxorubicin-loaded mesenchymal stem cells-derived exosomes as a versatile platform for fighting against colorectal cancer. Life Sciences. 2020 Nov;261: 118369.43. Haney MJ, Zhao Y, Jin YS, Li SM, Bago JR, Klyachko NL, et al. Macrophage-Derived Extracellular Vesicles as Drug Delivery Systems for Triple Negative Breast Cancer (TNBC) Therapy. J Neuroimmune Pharmacol. 2020 Sep,15(3):487-500.44. Mills J, Capece M, Cocucci E, Tessari A, Palmieri D. Cancer-Derived Extracellular Vesicle-Associated MicroRNAs in Intercellular Communication: One Cell’s Trash Is Another Cell’s Treasure. IJMS 2019 Dec 4;20(24):6109.45. Lv Q, Deng J, Chen Y, Wang Y, Liu B, Liu J. Engineered Human Adipose Stem-Cell- Derived Exosomes Loaded with miR-21 -5p to Promote Diabetic Cutaneous Wound Healing. Mol Pharmaceutics. 2020 May 4; 17(5): 1723— 33.46. Izco M, Blesa J, Schleef M, Schmeer M, Porcari R, Al-Shawi R, et al. Systemic Exosomal Delivery' of shRNA Mini circles Prevents Parkinsonian Pathology. Molecular Therapy. 2019 Dec;27(12):2111-22.47. Haney MJ, Klyachko NL, Zhao Y, Gupta R, Plotnikova EG, He Z, et al. Exosomes as drug delivery vehicles for Parkinson’s disease therapy. Journal of Controlled Release. 2015Jun, 207:18-30.48. Zheng W, Li G, Li X, Affinity purification in target identification: the specificity challenge Arch Pharm Res. 2015 Sep;38(9): 1661-85. 49. Koga Y, Yasunaga M, Moriya Y, Akasu T, Fujita S, Yamamoto S, et al. Exosome can prevent RNase from degrading microRNA in feces J Gastrointest Oncol. 2011 Dec, 2(4):215-22.50. Gelibter S. Marostica G, Mandelli A, Siciliani S, Podini P, Finardi A, et al. The impact of storage on extracellular vesicles: A systematic study. J of Extracellular Vesicle. 2022Feb;11(2):e12162. 51. Yarana C, St. Clair D Chemotherapy-Induced Tissue Injury: An Insight into the Role of Extracellular Vesicles-Mediated Oxidative Stress Responses. Antioxidants. 2017 Sep 28;6(4):75.Applicant Ref.: 0224061695452 Xiang M, Zeng Y, Yang R, Xu H, Chen Z, Zhong J, et al. U6 is not a suitable endogenous control for the quantification of circulating microRNAs, Biochemical and Biophysical Research Communications. 2014 Nov;454(l):210-4.53. Thery C, Witwer KW, Aikawa E, Alcaraz MJ, Anderson JD, Andriantsitohaina R, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J of Extracellular Vesicle. 2018 Dec;7(l):1535750.54. Kooijmans SAA, Aleza CG, Roffler SR, Van Solinge WW, Vader P, Schiffelers RM.Display of GPl-anchored anti-EGFR nanobodies on extracellular vesicles promotes tumour cell targeting. J of Extracellular Vesicle 2016 Jan;5(l):31O5355. Liang G, Kan S, Zhu Y, Feng S, Feng W, Gao S. Engineered exosome-mediated delivery of functionally active miR-26a and its enhanced suppression effect in HepG2 cells. UN. 2018 Jan; Volume 13:585-99.56. Bala S, Csak T, Momen-Heravi F, Lippai D, Kodys K, Catalano D, et al. Biodistribution and function of extracellular miRNA-155 in mice. Sci Rep. 2015 May 29;5(1): 10721.57. Ramanathan S, Shenoda BB, Lin Z, Alexander GM, Huppert A, Sacan A, et al. Inflammation potentiates miR-939 expression and packaging into small extracellular vesicles. J of Extracellular Vesicle. 2019 Dec;8(l): 1650595.58. Zhang D, Lee H, Wang X, Groot M, Shanna L, Dela Cruz CS, et al. A potential role of microvesicle-containing miR-223 / 142 in lung inflammation. Thorax. 2019 Sep;74(9):865-74.59 Sutaria DS, Badawi M, Phelps MA, Schmittgen TD. Achieving the Promise of Therapeutic Extracellular Vesicles: The Devil is in Details of Therapeutic Loading. Pharm Res. 2017 May;34(5): 1053-66.60. Han Y, Jones TW, Dutta S, Zhu Y, Wang X, Narayanan SP, et al. Overview and Update on Methods for Cargo Loading into Extracellular Vesicles, Processes. 2021 Feb 15;9(2):356.Applicant Ref.: 0224061695461 Kalyan S, Torabi C, Khoo H, Sung HW, Choi SE, Wang W, et al. Inertial Microfluidics Enabling Clinical Research. Micromachines. 2021 Mar 3; 12(3):

Claims

Applicant Ref.: 02240616954WE CLAIM:

1. A method of producing material comprising a population of extracellular vesicles (EVs) complexes, comprising:providing a sample comprising a population of EVs of interest;enhancing said population of EVs of interest over other components of said sample to provide an enhanced precursor material; andapplying an electroporation process to said enhanced precursor material to combine a cargo agent with at least a portion of said EVs of interest to provide said material comprising said population of extracellular vesicle (EV) complexes2. A method of producing protein-specific protein specific subpopulations of extracellular vesicles (EVs) comprising:obtaining a sample comprising a heterogenous population of extra cellular vesicles; combining said sample with a plurality of magnetic microbeads coated with antibodies targeting specific markers to form EV microbead complexes (EMCs),wherein said marker is an EV surface protein;wherein incubating said EMCs with a Poly A carrier RNAwherein said EMCs are combined with a cargo agent to form an electroporation mixture thenloading said cargo agent into said EVs by subjecting said electroporation mixture to electroporationfollowed by washing said electroporation mixture in buffer containing RNase and incubating said washed electroporated EMCs in RNase-containing buffer to remove unloaded cargo agent.

3. A method for producing extracellular vesicles with enhanced cargo purity comprising;Applicant Ref.: 02240616954providing extracellular vesicles complexed with a substrate;loading said complexed extracellular vesicles with a cargo agent through electroporation;removing unloaded cargo through enzymatic degradation; andfreezing said purified EV-microbead complexes to enhance purity.

4. The method according to claim 1, wherein said enhancing population of EVs of interest comprises providing a substrate that selectively binds to said EVs.

5. The method according to claim 1, wherein said cargo agent is selected from the group consisting of miRNA, siRNA, DNA, RNA, proteins, peptides, drugs, quantum dots and nucleic acids.

6. The method according to claim 1, wherein said EVs of interest are derived from a cell source selected from the group consisting of HEK-293 cells, tumor cells, mesenchymal stem cells, cancer cells and neuronal cells.

7. The method according to claim 1, wherein said electroporation process is performed in an electroporation buffer.

8. The method according to claim 1, further consisting of a purification step after electroporation comprising:blocking non-specific binding sites with Poly A carrier RNA prior to electroporation;washing said EV complexes in RNase-containing buffer, andincubating said EV complexes in RNase-containing buffer.Applicant Ref.: 022406169549. The method according to claim 4, wherein said substrate is a plurality of microbeads coated with a capture agent that binds selectively to said EVs of interest, wherein said EV complexes comprises: an EV of interest, a cargo agent, and a microbead.

10. The method according to claim 9, wherein said capture agent comprises antibodies specific to a surface protein.

11. The method according to claim 10, wherein said surface protein is a Cluster of Differentiation (CD) protein, tetraspanin protein or cellular surface protein.

12. The method according to claim 11, wherein said Cluster of Differentiation protein is selected from a group comprising of CD81, CD47, CD54 or CD63 proteins.

13. The method according to claim 2, wherein said carrier RNA is incubated with said EMCs at room temperature.

14. The method according to claim 2, wherein said RNase-containing buffer comprises RNase in TE buffer.

15. The method according to claim 2, further comprising incubating said EMCs on ice for 30- 60 minutes following electroporation.

16. The method according to claim 2, wherein said magnetic microbeads enable pelleting of said EMCs using a magnetic stand.

17. The method according to claim 3, wherein said freezing is performed at -20 degrees Celsius to -80 degrees Celsius for a period of at least 1 day.Applicant Ref.: 0224061695418. The method according to claim 3, wherein said extracellular vesicles with enhanced cargo purity are formed for therapeutic delivery to treat conditions comprising the following group: cancer, genetic disorders, inflammatory diseases and neurological disorders.