Photoenzymatic system for intermolecular c-h fluorination and fluorinated aromatic compounds produced therefrom

The photoenzymatic system addresses the challenge of intermolecular C-H fluorination by using biocatalysts and photosensitizers to efficiently fluorinate aromatic compounds, achieving high turnover and selectivity for pharmaceutical and agrochemical applications.

WO2026117470A1PCT designated stage Publication Date: 2026-06-04BOARD OF RGT THE UNIV OF TEXAS SYST

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BOARD OF RGT THE UNIV OF TEXAS SYST
Filing Date
2025-11-21
Publication Date
2026-06-04

Smart Images

  • Figure US2025056608_04062026_PF_FP_ABST
    Figure US2025056608_04062026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein is a method of intermolecular C-H fluorination of an aromatic compound (e.g., a compound including at least one aromatic moiety), the method including: a) contacting the aromatic compound with a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the aromatic compound to form a fluorinated aromatic compound (e.g., a fluorinated compound including at least one aromatic moiety). Also disclosed are fluorinated aromatic compounds and biocatalysts for intermolecular C-H fluorination.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. 10046-646W01PHOTOENZYMATIC SYSTEM FOR INTERMOLECULAR C-H FLUORINATION AND FLUORINATED AROMATIC COMPOUNDS PRODUCED THEREFROMCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U. S. Provisional Application No. 63 / 725,127, filed November 26, 2024, incorporated herein by reference in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The sequence listing submitted on November 21, 2025, as an. XML file entitled 10046-646W01_ST26.xml created on November 17, 2025 and having a file size of 53,416 bytes is hereby incorporated by reference pursuant to 37 C. F. R. § 1.52(e)(5).BACKGROUND

[0003] Carbon-fluorinc bonds arc found in over 20% of commercial pharmaceuticals, due to the unique features of fluorine that can affect key physical and chemical properties of molecules. Such high demand is driving the development of org anofluorine chemistry that allows for efficient C-H fluorination. Among reported methods, radical fluorination in aqueous solution via C-H functionalization represents one of the safest approaches to install fluorine atoms; however, it is much less explored compared to reactions in organic phases. Organofluorine compounds are vital in pharmaceuticals, and enzymes, nature's most efficient catalysts, offer tremendous potential for precise fluorination. However, no enzymatic strategies for intermolecular C-H fluorination have been realized. To address this issue, biocatalysts present an opportunity as they react under mild aqueous conditions in an efficient and sustainable manner.

[0004] There exists a need for improved biocatalysts and systems for C-H fluorination. These needs and others are at least partially satisfied by the present disclosure.SUMMARY

[0005] In accordance with the purposes of the disclosed compositions, devices, methods, and systems as embodied and broadly described herein, the disclosed subject matter relates to a photoenzymatic system for intermolecular C-H fluorination and fluorinated aromatic compounds produced therefrom.

[0006] In one aspect, provided is a method of intermolecular C-H fluorination of an aromatic compound (e.g., a compound comprising at least one aromatic moiety), the methodAttorney Docket No. 10046-646W01including: a) contacting the aromatic compound with a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture: b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the aromatic compound to form a fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety).

[0007] In another aspect, provided is a method of intermolecular C-H fluorination, the method including: a) contacting a compound of Formula I:R2Formula Iwith a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradialing the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transfomiation to thereby intermolecularly fluorinate the compound of Formula I to form a compound of Formula II:R2FFormula IIwherein: R1can be methyl, substituted or unsubstituted Ci-C.6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted Ci-C& carboxylic acid, substituted or unsubstituted C 1 -( > aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4, R5and R6can each independently be H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R or R5and Rc, together with the atoms to which they are attached, can form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.Attorney Docket No. 10046-646W01

[0008] In yet another aspect, provided is a fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety) produced by any of the disclosed methods.

[0009] In yet another aspect, provided is a biocatalyst including 80% similarity or more to any one of SEQ ID NOs: 1-4, and at least one photosensitizer. In an additional aspect, the biocatalyst includes mutations to remove oxidizable amino acids near an active site of the biocatalyst. In yet another aspect, the biocatalyst includes Y37F, Y121F, W244F, or and combination thereof relative to SEQ ID NO: 1.

[0010] In yet another aspect, provided is a photosensitizer including a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof. In a further aspect, the photoexcitable amino acid includes p-benzoyl-L-phenylalanine (pBPA). In another aspect, the photoexcitable amino acid includes at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.

[0011] In yet another aspect, provided is a biocatalyst with a total turn over of 100 or more.

[0012] In yet another aspect, the fluorine donor includes Selectfluor, Selectfluor II, N-fluorobenzenesulfonimide (NFSI), l-fluoro-2,4,6-trimethylpyridinium tetrafluoroborate (NFTPT), potassium fluoride, Togni’s reagent, Togni’s reagent II, or any combination thereof.

[0013] In yet another aspect, the mixture can include a pH from 4 to 10 and / or the mixture can include a temperature of from 4 °C to 90 °C, and / or the mixture can include from 0% to 50% acetonitrile (MeCN).

[0014] In yet another aspect, the electromagnetic radiation can include ultraviolet light. In a further aspect, the mixture can receive a total irradiation of from 10 mW / cm2to 500 mW / cm2.

[0015] In yet another aspect, the fluorinated aromatic compound is contacted with at least one additional enzyme, which generates one or more additional modifications. In a further aspect, the additional enzyme includes alcohol dehydrogenase (ADH), 4-coumaroyl-CoA ligase (4CL), 2-pyrone synthase (2PS), a ketoreductase, a transaminase, an esterase, an ene-reductase, an acylase, a metalloenzyme, or any combination thereof. In some aspects, the additional enzymes include SEQ ID NOs: 5-7.

[0016] In yet another aspect, the fluorinated aromatic compound includes (1-fluoroethyl)benzene, l-(4-(l-fluoroethyl)phenyl)ethan-l-one, 4-(l-fluoroethyl)phenyl acetate, 1 -chloro-4-( 1 -fluoroethyl)benzyne, 1 -bromo-4-(l -fluoroethyl)benzyne, 1 -iodo-4-(l -fluoroethyl)benzyne, 2-(l-fluoroethyl)naphthalene, 4-fluoro-4-phenylbutan-2-one, 3-fluoro-3-phenylpropanoic acid, 4-fluoro-4-phenylbutan-2-ol, 6-(2-fluoro-2-phenylethyl)-4-hydroxy-2H-pyran-2-one, or any derivatives or combinations thereof.Attorney Docket No. 10046-646W01

[0017] In yet another aspect, the fluorinated aromatic compound includes a pharmaceutical agent, therapeutic agent, or an agrochemical.

[0018] In yet another aspect, provided is a biocatalyst including 80% similarity or more to SEQ ID NO: 2 including 121F and 244F relative to SEQ ID NO: 2, and at least one photosensitizer.

[0019] Other systems, methods, features and / or advantages will be or may become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features and / or advantages be included within this description and be protected by the accompanying claims.BRIEF DESCRIPTION OF DRAWINGS

[0020] FIGURES 1A-1C depict Designing a photoenzymatic intermolecular C-H fluorination reaction. FIG. 1A shows the existing biocatalytic reactions for fluorinated products. The reaction catalyzed by natural fluorinase (PDB: 1RQP) is highlighted on the top right. The iron-enzyme catalyzed intramolecular fluorination (PDB: 4J1X) was highlighted on the bottom right. FIG. IB shows the cofactors from selected photoenzymatic systems for new-to-nature biocatalysis. FIG. 1C shows the proposed photoenzymatic intermolecular C-H fluorination reaction mechanism.

[0021] FIGURES 2A-2B depict protein purification of InterFase series. FIG. 2A shows SDS-page gel characterization of the purified InterFase protein. Color prestained protein ladder from New England Biolabs was used. FIG. 2B shows MALDI confirmation of the purified protein.

[0022] FIGURES 3A-3B depict fluorination reaction with different fluorination reagents.FIG. 3A shows different fluorination reagents and their performance. FIG. 3B shows intramolecular fluorine atom transfer reaction catalyzed by iron (II) or photocatalysts.

[0023] FIGURES 4A-4C depict a photoenzymatic fluorination mechanism study. FIG.4A shows a reaction with TEMPO as the radical trap. FIG.4B shows light on / off experiments. The temperature was measured at each timepoint. FIG. 4C shows quantum yield determination.

[0024] FIGURES 5A-5B depict enantioselectivity determination by chiral GC. FIG. 5A shows chiral GC analysis for the synthesized (l-fluoroethyl)benzene. FIG. 5B shows chiral GC analysis for the enzymatic fluorination reaction.

[0025] FIGURES 6A-6B depict protein engineering of InterFase. FIG. 6A shows alanine screening and rational mutagenesis of the InterFase (PDB: 7ZP6). FIG. 6B shows reaction analysis between Selectfluor and AAs and the design of InterFase2.Attorney Docket No. 10046-646W01

[0026] FIGURE 7 depicts a111-NMR spectrum for the reaction between Selectfluor and unreactive serine. The proton signals for Selectfluor, decomposed Selectfluor, internal standard and serine are highlighted. The ratio between the decomposed Selectfluor and internal standard are compared under different pH.

[0027] FIGURE 8A shows a111-NMR spectrum for the reaction between Selectfluor and cysteine. The proton signals for Selectfluor, decomposed Selectfluor, internal standard and cysteine are highlighted. FIGURE 8B shows a ’11-NMR spectrum for the reaction between Selectfluor and methionine. The proton signals for Selectfluor, decomposed Selectfluor, internal standard and methionine are highlighted. FIGURE 8C shows a111-NMR spectrum for the reaction between Selectfluor and tryptophan. The proton signals for Selectfluor, decomposed Selectfluor, internal standard and tryptophan are highlighted. FIGURE 8D shows a111-NMR spectrum for the reaction between Selectfluor and tyrosine. The proton signals for Selectfluor, decomposed Selectfluor, internal standard and tyrosine are highlighted.

[0028] FIGURES 9A-9B depict substrate scopes and one -pot enzymatic cascades for the fluorinated compound biosynthesis. FIG. 9A shows substrate scope by InterFase2 under standard reaction conditions. FIG. 9B shows cascade reactions for chiral fluorinated alcohol and fluorinated polyketide biosynthesis. ADH, alcohol dehydrogenase; 4CL, 4-coumaroyl-CoA ligase; 2PS, 2-pyrone synthase.

[0029] FIGURES 10A-10C depict one-pot biosynthesis of the fluorinated chiral alcohol.FIG. 10A shows asymmetric reduction of ketones by the reported W1 lOA-TeS ADH enzyme (7). FIG. 10B shows chiral GC analysis of the chemically synthesized standards. The hydroxyl group was acetylated for GC analysis. The ratio of two diastereomers were determined by 19F-NMR and reflected on GC analysis. FIG. 10C shows chiral GC analysis for the W110A-TeSADH catalyzed asymmetric reduction of the fluorinated products. The stereocenter of hydroxyl group was assigned based on the reported reactivities of ADH enzymes (6, 7). Enantioselectivity was calculated on the table.

[0030] FIGURES 11A-11B depict one-pot biosynthesis of fluorinated polyketides. FIG.11A shows LC / MS characterization of the fluorinated PKS product. FIG. 11B shows titer estimation by HPLC by comparing with the polyketide without the fluorine atom. Pdt: product HPLC integration area; IS: internal standard HPLC integration area.

[0031] FIGURES 12A-12C depict LED light and the reaction setup. FIG. 12A shows the emission spectrum of the 365 nm LED light used in this study. FIG. 12B shows the reaction setup of the photocatalytic reaction. FIG. 12C shows the reaction setup for screening of up to twelve reaction vials simultaneously.Attorney Docket No. 10046-646W01

[0032] FIGURE 13 depicts total turnover number comparison between InterFase2 and other small molecule catalysts.

[0033] FIGURES 14A-14B depict ethylbenzene fluorination reaction analysis. FIG. 14A shows the 'll-NMR spectrum for entry 9 in TABLE 2 (35% yield). About 58% ethylbenzene was left in the reaction, which led to 93% mass balance. FIG. 14B shows reported chemical shifts for potential side products. No obvious difluorination was observed by19F-NMR for entry 9 in TABLE 2.

[0034] FIGURES 15A-15B depict molecular dynamics simulation results. FIG. 15A shows the last frame of the simulation result. Both ethylbenzene and Selectfluor are shown in sphere. Water molecules are shown in red sphere. Sodium ion is shown in purple sphere and chloride ion is shown in green sphere. FIG. 15B shows the distance between the F atom of Selectflour and the C atom of the carbonyl group in PBA 173 side chain.

[0035] FIGURES 16A-16C depict rational design of InterFase2 for the biosynthesis of fluorinated compounds. FIG. 16A shows design of IntcrFasc2 guided by the reaction analysis between the Selectfluor and Aas. The protein structure (PDB: 7ZP6) was used. FIG.16B shows substrate scope by lnterFase2 under standard reaction conditions. FIG. 16C shows cascade reactions for chiral fluorinated alcohol and fluorinated polyketide biosynthesis. ADH, alcohol dehydrogenase; 4CL, 4-coumaroyl-CoA ligase; 2PS, 2-pyrone synthase.DETAILED DESCRIPTION

[0036] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate aspects, can also be provided in combination with a single aspect. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single aspect, can also be provided separately or in any suitable subcombination. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure.GENERAL DEFINITIONS

[0037] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:

[0038] As used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Moreover, each of the terms “by”, “comprising,” “comprises”, “comprised of,” “including,”Attorney Docket No. 10046-646W01“includes,” “included,” “involving,” “involves,” “involved,” and “such as” are used in their open, non-limiting sense and may be used interchangeably. Further, the term “comprising” is intended to include examples and aspects encompassed by the terms “consisting essentially of’ and “consisting of.” Similarly, the term “consisting essentially of’ is intended to include examples encompassed by the term “consisting of.

[0039] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound”, “a composition”, or “a cancer”, includes, but is not limited to, two or more such compounds, compositions, or cancers, and the like.

[0040] It should be noted that ratios, concentrations, amounts, and other numerical data can be expressed herein in a range format. It can be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it can be understood that the particular value forms a further aspect. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0041] When a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. For example, where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure, e.g. the phrase “x to y” includes the range from ‘x’ to ‘y’ as well as the range greater than ‘x’ and less than ‘y’. The range can also be expressed as an upper limit, e.g. ‘about x, y, z, or less’ and should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of Tess than x’, less than y’, and Tess than z’. Likewise, the phrase ‘about x, y, z, or greater’ should be interpreted to include the specific ranges of ‘about x’, ‘about y’, and ‘about z’ as well as the ranges of ‘greater than x’, greater than y’, and ‘greater than z’. In addition, the phrase “about ‘x’ to ‘y’”, where ‘x’ and ‘y’ are numerical values, includes “about ‘x’ to about ‘y’”.

[0042] It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-rangeAttorney Docket No. 10046-646W01is explicitly recited. To illustrate, a numerical range of “about 0.1% to 5%” should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also include individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and the subranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, and other possible sub-ranges) within the indicated range.

[0043] As used herein, the terms “about,'’ “approximate,” “at or about,” and “substantially” mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0044] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.CHEMICAL AND BIOLOGICAL DEFINITIONS

[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0046] The organic moieties mentioned when defining variable positions within the general formulae described herein (e.g., the term “halogen”) are collective terms for the individual substituents encompassed by the organic moiety. The prefix Cn-Cmpreceding a group or moiety indicates, in each case, the possible number of carbon atoms in the group or moiety that follows.

[0047] The term “ion,” as used herein, refers to any molecule, portion of a molecule, cluster of molecules, molecular complex, moiety, or atom that contains a charge (positive, negative, or both at the same time within one molecule, cluster of molecules, molecular complex, orAttorney Docket No. 10046-646W01moiety (e.g., zwitterions)) or that can be made to contain a charge. Methods for producing a charge in a molecule, portion of a molecule, cluster of molecules, molecular complex, moiety, or atom are disclosed herein and can be accomplished by methods known in the art, e.g., protonation, deprotonation, oxidation, reduction, alkylation, acetylation, esterification, deesterification, hydrolysis, etc.

[0048] The term “anion” is a type of ion and is included within the meaning of the term “ion.” An “anion” is any molecule, portion of a molecule (e.g., zwitterion), cluster of molecules, molecular complex, moiety, or atom that contains a net negative charge or that can be made to contain a net negative charge. The term “anion precursor” is used herein to specifically refer to a molecule that can be converted to an anion via a chemical reaction (e.g., deprotonation).

[0049] The term “cation” is a type of ion and is included within the meaning of the term “ion.” A “cation” is any molecule, portion of a molecule (e.g., zwitterion), cluster of molecules, molecular complex, moiety, or atom, that contains a net positive charge or that can be made to contain a net positive charge. The term “cation precursor” is used herein to specifically refer to a molecule that can be converted to a cation via a chemical reaction (e.g., protonation or alkylation).

[0050] As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms “substitution” or “substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0051] “Z1,” “z2,” “Z3,” and “Z4” are used herein as generic symbols to represent various specific substituents. These symbols can be any substituent, not limited to those disclosed herein, and when they are defined to be certain substituents in one instance, they can, in another instance, be defined as some other substituents.Attorney Docket No. 10046-646W01

[0052] The term “aliphatic” as used herein refers to a non-aromatic hydrocarbon group and includes branched and unbranched, alkyl, alkenyl, or alkynyl groups.

[0053] As used herein, the term “alkyl” refers to saturated, straight-chained or branched saturated hydrocarbon moieties. Unless otherwise specified, C1-C24 (e.g., C1-C22, C1-C20, C1-C18, C1-C16, C1-C14, C1-C12, C1-C10, C1-C8, C1-C6, or C1-C4) alkyl groups are intended. Examples of alkyl groups include methyl, ethyl, propyl, 1 -methyl-ethyl, butyl, 1 -methyl-propyl, 2-methyl-propyl, 1,1-dimethyl-ethyl, pentyl, 1-methyl-butyl, 2-methyl-butyl, 3-methyl-butyl, 2,2-dimethyl-propyl, 1 -ethyl-propyl, hexyl, 1,1-dimethyl-propyl, 1,2-dimethyl-propyl, 1-methyl-pentyl, 2-methyl-pentyl, 3-methyl -pentyl, 4-methyl-pentyl, 1,1-dimethyl-butyl, 1,2-dimethyl-butyl, 1,3-dimethyl-butyl, 2,2-dimethyl-butyl, 2,3-dimethyl-butyl, 3,3-dimethyl-butyl, 1 -ethyl-butyl, 2-ethyl -butyl, 1,1,2-trimethyl-propyl, 1,2,2-trimethyl-propyl, 1 -ethyl- 1-methyl-propyl, l-ethyl-2-methyl-propyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. Alkyl substituents may be unsubstituted or substituted with one or more chemical moieties. The alkyl group can be substituted with one or more groups including, but not limited to, hydroxyl, halogen, acyl, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below, provided that the substituents are sterically compatible and the rules of chemical bonding and strain energy are satisfied.

[0054] Throughout the specification “alkyl” is generally used to refer to both unsubstituted alkyl groups and substituted alkyl groups; however, substituted alkyl groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group. For example, the term “halogenated alkyl” or “haloalkyl” specifically refers to an alkyl group that is substituted with one or more halides (halogens; e.g., fluorine, chlorine, bromine, or iodine). The term “alkoxyalkyl” specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below. The term “alkylamino” specifically refers to an alkyl group that is substituted with one or more amino groups, as described below, and the like. When “alkyl” is used in one instance and a specific term such as “alkylalcohol” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “alkylalcohol” and the like.

[0055] This practice is also used for other groups described herein. That is, while a term such as “cycloalkyl” refers to both unsubstituted and substituted cycloalkyl moieties, the substituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyl can be referred to as, e.g., an “alkylcycloalkyl.” Similarly, a substitutedAttorney Docket No. 10046-646W01alkoxy can be specifically referred to as, e.g., a “halogenated alkoxy,” a particular substituted alkenyl can be, e.g., an “alkenylalcohol,” and the like. Again, the practice of using a general term, such as “cycloalkyl,” and a specific term, such as “alkylcycloalkyl,” is not meant to imply that the general term does not also include the specific term.

[0056] As used herein, the term “alkenyl” refers to unsaturated, straight-chained, or branched hydrocarbon moieties containing a double bond. Unless otherwise specified, C2-C24 (e.g., C2-C22, C2-C20, C2-C18, C2-C16, C2-C14, C2-C12, C2-C10. C2-C8, C2-C6, or C2-C4) alkenyl groups are intended. Alkenyl groups may contain more than one unsaturated bond. Examples include ethenyl, 1 -propenyl, 2-propenyl, 1 -methylethenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-methyl-1 -propenyl, 2-methyl- 1 -propenyl, l-methyl-2-propenyl, 2-methyl-2-propenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1 -methyl- 1-butenyl, 2-methyl-l-butenyl, 3-methyl- 1 -butenyl, 1 -methyl-2-butenyl, 2-methyl-2-butenyl, 3-methyl-2-butenyl, l-methyl-3-butenyl, 2-methyl-3-butenyl, 3-methyl-3-butenyl, l,l-dimethyl-2-propenyl, 1,2-dimethyl-l-propenyl, 1,2-dimethyl-2-propenyl, 1 -ethyl- 1 -propenyl, 1-ethyl-2-propenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, 5-hexenyl, 1 -methyl- 1 -pentenyl, 2-methyl- 1 -pentenyl, 3-methyl- 1 -pentenyl, 4-methyl- 1 -pentenyl, 1 -methyl-2-pentenyl, 2-methyl-2-pentenyl, 3-methyl- 2-pentenyl, 4-methyl-2-pentenyl, l-methyl-3-pentenyl, 2-methyl-3 -pentenyl, 3-methyl- 3 -pentenyl, 4-methyl-3-pentenyl, 1 -methyl-4-pentenyl, 2-methyl-4-pentenyl, 3-methyl-4-pentenyl, 4-methyl-4-pentenyl, l,l-dimethyl-2-butenyl, l,l-dimethyl-3-butenyl, 1,2-dimethyl- 1-butenyl, l,2-dimethyl-2-butenyl, 1,2-dimethy 1-3 -butenyl, 1,3-dimethyl- 1-butenyl, l,3-dimethyl-2-butenyl, l,3-dimethyl-3-butenyl, 2,2-dimethyl-3-butenyl, 2,3-dimethyl-l-butenyl, 2,3-dimethyl-2-butenyl, 2,3-dimethyl-3-butenyl, 3,3-dimethyl-l-butenyl, 3,3-dimethyl-2-butenyl, 1 -ethyl- 1-butenyl, l-ethyl-2-butenyl, l-ethyl-3-butenyl, 2-ethyl- 1-butenyl, 2-ethyl-2-butenyl, 2-ethyl-3-butenyl, l,l,2-trimethyl-2-propenyl, 1 -ethyl- 1 -methyl-2-propenyl, l-ethyl-2-methyl-l -propenyl, and l-ethyl-2-methyl-2-propenyl. The term “vinyl” refers to a group having the structure -CH=CH2; 1 -propenyl refers to a group with the structure -CH=CH-CH3; and 2-propenyl refers to a group with the structure -CH2-CH=CH2. Asymmetric structures such as (Z1Z2)C=C(Z3Z4) are intended to include both the E and Z isomers. This can be presumed in structural formulae herein wherein an asymmetric alkene is present, or it can be explicitly indicated by the bond symbol C=C. Alkenyl substituents may be unsubstituted or substituted with one or more chemical moieties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfoAttorney Docket No. 10046-646W01oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below, provided that the substituents are sterically compatible and the rules of chemical bonding and strain energy are satisfied.

[0057] As used herein, the term “alkynyl” represents straight-chained or branched hydrocarbon moieties containing a triple bond. Unless otherwise specified, C2-C24 (e.g., C2-C24, C2-C20, C2-C18, C2-C16, C2-C14, C2-C12, C2-C10, C2-C8, C2-C6, or C2-C4) alkynyl groups are intended. Alkynyl groups may contain more than one unsaturated bond. Examples include C2-Ce-alkynyl, such as ethynyl, 1-propynyl, 2-propynyl (or propargyl), 1-butynyl, 2-butynyl, 3-butynyl, l-methyl-2-propynyl, 1 -pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 3-methyl-l-butynyl, l-methyl-2-butynyl, l-methyl-3-butynyl, 2-methyl-3-butynyl, l,l-dimethyl-2-propynyl, l-ethyl-2-propynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, 5-hexynyl, 3-methyl-1 -pentynyl, 4- methyl- 1 -pentynyl, 1 -methyl- 2-pentynyl, 4-methyl-2-pentynyl, 1-methyl-3-pentynyl, 2-methyl-3-pentynyl, 1 -methyl-4-pentynyl, 2-methyl-4-pentynyl, 3-methyl-4-pentynyl, l,l-dimethyl-2-butynyl, l,l-dimethyl-3-butynyl, l,2-dimethyl-3-butynyl, 2,2-dimethyl-3-butynyl, 3, 3 -dimethyl- 1-butynyl, 1-ethyl-2-butynyl, 1-ethyl-3-butynyl, 2-ethyl-3-butynyl, and 1 -ethyl- l-methyl-2-propynyl. Alkynyl substituents may be unsubstituted or substituted with one or more chemical moieties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.

[0058] As used herein, the term “aryl,” as well as derivative terms such as aryloxy, refers to groups that include a monovalent aromatic carbocyclic group of from 3 to 50 carbon atoms. Aryl groups can include a single ring or multiple condensed rings. In some embodiments, aryl groups include Ce-Cio aryl groups. Examples of aryl groups include, but are not limited to, benzene, phenyl, biphenyl, naphthyl, tetrahydronaphthyl, phenylcyclopropyl, phenoxybenzene, and indanyl. The term “aryl” also includes “heteroaryl,” which is defined as a group that contains an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus. The term “non-heteroaryl,” which is also included in the term “aryl,” defines a group that contains an aromatic group that does not contain a heteroatom. The aryl substituents may be unsubstituted or substituted with one or more chemical moieties. Examples of suitable substituents include, for example, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein. The term “biaryl” is a specific type of aryl group and is included in the definition ofAttorney Docket No. 10046-646W01aryl. Biaryl refers to two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.

[0059] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term “heterocycloalkyl” is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. The cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.

[0060] The term “cycloalkenyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one double bound, i.e., C=C. Examples of cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, and the like. The term “heterocycloalkenyl” is a type of cycloalkenyl group as defined above and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted. The cycloalkenyl group and heterocycloalkenyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, acyl, aldehyde, amino, boronic acid, cyano, carboxylic acid, ester, ether, halide, hydroxyl, ketone, nitro, phosphonyl, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.

[0061] The term “cyclic group” is used herein to refer to either aryl groups, non-aryl groups (i.e., cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl groups), or both. Cyclic groups have one or more ring systems (e.g., monocyclic, bicyclic, tricyclic, polycyclic, etc.) that can be substituted or unsubstituted. A cyclic group can contain one or more aryl groups, one or more non-aryl groups, or one or more aryl groups and one or more non-aryl groups.

[0062] The term “acyl” as used herein is represented by the formula -C(O)Z1where Z1can be a hydrogen, hydroxyl, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above. As used herein,Attorney Docket No. 10046-646W01the term “acyl” can be used interchangeably with “carbonyl.” Throughout this specification “C(O)” or “CO” is a shorthand notation for C=O.

[0063] The term “acetal” as used herein is represented by the formula (Z1Z2)C(=OZ3)(=OZ4), where Z1, Z2, Z3, and Z4can be, independently, a hydrogen, halogen, hydroxyl, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or helerocycloalkenyl group described above.

[0064] The term “alkanol” as used herein is represented by the formula Z¹OH. where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0065] As used herein, the term “alkoxy” as used herein is an alkyl group bound through a single, terminal ether linkage; that is, an “alkoxy” group can be defined as to a group of the formula Z'-O-, where Z1is unsubstituted or substituted alkyl as defined above. Unless otherwise specified, alkoxy groups wherein Z1is a C1-C24 (e.g., C1-C22, C1-C20, C1-C18, C1-C16, C1-C14, C1-C12, C1-C10, C1-C8, C1-C6, or C1-C4) alkyl group are intended. Examples include methoxy, ethoxy, propoxy, 1 -methyl -ethoxy, butoxy, 1-methyl-propoxy, 2-methyl-propoxy, 1,1 -dimethyl-ethoxy, pentoxy, 1-methyl-butyloxy, 2-methyl-butoxy, 3-methyl-butoxy, 2,2-di-methyl-propoxy, 1 -ethyl-propoxy, hexoxy, 1, 1 -dimethyl-propoxy, 1,2-dimethyl-propoxy, 1-methyl-pentoxy, 2-methyl-pentoxy, 3-methyl -pentoxy, 4-methyl-penoxy, 1,1 -dimethylbutoxy, 1,2-dimethyl-butoxy, 1,3-dimethyl-butoxy, 2,2-dimethyl-butoxy, 2,3-dimethyl-butoxy, 3,3-dimethyl-butoxy, 1 -ethyl-butoxy, 2-ethylbutoxy, 1,1,2-trimethyl-propoxy, 1,2,2-trimethyl-propoxy, 1 -ethyl- 1-methyl-propoxy, and l-ethyl-2-methyl-propoxy.

[0066] The term “aldehyde” as used herein is represented by the formula — C(O)H. Throughout this specification “C(O)” is a shorthand notation for C=O.

[0067] The terms “amine” or “amino” as used herein are represented by the formula — NZ1Z2Z3. where Z1, Z2, and Z3can each be substitution group as described herein, such as hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0068] The terms “amide” or “amido” as used herein are represented by the formula — C(O)NZ1Z2, where Z1and Z2can each be substitution group as described herein, such as hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0069] The term “anhydride” as used herein is represented by the formula Z1C(O)OC(O)Z2where Z1and Z2, independently, can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.Attorney Docket No. 10046-646W01

[0070] The term “cyclic anhydride” as used herein is represented by the formula:where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0071] The term “azide” as used herein is represented by the formula -N=N=N.

[0072] The term “boronic acid” as used herein is represented by the formula — B(OH)2.

[0073] The term “carboxylic acid” as used herein is represented by the formula — C(O)OH.

[0074] “carboxylate” or “carboxyl” group as used herein is represented by the formula — C(O)O -

[0075] The term “cyano” as used herein is represented by the formula — CN.

[0076] The term “ester” as used herein is represented by the formula — OC(O)Z1or — C(O)OZ1, where Z1can be an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0077] The term “ether” as used herein is represented by the formula Z’OZ2. where Z1and Z2can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0078] The term “epoxy” or “epoxide” as used herein refers to a cyclic ether with a three atom ring and can represented by the formula:z1o z3z2^^z4where Z1, Z2, Z3, and Z4can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above

[0079] The term “ketone” as used herein is represented by the formula Z1C(O)Z2, where Z1and Z2can be, independently, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0080] The term “halide” or “halogen” or “halo” as used herein refers to fluorine, chlorine, bromine, and iodine.

[0081] The term “hydroxyl” as used herein is represented by the formula — OH.

[0082] The term “nitro” as used herein is represented by the formula — NO2.

[0083] The term “phosphonyl” is used herein to refer to the phospho-oxo group represented by the formula — P(O)(OZ1)2, where Z1can be hydrogen, an alkyl, alkenyl, alkynyl, aryl,Attorney Docket No. 10046-646W01heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0084] The term “silyl” as used herein is represented by the formula — SiZ'Z / Z’. where Z1, Z2, and Z3can be, independently, hydrogen, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0085] The term “sulfonyl” or “sulfone” is used herein to refer to the sulfo-oxo group represented by the formula — S(O)2Z1, where Z1can be hydrogen, an alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.

[0086] The term “sulfide” as used herein is comprises the formula — S —.

[0087] The term “thiol” as used herein is represented by the formula — SH.

[0088] “R1,” “R2,” “R3,” “Rn,” etc., where n is some integer, as used herein can, independently, possess one or more of the groups listed above. For example, if R1is a straight chain alkyl group, one of the hydrogen atoms of the alkyl group can optionally be substituted with a hydroxyl group, an alkoxy group, an amine group, an alkyl group, a halide, and the like. Depending upon the groups that are selected, a first group can be incorporated within second group or, alternatively, the first group can be pendant (i.e., attached) to the second group. For example, with the phrase “an alkyl group comprising an amino group,” the amino group can be incorporated within the backbone of the alkyl group. Alternatively, the amino group can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group.

[0089] Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible stereoisomer or mixture of stereoisomer (e.g., each enantiomer, each diastereomer, each meso compound, a racemic mixture, or scalemic mixture).

[0090] The terms “nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin (which may be single- stranded or double-stranded and may represent the sense or the antisense strand).

[0091] Reference also is made herein to peptides, polypeptides, proteins and compositions comprising peptides, polypeptides, and proteins. As used herein, a polypeptide and / or protein is defined as a polymer of amino acids, typically of length>100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically ofAttorney Docket No. 10046-646W01a length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).

[0092] A “functional fragment” as referred to herein comprises a portion of a polypeptide which retains its functional ability. In this case, the functional fragment would retain the ability to perform as a telomerase.

[0093] As disclosed herein, exemplary peptides, polypeptides, proteins may comprise, consist essentially of, or consist of any reference amino acid sequence disclosed herein, or variants of the peptides, polypeptides, and proteins may comprise, consist essentially of, or consist of an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any amino acid sequence disclosed herein. Variant peptides, polypeptides, and proteins may include peptides, polypeptides, and proteins having one or more amino acid substitutions, deletions, additions and / or amino acid insertions relative to a reference peptide, polypeptide, or protein. Also disclosed are nucleic acid molecules that encode the disclosed peptides, polypeptides, and proteins (e.g., polynucleotides that encode any of the peptides, polypeptides, and proteins disclosed herein and variants thereof).

[0094] The term “amino acid,” includes but is not limited to amino acids contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (He or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gin or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Vai or V), tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The term “amino acid residue” also may include amino acid residues contained in the group consisting of homocysteine, 2-Aminoadipic acid, N-Ethylasparagine, 3-Aminoadipic acid, Hydroxylysine, 0-alanine, P-Amino-propionic acid, allo-Hydroxylysine acid, 2-Aminobutyric acid, 3 -Hydroxyproline, 4- Aminobutyric acid, 4-Hydroxyproline, piperidinic acid, 6-Aminocaproic acid, Isodesmosine, 2-Aminoheptanoic acid, allo-Isoleucine, 2-Aminoisobutyric acid, N-Methylglycine, sarcosine, 3-Aminoisobutyric acid, N-Methylisoleucine, 2-Aminopimelic acid, 6-N-Methyllysine, 2,4-Diaminobutyric acid, N-Methylvaline, Desmosine, Norvaline, 2,2'-Diaminopimelic acid, Norleucine, 2,3-Diaminopropionic acid, Ornithine, and N-Ethylglycine. Typically, the amide linkages of the peptides are formed from an amino group of the backbone of one amino acid and a carboxyl group of the backbone of another amino acid.

[0095] The peptides, polypeptides, and proteins disclosed herein may be modified to include non-amino acid moieties. Modifications may include but are not limited toAttorney Docket No. 10046-646W01carboxylation (e.g., N-terminal carboxylation via addition of a di-carboxylic acid having 4-7 straight-chain or branched carbon atoms, such as glutaric acid, succinic acid, adipic acid, and 4,4-dimethylglutaric acid), amidation (e.g., C-terminal amidation via addition of an amide or substituted amide such as alkylamide or dialkylamide), PEGylation (e.g., N-terminal or C-terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N-terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranylgeraniol), amidation at C-terminus, glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). Distinct from glycation, which is regarded as a noncnzymatic attachment of sugars, polysialylation (e.g., the addition of polysialic acid), glypiation (e.g., glycosylphosphatidylinositol (GPI) anchor formation, hydroxylation, iodination (e.g., of thyroid hormones), and phosphorylation (e.g., the addition of a phosphate group, usually to serine, tyrosine, threonine or histidine).

[0096] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N-terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5 '-terminal or 3 '-terminal truncation or both of a reference polynucleotide).

[0097] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500Attorney Docket No. 10046-646W01contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C-terminal region of a polypeptide or the 5 '-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide or full length polypeptide.

[0098] Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides.

[0099] Fusion proteins and fusion polynucleotides also are contemplated herein. A “fusion protein” refers to a protein formed by the fusion of at least one peptide, polypeptide, protein or variant thereof as disclosed herein to at least one molecule of a heterologous peptide, polypeptide, protein or variant thereof. The heterologous protein(s) may be fused at the N-terminus, the C-terminus, or both termini. A fusion protein comprises at least a fragment or variant of the heterologous protein(s) that are fused with one another, preferably by genetic fusion (i.e., the fusion protein is generated by translation of a nucleic acid in which a polynucleotide encoding all or a portion of a first heterologous protein is joined in- frame with a polynucleotide encoding all or a portion of a second heterologous protein). The heterologous protein(s), once part of the fusion protein, may each be referred to herein as a “portion”, “region” or “moiety” of the fusion protein.

[0100] A fusion polynucleotide refers to the fusion of the nucleotide sequence of a first polynucleotide to the nucleotide sequence of a second heterologous polynucleotide (e.g., the 3' end of a first polynucleotide to a 5' end of the second polynucleotide). Where the first and second polynucleotides encode proteins, the fusion may be such that the encoded proteins are in-frame and results in a fusion protein. The first and second polynucleotide may be fused such that the first and second polynucleotide are operably linked (e.g., as a promoter and a gene expressed by the promoter as discussed below).

[0101] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.Attorney Docket No. 10046-646W01

[0102] A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250). In some embodiments a variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide.

[0103] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences due to the degeneracy of the genetic code. It is understood that changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.

[0104] “Operably linked” refers to the situation in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be in close proximity or contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0105] A “recombinant nucleic acid” is a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two or more otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1 3, Cold Spring Harbor Press, Plainview N. Y. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid. Frequently, a recombinant nucleic acid may include a nucleic acid sequence operably linked to a promoter sequence. Such a recombinant nucleic acid may be part of a vector that is used, for example, to transform a cell.

[0106] “Transformation” describes a process by which exogenous DNA is introduced into a recipient cell. Transformation may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method forAttorney Docket No. 10046-646W01transformation is selected based on the type of host cell being transformed and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, and particle bombardment. The term “transformed cells” includes stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the inserted DNA or RNA for limited periods of time.

[0107] “Substantially isolated or purified” nucleic acid or amino acid sequences are contemplated herein. The term “substantially isolated or purified” refers to nucleic acid or amino acid sequences that are removed from their natural environment, and are at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which they are naturally associated.BIOCATALYSTS

[0108] Organofluorine compounds are in high demand as pharmaceuticals, but natural and engineered enzymes capable of fluorination, especially of intermolecular C-H fluorination, are limited. To overcome the limitation, disclosed herein is a radical photoenzymatic system for the intermolecular C-H fluorination using, in some aspects, a photoreactive unnatural amino acid within a robust protein scaffold. The system can achieve a total turnover number of 270 for benzylic monofluorination of ethylbenzene with Selectfluor. Mechanistic studies supported the hydrogen atom transfer initiated by the photoexcited amino acid and disfavored a radical chain mechanism. The Selectfluor's biocompatibility led to a 20% turnover improvement via protein engineering. This system can successfully fluorinate various aromatic compounds and facilitated biosynthesis of fluorinated polyketides and chiral fluorinated alcohols. These results highlight the potential of radical photoenzymatic systems for expanding the toolkit of biocatalytic fluorination.

[0109] In an aspect, provided is a biocatalyst including 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 2. In some aspects, the biocatalyst can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 2. In someAttorney Docket No. 10046-646W01aspects, the biocatalyst can include SEQ ID NO: 2. In some aspects, the biocatalysts can consist of SEQ ID NO: 2. In some aspects, the biocatalyst can include 121F and 244F relative to SEQ ID NO: 2 and at least one photosensitizer.

[0110] As used herein, the term “photosensitizer” refers to a compound which can transfer energy from electromagnetic radiation to a chosen reagent. This energy transfer can, in some examples, generate a reactive species. For example, certain photosensitizers can induce, either directly or indirectly, energy or electron transfer to a photoinitiator (i.e., a compound that generates free radicals). In some aspects, the at least one photosensitizer can include a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof. In some specific aspects, the at least one photosensitizer can include 5 aminolevulinic acid (5 ALA), mitotropic porphyrins, phthalocyanines, aluminium phthalocyanines, be sulphonated aluminium phthalocyanines (e.g., AlPcS), di-sulphonated aluminium phthalocyanines (e.g., A1PCS2, AlPcS2a, or AlPcS4), sulphonated tetraphenylporphyrins (e.g. TPPS2a, TPPS4, TPPSi and TPPS20), chlorins such as tetra(m-hydroxyphenyl)chlorins (m-THPC) (e.g., temoporfin), chlorin derivatives including bacteriochlorins and ketochlorins, mono-L-aspartyl chlorin e6 (NPe6) or chlorin e6, natural and synthetic porphyrins (e.g., hematoporphyrin and benzoporphyrins), anthraquinones, or any derivatives or combinations thereof. Additionally or alternatively, in other aspects, the at least one photosensitizer can include quantum dots and / or nanorods.

[0111] As used herein, the term “photoexcitable amino acid” or “photoactivatable amino acid” refers to an amino acid which itself can act (either directly or indirectly) as a photosensitizer, or which has been modified with a moiety which can act (either directly or indirectly) as a photosensitizer. In some aspects, the photoexcitable amino acid can be p-benzoyl-L-phenylalanine (pBPA), diazirine-modified leucine, diazirine-modified methionine, or any combination thereof. Additionally or alternatively, in other aspects, the photoexcitable amino acid can include at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.METHODS

[0112] In an aspect, provided is a method of intermolecular C-H fluorination of an aromatic compound (e.g., a compound comprising at least one aromatic moiety), the method including: a) contacting the aromatic compound with a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the aromatic compound to form a fluorinated aromatic compound (e.g., a fluorinated compound comprising at least oneAttorney Docket No. 10046-646W01aromatic moiety). In some aspects, the aromatic compound can include a compound of Formula I:R1Formula Iand the fluorinated aromatic compound can include a compound of Formula 11:R1Formula IIwherein: R1can be substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4, R5and R6can each independently be H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R\ or R5and R6, together with the atoms to which they are attached, can form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0113] In another aspect, provided is a method of intermolecular C-H fluorination, the method including: a) contacting a compound of Formula I:Formula Iwith a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradiating the mixture with electromagnetic radiation, therebyAttorney Docket No. 10046-646W01photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the compound of Formula I to form a compound of Formula II:R2FFormula IIwherein: R1can be substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4, R\ and R6can each independently be H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R\ or R5and R6, together with the atoms to which they are attached, can form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0114] In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R1can be methyl.

[0115] In some aspects, R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester.

[0116] In some aspects, R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety.

[0117] In some aspects, R2, R5, and R6can each be hydrogen.

[0118] In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R3and R4. together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylicAttorney Docket No. 10046-646W01acid; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0119] In some aspects, R1can be methyl; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester. In some aspects, R1can be methyl; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be methyl; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be methyl; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be methyl; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R3, and R6can each be hydrogen.

[0120] In some aspects, R1can be substituted or unsubstituted C3 acyl; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester. In some aspects, R1can be substituted or unsubstituted C3 acyl; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C3 acyl; and R2, R\ and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C3 acyl; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C3 acyl; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0121] In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R2, R3, and R6can each be hydrogen. In some aspects,Attorney Docket No. 10046-646W01R1can be substituted or unsubstituted C2 carboxylic acid; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0122] In some aspects, R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen.

[0123] In some aspects, R4can be hydrogen; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be hydrogen; and R1can be methyl. In some aspects, R4can be hydrogen; and R2,and R6can each be hydrogen. In some aspects, R4can be hydrogen; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted Ci-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be hydrogen; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0124] In some aspects, R4can be halogen; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be halogen; and R1can be methyl. In some aspects, R4can be halogen; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be halogen; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be halogen; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0125] In some aspects, R4can be C2 acyl; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be C2 acyl; and R1can be methyl. In some aspects, R4can be C2 acyl; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 acyl; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R\ and R6can each be hydrogen. In some aspects, R4can be C2 acyl; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0126] In some aspects, R4can be C2 ester; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be C2 ester; and R1can be methyl. In some aspects,Attorney Docket No. 10046-646W01R4can be C2 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 ester; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 ester; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0127] In some aspects, R3and R4. together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R3, and R6can each be hydrogen.

[0128] In some aspects, the biocatalyst can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 1. In some aspects, the biocatalyst can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 1. In some aspects, the biocatalyst can include SEQ ID NO: 1. In some aspects, the biocatalysts can consist of SEQ ID NO: 1.

[0129] In some aspects, the biocatalyst can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 2. In some aspects, the biocatalyst can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 2. In some aspects, the biocatalyst can include SEQ ID NO: 2. In some aspects, the biocatalysts can consist of SEQ ID NO: 2.

[0130] In some aspects, the biocatalyst can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more,Attorney Docket No. 10046-646W0185% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 3. In some aspects, the biocatalyst can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 3. In some aspects, the biocatalyst can include SEQ ID NO: 3. In some aspects, the biocatalysts can consist of SEQ ID NO: 3.

[0131] In some aspects, the biocatalyst can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 4. In some aspects, the biocatalyst can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 4. In some aspects, the biocatalyst can include SEQ ID NO: 4. In some aspects, the biocatalysts can consist of SEQ ID NO: 4.

[0132] In some aspects, the biocatalyst can include one or more mutations to remove oxidizable amino acids (e.g., cysteine, cystine, histidine, methionine, tryptophan, and / or tyrosine) near an active site of the biocatalyst. In some aspects, the biocatalyst can include Y37F, Y121F, W244F, or any combination thereof relative to SEQ ID NO: 1.

[0133] In some aspects, the at least one photosensitizer can include a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof. In some specific aspects, the at least one photosensitizer can include 5 aminolevulinic acid (5 ALA), mitotropic porphyrins, phthalocyanines, aluminium phthalocyanines, be sulphonated aluminium phthalocyanines (e.g., AlPcS), di-sulphonated aluminium phthalocyanines (e.g., A1PCS2, AlPcS2a, or AlPcS4), sulphonated tetraphenylporphyrins (e.g. TPPS2a, TPPS4, TPPSi and TPPS20), chlorins such as tetra(m-hydroxyphenyl)chlorins (m-THPC) (e.g., temoporfin), chlorin derivatives includingAttorney Docket No. 10046-646W01bacteriochlorins and ketochlorins, mono-L-aspartyl chlorin e6 (NPe6) or chlorin e6, natural and synthetic porphyrins (e.g., hematoporphyrin and benzoporphyrins), anthraquinones, or any derivatives or combinations thereof. Additionally or alternatively, in other aspects, the at least one photosensitizer can include quantum dots and / or nanorods. In some aspects, the biocatalyst can include the photosensitizer.

[0134] In some aspects, the photoexcitable amino acid can be p-benzoyl-L-phenylalanine (pBPA), diazirine-modified leucine, diazirine-modified methionine, or any combination thereof. Additionally or alternatively, in other aspects, the photoexcitable amino acid can include at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.

[0135] In some aspects, the biocatalyst can have a total turnover number of 100 or more (e.g., 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, 210 or more, 220 or more, 230 or more, 240 or more, 250 or more, 260 or more, 270 or more, 280 or more, 290 or more, 300 or more, 310 or more, 320 or more, 330 or more, 340 or more, 350 or more, 360 or more, 370 or more, 380 or more, 390 or more, 400 or more, 410 or more, 420 or more, 430 or more, 440 or more, 450 or more, 460 or more, 470 or more, 480 or more, 490 or more, 500 or more, 525 or more, 550 or more, 575 or more, 600 or more, 625 or more, 650 or more, 675 or more, 700 or more, 725 or more, 750 or more, 775 or more, 800 or more, 825 or more, 850 or more, 875 or more, 900 or more, 925 or more, 950 or more, 975 or more, 1000 or more).

[0136] In some aspects, upon irradiation, the at least one photosensitizer can initiate radical transformation via hydrogen atom transfer.

[0137] In some aspects, the aromatic compound can include an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

[0138] In some aspects, the aromatic compound can be ethylbenzene, 4-ethylphenyl acetate, l-(4-ethylphenyl)ethan-l-one, 1 -chloro-4-ethylbenzene, l-bromo-4-ethylbenzene, 1-iodo-4-ethylbenzene, 2-ethylnaphthalene, 4-phenylbutan-2-one, 3 -phenylpropanoic acid, or any derivatives or combinations thereof.

[0139] In some aspects, the aromatic compound can beAttorney Docket No. 10046-646W01or any derivatives or combinations thereof.

[0140] In some aspects, the fluorine donor can include Selectfluor, Selectfluor II, N-fluorobenzenesulfonimide (NFSI), l-fhioro-2,4,6-trimethylpyridinium tetrafluoroborate (NFTPT), potassium fluoride, Togni’s reagent, Togni’s reagent II, or any combination thereof.

[0141] In some aspects, the mixture can have a pH of 4 or more (e.g., 4.2 or more, 4.4 or more, 4.6 or more, 4.8 or more, 5 or more, 5.2 or more, 5.4 or more, 5.6 or more, 5.8 or more, 6 or more, 6.2 or more, 6.4 or more, 6.6 or more, 6.8 or more, 7 or more, 7.2 or more, 7.4 or more, 7.6 or more, 7.8 or more, 8 or more, 8.2 or more, 8.4 or more, 8.6 or more, 8.8 or more, 9 or more, 9.2 or more, 9.4 or more, 9.6 or more, 9.8 or more, 10 or more). In some aspects, the mixture can have a pH of 10 or less (e.g., 9.8 or less, 9.6 or less, 9.4 or less, 9.2 or less, 9 or less, 8.8 or less, 8.6 or less, 8.4 or less, 8.2 or less, 8 or less, 7.8 or less, 7.6 or less, 7.4 or less, 7.2 or less, 7 or less, 6.8 or less, 6.6 or less, 6.4 or less, 6.2 or less, 6 or less, 5.8 or less, 5.6 or less, 5.4 or less, 5.2 or less, 5 or less, 4.8 or less, 4.6 or less, 4.4 or less, 4.2 or less, 4 or less).

[0142] It is considered that the mixture can have a pH ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the mixture can have a pH of from 4 to 10 (e.g., from 4.2 to 9.8, from 4.4 to 9.6, from 4.6 to 9.4, from 4.8 to 9.2, from 5 to 9, from 5.2 to 8.8, from 5.4 to 8.6, from 5.6 to 8.4, from 5.8 to 8.2, from 6 to 8, from 6.2 to 7.8, from 6.4 to 7.6, from 6.6 to 7.4, from 6.8 to 7.2, from 4 to 7, from 4.2 to 6.8, from 4.4 to 6.6, from 4.6 to 6.4, from 4.8 to 6.2, from 5 to 6, from 5.2 to 5.8, from 5.4 to 5.6, from 7 to 10, from 7.2 to 9.8, from 7.4 to 9.6, from 7.6 to 9.4, from 7.8 to 9.2, from 8 to 9, from 8.2 to 8.8, from 8.4 to 8.6).Attorney Docket No. 10046-646W01

[0143] In some aspects, the mixture can further include a solvent. In some aspects, the solvent can include an organic solvent, for example, acetonitrile (MeCN), acetone, dimethyl formamide, dimethyl propylene urea, dimethyl sulfoxide, hexamethyl phosphoramide, pyridine, sulfolane, tetrahydrofuran, or any combination thereof.

[0144] In some aspects, the mixture can include more than 0% solvent (e.g., 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more). In some aspects, the mixture can include 80% solvent or less (e.g., 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less. 5% or less).

[0145] It is considered that the mixture can include an amount of solvent ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the mixture can include from 0% to 80% solvent (e.g., from 5% to 75%, from 10% to 70%, from 15% to 65%, from 20% to 60%, from 25% to 55%, from 30% to 50%, from 35% to 45%, from 0% to 40%, from 5% to 35%, from 10% to 30%, from 15% to 25%, from 40% to 80%, from 45% to 75%, from 50% to 70%, from 55% to 65%).

[0146] In some aspects, the mixture can include more than 0% MeCN (e.g., 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more). In some aspects, the mixture can include 80% or less MeCN (e.g., 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less).

[0147] It is considered that the mixture can include an amount of MeCN ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the mixture can include from 0% to 80% MeCN (e.g., from 5% to 75%, from 10% to 70%, from 15% to 65%, from 20% to 60%, from 25% to 55%, from 30% to 50%, from 35% to 45%, from 0% to 40%, from 5% to 35%, from 10% to 30%, from 15% to 25%, from 40% to 80%, from 45% to 75%, from 50% to 70%, from 55% to 65%).

[0148] In some aspects, the mixture can have a temperature of 4°C or more (e.g., 5°C or more, 6°C or more, 7°C or more, 8°C or more, 9°C or more, 10°C or more, 15°C or more, 20°C or more, 25°C or more, 30°C or more, 35°C or more, 40°C or more, 45°C or more, 50°C orAttorney Docket No. 10046-646W01more, 55°C or more, 60°C or more, 65°C or more, 70°C or more, 75°C or more, 80°C or more, 85°C or more, 90°C or more). In some aspects, the mixture can have a temperature of 90°C or less (e.g., 85°C or less, 80°C or less, 75°C or less, 70°C or less, 65°C or less, 60°C or less, 55°C or less, 50°C or less, 45°C or less, 40°C or less, 35°C or less, 30°C or less, 25°C or less, 20°C or less, 15°C or less, 10°C or less, 9°C or less, 8°C or less, 7°C or less, 6°C or less, 5°C or less, 4°C or less).

[0149] It is considered that the mixture can have a temperature ranging from any of the minimum values described above to any of the maximum values described above. For example, in some aspects, the mixture can have a temperature of from 4°C to 90°C (e.g., from 5°C to 85°C, from 6°C to 80°C, from 7°C to 75°C, from 8°C to 70°C, from 9°C to 65°C, from 10°C to 60°C, from 15°C to 55°C, from 20°C to 50°C, from 25°C to 45°C, from 30°C to 40°C, from 4°C to 35°C, from 5°C to 30°C, from 6°C to 25°C, from 7°C to 20°C, from 8°C to 15°C, from 9°C to 10°C, from 35°C to 90°C, from 40°C to 85°C, from 45°C to 80°C, from 50°C to 75°C, from 55°C to 70°C, from 60°C to 65°C).

[0150] In some aspects, the electromagnetic radiation can include ultraviolet light and / or visible light. In some aspects, the mixture can receive a total irradiation of 10 mW / cm2or more (e.g., 15 mW / cm2or more, 20 mW / cm2or more, 25 mW / cm2or more, 30 mW / cm2or more, 35 mW / cm2or more, 40 mW / cm2or more, 45 mW / cm2or more, 50 mW / cm2or more, 60 mW / cm2or more, 70 mW / cm2or more, 80 mW / cm2or more, 90 mW / cm2or more, 100 mW / cm2or more, 125 mW / cm2or more, 150 mW / cm2or more, 175 mW / cm2or more, 200 mW / cm2or more, 225 mW / cm2or more, 250 mW / cm2or more, 275 mW / cm2or more, 300 mW / cm2or more, 325 mW / cm2or more, 350 mW / cm2or more, 375 mW / cm2or more, 400 mW / cm2or more, 425 mW / cm2or more, 450 mW / cm2or more, 475 mW / cm2or more, 500 mW / cm2or more). In some aspects, the mixture can receive a total irradiation of 500 mW / cm2or less (e.g., 475 mW / cm2or less, 450 mW / cm2or less, 425 mW / cm2or less, 400 mW / cm2or less, 375 mW / cm2or less, 350 mW / cm2or less, 325 mW / cm2or less, 300 mW / cm2or less, 275 mW / cm2or less, 250 mW / cm2or less, 225 mW / cm2or less, 200 mW / cm2or less, 175 mW / cm2or less, 150 mW / cm2or less, 125 mW / cm2or less, 100 mW / cm2or less, 90 mW / cm2or less, 80 mW / cm2or less, 70 mW / cm2or less, 60 mW / cm2or less, 50 mW / cm2or less, 45 mW / cm2or less, 40 mW / cm2or less, 35 mW / cm2or less, 30 mW / cm2or less, 25 mW / cm2or less, 20 mW / cm2or less, 15 mW / cm2or less, 10 mW / cm2or less).

[0151] It is considered that the mixture can receive a total irradiation ranging from any of the minimum values described above to any of the maximum values described above. ForAttorney Docket No. 10046-646W01example, in some aspects, the mixture can receive a total irradiation of from 10 mW / cm2to 500 mW / cm2(e.g., from 15 mW / cm2to 475 mW / cm2, from 20 mW / cm2to 450 mW / cm2, from 25 mW / cm2to 425 mW / cm2, from 30 mW / cm2to 400 mW / cm2, from 35 mW / cm2to 375 mW / cm2, from 40 mW / cm2to 350 mW / cm2, from 45 mW / cm2to 325 mW / cm2, from 50 mW / cm2to 300 mW / cm2, from 60 mW / cm2to 275 mW / cm2, from 70 mW / cm2to 250 mW / cm2, from 80 mW / cm2to 225 mW / cm2, from 90 mW / cm2to 200 mW / cm2, from 100 mW / cm2to 175 mW / cm2, from 125 mW / cm2to 150 mW / cm2, from 10 mW / cm2to 150 mW / cm2, from 15 mW / cm2to 125 mW / cm2, from 20 mW / cm2to 100 mW / cm2, from 25 mW / cm2to 90 mW / cm2, from 30 mW / cm2to 80 mW / cm2, from 35 mW / cm2to 70 mW / cm2, from 40 mW / cm2to 60 mW / cm2, from 45 mW / cm2to 50 mW / cm2, from 100 mW / cm2to 500 mW / cm2, from 125 mW / cm2to 475 mW / cm2, from 150 mW / cm2to 450 mW / cm2, from 175 mW / cm2to 425 mW / cm2, from 200 mW / cm2to 400 mW / cm2, from 225 mW / cm2to 375 mW / cm2, from 250 mW / cm2to 350 mW / cm2, from 275 mW / cm2to 325 mW / cm2).

[0152] In some aspects, the fluorinated aromatic compound can be monofluorinated. In other aspects, the fluorinated aromatic compound can be trifluoromethylated. In yet other aspects, the fluorinated aromatic compound can be perfluorinated.

[0153] In some aspects, the method can further include: c) contacting the fluorinated aromatic compound with at least one additional enzyme, thereby generating one or more additional modifications.

[0154] In some aspects, the at least one additional enzyme can be alcohol dehydrogenase (ADH), 4-coumaroyl-CoA ligase (4CL), 2-pyrone synthase (2PS), a ketoreductase, a transaminase, an esterase, an ene-reductase, an acylase, a metalloenzyme, or any combination thereof.

[0155] In some aspects, the at least one additional enzyme can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 5. In some aspects, the at least one additional enzyme can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 5. In some aspects, the at least one additional enzymeAttorney Docket No. 10046-646W01can include SEQ ID NO: 5. In some aspects, the at least one additional enzyme can consist of SEQ ID NO: 5.

[0156] In some aspects, the at least one additional enzyme can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 6. In some aspects, the at least one additional enzyme can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 6. In some aspects, the at least one additional enzyme can include SEQ ID NO: 6. In some aspects, the at least one additional enzyme can consist of SEQ ID NO: 6.

[0157] In some aspects, the at least one additional enzyme can include 80% similarity or more (e.g., 81% similarity or more, 82% similarity or more, 83% similarity or more, 84% similarity or more, 85% similarity or more, 86% similarity or more, 87% similarity or more, 88% similarity or more, 89% similarity or more, 90% similarity or more, 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 7. In some aspects, the at least one additional enzyme can include 90% similarity or more (e.g., 91% similarity or more, 92% similarity or more, 93% similarity or more, 94% similarity or more, 95% similarity or more, 96% similarity or more, 97% similarity or more, 98% similarity or more, 99% similarity or more, 100% similarity) to SEQ ID NO: 7. In some aspects, the at least one additional enzyme can include SEQ ID NO: 7. In some aspects, the at least one additional enzyme can consist of SEQ ID NO: 7.FLUORINATED AROMATIC COMPOUNDS

[0158] In an aspect, provided is a fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety) produced by any of the disclosed methods.

[0159] In some aspects, the fluorinated aromatic compound can include a compound of Formula II:Attorney Docket No. 10046-646W01R2FFormula IIwherein: R1can be substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted Ci-O, carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4, R\ and R6can each independently be H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R5, or R5and R6, together with the atoms to which they are attached, can form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0160] In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R1can be methyl.

[0161] In some aspects, R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester.

[0162] In some aspects, R3and R4. together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety.

[0163] In some aspects, R2, R5, and R6can each be hydrogen.

[0164] In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted orAttorney Docket No. 10046-646W01unsubstituted C1-C3 carboxylic acid; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0165] In some aspects, R1can be methyl; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester. In some aspects, R1can be methyl; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be methyl; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be methyl; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester; and R2, R3, and R6can each be hydrogen. In some aspects, R1can be methyl; R3and R4together with the atoms to which they arc attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R3, and R6can each be hydrogen.

[0166] In some aspects, R1can be substituted or unsubstituted C3 acyl; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted Ci-C3 ester. In some aspects, R1can be substituted or unsubstituted C3 acyl; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C3 acyl; and R2, R3, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C3 acyl; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C acyl; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0167] In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5,Attorney Docket No. 10046-646W01and R6can each be hydrogen. In some aspects, R1can be substituted or unsubstituted C2 carboxylic acid; R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0168] In some aspects, R4can be hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester; and R2, R5, and R6can each be hydrogen.

[0169] In some aspects, R4can be hydrogen; and R1can be substituted or unsubstituted Ci-C alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be hydrogen; and R1can be methyl. In some aspects, R4can be hydrogen; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be hydrogen; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted Ci-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R3, and R6can each be hydrogen. In some aspects, R4can be hydrogen; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0170] In some aspects, R4can be halogen; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be halogen; and R1can be methyl. In some aspects, R4can be halogen; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be halogen; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be halogen; R1can be methyl; and R2, R\ and R6can each be hydrogen.

[0171] In some aspects, R4can be C2 acyl; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be C2 acyl; and R1can be methyl. In some aspects, R4can be C2 acyl; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 acyl; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 acyl; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0172] In some aspects, R4can be C2 ester; and R1can be substituted or unsubstituted Ci-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid. In some aspects, R4can be C2 ester; and R1can be methyl. In some aspects, R4can be C2 ester; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 ester; R1can be substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3Attorney Docket No. 10046-646W01acyl, or substituted or unsubstituted C1-C3 carboxylic acid; and R2, R5, and R6can each be hydrogen. In some aspects, R4can be C2 ester; R1can be methyl; and R2, R5, and R6can each be hydrogen.

[0173] In some aspects, R3and R4together with the atoms to which they are attached, can form a 6-12 membered substituted or unsubstituted aromatic moiety; and R2, R5, and R6can each be hydrogen.

[0174] In some aspects, the fluorinated aromatic compound can include an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

[0175] In some aspects, the fluorinated aromatic compound can be monofluorinated. In other aspects, the fluorinated aromatic compound can be trifluoromethylated. In yet other aspects, the fluorinated aromatic compound can be perfluorinated.

[0176] In some aspects, the fluorinated aromatic compound can be (l-fluoroethyl)benzene, l-(4-(l-fluorocthyl)phcnyl)cthan-l-onc, 4-(l-fhrorocthyl)phcnyl acetate, l-chloro-4-(l-fluoroethyl)benzyne, l-bromo-4-(l-fluoroethyl)benzyne, l-iodo-4-(l-fluoroethyl)benzyne, 2-(l-fhioroethyl)naphthalene, 4-fluoro-4-phenylbutan-2-one, 3 -fluoro-3 -phenylpropanoic acid, 4-fluoro-4-phenylbutan-2-ol, 6-(2-fluoro-2-phenylethyl)-4-hydroxy-2H-pyran-2-one, or any derivatives or combinations thereof.

[0177] In some aspects, the fluorinated aromatic compound can be:Attorney Docket No. 10046-646W01

[0178] In some aspects, the fluorinated aromatic compound can be a pharmaceutical or therapeutic agent. In some aspects, the fluorinated aromatic compound can be an agrochemical.EXAMPLESExample 1: Creating a Photoenzymatic System for Intermolecular C-H Fluorination

[0179] Disclosed herein is a radical photoenzymatic system for the intermolecular C-H fluorination of organic compounds. Organofluorine compounds are prevalent in bioactive molecules and are crucial in pharmaceutical development due to their unique properties. However, natural enzymatic systems for fluorination are limited, which restricts the advancement of biocatalytic fluorination. This photoenzymatic system enables efficient and selective C-H fluorination in aqueous conditions.

[0180] A robust protein scaffold was designed and engineered to incorporate a photoreactive unnatural amino acid. This scaffold forms the basis of the photoenzymatic system. The photoreactive amino acid is responsible for initiating radical transformations through hydrogen atom transfer (HAT) mechanisms upon photoexcitation. The fluorination reactions were conducted in aqueous potassium phosphate buffer (100 mM, pH 6) using Selectfluor as the fluorine donor. Reaction conditions were optimized to achieve a total turnover number (TTN) of over 270 for the monofluorination at the benzylic position of ethylbenzene. The mechanism involves the photoexcitation of the unnatural amino acid, leading to the generation of radicals that facilitate the fluorination process. Unlike traditional radical chain mechanisms, this system operates without a radical chain mechanism, ensuring greater control and selectivity.

[0181] The biocompatibility of Selectfluor with proteins was investigated, and through protein engineering, a mutant enzyme with a 20% improvement in TTN was developed. This demonstrates the system's potential for further enhancements through directed evolution and protein engineering techniques. The photoenzymatic system was also tested on various aromatic compounds, achieving monofluorination at the benzylic positions with yields up to 44%. Additionally, the system was used to synthesize fluorinated polyketides and chiral fl-fluorinated alcohols through one-pot cascade reactions, showcasing its versatility in complex organic synthesis.

[0182] This radical photoenzymatic system is capable of efficient and selective intermolecular C-H fluorination of organic compounds, offering significant advancements in pharmaceutical development, organic synthesis, and biotechnological applications. The system provides a method for synthesizing organofluorine compounds, which are essential in the development of pharmaceuticals with enhanced stability, bioavailability, and metabolicAttorney Docket No. 10046-646W01properties. The system can also be utilized in the synthesis of various fluorinated organic compounds, offering a biocatalytic alternative to traditional chemical methods that often require harsh conditions and hazardous reagents. Finally, the engineered enzymes and photoenzymatic system can be employed in biotechnological processes for the production of fine chemicals, agrochemicals, and other fluorinated products.

[0183] This radical photoenzymatic system integrates photoreactive unnatural amino acids within a protein scaffold to drive radical-mediated transformations. This amino acid initiates radical transformations via hydrogen atom transfer (HAT) upon light activation, which is not common in traditional enzymatic systems. Through protein engineering, a mutant enzyme with a 20% improvement in total turnover number (TTN) was developed, showcasing the system's potential for optimization and enhancement via directed evolution.

[0184] The system effectively transforms a variety of aromatic substrates, including ethylbenzene derivatives and naphthalene, into fluorinated products. This versatility highlights its broad applicability in organic synthesis. Conventional fluorination techniques often require harsh conditions, such as high temperatures, strong acids or bases, and toxic reagents, which limit their use in biocatalysis and aqueous environments. In contrast, this photoenzymatic system operates under mild, aqueous conditions, making it more environmentally friendly and compatible with biological systems.

[0185] Natural enzymatic systems for fluorination are extremely rare, with only one type of natural fluorinase identified to date. This system expands the toolkit of biocatalytic fluorination by engineering a system capable of intermolecular C-H fluorination, addressing the gap in natural enzyme capabilities. The system’s compatibility with living cells and aqueous conditions also makes it suitable for scalable bioproduction. Traditional chemical methods for fluorination are not easily adaptable to biotechnological applications or large-scale production in biological systems.

[0186] The system solves key problems associated with current fluorination technologies, including the scarcity of natural enzymatic fluorination, the need for harsh reaction conditions, lack of selectivity and control, and incompatibility with living systems. The system advantageously has mild reaction conditions, high selectivity and control, biocompatibility, scalability, broad substrate scope, integration with protein engineering, sustainability, and the potential for enhanced performance through directed evolution.

[0187] There is a growing demand for organofluorine compounds in pharmaceuticals, agrochemicals, and materials science due to their unique properties. However, the existing natural fluorinase has a narrow substrate scope, limiting its utility. Traditional chemicalAttorney Docket No. 10046-646W01fluorination methods often require harsh conditions, such as high temperatures, strong acids or bases, and toxic reagents, which are not environmentally friendly and can be hazardous. These methods also lack selectivity, leading to complex mixtures of products.

[0188] Disclosed herein is a photoenzymatic system for intermolecular C-H fluorination. It utilizes a photoreactive unnatural amino acid embedded within a robust protein scaffold to achieve selective fluorination of benzylic positions in aromatic compounds.

[0189] This photoenzymatic system for intermolecular C-H fluorination features a photoreactive unnatural amino acid. Utilizing Selectfluor as the fluorine donor, it operates under mild, aqueous conditions, ensuring environmental friendliness and biocompatibility. Enhanced through protein engineering, the system demonstrates high efficiency and versatility across various substrates, with scalability for milligram-scale reactions. Its biocompatibility facilitates the synthesis of fluorinated polyketides and chiral alcohols via one-pot cascade reactions, offering a sustainable and selective alternative to traditional chemical fluorination methods.

[0190] The benefits of this photoenzymatic fluorination system include its high selectivity and efficiency in benzylic fluorination under mild, aqueous conditions, reducing environmental impact and enhancing biocompatibility. It offers a sustainable and scalable alternative to traditional chemical methods, with applications in pharmaceutical and organic synthesis. The system's versatility across various substrates and improved yields through protein engineering make it a valuable tool for producing fluorinated compounds with fewer side reactions, faster operation, and cost-effective production, ultimately advancing the development of bioactive molecules and complex organic compounds.Example 2: Harnessing Photoenzymatic Systems for Intermolecular C-H Fluorination

[0191] In nature, enzymes catalyze the production of a wide variety of natural products. In contrast, only around 30 fluorinated natural products have been discovered to date, significantly lower than that of chlorinated and brominated natural products (7, 8). Notably, only one type of natural fluorinase has been identified. This unique enzyme replaces the C-sulfonium bond of S-adenosyl-methionine with a C-F bond via an SN2 mechanism (FIG. 1A) (9). Taking advantage of this enzyme, researchers have coupled it with modified biosynthetic pathways to access more fluorinated products (10-12). To expand the biocatalysts beyond the natural fluorinase, the Huang and Yang groups repurposed two non-heme iron enzymes artificial fluorinases that catalyzed the stereoselective intramolecular fluorine atom transfer of pre-fluorinated substrates (FIG. 1A) (13, 14). While the demonstration of intramolecular C-HAttorney Docket No. 10046-646W01fluorination is an important step, pharmaceutical applications demand an enzymatic system that allows for direct intermolecular C-H fluorination without substrate pre-fluorination.

[0192] To enable the intermolecular C-F bond formation, a study was conducted which explored the use of photoenzymatic reactions, which has seen significant progress recently in catalyzing a range of organic radical transformations. For example, by irradiating enzymatic systems with light, natural flavin-dependent cofactors (FIG. IB) can be excited to initiate radical reactions with diverse reactivity patterns (15-20). Furthermore, enzymes containing pyridoxal phosphate and thiamine pyrophosphate cofactors were combined with organo-photocatalysts, transition metal catalysts and oxidants for radical biocatalysis (21-24). Beyond native cofactors, unnatural amino acid p-benzoyl-L-phenylalanine (pBPA) have been incorporated into protein scaffolds as a photosensitizer, facilitating the [2+2] cycloaddition by an energy transfer mechanism (25-28). Additionally, the photoexcited pBPA can initiate radical transformations through a hydrogen atom transfer (HAT) mechanism (29). Although this mechanism has been employed previously for photocrosslinking (30, 31), its applications in biocatalytic reactions have not been fully realized. To fill this gap, this study reports the intermolecular C-H fluorination empowered by the photoenzymatic mechanism (FIG. 1C). Materials and Methods

[0193] General information: Unless otherwise noted, all chemicals and reagents were obtained from commercial suppliers (Millipore Sigma, VWR, TCI America, Fischer Scientific) and were used without further purification. All the biological enzymes are purchased from New England Biolabs. NMR spectra of chemicals in CDCF were obtained using a Broker AVANCE III 400 spectrometer and were referenced to residual solvent signals. Data for NMR are reported as follows: chemical shift t (6 ppm), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet, bs = broad singlet), coupling constant (Hz), and integration. High-resolution mass spectra were obtained at the University of Texas, Austin Mass Spectrometry Facility using Agilent 6530 Q-TOF liquid chromatography-mass spectroscopy (LC / MS). Agilent 1200 Infinity instrament was used as reverse-phase high-performance liquid chromatography (HPLC) analysis with a C18 (Agilent Polaris 180A C18-A, 4.6 x 150 mm, 5 pm) HPLC column.

[0194] Cloning, mutagenesis, and expression of enzymes: Expression vector pET16b (Novagen, ampicillin resistance) was used for cloning and expression of all variants described in this paper for protein purification unless otherwise noted. Site-directed mutagenesis was performed using polymerase chain reaction (PCR) with primers containing a mutated codon at the desired position. The PCR products were digested with Dpnl (New England Biolabs, NEB),Attorney Docket No. 10046-646W01purified with NEB gel purification kit, and then KLD enzyme mix kit (NEB). Without further purification after ligation, 2-5 pL of the product was used to transform into 50 pL of NEB 5-alpha Competent E. colt (high efficiency) for DNA maintenance. The full plasmid sequences were verified by whole plasmid sequencing provided by Plasmidsaurus. Then, 2-5 pL of the verified plasmids were further transformed into 50 pL of NEB BL21(DE3) Competent E. coli for protein expression. Primers for mutagenesis are provided in TABLE 1.TABLE 1. Primer list for mutagenesis.Name 5’ -3’ Forward (Fwd) Primer 5 ’-3’ Reverse (Rev) Primer CAATGCGGGCTCCTCGCATATCGAA GCAACTAACAAATTGTTGTCTTCW244AGTA (SEQ ID NO: 8) GTCGAAATCC (SEQ ID NO: 9) CGATTCGTTAGATGAAAAATTCGG GTAAAATCGGCAGGGGC (SEQ ID I146DGTC (SEQ ID NO: 10) NO: 11) CGAATCGTTAGATGAAAAATTCGG GTAAAATCGGCAGGGGC (SEQ ID I146EGTC (SEQ ID NO: 12) NO: 13) CGCATCGTTAGATGAAAAATTCGG GTAAAATCGGCAGGGGC (SEQ ID 1146 AGTC (SEQ ID NO: 14) NO: 15) GGCCGATGAAAAATTCGGGTCAAT GAGATGGTAAAATCGGCA (SEQ LI 48 ACT (SEQ ID NO: 16) ID NO: 17) AGCTGTGGAGGTAAACGGTAAAC GGAGCCACAATATAAAAGTCCY37A(SEQ ID NO: 18) (SEQ ID NO: 19) GGCTGAAAACAATGCAGTCTGGAA TCCGTCACGAAAATGGTTTTTH287AG (SEQ ID NO: 20) (SEQ ID NO: 21) GGCTCGGACTAAAAAGTTATGGTC TCGGCCACAATCAGTTG (SEQ ID Q195AC (SEQ ID NO: 22) NO: 23) CGCGTGCGCTTTTGATTATGAAGGA GCGCAACCCTGCATACGA (SEQ Y121AAACTTATG (SEQ ID NO: 24) ID NO: 25) CTTCTGCGCTTTTGATTATGAAGGA GCGCAACCCTGCATACGA (SEQ Y121FAACTTATG (SEQ ID NO: 26) ID NO: 25) CCTGTGCGCTTTTGATTATGAAGGA GCGCAACCCTGCATACGA (SEQ Y121LAACTTATG (SEQ ID NO: 27) ID NO: 25) AGATGTGGAGGTAAACGGTAAAC GGAGCCACAATATAAAAGTCCY37D(SEQ ID NO: 28) (SEQ ID NO: 29)Attorney Docket No. 10046-646W01AGAAGTGGAGGTAAACGGTAAAC GGAGCCACAATATAAAAGTCCY37E(SEQ ID NO: 30) (SEQ ID NO: 29) ATTCGTGGAGGTAAACGGTAAAC GGAGCCACAATATAAAAGTCCY37F(SEQ ID NO: 31) (SEQ ID NO: 29) CAATTTCGGCTCCTCGCATATCGAA GCAACTAACAAATTGTTGTCTTCW244FGTA (SEQ ID NO: 32) GTCGAAATCC (SEQ ID NO: 33) CGCAGGTATGGATTTCGACGAAGA GCTCCACCCTCGTGAGTG (SEQ ID S229ACAAC (SEQ ID NO: 34) NO: 35) GTTTCGGACTAAAAAGTTATGGTCC TCGGCCACAATCAGTTG (SEQ ID Q195F(SEQ ID NO: 36) NO: 23)

[0195] The plasmid (pEVOL-pBPA) encoding for p-benzoyl-phenylalanine (pBPA) incorporation was a gift from the Schultz lab (Addgene plasmid # 31190).

[0196] For double transformation, 100 ng of pET16b-EnT1.3 (ampicillin resistance) and 100 ng of pEVOL-pBPA (chloramphenicol resistance) were mixed into 5 pL solution. 3 pL of the DNA mixture were transformed into NEB BL21(DE3) competent cells. Agar plates containing 50 pg / mL ampicillin and 34 pg / mL chloramphenicol were utilized for selection.

[0197] BL21(DE3) E. coli cells co-transformed with pET16b and pEVOL were grown overnight in 5 mL 2YT medium with 100 pg / mL ampicillin and 34 pg / mL chloramphenicol at 37°C. Subsequently, 5 mL of this preculture were used to inoculate 0.5-liter 2YT medium supplemented with 100 pg / mL ampicillin, 34 pg / mL chloramphenicol and 1 mM pBPA (dissolved in 1 mM NaOH) at 37°C. The expression culture was incubated at 37°C and shaken at 200 rpm until OD600 reached 0.8. Then, the expression culture was induced with 0.05% L-arabinose (250 mg) and 0.4 mM isopropyl 0-D-1 -thiogalactopyranoside (IPTG) (final concentration). Cells were expressed at 25°C and 180 rpm overnight for 20 hours. Once expression was finished, the cultures were centrifuged (8000 x g, 20 minutes and 4°C) and the pellets were stored at -20°C freezer until protein purification.

[0198] Protein Purification Half liter culture cell pellet was thawed under 4°C for 30 min. It was then resuspended in 50 mL lysis buffer (50 mM HEPES, pH = 7.5) by adding 1 mg / mL lysozyme, 1 mM PMSF (final concentration) and 1 pL benzonase for 30 min. The solution was sonicated for 5 minutes (70% amplitude, 2s on and 8s off per cycle). The supernatant was separated and filtered after centrifugation (18000 rpm, 30 minutes and 4°C) and loaded into 5 mL Cytiva nickel HisTrap high performance column (2.5 mL / min loading rate). The proteinAttorney Docket No. 10046-646W01was purified by Akta purifier FPLC system (GE healthcare) with a flow rate of 2.5 mL / min by buffer B (250 mM imidazole, 50 mM HEPES, 100 mM NaCl, pH = 7.5). Protein fractions were analyzed by SDS-PAGE gel which showed a mass band around 36 kDa in denatured gel.

[0199] The corresponding fraction was concentrated to less than 2.5 mL volume using centrifugal spin filters (10 kDa molecular weight cut-off, Amicon Ultra, Merck Millipore). Subsequently, the concentrated protein solution was loaded into Cytiva PD10 desalting columns to change the buffer into pH=7.4 NaPi buffer. Protein fractions were concentrated, flash-frozen on liquid nitrogen and stored at -80°C for further application. The calculated molecular weight of WT-InterFase is 36195 Da and its extinction coefficient is reported to be 62152 M1cm’1.

[0200] Analytical scale enzymatic assays: For reactivity test, 300 pL reaction assays were conducted for reactivity tests. First, 160 mM Selectfluor was measured in a 2 mL GC vial with a stir bar and transferred into glovebox. The solid was dissolved in 100 mM pH = 6 KPi buffer. Then, 60 pL acetonitrile, 0.13% enzyme and 80 mM ethylbenzene were injected into the solution. The reaction vial was transferred out of the box and stirred 1 cm above the LED array light for 3 cycles (1 hour light on and 5 min light off per cycle). The reaction temperature was increased from room temperature (22°C) to 37°C by the released heat from LED and stayed at 37°C. The reaction was quenched by opening the vial. 5 pL of 100 mM 2,4-dichlorobenzotrifluoride was added into the system as an NMR internal standard. The solution was extracted by 450 pL d-chloroform and analyzed by NMR to determine the yield.

[0201] Substrate preparation for the intramolecular fluorination reaction: The molecule for the intramolecular fluorination reaction was synthesized as previously reported (48, 49). To prepare for the desired amide intermediate, 1.1 equivalent of oxalyl chloride was added slowly at 0°C to a solution of 2-ethylbenzoic acid (10 mmol) and DMF (10 pL) in dry CH2Q2 (15 mL). The reaction mixture was stirred at room temperature until bubbles ceased. Volatile compounds were then removed by rotary evaporation and high vacuum. The crude reaction product was dissolved in 15 mL CH2Q2, followed by the addition of 1.5 equivalent of tertbutylamine and 2 equivalents of triethylamine. The reaction mixture was stirred for another three hours. Water (50 mL) was added, and the resulting mixture was extracted with CH2CI2. The crude amide was concentrated by rotary evaporation and high vacuum, which was directly used in the next step.

[0202] The above amide product (10 mmol) was dissolved in dry THE and stirred at 0°C under nitrogen. Then, 1.2 equivalent of nBuLi was added dropwise. The reaction mixture was kept at 0°C for 1.5 hours, followed by the addition of NFSI (1.5 equivalent, 0.5 M in THF).Attorney Docket No. 10046-646W01The reaction was left overnight in an ice bath and allowed to warm to the room temperature. It was then quenched with 1 M HCL The organic phase was extracted with CH2Q2, concentrated under vacuum, and purified by flash column chromatography.

[0203] Light source characterization The light source (Everbeam 365 nm 100 W UV LED Black light) was purchased from Amazon. The emission spectrum was measured using an Ocean Optics QE PRO-ABS Fiber Optic Spectrometer with a 5 pm slit width and boxcar set to 0. The light intensity at a distance 1 cm from the LED was measured to be 75 mW / cm2using a Thorlabs PM100D photometer with a S401C power sensor.

[0204] Quantum yield measurement: The photon flux of the irradiation setup with the Everbeam light source was measured using standard ferri oxalate actinometry (50, 51). Firstly, a 0.006 M solution of ferrioxalate was prepared by dissolving potassium ferrioxalate hydrate in 0.05 M H2SO4. A buffered solution of phenanthroline was prepared by dissolving 5.5 mg of phenanthroline monohydrate and 1.125 g of sodium acetate in 5 mL of 0.5 M H2SO4. Both solutions were stored in the dark to prevent photodecomposition. To determine the photon flux of the spectrophotometer, 300 pL of ferrioxalate solution was prepared in a 2mL GC vial and irradiated for 30 seconds at 365 nm. After irradiation, 195 pL of the phenanthroline solution was mixed with 5 pL of the irradiated solution. A dark control was prepared by mixing 5 pL of the non-irradiated solution with 195 pL of the phenanthroline solution. The combined solution was allowed to sit for 1 hour to ensure the complete coordination of ferrous ions with phenanthroline. The absorbance at 510 nm was monitored using an Agilent Cary 60 spectrophotometer to determine how much Fe2+was generated (molarity absorptivity at 510 nm is 11100 L x mol1cm1).

[0205] With the same setup, a 300 pL photoenzymatic reaction was prepared as the assay protocol above and irradiated for 30 seconds. The fluorinated product was then detected and quantified to calculate the overall quantum yield of the fluorination reaction.

[0206] Reactions between Selectfluor and / LA.v: In a 2 mL GC vial, a 400 pL reaction containing 125 mM amino acid substrate and 625 mM Selectfluor was prepared in 100 mM potassium phosphate buffer at pH 6, 7, 8. After three hours, 5 pL of 100 mM sodium trimethylsilylpropanesulfonate was added as an internal standard for both NMR and mass spectrometry analysis. The NMR was run under water suppression.

[0207] Analytic HPLC method for yield determination: For analytical HPLC, water and acetonitrile (MeCN) containing 1% acetic acid were used as mobile phase in 0.6 mL / min flow rate. Column temperature oven was set at 30°C. The separation program was 75% water for 2Attorney Docket No. 10046-646W01min; 75% water to 5% water gradient for 4.5 min; 5% water for 3 min, 95% water for another 1.5 min.

[0208] 10 |iL of the reaction assay was directly injected. The yield was determined based on the standard calibration curves.

[0209] Chiral GC method for enantioselectivity determination'. The reaction products were analyzed on a Shimadzu GC-2030 instrument equipped with FID detector. A 30 m x 0.25 mm x 0.12 pm CHIRALDEX G-TA (Astec) capillary column was used to separate the enantiomers in products and to evaluate the enantioselectivity of the catalysts. The method parameters were determined using racemic chemical standard. The injector temperature was 220°C and the detector temperature was 380°C. The flow rate was 0.66 mL / min. The column temperature was programmed between 80°C and 170°C.

[0210] Fluorinated product chemical synthesis: Chemical synthesis of the fluorinate products were conducted following the reported procedures (48, 52):

[0211] General procedure 1: An oven-dried, 10 mL vial equipped with a stir bar was placed under an atmosphere of N2. Selectfluor (195.0 mg, 0.55 mmol, 2.2 equiv.) and Fe(acac)2 (6.0 mg, 0.025 mmol, 0.1 equiv.) were added followed by MeCN (3.0 mL). Substrate (0.25 mmol, 1 equiv.) was then added, and the mixture allowed to stir overnight. The product was extracted into CH2Q2 and washed with water. The organics were dried with MgSCL and filtered through celite. The solvents were removed by rotary evaporation and the residue subjected to column chromatography.

[0212] General procedure 2: To a 10 mL vial charged with Selectfluor (141.7 mg, 0.4 mmol, 2.0 equiv.) was added anhydrous acetonitrile (2.5 mL), 9- fluorenone (0.01 mmol, 1.8 mg), and the reaction substrate (0.2 mmol, 1.0 equiv.) under nitrogen. The reaction mixture was degassed three times by Freeze-Pump-Thaw cycles and irradiated with an 11 W CFL 2-5 cm away from the reaction at room temperature for 24h. The reaction mixture was then poured into diethyl ether (20 mL), filtrated, concentrated and purified by silica gel flash column chromatography.

[0213] General procedure 3: To a solution of 2-vinylnaphthalene (0.2 mmol, 1 equiv.) in 8 mL MeCN in a 10 mL screw-top vial was added Pd(PPh3)4 (1 mol%), Selectfluor (3 equiv.), I U3S1I I (1.5 equiv.). The solution was stirred for 2 hours at 0 °C, quenched with water and extracted with CH2O2 (3x6 mL). The combined layer was dried over MgSCL, and the solvent was removed under reduced pressure. The crude product was purified by flash column chromatography to produce the final product as white solid.Attorney Docket No. 10046-646W01

[0214] General procedure 4: The reaction substrate, pyridine N-oxides as initiator (40 mol%), Selectfluor (2.0 equiv.) and AgF (20 mol %.) were weighed into a 4 mL screw-capped vial equipped with a magnetic stir bar. The vial was loosely capped, transferred into a nitrogen-filled glovebox and solvent (water) was added into it. The solution was stirred for 8 hours in dark. After that, it was extracted with ethyl acetate (3x2 mL). The combined organic phases were dried over anhydrous Na2SC>4 and concentrated under reduced pressure. The residue was subsequently subjected to silica gel chromatograph to give desired product.

[0215] General procedure 5: The reaction substrate, 41 mg indolin-2-one (0.31 mmol) was placed into a 20 mL glass vial, followed by the addition of 3 equivalents of Selectfluor and 2 mL of DMF. The reaction was then carried out at room temperature for approximately 6 h under magnetic stirring. Completion of the reaction was monitored using thin-layer chromatography. Purification of the reaction was achieved through column chromatography using hexane and ethyl acetate.

[0216] One-pot enzymatic cascade for chiral f -fluorinated alcohol biosynthesis'. The ADH mutant (WHOA-TesADH) gene was ordered from Integrated DNA Technologies, cloned into pET16b and transformed to BL21(DE3) E. coli cells for protein expression (53). Cultures were grown in 500 mL LB medium containing 100 mg / L ampicillin at 37 °C. When the culture reached an OD600 of 0.6, it was induced with 0.4 mM IPTG and grown overnight at 18°C. The cells were harvested and lyophilized, resulting in about 1 gram of dry weight. The reduction catalyzed by WHOA-TesADH was directly achieved using lyophilized cell lysate.

[0217] For the chemical synthesis oftheb-fluorinated alcohol standard, lOmg (0.06 mmol) of the 4-fluoro-4-phenylbutan-2-one was dissolved in 1.2 ml MeOH in a flame dried vial. At 0°C, NaBILi (4.5 mg, 0.12 mmol, 2 equiv.) was added. After 30min, the reaction was quenched by saturated NH4CI, extracted by EtOAc, concentrated and purified by column.

[0218] For the chemical synthesis of the acetylated product standard, this product was synthesized with the following protocol. In a flame dried vial, the reduced fluorinated alcohol (10 mg, 0.06 mmol) was dissolved in 1.2 ml CH2CI2. At 0°C, El N (18.2 mg, 0.18 mmol, 3 equiv.) was added, followed by AC2O (0.18 mg, 0.09 mmol, 1.5 equiv.). After Ih, the reaction was quenched by saturated NaHCCF, extracted by EtOAc, concentrated and purified by column.

[0219] The fluorination assay for 80 mM 4-phenyl-2-butanone was conducted as per the standard procedures in 300 pL of 100 mM potassium phosphate buffer at pH 6. After the fluorination reaction, the system was mixed with 700 pL 50 mM pll = 8 Tris-IICl buffer containing 2 mg NADP+, 2 mg cell lysate and 300 pL isopropanol. The reaction mixture was stirred at 50°C for 10 hours. It was then extracted with CH2Q2, concentrated under vacuumAttorney Docket No. 10046-646W01and analyzed by NMR. The chiral P-fluorinated alcohol product was confirmed by HR-LCMS and the reported NMR spectrum (52). For enantioselectivity analysis, the crude product was mixed with pyridine (100 pL) and AC2O (25 pL). After 4-hour stirring, the sample was diluted 50-fold in chloroform for chiral GC analysis.

[0220] For the chemical synthesis of the P-fluorinated alcohol standard, 10 mg (0.06 mmol) of the 4-fluoro-4-phenylbutan-2-one was dissolved in 1.2 ml MeOH in a flame dried vial. At 0°C, NaBFU (4.5 mg, 0.12 mmol, 2 equiv.) was added. After 30min, the reaction was quenched by saturated NH4CI, extracted by EtOAc, concentrated and purified by column.

[0221] For the chemical synthesis of the acetylated product standard, this product was synthesized with the following protocol. In a flame dried vial, the reduced fluorinated alcohol (10 mg, 0.06 mmol) was dissolved in 1.2 ml CH2CI2. At 0°C, EtsN (18.2 mg, 0.18 mmol, 3 equiv.) was added, followed by AC2O (0.18 mg, 0.09 mmol, 1.5 equiv.). After Ih, the reaction was quenched by saturated NaHCCb, extracted by EtOAc, concentrated and purified by column.

[0222] One -pot enzymatic cascade for fluorinated polyketide biosynthesis: The fluorination assay for 80 mM 3-phenylpropanoic acid (3.6 mg) was conducted as per the standard procedures in 300 pL of 100 mM potassium phosphate buffer at pH 6. After the fluorination reaction, the system was mixed with 12 mL of the Rosetta2(DE3) E. coli cell culture expressing both 4CL and 2PS mutant in M9 minimal medium. Following overnight biotransformation, 200 pL of the cell culture was analyzed by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) to detect the fluorinated polyketide products.

[0223] The following LC-HRMS method was applied: water containing 0.1 % formic acid as mobile phase A; MeCN as mobile phase B; 0.4 mL / min flow rate; 95% A as the initial solvent composition; 30% A for 10 min; 30% to 10% A gradient for 3 min; 10% to 95% A gradient for 0.1 min. The Agilent ZORBAX RRHD Eclipse Plus C18 Column was used.

[0224] The following HPLC method was applied to estimate the fluorinated PKS product titer: Water and acetonitrile (MeCN) containing 1% acetic acid were used as mobile phase in 0.4 mL / min flow rate. Column temperature oven was set at 30°C. The separation program was 90% water for 5 min, 90% water to 10% water gradient for 10 min, 10% water for 5 min, 90% water for another 5 min. 2 pL of 1 mM 4-methoxyl-6-methyl-2-pyrone dimethyl sulfoxide (DMSO) stock solution was injected into the assay as internal standard.Protein ligand docking and molecular dynamics simulation

[0225] The protein mutant structures were prepared in ChimeraX-1.2.5 by mutating the corresponding residues from the reported crystal structure (PDB: 7ZP6). All the water andAttorney Docket No. 10046-646W01ligand molecules were removed. To perform protein-ligand docking, the ligand three dimensional PDB file was first converted from SMILES file by Openbable. The ligand and simulated protein scaffold both were used for docking calculations by Autodock Vina. A grid box of 20 A x 20 A x 20 A size was centered on the active site. Completeness was set to 16. No constraint was applied to the rotatable bond of the substrate. The lowest energy docking poses were used for simulation studies.

[0226] To simulate the protein scaffold, input files for NAMD were generated using CHARMM-GUI server. The ligand was parameterized by the server, a rectangular water box that fits the protein size was prepared by the server and 0.1 M sodium chloride was added. A 25 ns minimization and equilibrium process waw performed with a periodic boundary for constant pressure (isothermal-isobaric ensemble, NPT) and with a constant temperature of 310.25 K. A 20 ns production was performed with a periodic boundary for constant pressure (NPT) with a constant temperature of 310.25 K. The simulation output was analyzed by VMD and the final frame was extracted as the simulated mutation structure.NMR Yield Determination and Product Characterization

[0227] (l-fluoroethyl)benzene-. 1’his product was synthesized following general procedure 1. The characterization data matches the record (48). NMR yield = 19.66x5x100 / 80 / 300x100% = 42%. ’ll NMR (400 MHz, Chloroform-d) 57.42 - 7.28 (m, 5H), 5.63 (dq, J = 47.7, 6.4 Hz, 1H), 1.65 (dd, J = 23.9. 6.5 Hz, 3H).13C NMR (101 MHz, Chloroform-d) 5 141.62 (d, J = 22.4 Hz), 128.62, 128.36 (d, J = 2.1 Hz), 125.36 (d, J = 6.7 Hz), 91.13 (d, J = 167.3 Hz), 23.08 (d, J = 25.2 Hz).19F-NMR: (471 MHz, Chloroform-d), 5 -166.68 (dq, J = 47.9, 23.8 Hz, IF).

[0228] l-chloro-4-(l-fluoroethyl)benzene: This product was synthesized following general procedure 2. The characterization data matches the record (52). NMR yield = 16.15x5x100 / 80 / 300x100% = 34%. II-NMR: (400 MHz, Chloroform-d) 5 7.37 - 7.27 (m, 4H), 5.60 (dq, J = 47.4, 6.4 Hz, 1H), 1.62 (dd, J = 23.8, 6.4 Hz, 3H).13C-NMR: (151 MHz, Chloroform-d) 5 140.15, 134.12, 128.82, 126.76 (d, J = 6.5 Hz), 90.42 (d, J = 168.4 Hz), 23.05 (d, J = 25.1 Hz).19F-NMR: (471 MHz, Chloroform-d), 5 -167.29 (dq, J = 47.7, 24.1 Hz, IF).

[0229] l-(4-(l-fluoroelhyl)phenyl)elhan-l-one'. This product was synthesized following general procedure 2. The characterization data matches the record (52). NMR yield = 20.59x5x100 / 80 / 300x100% = 43%.XH-NMR: (500 MHz, d-chloroform) 87.97 (d, J = 7.9 Hz, 2H), 7.44 (d, J = 8.0 Hz, 2H), 5.68 (dq,.1 = 47.6, 6.5 Hz, 1H), 2.61 (s, 3H), 1.65 (dd, J = 24.0, 6.5 Hz, 311).13C-NMR: (101 MHz, Chloroform-d) 8 198.12, 147.17 (d, J = 19.4 Hz), 137.35, 129.09, 125.59 (d, J = 7.3 Hz), 90.77 (d, J = 169.9 Hz). 27.13, 23.47 (d, J = 24.8 Hz).19F-Attorney Docket No. 10046-646W01NMR: (471 MHz, Chloroform-d) 6 -171.40 (dq, J - 48.0, 24.0 Hz). HRMS: m / z calculated for C10H12FO [M+H]+: 167.0872; found: 167.0875.

[0230] 4-(l-fluoroethyl)phenyl acetate This product was synthesized following general procedure 2. The characterization data matches the record (52). NMR yield = 5.1x5x100 / 80 / 300x100%= 11%. 'll-NMR: (500 MHz, d-chloroform) 5 7.04 (d, J = 8.2 Hz, 2H), 6.99 (d, J = 8.6 Hz, 2H), 5.57 (dq, J = 47.6, 6.4 Hz, 1H). 2.23 (s, 1H), 1.58 (dd, J = 23.9, 6.4 Hz, 3H).13C-NMR: (101 MHz, Chloroform-d) 5 168.6, 150.1 (d, J = 2.3 Hz), 139.2 (d, J = 19.9 Hz), 126.5 (d, J = 6.5 Hz), 121.8, 90.6 (d, J = 167.8 Hz), 23.1 (d, J = 25.3 Hz), 21.3.19F-NMR: (471 MHz, Chloroform-d) 8 -166.03 (dq, J = 47.9, 24.1 Hz, IF). HRMS: m / z calculated for CioHi2F02[M+H]+: 183.0821; found: 183.0819.

[0231] 2-(l-fluoroethyl)naphthalene This product was synthesized following general procedure 3. NMR yield = 10.43x5x100 / 80 / 400x100% = 16%.XH-NMR: (600 MHz, Chloroform-d) 87.93 - 7.77 (m, 4H), 7.57 - 7.44 (m, 3H), 5.80 (dq, J = 47.6, 6.5 Hz, 1H), 1.73 (dd, J = 23.9, 6.4 Hz, 3H).13C-NMR: (151 MHz, Chloroform-d) 8 139.01, 133.30, 133.22, 128.52, 128.23, 127.86, 124.32 (d, J = 7.6 Hz), 123.26 (d, J = 5.4 Hz), 91.29 (d, J = 167.8 Hz), 23.12 (d, J = 25.6 Hz).19F-NMR: (376 MHz, Chloroform-d) 8 -167.03 (dq, J = 47.9, 23.9 Hz).

[0232] 4-fluoro-4-phenylbutan-2-one: This product was synthesized following general procedure 1. The characterization data matches the record (48). NMR yield = 20.82x5x100 / 80 / 300x100% = 44%. ’H-NMR (600 MHz, Chloroform-d): 8 7.42 - 7.32 (m, 5H), 5.95 (ddd, J = 46.9, 8.8, 3.9 Hz, 1H), 3.21 (ddd, J = 16.8, 14.6, 8.8 Hz, 1H), 2.91 - 2.73 (m, 1H), 2.22 (s, 3H).13C-NMR (151 MHz, Chloroform-d) 8204.76, 139.26, 128.87, 128.85, 128.81, 90.27 (d, J = 170.7 Hz), 50.82 (d,.1 = 26.0 Hz), 31.08.19F-NMR (471 MHz, Chloroform-d) 8 -173.71 (ddd, J = 47.5, 32.7, 14.7 Hz). HRMS: m / z calculated for CIOIII2FO [M+H]+: 167.0872; found: 167.0875.

[0233] 3-fluoro-3-phenylpropanoic acid: This product was synthesized following general procedure 1. The characterization data matches the record (48). NMR yield = 3.84x5x100 / 80 / 300x100% = 8%. ^-NMR: (600 MHz, Chloroform-d) 87.52 - 7.30 (m, 5H), 5.93 (ddd, J = 46.9, 9.2, 4.0 Hz, 1H), 3.09 (ddd, J = 16.4. 13.4, 9.2 Hz, 1H), 2.87 (ddd, J = 32.7, 16.4, 4.0 Hz, 1H).13C-NMR: (151 MHz, Chloroform-d) 8 174.98 (d, J = 3.9 Hz), 138.41 (d, J = 19.5 Hz), 129.16 (d,.1 = 2.1 Hz), 128.90, 125.76 (d, J = 6.5 Hz), 90.41 (d, J = 172.3 Hz), 42.14 (d, J = 27.3 Hz).19F-NMR: 19F NMR (471 MHz, Chloroform-d) 8 -172.73 (ddd, J = 46.5, 33.2, 13.2 Hz). HRMS: m / z calculated for CgllsFCF [M-II]’: 167.0508; found: 167.0514.

[0234] 4-fluoro-4-phenylbutan-2-ol: This product was synthesized following the above procedure for one -pot enzymatic cascade for chiral [>- fluorinated alcohol biosynthesis. ’H-Attorney Docket No. 10046-646W01NMR: (600 MHz, Benzene-d6) 57.26 - 6.97 (m, 8H), 5.72 (ddd, J = 48.6, 10.3, 2.4 Hz. 0.6H), 5.50 (ddd, J = 48.0, 7.9, 5.9 Hz, 1H), 3.91 (did, J = 14.3, 7.2, 6.8, 4.1 Hz. 0.6H), 3.57 (dddd, J = 8.2, 6.3, 4.1, 2.0 Hz, 1H), 2.05 (tt, J = 13.8, 8.0 Hz, 1H), 1.81 (tdd, J = 14.8, 10.3, 2.8 Hz, 0.6H), 1.66 - 1.44 (m, 1.6H), 0.93 (d, J = 6.3 Hz, 3H), 0.91 (d, J = 6.2 Hz, 1.8H).13C-NMR: (151 MHz, Benzene-d6) 5 141.36 (d, J = 19.6 Hz), 140.68 (d, J = 19.7 Hz), 128.69, 128.51 (d, J = 2.1 Hz), 126.09 (d, J = 6.8 Hz), 125.67 (d, J = 7.0 Hz), 93.57 (d, J = 168.2 Hz), 91.70 (d, J = 169.7 Hz), 65.12 (d, J = 5.6 Hz), 63.83 (d, J = 2.2 Hz), 47.26 (d, J = 22.9 Hz), 46.43 (d, J = 22.4 Hz), 23.97 (d, J = 89.2 Hz).19F-NMR: (376 MHz, C6D6) 5 -174.06, -179.01. HRMS: m / z calculated for C10H14FO [M+H]+: 169.1029; found: 169.1032.

[0235] 4-fluoro-4-phenylbutan-2-yl acetate'. This product was synthesized following the above procedure for one-pot enzymatic cascade for chiral P-fluorinated alcohol biosynthesis. 'H-NMR: (600 MHz, Chloroform-d) 5 7.40 - 7.29 (m, 7.5H), 5.60 - 5.44 (m, 2.5H), 5.20 -5.14 (m, 1H), 5.04 - 4.97 (m, 1.5H), 2.37 (ddt, J = 15.9, 14.9, 7.5 Hz, 1.5H), 2.18 - 2.01 (m, 2.5H), 2.03 (s, 3H), 2.00 (s, 4.5H), 1.99 - 1.94 (m, 1H), 1.30 (dt, J = 6.3, 1.0 Hz, 7.5H).13C-NMR: (151 MHz, CDC13) 5 170.70, 170.58, 139.90, 139.79, 139.66, 128.73, 128.69, 128.68, 128.60, 125.70, 125.65, 125.59, 77.37, 77.16. 76.95, 67.94, 67.78, 67.76, 43.89, 43.73, 43.19, 43.04, 21.41, 20.76, 20.72, 20.22, 20.19.19F-NMR: (376 MHz, Chloroform-d) 5 -174.64 (ddd, J = 47.6, 26.6, 15.7 Hz), -176.14 (ddd, J = 49.2, 34.6, 15.3 Hz). HRMS: m / z calculated for C12H16FO2 [M+H]+: 211.1134: found: 211.1132.Results

[0236] Development and optimization of the enzymatic fluorination: The study commenced by testing the photoenzymatic intermolecular C-H fluorination of ethylbenzene under 365 nm light with Selectfluor as the fluorinating reagent (TABLE 2). Three well-established protein scaffolds including Lactococcal multidrug resistance Regulator (LmrR), myoglobin (Mb) and a designed protein scaffold (PDB: 7ZP6) were used as the biocatalysts. Firstly, VL5pBPA-LmrR was constructed (26, 32) and it achieved 15% yield of 1 -fluoroethylbenzene according to NMR analysis (TABLE 2, entry 1). In addition, given the extensive engineering of Mb for biocatalysis (33), the study replaced the heme-coordinating residue His93 with pBPA and further changed the active site by H64V / V68A mutations. This H64V / V68A / H93pBPA-Mb mutant only displayed 12% yield (TABLE 2, entry 2), possibly due to the instability of Mb after the His93 removal (34). Next, the designed protein scaffold (PDB: 7ZP6) has been reported to have a robust incorporation of pBPA and high stability toward oxygen, organic solvent, and ultraviolet light (25). The study purified this protein (FIGS. 2A-2B) and found it produced 26% of the fluorinated product with a total turnover number (TTN) of 200 (TABLEAttorney Docket No. 10046-646W012, entry 3). No detectable benzylic difluorination or aromatic C-H fluorination was observed in the reaction. Consequently, this enzyme was named InterBase (INTERmolecular FluorinASE) to reflect its role in catalyzing the intermolecular C-H fluorination.enzyme2 equiv. Selectfluor365 nm lightanaerobic, aqueousSCHEME 1. Intermolecular fluorination reaction.TABLE 2. Condition optimization of the intermolecular fluorination reaction.Entry Condition Catalyst Yield (%) TTN 20% MeCN1 0.13% V 15pBPA-LmrR 15 ± 2 115 pH = 7.4 KPi0.13%20% MeCN2 H64V / V68A / H93pBPA- 12 + 2 92 pH = 7.4 KPiMb20% MeCN3 0.13% InterBase 26 + 1 200 pH = 7.4 KPi20% MeCN4 0.13% 9-fluorenone 0.5 + 0.2 4 pll = 7.4 KPi20% MeCN5 0.13% pB PA 2 + 1 15 pH = 7.4 KPi20% MeCN6 no cat 0 0 pll = 7.4 KPi20% MeCN7 pH = 7.4 KPi 0.13% InterBase 0 0 no light20% MeCN8 0.13% InterBase 16 ± 2 123 pH = 8 KPi20% MeCN9 0.13% InterBase 35 + 1 270 pH = 6 KPi10 20% MeCN 0.13% InterBase 24 ± 1 185Attorney Docket No. 10046-646W01pH = 5.5NaOAc10% MeCN11 0.13% InterBase 11 ± 1 85 pH = 6 KPa

[0237] The study further compared this InterBase with equivalent amounts of small molecular catalysts. Under the same condition, 9-fluorenone and the unnatural amino acid pBPA only produced 0.5-2% yield (TABLE 2, entries 4-5) (4). This result highlighted the initial success of the photoenzymatic system, showing at least a 13-fold improvement over small molecule catalysts. In addition, no product was detected in the absence of either light or enzyme (TABLE 2, entries 6-7), confirming the photoenzymatic nature of the reaction.

[0238] To further enhance the InterBase's performance, the study optimized the reaction condition by adjusting the pH and the cosolvent concentration. The results indicated that the reaction favored slightly acidic conditions, particularly pH 6, with an improved yield of 35% (TABLE 2, entries 8-10). However, at pH conditions below 6, WT-InterBase became unstable and precipitated out of the solution during assays. Additionally, reducing the cosolvent concentration to 10% acetonitrile (MeCN) significantly decreased the yield to only 11% (TABLE 2, entry 11). This lower yield is likely due to the poor solubility of ethylbenzene in aqueous conditions. Given that the designed scaffold tolerated up to 20% MeCN (25), the study continued to perform fluorination assays with the optimal 20% MeCN.

[0239] Next, fluorine sources were screened, including widely used organofluorine reagents and soluble potassium fluoride (FIG. 3A). Among them, Selectfluor II showed 33% yield of monolluorinated product and 2% of difluorinated side product. This is likely due to the stronger oxidative property of Selectfluor II (4). Other widely used reagents for electrophilic and radical fluorination such as NBSI (N-fluorobenzenesulfonimide) and NBTPT (l-fluoro-2,4,6-trimethylpyridinium tetrafluoroborate) showed much lower yields (0-1%) compared to Selectfluor (35). Inorganic fluoride was previously combined with manganese catalysts for fluorination (36, 37), but it was ineffective for this enzymatic reaction.

[0240] To assess the feasibility of the photoenzymatic system for intramolecular fluorine atom transfer, the study synthesized the corresponding N-fluoroamide (FIG. 3B). Previously, ferrous salts and Fc(II) enzymes effectively initiated the homolytic cleavage of the N-F bond and catalyzed the intramolecular fluorine atom transfer (FIG. 1A) (13, 14, 38). Despite its success in the previous Fe-catalyzed fluorination (13, 14, 38), no target product was detectedAttorney Docket No. 10046-646W01under photocatalytic conditions. Given the plausible HAT mechanism at the benzylic position, it is likely that the bond dissociation energy of the N-F bond in the synthesized N-fluoroamide is higher than that in Selectfluor (39). This difference prevented the successful intramolecular fluorine atom transfer in the photocatalytic mechanism.

[0241] Mechanistic studies and protein engineering'. After achieving a high performance of enzymatic fluorination with the yield up to 35%, the study investigated the mechanism of the designed fluorination reaction. Firstly, the study explored whether the benzylic radical was generated by HAT. Upon adding one equivalent of TEMPO as a radical trap, the reaction was quenched without any fluorinated product observed (FIG. 4A). Instead, the TEMPO-trapped benzylic radical originating from ethylbenzene was detected. This result strongly supported the proposed HAT mechanism. Next, light on / off experiments were conducted to determine if the process involved a radical chain mechanism (FIG.4B). According to the proposed mechanism, the nitrogen-centered radical cation could potentially abstract the benzylic C-H bond (40). However, no yield increase was detected during the light-off cycles. Furthermore, the quantum yield of the photoreaction was measured to be only 2.3% (FIG.4C), disfavoring a radial chain mechanism (41, 42).

[0242] Given the supportive evidence for the proposed mechanism shown in FIG. 1C, the study measured the enantioselectivity of the transformation. No significant enantioselectivity was observed under any of the conditions screened in TABLE 2 (FIGS. 5A-5B). It is likely that the benzylic radical escaped from the active site and the fluorine atom transfer occurred outside the protein scaffold, which would lead to no enantioselectivity. Although aromatic substrates such as ethylbenzene are hydrophobic and capable of interacting with the active site, Selectfluor is highly charged and hydrophilic. This discrepancy may result in the low affinity for Selectfluor.

[0243] To further improve the InterFase’s performance, the study performed an alanine screening of the active site (FIG. 6A). The yields were reduced when residues in the pocket were mutated. In particular, Y37A, Y121A, I146A, W244A and H287A showed almost half the yield compared to the WT enzyme. The previously reported crystal structure indicated that H287 and W244 played key roles in providing aromatic interactions with the substrates (25), which may explain the observed yield decrease. To further investigate the roles of the other three residues, the study rationally prepared more mutations at Y37, Y121 and 1146 (FIG.6A).Among these, InterFase-Y121F displayed a slightly higher yield (37%) than WT (35%). Given that Selectfluor is an oxidant commonly used in organic chemistry (43), it is possible that tyrosine was oxidized in aqueous conditions, influencing the biocatalytic reactions.Attorney Docket No. 10046-646W01

[0244] To better understand how Selectfluor interacts with amino acids (AAs) and modifies the protein scaffold, the study tested the reactions between Selectfluor and 20 AAs at pH 6, 7, and 8. Sixteen AAs stayed intact (FIG.6B and FIG.7), but Selectfluor decomposition was increased under more basic conditions. Furthermore, Cys, Met, Trp and Tyr were oxidized (FIGS. 8A-8D). To mitigate the impact of these oxidizable residues near the active site, Y37F / Y121F and Y121F / W244F mutants were constructed. The Y37F / Y121F mutant only displayed 16% yield. However, Y121F / W244F showed 42% yield with 20% improvement over WT-InterFase. The enhanced variant Y121F / W244F was subsequently named InterFase2.

[0245] Substrate scopes and biosynthetic fluorination cascade reactions'. To demonstrate the applications of the developed photoenzymatic fluorination system, the study tested the substrate scope in milligram-scale reactions. InterFase2 readily transformed various aromatic substrates, including ethylbenzene substituted with 4-acetoxy, 4-acetyl, and 4-chloro as well as naphthalene, into the corresponding fluorinated products with yields up to 42% (FIG. 9A).Additionally, 4-phcnyl-2-butanonc was fluorinated with 44% yield (FIG. 9B). This product was reduced by an alcohol dehydrogenase (ADH) mutant to synthesize the chiral P-fluorinated alcohol containing two stereocenters with 35% yield and up to 96% ee at the hydroxyl center (FIG. 9B and FIGS. 10A-10C) (44, 45). Furthermore, fluorinated 3-phenylpropanoic acid was synthesized in 8% yield (FIG. 9B). This compound was transformed into fluorinated polyketides in estimated 7 pg / mL titer via a 12 mL E. coli culture expressing 4-coumaroyl-CoA ligase (4CL) and 2-pyrone synthase (2PS) mutant (FIG. 9B and FIGS. 11A-11B) (46, 47). Overall, these results highlight the broad applicability of the photoenzymatic system for the synthesis of diverse fluorinated compounds.

[0246] In summary, this study has reported enzymatic intermolecular C-H fluorination catalyzed by the engineered InterFase. This study highlighted the biocatalytic applications of the hydrogen atom transfer mechanism facilitated by the photoexcitation of pBPA. InterFase2 achieved enzymatic fluorination with yields up to 44%. Biocatalytic cascade reactions were also established for fluorinated polyketides and chiral fluorinated alcohols. The ability to fluorinate benzylic C-H bonds under aqueous conditions not only demonstrates the integration of photoenzymatic catalysis with green chemistry but also underscores its potential for broader applications in organic synthesis to produce fluorinated products.Example 3: Harnessing Photoenzymatic Systems for Intermolecular C-H Fluorination

[0247] Organofluorine compounds are vital in pharmaceuticals, and enzymes, nature's most efficient catalysts, offer tremendous potential for precise fluorination. However, no enzymatic strategies for intermolecular C-H fluorination have been realized — until now. TheAttorney Docket No. 10046-646W01study discloses the first radical photoenzymatic system enabling intermolecular C-H fluorination using an unnatural amino acid within a robust de novo protein scaffold. This system achieves chemoselective benzylic monofluorination in aqueous solutions with Selectfluor, driven by hydrogen atom transfer from the photoexcited amino acid. It successfully fluorinated various aromatic compounds and enabled the biosynthesis of fluorinated polyketides and chiral fluorinated alcohols. These results establish radical photoenzymatic systems as a powerful new approach for efficient, selective biocatalytic fluorination, with direct relevance to pharmaceuticals

[0248] Carbon-fluorine (C-F) bonds are present in over 20% of commercial pharmaceuticals and -30% of agrochemicals, due to the unique electronic properties, small size, and lipophilicity of fluorine that can enhance physicochemical and pharmacokinetic properties (1,2). To meet the growing demand for fluorine-containing pharmaceuticals and agrochemicals, biocatalysis has emerged as an effective approach (3-5). For example, fluorinated motifs such as -CF3, -CF2CF3 have been incorporated into different organic molecules by engineering enzymes (FIG. 1A) such as ene-reductases (6-9), heme-containing enzymes (10-13), non-heme enzymes (14-16), and methyltransferases (17). In addition, fluoromalonyl coenzyme A has also been incorporated into complex polyketide natural products by polyketide synthases (FIG. 1A)( 18-20).

[0249] While the above advances in fluorinated motif incorporation are exciting, a key biosynthetic challenge remains in constructing C-F bonds directly (FIG. 1A), especially by selectively fluorinating C-H bonds in unactivated molecules, including many pharmaceuticals and agrochemicals that do not contain any fluorine and thus significantly expand the number of fluorinated chemicals. (21, 22) Despite the importance, only one type of natural fluorinase has been identified capable of constructing a C-F bond by replacing the C-sulfonium bond of S-adenosyl-methionine via an SN2 mechanism (FIG. 1A)(23), even though extensive efforts have been devoted toward discovering natural fluorinated products and fluorination enzymes. As a result, only around 30 fluorinated natural products have been discovered to date (24,25), compared to over 5000 other halogenated natural products (26).

[0250] To expand the biocatalysts beyond the natural fluorinase, the Huang and Yang groups repurposed two non-heme iron enzymes as the first examples of artificial fluorinases, catalyzing stereoselective intramolecular fluorine atom transfer of pre-fluorinated substrates (FIG. 1A) (27,28). These demonstrations of intramolecular C-H fluorination represent an important step toward enzymatically constructing C-F bonds from C-H bonds via a two-step process: substrate pre- fluorination followed by fluorine atom transfer. To apply the biocatalyticAttorney Docket No. 10046-646W01strategy to synthesize a much wider range of pharmaceuticals and agrochemicals, an enzymatic system that allows for one-step intermolecular C-H fluorination using commercially available organofluorine reagents without pre-fluorination of the substrate would be transformative.

[0251] To enable intermolecular C-F bond formation, this study explored the use of photoenzymatic reactions, inspired by their recent applications in catalyzing a range of organic radical transformations (29-31). For example, by irradiating enzymatic systems with light, natural flavin-dependent cofactors (FIG. IB) can be excited to initiate radical reactions with diverse reactivity patterns (6,32-36). Furthermore, enzymes containing pyridoxal phosphate and thiamine pyrophosphate cofactors were combined with organo-photocatalysts, metal-based photocatalysts and oxidants for radical biocatalysis (37-41). Beyond native cofactors, unnatural amino acids such as p-benzoyl-L-phenylalanine (pBPA) and thioxanthones have been incorporated into protein scaffolds as an ultraviolet (UV) light absorbing photosensitizer to facilitate [2+2] cycloaddition and deracemization (42-49). Additionally, the photoexcited pBPA has been demonstrated to initiate radical transformations through hydrogen atom transfer (HAT) (50). Although the HAT mechanism has been employed previously for photocrosslinking (51,52), its applications in biocatalytic reactions have not been realized. To fill this gap, the study herein reports intermolecular C-H fluorination empowered by the photoenzymatic mechanism (FIG. 1C).Development and optimization of enzymatic fluorination

[0252] The study commenced by testing the photoenzymatic intermolecular C-H fluorination of ethylbenzene upon exposure to 365 nm light (FIGS. 12A-12B) with Selectfluor as the fluorinating reagent (TABLE 2). Three well-established protein scaffolds including Lactococcal multidrug resistance Regulator (LmrR), myoglobin (Mb) and a de novo-designed protein scaffold (PDB: 7ZP6) were used as the biocatalysts. Firstly, V15pBPA-LmrR was constructed (43,53), and it achieved a 15% yield of 1 -fluoroethylbenzene, as characterized using 19F-NMR spectroscopy (TABLE 2, entry 1). In addition, given the extensive engineering of Mb for biocatalysis (54), the study replaced the heme-coordinating residue His93 to pBPA and further modified the active site with H64V / V68A mutations. This H64V / V68A / H93pBPA-Mb mutant only displayed a 12% yield (TABLE 2, entry 2). Next, the de novo-designed protein scaffold (PDB: 7ZP6) has been reported to have a robust incorporation of pBPA and high stability toward oxygen, organic solvents, and ultraviolet light (42). The study purified this protein (FIGS. 2A-2B) and found it produced 26% of the fluorinated product with a total turnover number (TTN) of 200 (TABLE 2, entry 3). No detectable benzylic difluorination or aromatic C-H fluorination was observed in the reactionAttorney Docket No. 10046-646W01(FIGS. 14A-14B). Consequently, this enzyme was named InterFase (INTERmolecular FluorinASE) to reflect its role in catalyzing intermolecular C-H fluorination.

[0253] The study further compared this InterFase with equimolar amounts of small molecule homogeneous catalysts. Under the same condition, 9-fluorenone and the unnatural amino acid pBPA only produced 0.5-2% yield (TABLE 2, entries 4-5) (21). This result highlighted the initial success of the photoenzymaric system, showing > 13-fold improvement over small molecule catalysts with the enzyme loading low to only 0.13%. In addition, no product was detected in the absence of either light or enzyme (TABLE 2, entries 6-7), confirming the photoenzymaric nature of the reaction.

[0254] To further enhance the InterFase’ s performance, the study optimized the reaction condition by adjusting the pH and the cosolvent concentration. The results indicated that the reaction favored slightly acidic conditions, particularly pH 6, with an improved yield of 35% (TABLE 2, entries 8-10). However, at pH conditions below 6, WT-InterFase became unstable and precipitated out of the solution. Additionally, reducing the cosolvent concentration to 10% acetonitrile (MeCN) significantly decreased the yield to only 11% (TABLE 2, entry 11). This lower yield is likely due to the poor solubility of ethylbenzene in aqueous conditions. Given that the de novo designed scaffold tolerated up to 20% MeCN (42), the study continued to perform fluorination assays with the optimal 20% MeCN.

[0255] Next, fluorine sources were screened, including widely used org anofluorine reagents and soluble potassium fluoride (FIG. 3A). Among them, Selectfluor II showed 33% yield of monofluorinated product and 2% of difluorinated side product. This is likely due to the stronger oxidative property of Selectfluor II (21). Other widely used reagents for electrophilic and radical fluorination such as NFSI (N-fluorobenzenesulfonimide) and NFTPT (l-fluoro-2,4,6-trimethylpyridinium tetrafluoroborate) showed much lower yields (0-1%) compared to Selectfluor (55). Inorganic fluoride was previously combined with manganese catalysts for fluorination (56,57), but it was ineffective for the present enzymatic reaction. Mechanistic studies and protein engineering

[0256] After achieving efficient enzymatic fluorination, the study examined the associated mechanism. Firstly, the study examined whether the benzylic radical was generated by HAT. Upon adding one equivalent of TEMPO (2,2,6,6-tetramethylpiperidin-l-oxyl) as a radical trap, the reaction was quenched without any fluorinated product observed (FIG. 4A). Instead, the TEMPO-trapped benzylic radical originating from ethylbenzene was detected, which strongly supports the proposed HAT mechanism. Next, light on / off experiments were conducted to determine if the process involved a radical chain mechanism (FIG. 4B). According to theAttorney Docket No. 10046-646W01proposed mechanism, the nitrogen-centered radical cation of the Selectfluor intermediate can abstract the benzylic C-H bond (58). However, no yield increase was detected during the light-off cycles. Furthermore, the internal quantum yield (d ) of the photoreaction was measured via chemical actinometry to be 2.3% (FIG. 4C), which is comparable to the previously reported values for small molecule photocatalysis (59). In contrast, a much higher quantum yield of reaction ( »1OO%) is typically observed for a radial chain mechanism (60,61).

[0257] Given the supportive evidence for the proposed mechanism shown in FIG. 1C, the study measured the enantioselectivity of the transformation. No significant enantioselectivity was observed under any of the conditions screened in TABLE 2 (FIGS. 5A-5B). It is likely that the benzylic radical escaped from the active site and the fluorine atom transfer occurred outside the protein scaffold, which would lead to lack of enantioselectivity. Although aromatic substrates such as ethylbenzene are hydrophobic and capable of interacting with the active site, Selectfluor is highly charged and hydrophilic. This discrepancy may result in a low affinity for Sclcctfluor. To test this hypothesis, the study docked both ethylbenzene and Sclcctfluor into InterFase and then applied molecular dynamics simulation to understand the protein-substrate interactions. During the 20 ns timescale, ethylbenzene was tightly bound in the active site, interacting with the hydrophobic side chains including pPBA173 (FIGS. 15A-15B). In contrast, Selectfluor quickly escaped from the active site to the aqueous solution, which never reentered the active site (FIGS. 15A-15B). The average distance is 39 ± 12 A between the F atom of Selectfluor and the carbon atom of the carbonyl group in the pPBA173 side chain (FIG. 15B) The computational results supported the hypothesis that the high hydrophilicity of Selectfluor is the major obstacle for enantioselectivity.

[0258] To better understand how Selectfluor interacts with amino acids (A As) and the protein scaffold, the study tested the reactions between Selectfluor and twenty AAs at pH 6, 7, and 8. Sixteen AAs stayed intact (FIGS. 16A and FIG. 7), but Selectfluor decomposition increased under more basic conditions. Furthermore, oxidation of Cys, Met, Trp and Tyr was observed as by 1H-NMR and LC-MS (FIGS. 8A-8D) (62). To mitigate the impact of these oxidizable residues, alanine screening as well as Trp / Tyr to Phe mutations were examined for the residues in the active site (no Cys / Met exists in the active site). Among the screened mutations (FIG. 6 A), Y121F / W244F showed 42% yield and a TTN of 323 with 20% improvement over WT-InterFase. The enhanced variant Y121F / W244F was subsequently named InterFase2, achieving the highest reported TTN with a > 9-fold improvement over other reported systems employing small molecule catalysts for the same reaction (TTN values from 4-38, FIG. 13) (21,63-66).Attorney Docket No. 10046-646W01Substrate scope and biosynthetic fluorination cascade reactions

[0259] To demonstrate the versatility of the photoenzymatic fluorination system, the study tested various substrates. InterFase2 readily transformed aromatic substrates with diverse functional groups. For example, ethylbenzene with both electron-donating groups (4- acetoxy, 4-phenyl) and electron-withdrawing groups (4-bromo, 4-chloro, 4-acetyl and 4-carboxylate), bulky substitutes (3-tert-butyl and 4-phenyl) are all monofluorinated, with yield up to 60%. Bicyclic aromatic substrates containing 2-oxindole, naphthalene, diphenyl motifs, were all successfully fluorinated in 3% ~ 16% yield. Besides the methylene C-H at the benzylic position, substrates with methyl, propyl and isopropyl groups were all monofluorinated with yield up to 28%. Additionally, 4-phenyl-2-butanone was fluorinated with 44% yield (FIG.16C). This product was reduced by an alcohol dehydrogenase (ADH) mutant to synthesize the chiral -fluorinated alcohol containing two stereocenters with a 35% yield and up to 96% ee at the hydroxyl center (FIG. 16C and FIGS. 10A-10C) (67,68). Furthermore, fluorinated 3-phcnylpropanoic acid was synthesized in 8% yield (FIG. 16C). This compound was transformed into fluorinated polyketides via a 12 mL E. coli culture expressing 4-coumaroyl-CoA ligase (4CL) and 2-pyrone synthase (2PS) mutant, resulting in ~7 pg / inl. titer (FIG. 16C and FIGS. 11A-11B) (69,70). Overall, these results highlight the broad applicability of the photoenzymatic system for the synthesis of diverse fluorinated compounds.

[0260] In summary, this study has reported enzymatic intermolecular C-H fluorination catalyzed by the engineered InterFase. This study highlighted the biocatalytic applications of the HAT mechanism facilitated by photoexcitation of pBPA. Biocatalytic cascade reactions were also established for fluorinated polyketides and chiral fluorinated alcohols. The ability to fluorinate benzylic C-H bonds under aqueous conditions not only demonstrates the integration of photoenzymatic catalysis with green chemistry, but also underscores its potential for broader applications in organic synthesis to produce fluorinated products with utility in pharmaceuticals.EXAMPLE ASPECTS

[0261] In view of the described compositions, devices, systems, and methods, herein below are described certain more particularly described aspects of the inventions. The particularly recited aspects should not, however, be interpreted to have any limiting effect on any different claims containing different or more general teachings described herein or that the “particular” aspects are somehow limited in some way other than the inherent meanings of the language and formulas literally used therein.Attorney Docket No. 10046-646W01

[0262] Example 1: A method of intermolecular C-H fluorination of an aromatic compound (e.g., a compound comprising at least one aromatic moiety), the method comprising: a) contacting the aromatic compound with a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the aromatic compound to form a fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety).

[0263] Example 2: The method of any one of the examples herein, particularly Example 1, wherein the aromatic compound comprises a compound of Formula I:Formula Iwherein: R1is substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; and R2, R3, R4, R’, and R6are each independently H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R3, or R5and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0264] Example 3: The method of any one of the examples herein, particularly Examples 1-2, wherein the fluorinated aromatic compound comprises a compound of Formula II:R2FR5Formula IIwherein: R1is substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylicAttorney Docket No. 10046-646W01acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted Ci-C& ester; and R2, R3, R4, R5, and R6are each independently H, OH, halogen, substituted or unsubstituted Ci-C6alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R5, or R5and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0265] Example 4: A method of intermolecular C-H fluorination, the method comprising: a) contacting a compound of Formula I:with a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture; b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation to thereby intermolecularly fluorinate the compound of Formula I to form a compound of Formula II:R2FFormula IIwherein: R1is substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C' i-C, carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; and R2, R3, R4, R5, and R6are each independently H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R5, or R5and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.Attorney Docket No. 10046-646W01

[0266] Example 5: The method of any one of the examples herein, particularly Examples 2-4, wherein R1is substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid.

[0267] Example 6: The method of any one of the examples herein, particularly Example 5, wherein R1is methyl.

[0268] Example 7: The method of any one of the examples herein, particularly Examples 2-6, wherein R4is hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester.

[0269] Example 8: The method of any one of the examples herein, particularly Examples 2-6, wherein R3and R4together with the atoms to which they are attached, form a 6-12 membered substituted or unsubstituted aromatic moiety.

[0270] Example 9: The method of any one of the examples herein, particularly Examples 2-7, wherein R2, R5, and R6are each hydrogen.

[0271] Example 10: The method of any one of the examples herein, particularly Examples 1-9, wherein the biocatalyst comprises 80% similarity or more to any one of SEQ ID NOs: 1-4.

[0272] Example 11: The method of any one of the examples herein, particularly Examples 1-10, wherein the biocatalyst comprises 90% similarity or more to any one of SEQ ID NOs: 1-4.

[0273] Example 12: The method of any one of the examples herein, particularly Examples 1-11, wherein the biocatalyst comprises any one of SEQ ID NOs: 1-4.

[0274] Example 13: The method of any one of the examples herein, particularly Examples 1-12, wherein the biocatalyst comprises one or more mutations to remove oxidizable amino acids near an active site of the biocatalyst.

[0275] Example 14: The method of any one of the examples herein, particularly Example 13, wherein the biocatalyst comprises Y37F, Y121F, W244F, or any combination thereof relative to SEQ ID NO: 1.

[0276] Example 15: The method of any one of the examples herein, particularly Examples 1-14, wherein the at least one photosensitizer comprises a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof.

[0277] Example 16: The method of any one of the examples herein, particularly Example 15, wherein the photoexcitable amino acid is p-benzoyl-L-phenylalanine (pBPA), and / orAttorney Docket No. 10046-646W01wherein the photoexcitable amino acid comprises at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.

[0278] Example 17: The method of any one of the examples herein, particularly Examples 1-16, wherein the biocatalyst comprises the photosensitizer.

[0279] Example 18: The method of any one of the examples herein, particularly Examples 1-17, wherein the biocatalyst has a total turnover number of 100 or more.

[0280] Example 19: The method of any one of the examples herein, particularly Examples 1-18, wherein, upon irradiation, the at least one photosensitizer initiates radical transformation via hydrogen atom transfer.

[0281] Example 20: The method of any one of the examples herein, particularly Examples 1-19, wherein the aromatic compound comprises an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

[0282] Example 21: The method of any one of the examples herein, particularly Examples 1-20, wherein the fluorine donor comprises Selectfluor, Selectfluor II, N-fluorobenzenesulfonimide (NESI), l-fhioro-2,4,6-trimethylpyridinium tetrafluoroborate (NFTPT), potassium fluoride, Togni’s reagent, Togni’s reagent II, or any combination thereof.

[0283] Example 22: The method of any one of the examples herein, particularly Examples 1-21, wherein the mixture has pH of from 4 to 10.

[0284] Example 23: The method of any one of the examples herein, particularly Examples 1-22, wherein the mixture further comprises a solvent.

[0285] Example 24: The method of any one of the examples herein, particularly Example 23, wherein the mixture comprises from 0% to 80% acetonitrile (MeCN).

[0286] Example 25: The method of any one of the examples herein, particularly Examples 1-24, wherein the mixture has a temperature of from 4°C to 90°C.

[0287] Example 26: The method of any one of the examples herein, particularly Examples 1-25, wherein the electromagnetic radiation comprises ultraviolet light.

[0288] Example 27: The method of any one of the examples herein, particularly Examples 1-26, wherein the mixture receives a total irradiation of from 10 mW / cm2to 500 mW / cm2.

[0289] Example 28: The method of any one of the examples herein, particularly Examples 1-27, wherein the fluorinated aromatic compound is monofluorinated, trifluoromethylated, or perfluorinated.Attorney Docket No. 10046-646W01

[0290] Example 29: The method of any one of the examples herein, particularly Examples 1-28, further comprising: c) contacting the fluorinated aromatic compound with at least one additional enzyme, thereby generating one or more additional modifications.

[0291] Example 30: The method of any one of the examples herein, particularly Example 29, wherein the at least one additional enzyme is alcohol dehydrogenase (ADH), 4-coumaroyl-CoA ligase (4CL), 2-pyrone synthase (2PS), a ketoreductase, a transaminase, an esterase, an ene-reductase, an acylase, a metalloenzyme, or any combination thereof.

[0292] Example 31: The method of any one of the examples herein, particularly Example 30, wherein the at least one additional enzyme comprises any one of SEQ ID NOs: 5-7.

[0293] Example 32: A fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety) produced by the method of any one of claims 1-31.

[0294] Example 33: The fluorinated aromatic compound of any one of the examples herein, particularly Example 32, wherein the fluorinated aromatic compound comprises a compound of Formula IER2FFormula IIwherein: R1is substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; and R2, R3, R4, R\ and R6are each independently H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R\ or R5and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

[0295] Example 34: The fluorinated aromatic compound of any one of the examples herein, particularly Example 33, wherein R1is substituted or unsubstituted C1-C3 alkyl, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 carboxylic acid.

[0296] Example 35: The fluorinated aromatic compound of any one of the examples herein, particularly Example 34, wherein R1is methyl.Attorney Docket No. 10046-646W01

[0297] Example 36: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 33-35, wherein R4is hydrogen, halogen, substituted or unsubstituted C1-C3 acyl, or substituted or unsubstituted C1-C3 ester.

[0298] Example 37: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 33-35, wherein R3and R4. together with the atoms to which they are attached, form a 6-12 membered substituted or unsubstiluted aromatic moiety.

[0299] Example 38: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 33-37, wherein R2, R5, and R6are each hydrogen.

[0300] Example 39: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 32-38, wherein the fluorinated aromatic compound comprises an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

[0301] Example 40: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 32-39, wherein the fluorinated aromatic compound is monofluorinated, trifluoromethylated, or perfluorinated.

[0302] Example 41: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 32-40, wherein the fluorinated aromatic compound is (1-fluoroethyl)benzene, l-(4-(l-fluoroethyl)phenyl)ethan-l-one, 4-(l-fluoroethyl)phenyl acetate, 1 -chloro-4-( 1 -fluoroethyl)benzy ne, 1 -bromo-4-( 1 -fluoroethyl)benzy ne, 1 -iodo-4-( 1 -fluoroethyl)benzyne, 2-(l-fluoroethyl)naphthalene, 4-fluoro-4-phenylbutan-2-one, 3-fluoro-3-phenylpropanoic acid, 4-fluoro-4-phenylbutan-2-ol, 6-(2-fluoro-2-phenylethyl)-4-hydroxy-2H-pyran-2-one, or any derivatives or combinations thereof.

[0303] Example 42: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 32-41, wherein the fluorinated aromatic compound is a pharmaceutical or therapeutic agent.

[0304] Example 43: The fluorinated aromatic compound of any one of the examples herein, particularly Examples 32-42, wherein the fluorinated aromatic compound is an agrochemical.

[0305] Example 44: A biocatalyst comprising 80% similarity or more to SEQ ID NO: 2, wherein the biocatalyst comprises 121F and 244F relative to SEQ ID NO: 2 and at least one photosensitizer.

[0306] Example 45: The biocatalyst of any one of the examples herein, particularly Example 44, wherein the biocatalyst comprises 90% similarity or more to SEQ ID NO: 2.Attorney Docket No. 10046-646W01

[0307] Example 46: The biocatalyst of any one of the examples herein, particularly Examples 44-45, wherein the biocatalyst comprises SEQ ID NO: 2.

[0308] Example 47: The biocatalyst of any one of the examples herein, particularly Example 46, wherein the biocatalyst consists of SEQ ID NO: 2.

[0309] Example 48: The biocatalyst of any one of the examples herein, particularly Examples 44-47, wherein the at least one photosensitizer comprises a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof.

[0310] Example 49: The biocatalyst of any one of the examples herein, particularly Example 48, wherein the photoexcitable amino acid is p-benzoyl-L-phenylalanine (pBPA), and / or wherein the photoexcitable amino acid comprises at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.

[0311] The following patents, applications and publications as listed below and throughout this document arc hereby incorporated by reference in their entirety herein.Reference List for Examples 1-21. K. Muller, C. Faeh, F. Diederich, Science. 317, 1881-1886 (2007).2. M. Inoue, Y. Sumii, N. Shibata, ACS Omega. 5, 10633-10640 (2020).3. L. Yang, T. Dong, H. M. Revankar, C.-P. Zhang, Green Chem. 19, 3951-3992 (2017).4. J.-B. Xia, C. Zhu, C. Chen, J. Am. Chem. Soc. 135, 17494—17500 (2013).5. E. N. Kissman et al., Nature. 631, 37-48 (2024).6. C. Van Stappen et al., Chem. Rev. 122, 11974-12045 (2022).7. M. C. Walker, M. C. Y. Chang, Chem. Soc. Rev. 43, 6527-6536 (2014).8. D. O’Hagan, H. Deng, Chem. Rev. 115, 634-649 (2015).9. D. O’Hagan, et al., Nature. 416, 279-279 (2002).10. M. C. Walker et al., Science. 341, 1089-1094 (2013).11. S. Sirirungruang et al., Nat Chem Biol. 18, 886-893 (2022).12. A. Rittner et al., Nat. Chem. 14, 1000-1006 (2022).13. Q. Zhao et al., Nat. Synth, 1-9 (2024).14. L.-P. Zhao et al., Nat. Synth, 1-9 (2024).15. Megan A. Emmanuel, et al., Nature. 540, 414—417 (2016).16. K. F. Biegasiewicz et al., Science. 364, 1166-1169 (2019).17. X. Huang et al., Nature. 584, 69-74 (2020).18. M. A. Emmanuel et al., Chem. Rev. 123, 5459-5520 (2023).Attorney Docket No. 10046-646W0119. H. Fu, T. K. Hyster, Acc. Chem. Res. 57, 1446-1457 (2024).20. M. Li, Y. Yuan, W. Harrison, Z. Zhang, H. Zhao, Science. 385, 416-421 (2024). 21. Y. Xu et al., Nature. 625, 74-78 (2024).22. T.-C. Wang et al., Nature. 629, 98-104 (2024).23. Y. Ouyang, et al., J. Am. Chem. Soc. 146, 13754—13759 (2024).24. Y. Wang et al., J. Am. Chem. Soc. (2024), doi:10.1021 / jacs.4c05997.25. J. S. Trimble et al., Nature. 611, 709-714 (2022).26. N. Sun et al., Nature. 611, 715-720 (2022).27. Y. Fu et al., J. Am. Chem. Soc. 143, 617-622 (2021).28. J. Guo et al., J. Am. Chem. Soc. 146, 19030-19041 (2024).29. H. Cao, X. Tang, H. Tang, Y. Yuan, J. Wu, Chem Catalysis. 1, 523-598 (2021). 30. G. Dorman, G. D. Prestwich, Biochemistry. 33, 5661-5673 (1994).31. J. W. Chin, A. B. Martin, D. S. King, L. Wang, P. G. Schultz, Proceedings of the National Academy of Sciences. 99, 11020-11024 (2002).32. G. Roelfes, Acc. Chem. Res. 52, 545-556 (2019).33. O. F. Brandenberg, et aL, Current Opinion in Biotechnology. 47, 102-111 (2017). 34. D. S. Culbertson, J. S. Olson, Biochemistry. 49, 6052-6063 (2010).35. F.-L. Qing et al., CCS Chemistry. 4, 2518-2549 (2022).36. W. Liu et al., Science. 337, 1322-1325 (2012).37. W. Liu, J. T. Groves, Angewandte Chemie International Edition. 52, 6024-6027 (2013).38. S. Bloom et al., Org. Lett. 15, 1722-1724 (2013).39. D. Meyer, II. Jangra, F. Walther, II. Zipse, P. Renaud, Nat Commun. 9, 4888 (2018).40. F. J. Aguilar Troyano, et al., Asian Journal of Organic Chemistry. 9, 992-1007 (2020).41. C. G. Hatchard, C. A. Parker, Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences. 235, 518-536 (1956).42. M. A. Cismesia, T. P. Yoon, Chem. Sci. 6, 5426-5434 (2015).43. P. T. Nyffeler, et al., Angewandte Chemie International Edition. 44, 192-212 (2005).44. M. M. Musa, et al., J. Org. Chem. 72, 30-34 (2007).45. A. S. de Miranda, et al., Front. Catal. 2 (2022), doi: 10.3389 / fctls.2022.900554.46. Y. Zhou et al., Angewandte Chemie International Edition. 62, e202212440 (2023). 47. Y. Zhou et al., ChemBioChem. 25, e202300849 (2024).48. S. Bloom et al., Org. Lett. 15, 1722-1724 (2013).49. Q. Zhao et al., Nat. Synth, 1-9 (2024).Attorney Docket No. 10046-646W0150. C. G. Hatchard, C. A. Parker, Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences. 235, 518-536 (1956).51. M. A. Cismesia, T. P. Yoon, Chem. Sci. 6, 5426-5434 (2015).52. J.-B. Xia, C. Zhu, C. Chen, J. Am. Chem. Soc. 135, 17494-17500 (2013).53. A. S. de Miranda, et al., Front. Catal. 2 (2022), doi: 10.3389 / fctls.2022.900554.54. M. M. Musa, et al., J. Org. Chem. 72, 30-34 (2007).Reference List for Example 3(1) K. Muller et al., Science 2007, 317, 1881-1886.(2) M. Inoue et al., ACS Omega 2020, 5, 10633-10640.(3) E. N. Kissman et al., Nature 2024, 631, 37-48.(4) C. Van Stappen et al., Chem. Rev. 2022, 122, 11974-12045.(5) Y. Zhou et al., Trends in Biotechnology 2025, 43, 1094-1103.(6) M. Li et al., Science 2024, 385, 416-421.(7) C. Huang et al., Nat Commun 2025, 16, 5753.(8) D. Wu et al., J. Am. Chem. Soc. 2025, 147, 25508-25516.(9) X. Duan et al., Nat Commun 2025, 16, 1225.(10) A. Rentmeister et al., Nat Chem Biol 2009, 5, 26-28.(11) X. Huang et al., ACS Cent. Sci. 2019, 5, 270-276.(12) J. Zhang et al., J. Am. Chem. Soc. 2019, 141, 9798-9802.(13) L. Schaus et al., Angewandte Chemie International Edition 2023, 62, e202208936. (14) J. G. Zhang et al., J. Am. Chem. Soc. 2024, 146, 34878-34886.(15) J. G. Zhang, X. Huang, J. Am. Chem. Soc. 2025, 147, 29624-29630.(16) H. He et al., Angewandte Chemie International Edition 2025, 64, e202423507.(17) S. S. Neti et al., ACS Cent. Sci. 2023, 9, 905-914.(18) M. C. Walker et al., Science 2013, 341, 1089-1094.(19) S. Sirirungruang et al., Nat Chem Biol 2022, 18, 886-893.(20) A. Rittner et al, Nat. Chem. 2022, 14, 1000-1006.(21) J.-B. Xia et al., J. Am. Chem. Soc. 2013, 135, 17494-17500.(22) L. Yang et al., Green Chem. 2017, 19, 3951-3992.(23) D. O’Hagan et al., Nature 2002, 416, 279-279.(24) M. C. Walker, M. C. Y. Chang, Chem. Soc. Rev. 2014, 43, 6527-6536.(25) D. O’Hagan, H. Deng, Chem. Rev. 2015, 115, 634-649.(26) G. W. Gribble, Marine Drugs 2015, 13, 4044—4136.Attorney Docket No. 10046-646W01(27) Q. Zhao et al., Nat. Synth 2024, 1-9.(28) L.-P. Zhao et al., Nat. Synth 2024, 1-9.(29) C. Zhang et al., Science 2025, 389, eadx2935.(30) C. Zhang et al., Nat. Chem. 2025, 1-8.(31) Y.-C. Lu et al., J. Am. Chem. Soc. 2025, 147, 17804-17816.(32) M. A. Emmanuel et al., Nature 2016, 540, 414-417.(33) K. F. Biegasiewicz et al., Science 2019, 364, 1166-1169.(34) X. Huang et al., Nature 2020, 584, 69-74.(35) M. A. Emmanuel et al., Chem. Rev. 2023, 123, 5459-5520.(36) H. Fu, T. K. Hyster, Acc. Chem. Res. 2024, 57, 1446-1457.(37) Y. Xu et al., Nature 2024, 625, 74-78.(38) T.-C. Wang et al., Nature 2024, 629, 98-104.(39) Y. Ouyang et al., J. Am. Chem. Soc. 2024, 146, 13754—13759.(40) Y. Wang et al., J. Am. Chem. Soc. 2024, 146, 23321-23329.(41) Z. Xing et al., Nature 2024, 1-3.(42) J. S. Trimble et aL, Nature 2022, 611, 709-714.(43) N. Sun et al., Nature 2022, 611, 715-720.(44) Y. Fu et al., J. Am. Chem. Soc. 2021, 143, 617-622.(45) J. Guo et al., J. Am. Chem. Soc. 2024, 146, 19030-19041.(46) M. Li et al., J. Am. Chem. Soc. 2025, 147, 13190-13199.(47) R. Crawshaw et al., Nat. Chem. 2025, 17, 1083-1090.(48) K.-Y. Chen et al., Angewandte Chemie International Edition 2025, 64, e202419022. (49) X. Yang et al., Nat Catal 2025, 1-10.(50) H. Cao et al., Chem Catalysis 2021, 1, 523-598.(51) G. Dorman, G. D. Prestwich, Biochemistry 1994, 33, 5661-5673.(52) J. W. Chin et al., Proceedings of the National Academy of Sciences 2002, 99, 11020— 11024.(53) G. Roelfes, Acc. Chem. Res. 2019, 52, 545-556.(54) O. F. Brandenberg et al., Current Opinion in Biotechnology 2017, 47, 102-111.(55) F.-L. Qing et al., CCS Chemistry 2022, 4, 2518-2549.(56) W. Liu et al., Science 2012, 337, 1322-1325.(57) W. Liu, J. T. Groves, Angewandte Chemie International Edition 2013, 52, 6024-6027. (58) F. J. Aguilar Troyano et al., Asian Journal of Organic Chemistry 2020, 9, 992-1007. (59) N. A. Romero, D. A. Nicewicz, Chem. Rev. 2016, 116, 10075-10166.Attorney Docket No. 10046-646W01(60) C. G. Hatchard, C. A. Parker, Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences 1956, 235, 518-536.(61) M. A. Cismesia, T. P. Yoon, Chem. Sci. 2015, 6, 5426-5434.(62) P. T. Nyffeler et al., Angewandte Chemie International Edition 2005, 44, 192-212. (63) H. Hintz et al., Chem Catalysis 2023, 3, 100491.(64) S. Bloom el al., Org. Lett. 2013, 15, 1722-1724.(65) I. N.-M. Leibler et al., Nat Commun 2021, 12, 6950.(66) J.-B. Xia et al., Org. Chem. Front. 2014, 1, 468-472.(67) Musa et al., J. Org. Chem. 2007, 72, 30-34.(68) A. S. de Miranda et al., Front. Catal. 2022, 2, DOI 10.3389 / fctls.2022.900554.(69) Y. Zhou et al., Angewandte Chemie International Edition 2023, 62, e202212440. (70) Y. Zhou et al., ChemBioChem 2024, 25, e202300849.Attorney Docket No. 10046-646W01SEQUENCES SEQ ID NO: 1 (WT-InterFase) ATGGAGATCCCTGTCATTGAGCCTTTGTTTACCAAAGTGACCGAAGATATTCCTG GTGCTGCTGGTCCAGTGTTCGACAAGAATGGGGACTTTTATATTGTGGCTCCATA CGTGGAGGTAAACGGTAAACCAGCAGGTGAAATCTTGCGCATCGATTTGAAGAC AGGTAAGAAGACGGTCATCTGTAAGCCTGAAGTCAACGGCTATGGAGGCATACC AGCCGGGTGCCAGTGCGACCGTGACGCCAACCAGTTATTTGTAGCTGATGCACGT CTGGGCCTTCTTGTTGTGCAAACTGATGGGACATTTGAAGAAATTGCAAAAAAGG ACAGCGAGGGGCGTCGTATGCAGGGTTGCGCCTACTGCGCTTTTGATTATGAAGG AAACTTATGGATTACGGCCCCAGCGGGCGAGGTGGCCCCTGCCGATTTTACCATC TCGTTAGATGAAAAATTCGGGTCAATCTATTGTTTTACCACCGACGGGCAAATGA TCCAAGTGGATACCGCATTTCAGTAGCCAGCTGGTATTGCCGTGCGCCACATGAA CGACGGTCGCCCATATCAACTGATTGTGGCCGAGCAGCGGACTAAAAAGTTATG GTCCTATGACATTAAAGGACCGGCAAAAATTGAAAATAAGAAAGTGTGGGGGCA CATCCCGGGCACTCACGAGGGTGGAGCCTCGGGTATGGATTTCGACGAAGACAA CAAl rGlTAGl GCCAATTGGGGCTCCTCGCATATCGAAGTATTCGGCCCGGAT GGAGGTCAACCTAAGATGCGCATCCGCTGCCCGTTCGAAAAACCTTCTGCTTTAC ACTTTAAGCCACAGACAAAAACCATTTTCGTGACGGAGCACGAAAACAATGCAG TCTGGAAGTTCGAGTGGCAGCGCAATGGCAAAAAGCAGTATTGCGAAACTCTTA AGTTCGGCATCTTCGGATCGCTCGAGCACCACCACCACCACCACTGA(start / stop codons in bold, His-tag sequence underlined, unnatural amino acid location in bold underline)SEQ ID NO: 2 (InterFase 2) ATGGAGATCCCTGTCATTGAGCCTTTGTTTACCAAAGTGACCGAAGATATTCCTG GTGCTGCTGGTCCAGTGTTCGACAAGAATGGGGACTTTTATATTGTGGCTCCATA CGTGGAGGTAAACGGTAAACCAGCAGGTGAAATCTTGCGCATCGATTTGAAGAC AGGTAAGAAGACGGTCATCTGTAAGCCTGAAGTCAACGGCTATGGAGGCATACC AGCCGGGTGCCAGTGCGACCGTGACGCCAACCAGTTATTTGTAGCTGATGCACGT CTGGGCCTTCTTGTTGTGCAAACTGATGGGACATTTGAAGAAATTGCAAAAAAGG ACAGCGAGGGGCGTCGTATGCAGGGTTGCGCC7TCTGCGCTTTTGATTATGAAGG AAACTTATGGATTACGGCCCCAGCGGGCGAGGTGGCCCCTGCCGATTTTACCATC TCGTTAGATGAAAAATTCGGGTCAATCTATTGTTTTACCACCGACGGGCAAATGA TCCAAGTGGATACCGCATTTCAGTAGCCAGCTGGTATTGCCGTGCGCCACATGAAAttorney Docket No. 10046-646W01CGACGGTCGCCCATATCAACTGATTGTGGCCGAGCAGCGGACTAAAAAGTTATG GTCCTATGACATTAAAGGACCGGCAAAAATTGAAAATAAGAAAGTGTGGGGGCA CATCCCGGGCACTCACGAGGGTGGAGCCTCGGGTATGGATTTCGACGAAGACAA CAATTTGTTAGTTGCCAAT77CGGCTCCTCGCATATCGAAGTATTCGGCCCGGATG GAGGTCAACCTAAGATGCGCATCCGCTGCCCGTTCGAAAAACCTTCTGCTTTACA CTTTAAGCCACAGACAAAAACCATTTTCGTGACGGAGCACGAAAACAATGCAGT CTGGAAGTTCGAGTGGCAGCGCAATGGCAAAAAGCAGTATTGCGAAACTCTTAA GTTCGGCATCTTCGGATCGCTCGAGCACCACCACCACCACCACTGA(start / stop codons in bold, His-tag sequence underlined, unnatural amino acid location in bold underline, mutations in italic underline)SEQ ID NO: 3 (V15pBPA-LinrR) ATGGGTGCCGAAATCCCGAAAGAAATGCTGCGTGCTCAAACCAATTAGATCCTG CTGAATGTCCTGAAACAAGGCGATAACTATGTGTATGGCATTATCAAACAGGTG AAAGAAGCGAGCAACGGTGAAATGGAACTGAATGAAGCCACCCTGTATACGATT1TTGATCGTCTGGAACAGGACGGCATTATCAGCTC1TACTGGGGTGATGAAAGTC AAGGCGGTCGTCGCAAATATTACCGTCTGACCGAAATCGGCCATGAAAACATGC GCCTGGCGTTCGAATCCTGGAGTCGTGTGGACAAAATCATTGAAAATCTGGAAG CAAACAAAAAATCTGAAGCGATCAAATCTAGAGGTGGCAGCGGTGGCTGGAGCC ACCCGCAGTTCGAAAAATAA(start / stop codons in bold, Strep-tag sequence underlined, unnatural amino acid location in bold underline)SEQ ID NO: 4 (H64V / V68A / H93pPBA-Myoglobin) ATGGGCCATCATCATCATCATCACGAGAACCTGTACTTCCAGGGTGTTCTGTCTG AAGGTGAATGGCAGCTGGTTCTGCATGTTTGGGCTAAAGTTGAAGCTGACGTCGC TGGTCATGGTCAGGACATCTTGATTCGACTGTTCAAATCTCATCCGGAAACTCTG GAAAAATTCGATCGTTTCAAACATCTGAAAACTGAAGCTGAAATGAAAGCTTCT GAAGATCTGAAAAAAGTGGGTGTTACCGCGTTAACTGCCCTAGGTGCTATCCTTA AGAAAAAAGGGCATCATGAAGCTGAGCTCAAACCGCTTGCGCAATCGTAGGCTA CTAAACATAAGATCCCGATCAAATACCTGGAATTCATCTCTGAAGCGATCATCCA TGTTCTGCATTCTAGACATCCAGGTGACTTCGGTGCTGACGCTCAGGGTGCTATG AACAAAGCTCTCGAGCTGTTCCGTAAAGATATCGCTGCTAAGTACAAAGAACTG GGTTACCAGGGTTGAAttorney Docket No. 10046-646W01(start / stop codons in bold, His-tag sequence underlined, unnatural amino acid location in bold underline)SEQ ID NO: 5 (ADH-W100A) ATGAAGGGTTTTGCTATGCTGTCCATCGGCAAAGTGGGGTGGATTGAGAAAGAA AAACCAGCGCCGGGACCATTCGATGCAATTGTTCGCCCGTTAGCTGTTGCCCCCT GCACCAGTGATATCCACACTGTATTCGAGGGAGCCATTGGAGAGCGCCATAATA TGATTCTGGGACACGAAGCCGTCGGAGAAGTGGTAGAAGTCGGGTCAGAAGTGA AAGACTTCAAACCAGGGGACCGCGTAGTGGTACCAGCTATCACCCCCGATTGGC GTACTTCAGAAGTACAACGCGGTTACCACCAGCACAGTGGGGGCATGCTGGCCG GGGCCAAGTTTTCTAATGTCAAAGACGGGGTTTTTGGGGAATTTTTTCACGTAAA TGATGCGGACATGAACCTTGCTCACCTTCCAAAAGAAATTCCTTTGGAAGCTGCG GTTATGATCCCAGACATGATGACCACGGGGTTCCACGGTGCCGAACTTGCTGATA TCGAATTGGGTGCTACAGTAGCCGTCTTAGGGATCGGTCCGGTGGGGCTGATGGC GGTCGCAGGGGCTAAATTACGCGGGGCGGGCCGTATTATTGCAGTTGGCTCACG TCCGGTATGTGTCGATGCCGCTAAATACTACGGAGCAACTGATA1TGTAAACTAC AAAGACGGTCCCATCGAGTCTCAGATTATGAATTTAACAGAGGGGAAAGGCGTG GATGCTGCCATTATCGCGGGGGGTAACGCCGACATCATGGCAACGGCTGTGAAG ATTGTGAAACCAGGGGGGACGATTGCAAACGTAAATTACTTTGGGGAAGGTGAA GTTTTGCCAGTGCCCCGTCTTGAATGGGGATGTGGGATGGCGCACAAAACCATTA AGGGAGGCTTGTGTCCAGGAGGGCGCTTACGTATGGAGCGTCTGATTGACTTAGT GTTCTATAAGCGTGTCGATCCCTCCAAGCTGGTAACCCACGTATTCCGCGGGTTT GACAATATTGAGAAAGCGTTTATGTTAATGAAGGACAAGCCAAAAGACTTAATT AAACCCGTCGTTATTTTGGCGCACCACCACCACCACCACTGA(start / stop codons in bold, His-tag sequence underlined, mutations in italic underline)SEQ ID NO: 6 (2-pyrone synthase mutant) ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCGAGAACCTGTACTTC CAGGGTGGCAGCATGGGAAGTTATTCATCTGATGACGTAGAAGTGATTCGTGAG GCAGGCCGTGCTCAAGGCCTTGCCACGATCCTGGCAATTGGTACGGCGACCCCTC CCAACTGCGTGGCCCAGGCAGACTACGCGGACTATTACTTTCGTGTTACCAAATC CGAACACATGGTTGACCTGAAGGAGAAGTTCAAACGCATCTGTGAGAAGACCGC GATCAAAAAGCGTTATCTGGCCTTAACCGAGGACTACTTGCAAGAAAATCCGAC CATGTGCGAATTTATGGCACCGTCCCTGAATGCTAGACAAGATCTGGTGGTAACAAttorney Docket No. 10046-646W01GGAGTTCCCATGTTAGGGAAAGAGGCAGCTGTGAAGGCCATCGACGAATGGGGT TTGCCAAAAAGCAAAATCACGCACCTTATCTTTTGTACCACCGCGGGTGTTGATA TGCCGGGCGCGGATTATCAATTAGTCAAGCTCCTTGGCCTGTCCCCGAGCGTTAA GCGCTATATGTTGTACCAACAGGGGTGCGCCGCGGGTGGCACCGTTCTGCGTCTG GCGAAGGATCTGGCCGAGAACAACAAAGGTTCTCGTGTTTTGATCGTTTGCAGCG AGATCACTGCGGTGGGGTTCCATGGTCCGAATGAAAACCACTTGGACAGCCTGG TTGCGCAGGCACTGTTTGGCGATGGTGCAGCGGCGCTGATTGTGGGTAGCGGCCC TCATCTGGCGGTCGAGCGTCCGATTTTCGAGATCGTGAGTACCGACCAAACCATT CTGCCGGATACCGAAAAGGCGATGAAAGGCCACTTGAGAGAAGGTGGTTTGACC TTCCAGCTGCACCGTGACGTGCCGCTGATGGTGGCAAAGAACATTGAAAACGCT GCTGAAAAGGCGCTGTCTCCGCTGGGTATTACGGACTGGAATAGCGTGTTTTGGA TGGTTCACCCGGGTGGCCGTGCTATCCTGGACCAGGTAGAGCGCAAACTGAATCT GAAAGAAGATAAACTGCGCGCTAGCCGTCATGTTCTCTCCGAGTACGGCAACCT GTCGTCGGCATGCGTGTTGTTCATCATTGATGAAGTTAGAAAGCGTAGCATGGCG GAAGGCAAATCTACGACCGGTGAAGGCCTGGATTGTGGTGTCCTGTTCGGCTTTG GCCCAGGTATGACCGTGGAAACCGTTGTG1TGCGCTCCG1TCGTGTGACCGCTGC TGTGGCAAACGGTAACTGA(start / stop codons in bold, His-tag sequence underlined)SEQ ID NO: 7 (4-coumaroyl-CoA-ligase) ATGGAGGAGGATTACAAAATGGCGCCACAAGAACAAGCAGTTTCTCAGGTGATG GAGAAACAGAGCAACAACAACAACAGTGACGTCATTTTCCGATCAAAGTTACCG GATATTTACATCCCGAACCACCTATCTCTCCACGACTACATCTTCCAAAACATCT CCGAATTCGCCACTAAGCCTTGCCTAATCAACGGACCAACCGGCCACGTGTACAC TTACTCCGACGTCCACGTCATCTGCCGCCAAATCGCCGCCAATTTTGACAAACTC GGCGTTAACCAAAACGACGTCGTCATGCTCCTCCTCCCAAACTGTCCCGAATTCG TCCTCTCTTTCCTCGCCGCCTCCTTCCGCGGCGCAACCGCCACCGCCGCAAACCCT TTCTTCACTCCGGCGGAGATAGCTAAACAAGCCAAAGCCTCCAACACCAAACTC ATAATCACCGAAGCTCGTTACGTCGACAAAATCAAACCACTTCAAAACGACGAC GGAGTAGTCATCGTCTGCATCGACGACAACGAATCCGTGCCAATCCCTGAAGGC TGCCTCCGCTTCACCGAGTTGACTCAGTCGACAACCGAGGCATCAGAAGTCATCG ACTCGGTGGAGATTTCACCGGACGACGTGGTGGCACTACCTTACTCCTCTGGCAC GACGGGATTACCAAAAGGAGTGATGCTGACTCACAAGGGACTAGTCACGAGCGT TGCTCAGCAAGTCGACGGCGAGAACCCGAATCTTTATTTCCACAGCGATGACGTCAttorney Docket No. 10046-646W01ATACTCTGTGTTTTGCCCATGTTTCATATCTACGCTTTGAACTCGATCATGTTGTG TGGTCTTAGAGTTGGTGCGGCGATTCTGATAATGCCGAAGTTTGAGATCAATCTG CTATTGGAGCTGATCCAGAGGTGTAAAGTGACGGTGGCTCCGATGGTTCCGCCG ATTGTGTTGGCCATTGCGAAGTCTTCGGAGACGGAGAAGTATGATTTGAGCTCGA TAAGAGTGGTGAAATCTGGTGCTGCTCCTCTTGGTAAAGAACTTGAAGATGCCGT TAATGCCAAGTTTCCTAATGCCAAACTCGGTCAGGGATACGGAATGACGGAAGC AGGTCCAGTGCTAGCAATGTCGTTAGGTTTTGCAAAGGAACCTTTTCCGGTTAAG TCAGGAGCTTGTGGTACTGTTGTAAGAAATGCTGAGATGAAAATAGTTGATCCAG ACACCGGAGATTCTCTTTCGAGGAATCAACCCGGTGAGATTTGTATTCGTGGTCA CCAGATCATGAAAGGTTACCTCAACAATCCGGCAGCTACAGCAGAGACCATTGA TAAAGACGGTTGGCTTCATACTGGAGATATTGGATTGATCGATGACGATGACGA GCTTTTCATCGTTGATCGATTGAAAGAACTTATCAAGTATAAAGGTTTTCAGGTA GCTCCGGCTGAGCTAGAGGCTTTGCTCATCGGTCATCCTGACATTACTGATGTTG CTGTTGTCGCAATGAAAGAAGAAGCAGCTGGTGAAGTTCCTGTTGCATTTGTGGT GAAATCGAAGGATTCGGAGTTATCAGAAGATGATGTGAAGCAATTCGTGTCGAA ACAGGTTGTGTTTTACAAGAGAATCAACAAAGTGTTCTTCACTGAATCCATTCCT AAAGCTCCATCAGGGAAGATATTGAGGAAAGATCTGAGGGCAAAACTAGCAAAT GGATTGTGA(start / stop codons in bold)SEQ ID NO: 8 (W244A F)CAATGCGGGCTCCTCGCATATCGAAGTASEQ ID NO: 9 (W244A R)GCAACTAACAAATTGTTGTCTTCGTCGAAATCCSEQ ID NO: 10 (I146D F)CGATTCGTTAGATGAAAAATTCGGGTCSEQ ID NO: 11 (I146D R)GTAAAATCGGCAGGGGCSEQ ID NO: 12 (I146E F)CGAATCGTTAGATGAAAAATTCGGGTCAttorney Docket No. 10046-646W01SEQ ID NO: 13 (I146E R)GTAAAATCGGCAGGGGC SEQ ID NO: 14 (I146A F)CGCATCGTTAGATGAAAAATTCGGGTC SEQ ID NO: 15 (I146A R)GTAAAATCGGCAGGGGC SEQ ID NO: 16 (L148A F)GGCCGATGAAAAATTCGGGTCAATCT SEQ ID NO: 17 (L148A R)GAGATGGTAAAATCGGCA SEQ ID NO: 18 (Y37A F)AGCTGTGGAGGTAAACGGTAAAC SEQ ID NO: 19 (Y37A R)GGAGCCACAATATAAAAGTCC SEQ ID NO: 20 (H287A F)GGCTGAAAACAATGCAGTCTGGAAG SEQ ID NO: 21 (H287A R)TCCGTCACGAAAATGGTTTTT SEQ ID NO: 22 (Q195A F)GGCTCGGACTAAAAAGTTATGGTCC SEQ ID NO: 23 (Q195A R)TCGGCCACAATCAGTTGAttorney Docket No. 10046-646W01 SEQ ID NO: 24 (Y121A F)CGCGTGCGCTTTTGATTATGAAGGAAACTTATG SEQ ID NO: 25 (Y121A R)GCGCAACCCTGCATACGA SEQ ID NO: 26 (Y121F F)CTTCTGCGCTTTTGATTATGAAGGAAACTTATG SEQ ID NO: 27 (Y121L F)CCTGTGCGCTTTTGATTATGAAGGAAACTTATG SEQ ID NO: 28 (Y37D F)AGATGTGGAGGTAAACGGTAAAC SEQ ID NO: 29 (Y37D R)GGAGCCACAATATAAAAGTCC SEQ ID NO: 30 (Y37E F)AGAAGTGGAGGTAAACGGTAAAC SEQ ID NO: 31 (Y37F F)ATTCGTGGAGGTAAACGGTAAAC SEQ ID NO: 32 (W244F F)CAATTTCGGCTCCTCGCATATCGAAGTA SEQ ID NO: 33 (W244F R)GCAACTAACAAATTGTTGTCTTCGTCGAAATCC SEQ ID NO: 34 (S229A F)CGCAGGTATGGATTTCGACGAAGACAAC SEQ ID NO: 35 (S229A R)Attorney Docket No. 10046-646W01 GCTCCACCCTCGTGAGTG SEQ ID NO: 36 (Q195F F)GTTTCGGACTAAAAAGTTATGGTCC

Claims

Attorney Docket No. 10046-646W01CLAIMS1. A method of intermolecular C-H fluorination, the method comprising:a) contacting a compound of Formula I:R5Formula Iwith a fluorine donor in the presence of a biocatalyst and at least one photosensitizer, thereby forming a mixture;b) irradiating the mixture with electromagnetic radiation, thereby photoexciting the at least one photosensitizer, which initiates radical transformation, via hydrogen atom transfer, to thereby intermolecularly fluorinate the compound of Formula I to form a compound of Formula II:Formula IIwherein:R1is methyl, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-Ce alkenyl, substituted or unsubstituted C1-C.6 acyl, substituted or unsubstituted C1-C.6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4, R5, and R6are each independently H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C 1 -C<> ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R5, or R5and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.Attorney Docket No. 10046-646W012. The method of claim 1, wherein the biocatalyst comprises 80% similarity or more to any one of SEQ ID NOs: 1-4, and optionally, the biocatalyst comprises the photosensitizer.

3. The method of any one of claim 1 or 2, wherein the biocatalyst comprises one or more mutations to remove oxidizable amino acids near an active site of the biocatalyst.

4. The method of claim 3, wherein the biocatalyst comprises Y37F, Y121F, W244F, or any combination thereof relative to SEQ ID NO: 1.

5. The method of any one of claims 1 -4, wherein the at least one photosensitizer comprises a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof optionally wherein the photoexcitable amino acid is p-benzoyl-L-phenylalanine (pBPA), and / or wherein the photoexcitable amino acid comprises at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.

6. The method of any one of claims 1-5, wherein the biocatalyst has a total turnover number of 100 or more.

7. The method of any one of claims 1-6, wherein the aromatic compound comprises an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

8. The method of any one of claims 1-7, wherein the fluorine donor comprises Selectfluor, Selectfluor II, N-fluorobenzenesulfonimide (NFSI), l-fluoro-2,4,6-trimethylpyridinium tetrafluoroborate (NFTPT), potassium fluoride, Togni’s reagent, Togni’s reagent II, or any combination thereof.

9. The method of any one of claims 1 -8, wherein the mixture has pH of from 4 to 10 and / or the mixture has a temperature of from 4°C to 90°C, and / or the mixture comprises from 0% to 80% acetonitrile (MeCN).Attorney Docket No. 10046-646W0110. The method of any one of claims 1-9, wherein the electromagnetic radiation comprises ultraviolet light, optionally wherein the mixture receives a total irradiation of from 10 mW / cm2to 500 mW / cm2.

11. The method of any one of claims 1-10, further comprising:c) contacting the fluorinated aromatic compound with at least one additional enzyme, thereby generating one or more additional modifications.

12. The method of claim 11, wherein the at least one additional enzyme is alcohol dehydrogenase (ADH), 4-coumaroyl-CoA ligase (4CL), 2-pyrone synthase (2PS), a ketoreductase, a transaminase, an esterase, an ene-reductase, an acylase, a metalloenzyme, or any combination thereof.

13. The method of claim 12, wherein the at least one additional enzyme comprises any one of SEQ ID NOs: 5-7.

14. A fluorinated aromatic compound (e.g., a fluorinated compound comprising at least one aromatic moiety) produced by the method of any one of claims 1-13.

15. The fluorinated aromatic compound of claim 14, wherein the fluorinated aromatic compound comprises a compound of Formula II:R2FFormula IIwherein:R1is methyl, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C'e alkenyl, substituted or unsubstituted C1-C6 acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester; andR2, R3, R4,and R6are each independently H, OH, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted orAttorney Docket No. 10046-646W01unsubstituted Ci-C& acyl, substituted or unsubstituted C1-C6 carboxylic acid, substituted or unsubstituted C1-C6 aldehyde, or substituted or unsubstituted C1-C6 ester, or wherein, as valence permits, R2and R3, R3and R4, R4and R5, or R?and R6, together with the atoms to which they are attached, form a 3-12 membered substituted or unsubstituted cyclic or aromatic moiety.

16. The fluorinated aromatic compound of claim 15, wherein the fluorinated aromatic compound comprises an alkylbenzene moiety, a naphthalene moiety, a polyketide moiety, a chiral alcohol moiety, or any derivatives or combinations thereof.

17. The fluorinated compound of claim 15 or 16, wherein the fluorinated aromatic compound is (l-fluoroethyl)benzene, l-(4-(l-fluoroethyl)phenyl)ethan-l-one, 4-(l -fluoroethyl )phenyl acetate, l-chloro-4-(l-fluoroethyl)benzyne, l-bromo-4-(l-fluoroethyl)benzyne, l-iodo-4-(l-fluorocthyl)bcnzync, 2-(l-fluorocthyl)naphthalcnc, 4-fluoro-4-phcnylbutan-2-onc, 3-fluoro-3-phenylpropanoic acid, 4-fluoro-4-phenylbutan-2-ol, 6-(2-fluoro-2-phenylethyl)-4-hydroxy-2H-pyran-2-one, or any derivatives or combinations thereof.

18. The fluorinated aromatic compound of any one of claims 15-17, wherein the fluorinated aromatic compound is a pharmaceutical agent, therapeutic agent, or an agrochemical.

19. A biocatalyst comprising 80% or more similarity to SEQ ID NO: 2.

20. The biocatalyst of claim 19, wherein the at least one photosensitizer comprises a photoexcitable amino acid, an organic photosensitizer, an organometallic photosensitizer, a transition metal photosensitizer, or any combination thereof, optionally wherein the photoexcitable amino acid is p-benzoyl-L-phenylalanine (pBPA), and / or wherein the photoexcitable amino acid comprises at least one 9-fluoronone, thioxanthone, and / or xanthone side chain.