A recombinant escherichia coli, a method for constructing the same and a method for producing oxalate by metabolic engineering
By expressing plant-derived inositol-1-phosphate synthase and inositol oxidase genes in Escherichia coli, a recombinant strain was constructed, solving the problems of severe pollution and low efficiency in the production of gluconic acid in existing technologies, and realizing efficient and environmentally friendly production of gluconic acid.
Patent Information
- Application Number
- CN201710200371.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2017-03-30
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2037-03-30
AI Technical Summary
Existing methods for preparing gluconic acid suffer from severe pollution from chemical methods and a lack of efficient recombinant strains in microbial fermentation methods, making it difficult to achieve efficient and environmentally friendly production.
Recombinant strains were constructed by cloning and expressing plant-derived inositol-1-phosphate synthase gene Ino1, inositol oxidase gene MIOX, and aldehyde dehydrogenase gene Udh in Escherichia coli, which synthesize gluconic acid using glucose, glycerol, sucrose, or inositol as substrates.
This study achieved efficient production of gluconic acid in LB medium, which has the advantages of low culture cost, genetic stability, and rapid production, providing a new method for efficient biological production of gluconic acid.
Smart Images

Figure CN106929459B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of metabolic engineering, and particularly relates to a recombinant Escherichia coli, a construction method thereof and a method for producing glucaric acid through metabolic engineering. BACKGROUND
[0002] Glucuric acid (saccharic acid) is a compound containing 4 chiral carbon atoms, and usually exists in the form of chiral compound D-glucaric acid, which is spontaneously oxidized in aqueous solution to form mono-lactone D-glucaric acid-1,4-lactone and D-glucaric acid-3,6-lactone and a small amount of bis-lactone D-glucaric acid-1,4; 3,6-lactone.
[0003] Glucaric acid is a natural and non-toxic compound, and is produced in small amounts in mammals including humans and some plants such as tomatoes, grapefruits and the like. Glucaric acid has important biological functions, and is determined by the U.S. Department of Energy as "the most valuable biorefinery product". Like many nutrients, it can help and enhance immunity and body detoxification, thereby reducing human diseases. Studies have shown that glucaric acid has pharmacological effects, and it can specifically and strongly inhibit the activity of some enzymes related to the occurrence of cancer such as β-glucuronidase. It can also reduce cholesterol, and its calcium salt is also a food additive. Glucaric acid and its derivatives can significantly inhibit thrombin-induced arachidonic acid peroxidation, and can play an obvious anti-inflammatory role; glucaric acid and its derivatives affect the activation of platelets under oxidative stress conditions, and help prevent excessive platelet activation through antioxidant mechanisms, so glucaric acid and its derivatives can be the top health care products for preventing cardiovascular disease risk, and some fruits and vegetables contain a large amount of glucaric acid and its derivatives, which can be used as dietary to prevent cardiovascular disease risk.
[0004] Glucaric acid is non-toxic to the human body, its structure is similar to that of monosaccharide, it can enter the cell interior through the sugar transport system of the human body, and it can be rapidly absorbed by lesions and a small amount of ischemic tissues, so it can be used as an imaging agent in the research of myocardial infarction and tumors. In addition, glucaric acid can also be applied to the production of polymer monomers which are widely used in life and production, and these polymers can be hydrolyzed into small molecular monomers which can be absorbed and utilized by plants and microorganisms in nature, so it can be used as a raw material for synthesizing various high-efficiency and environmentally-friendly emerging biomass energy, and has great potential economic value.
[0005] Currently, the preparation method of glucaric acid is mainly chemical method, such as nitric acid oxidation method and TEMPO catalyzed oxidation method. The nitric acid oxidation method mainly oxidizes glucose into glucose and small molecule substances. This method produces many and complex by-products, and emits a large amount of harmful gases such as NO and NO2, which pollutes the environment, so it is gradually replaced by new methods. The TEMPO oxidation method refers to the method for synthesizing glucaric acid by using 2,2,6,6-tetramethyl-1-piperidine free radical (TEMPO) mediated electrochemical oxidation of glucose. Since it destroys the oxidizing reaction metal involved in the reaction and the reaction conditions are mild, it has selectivity to the product and can limit the production of non-recyclable by-products, and is easy to operate, so it is a commonly used method at present; but since the reaction temperature and pH value need to be controlled to achieve the best in the reaction process, and the expensive catalyst also needs to be improved.
[0006] For a long time, the microbial fermentation method is a commonly used method for realizing efficient and environmentally friendly production of organic acids. Compared with the chemical method, the microbial fermentation method has great improvement in raw material loss, product purity and other aspects, and becomes a better synthesis method. Glucaric acid is found in mammals as a metabolic end product, and in the body, at least 10 steps are required from glucose to glucaric acid. Prather et al. obtained inositol-1-phosphate synthase (Ino1) and inositol oxidase (MIOX) from Saccharomyces cerevisiae and mice, and aldehyde dehydrogenase (Udh) from Pseudomonas syringae, cloned them into Escherichia coli, and realized the biosynthesis of glucaric acid.
[0007] At present, there is no report on the fermentation production of glucaric acid by recombinant Escherichia coli with plant-derived inositol oxidase. The content of glucaric acid in plants is low, and it is difficult to extract, separate and purify. In view of this, the construction of plant-derived gene isomerization recombination in Escherichia coli in the present application provides a new method and idea for microbial fermentation production of glucaric acid. SUMMARY
[0008] The present application clones and expresses inositol-1-phosphate synthase gene (Ino1), inositol oxidase gene (MIOX) and aldehyde dehydrogenase gene (Udh) derived from Agrobacterium tumefaciens into Escherichia coli strain to construct a recombinant bacterium, which can synthesize glucaric acid with glucose, glycerol, sucrose or inositol as substrate.
[0009] The present application is realized by the following technical scheme.
[0010] A recombinant Escherichia coli, which simultaneously expresses inositol-1-phosphate synthase gene Ino1, inositol oxidase gene MIOX and aldehyde dehydrogenase gene Udh.
[0011] Preferably, the myo-inositol-1-phosphate synthase gene Ino1 is derived from any one of the following: Saccaromyces cerevisiae, Pichia pastoris, Solanaceae Lycopersicon 1706, Zea mays, Glycine max.
[0012] Further preferably, the myo-inositol-1-phosphate synthase gene Ino1, in an embodiment of the present application, is derived from Solanaceae Lycopersicon 1706.
[0013] Preferably, the myo-inositol oxidase gene MIOX is derived from any one of the following: Pichia pastoris GS115, Solanaceae Lycopersicon 1706, Zea mays, Glycine max.
[0014] Further preferably, the myo-inositol oxidase gene MIOX, in an embodiment of the present application, is derived from Solanaceae Lycopersicon 1706.
[0015] Preferably, the aldehyde dehydrogenase gene Udh is derived from Agrobacterium tumefaciens GV3103.
[0016] Preferably, the myo-inositol-1-phosphate synthase gene Ino1, the myo-inositol oxidase gene MIOX, and the aldehyde dehydrogenase gene Udh, in an embodiment of the present application, have the nucleotide sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively.
[0017] Preferably, the myo-inositol-1-phosphate synthase gene Ino1, the myo-inositol oxidase gene MIOX, and the aldehyde dehydrogenase gene Udh, in an embodiment of the present application, have the amino acid sequences shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively.
[0018] Preferably, the starting host strain of the recombinant Escherichia coli is Escherichia coli.
[0019] Preferably, the myo-inositol-1-phosphate synthase gene Ino1, the myo-inositol oxidase gene MIOX, and the aldehyde dehydrogenase gene Udh are expressed integrally.
[0020] The method for constructing the recombinant E. coli comprises the following steps:
[0021] (1) connecting the myo-inositol-1-phosphate synthase gene Ino1 and the myo-inositol oxidase gene MIOX to a binary expression vector to transform a host strain of E. coli to obtain a recombinant E. coli 1;
[0022] (2) connecting the aldehyde dehydrogenase gene Udh to an expression vector to transform the recombinant E. coli 1 obtained in step (1) to obtain a recombinant E. coli.
[0023] Preferably, the method specifically comprises the following steps:
[0024] (1) amplifying the MIOX gene and the Ino1 gene using the genome of Solanaceae Lycopersicon 1706 as a template, adding appropriate restriction enzyme sites, respectively, connecting the fragments to the binary expression vector pETDuet1, and transforming DH5α by chemical method to obtain the correct recombinant plasmid, which is named pETDuet1-Ino1-MIOX, and transforming the recombinant plasmid into the host strain E. coli BL21(DE3) to obtain E. coli BL21(DE3) / Ino1-MIOX;
[0025] (2) amplifying the Udh gene using the genome of Agrobacterium tumefaciens GV3103 as a template, connecting to pET28a, and transforming the expression host E. coli BL21(DE3) / Ino1-MIOX constructed in step (1) by chemical method to obtain the correct recombinant E. coli, which is named E. coli BL21(DE3) / Ino1-MIOX-Udh.
[0026] A method for producing glucaric acid by using the above-mentioned recombinant E. coli, which catalytically synthesizes glucaric acid from glucose, glycerol, sucrose or myo-inositol as a substrate.
[0027] Preferably, the method specifically comprises inoculating the seed liquid of the recombinant E. coli into a fermentation medium at an inoculation amount of 2%-5%, adding IPTG at a final concentration of 0.1-1 mM and 10 g / L glucose at OD600 of about 0.6, and culturing at 25-30°C, 160-200 rpm for 60-100 h.
[0028] Further preferably, the fermentation medium, in an embodiment of the present application, has glucose and / or myo-inositol as a carbon source.
[0029] Further preferably, the method, in one embodiment of the present application, is inoculating the seed culture solution into a 250ml flask containing 50ml fermentation medium at an inoculation amount of 2%, when the OD600 is about 0.6, adding IPTG at a final concentration of 0.1-1mM and glucose at 10g / L, the temperature is 30℃, the shaking speed is 180rpm, and the culture time is 100 hours.
[0030] Compared with the prior art, the present application has the following advantages:
[0031] (1) The present application provides a method for producing glucaric acid by recombinant Escherichia coli with key enzyme genes from isomerous plant sources. The recombinant Escherichia coli produces glucaric acid at 2.53g / L in LB medium, while no glucaric acid is detected in the control Escherichia coli BL21(DE3).
[0032] (2) The Ino1 gene and MIOX gene from tomato used in the present application have large differences in amino acid sequence compared with the reported MIOX from mouse, and there is no related report that the Ino1 gene and MIOX gene from tomato can convert glucose into aldehyde acid.
[0033] (3) The recombinant Escherichia coli of the present application for synthesizing glucaric acid also has many advantages such as low nutritional requirement during culture, fast production, low culture cost, genetic stability, and high expression level.
[0034] (4) The present application uses the strategy of metabolic engineering to modify microbial strains to synthesize the target product glucaric acid, which lays a solid foundation for the efficient production of glucaric acid by biological method. BRIEF DESCRIPTION OF DRAWINGS
[0035] Figure 1 Figure 2 is a curve graph of the amount of glucaric acid produced by recombinant Escherichia coli in a flask fermentation increasing with fermentation time;
[0036] Figure 2a Figure 4 is the HPLC spectrum of a glucaric acid standard;
[0037] Figure 2b Figure 5 is the HPLC spectrum of the fermentation broth of recombinant Escherichia coli. DETAILED DESCRIPTION
[0038] The specific embodiments of the present application are further described below in conjunction with examples and drawings, but the embodiments of the present application are not limited thereto. For process parameters not specifically described, conventional techniques can be referred to.
[0039] Detection of glucaric acid: Waser1525 (Binary HPLC Pump), 2414 time difference detector and 2487 ultraviolet detector. Preparation of glucaric acid standard sample: 50 mg of glucaric acid was accurately weighed and dissolved in 5 mM H2SO4, and the dissolved solution was transferred to a 10 ml volumetric flask for constant volume, with a concentration of 100 mg / L. Then 5 mM H2SO4 was used to dilute to 4 mg / ml, 3 mg / ml, 2 mg / ml, 1 mg / ml, respectively.
[0040] Sample preparation: 1 ml of fermentation broth was centrifuged at 12000 rpm for 5 min, and the supernatant was filtered through a 0.22 um filter membrane. The filtrate was analyzed by liquid chromatography.
[0041] Analysis conditions:
[0042] Mobile phase: 5 mM H2SO4, isocratic elution
[0043] Chromatographic column: HPX-87H
[0044] Detector: 2414 time difference detector and 2487 ultraviolet detector
[0045] Example 1 Construction of recombinant E. coli BL21(DE3) / Ino1-MIOX
[0046] The Ino1 gene and MIOX gene were amplified using the tomato (Solanaceae Lycopersicon 1706) genome as the template, and the Ino1-F (the sequence is shown in SEQ ID NO. 7) and Ino1-R (the sequence is shown in SEQ ID NO. 8) primers were used to amplify the Ino1 gene, and the MIOX-F (the sequence is shown in SEQ ID NO. 9) and MIOX-R (the sequence is shown in SEQ ID NO. 10) primers were used to amplify the MIOX gene. The obtained Ino1 gene and MIOX gene were double-digested through the enzyme digestion sites at both ends of the primers, and then ligated to the expression vector pETDuet1 (purchased from Novegen Company) with the corresponding cuts, and transformed into DH5α (purchased from Quanshijin Company). Under the premise of ensuring the correct reading frame, the recombinant expression plasmid pETDuet1-Ino1-MIOX was identified, and the sequence was correct after sequencing comparison. The recombinant plasmid was chemically transformed into the expression host E. coli BL21(DE3) (purchased from Quanshijin Company), and the recombinant clone was verified by PCR to be correct, and was named E. coli BL21(DE3) / Ino1-MIOX.
[0047] Example 2 Construction of recombinant E. coli BL21(DE3) / Ino1-MIOX-Udh
[0048] The Udh gene was amplified using the genome of Agrobacterium tumefaciens GV3103 as a template, and Udh-F (the sequence is shown in SEQ ID NO. 11) and Udh-R (the sequence is shown in SEQ ID NO. 12) as primers. The Udh gene was ligated to the expression vector pET28a (purchased from BioVector plasmid vector strain cell gene preservation center) with corresponding cuts through the double enzyme digestion sites on the primers, and transformed into E. coli DH5α (purchased from Quanshijin Company). The recombinant expression plasmid pET28a-Udh was identified under the premise of ensuring the correct reading frame, and the recombinant sequence was correct through DNA sequencing comparison. The recombinant plasmid was chemically transformed into the expression host E. coli BL21 (DE3) / Ino1-MIOX constructed in Example 1, and the correct recombinant E. coli was screened and named E. coli BL21 (DE3) / Ino1-MIOX-Udh.
[0049] Table 1 is the primer used in Examples 1 and 2.
[0050] Table 1
[0051] Primer Sequence Udh-F CGC AAGCTT ATGAAACGGCTTCTTGTTACC Udh-R CG CTCGAG CGGTGTCGTCTCGGTTATAT Ino1-F CG CGGATC CGATGTTTATTGAAAATTTTAAGGT Ino1-R GCG CTGCAG GATTTGTATTCCAAAATCATG]]> MIOX-F CG GATATC GATGACTATTCTCATTGAGCAGCCT MIOX-R CCG CTCGAG ACCACCTCAGCTTTGTTGGAAAAT
[0052] Example 3 Fermentation of recombinant E. coli to produce glucaric acid
[0053] The recombinant E. coli E. coli BL21 (DE3) / Ino1-MIOX-Udh was fermented and cultured. The single clone of recombinant E. coli E. coli BL21 (DE3) / Ino1-MIOX-Udh was inoculated into 25 ml of LB medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, pH 7) and cultured at 37°C and 180 rpm for 16 h. Then, it was inoculated into 50 ml (shake flask capacity is 500 ml) of fermentation medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of sodium chloride) at an inoculation amount of 2%, and fermented at 30°C and 180 rpm. When the OD600 was 0.6, the inducer IPTG was added to make the concentration 0.2 mM, and glucose was added to make the concentration 10 g / L. The culture was incubated for 100 hours. After the culture was completed, 1 ml of fermentation broth was centrifuged at 12000 rpm for 5 min, and the supernatant was filtered through a 0.22 um filter membrane. The product was detected by HPLC. Figure 2a The HPLC spectrum of the glucaric acid standard sample is shown in Figure 1. Figure 2b The HPLC spectrum of the fermentation broth of the recombinant E. coli is shown in Figure 2. As can be seen from the standard sample, the glucaric acid has a peak time of 10.058 min, and glucaric acid with the same peak time can be detected in the fermentation broth of the recombinant strain.
[0054] Figure 1 Figure 2 is a graph showing the amount of production of glucaric acid by recombinant E. coli shake flask fermentation over time; and Figure 1 As can be seen, as the shake flask fermentation time increases, the amount of glucose decreases and the amount of glucaric acid produced increases, reaching 2.53 g / L. SEQUENCE LISTING <110> South China University of Technology <120> A recombinant E. coli and a method for constructing the same and a method for producing glucaric acid by metabolic engineering <130> <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 1533 <212> PRT <213> Artificial Sequence <400> 1 Ala Thr Gly Thr Thr Thr Ala Thr Thr Gly Ala Ala Ala Ala Thr Thr 1 5 10 15 Thr Thr Ala Ala Gly Gly Thr Gly Gly Ala Ala Ala Gly Cys Cys Cys 20 25 30 Ala Ala Ala Thr Gly Thr Gly Ala Ala Gly Thr Ala Thr Ala Thr Thr 35 40 45 Gly Ala Gly Ala Ala Thr Gly Ala Ala Ala Thr Thr Cys Ala Thr Thr 50 55 60 Cys Thr Gly Thr Gly Thr Ala Thr Gly Ala Thr Thr Ala Thr Gly Ala 65 70 75 80 Ala Ala Cys Cys Ala Cys Ala Gly Ala Gly Cys Thr Thr Gly Thr Thr 85 90 95 Cys Ala Thr Gly Ala Ala Gly Ala Gly Ala Gly Ala Ala Ala Thr Gly 100 105 110 Gly Ala Ala Cys Thr Thr Ala Thr Cys Ala Ala Thr Gly Gly Ala Thr 115 120 125 Thr Gly Thr Thr Ala Ala Gly Cys Cys Thr Ala Ala Ala Ala Cys Thr 130 135 140 Gly Thr Cys Ala Ala Ala Thr Ala Thr Gly Ala Ala Thr Thr Thr Ala 145 150 155 160 Ala Ala Ala Cys Thr Gly Ala Thr Ala Cys Cys Cys Ala Thr Gly Thr 165 170 175 Gly Cys Cys Ala Ala Ala Ala Thr Thr Gly Gly Gly Gly Gly Thr Thr 180 185 190 Ala Thr Gly Cys Thr Thr Gly Thr Thr Gly Gly Ala Thr Gly Gly Gly 195 200 205 Gly Ala Gly Gly Ala Ala Ala Cys Ala Ala Thr Gly Gly Thr Thr Cys 210 215 220 Ala Ala Cys Ala Thr Thr Gly Ala Cys Thr Gly Gly Ala Gly Gly Thr 225 230 235 240 Gly Thr Thr Ala Thr Thr Gly Cys Gly Ala Ala Thr Cys Gly Ala Gly 245 250 255 Ala Ala Gly Gly Ala Ala Thr Thr Thr Cys Ala Thr Gly Gly Gly Cys 260 265 270 Ala Ala Cys Gly Ala Ala Ala Gly Ala Ala Ala Ala Ala Gly Thr Gly 275 280 285 Cys Ala Ala Cys Ala Ala Gly Cys Cys Ala Ala Thr Thr Ala Thr Thr 290 295 300 Thr Thr Gly Gly Gly Thr Cys Thr Cys Thr Thr Ala Cys Thr Cys Ala 305 310 315 320 Gly Gly Cys Ala Thr Cys Ala Ala Cys Cys Ala Thr Thr Cys Gly Ala 325 330 335 Gly Thr Thr Gly Gly Gly Thr Cys Thr Thr Thr Cys Ala Ala Thr Gly 340 345 350 Gly Cys Gly Ala Ala Gly Ala Gly Ala Thr Cys Thr Ala Thr Gly Cys 355 360 365 Ala Cys Cys Cys Thr Thr Cys Ala Ala Ala Ala Gly Cys Cys Thr Cys 370 375 380 Cys Thr Thr Cys Cys Cys Ala Thr Gly Gly Thr Cys Ala Ala Cys Cys 385 390 395 400 Thr Gly Gly Ala Gly Gly Ala Thr Gly Gly Gly Ala Cys Ala Thr Thr 405 410 415 Thr Gly Gly Ala Gly Gly Ala Thr Gly Gly Gly Ala Cys Ala Thr Thr 420 425 430 Ala Gly Cys Ala Ala Cys Ala Thr Gly Ala Ala Thr Thr Thr Gly Gly 435 440 445 Cys Ala Gly Ala Thr Gly Cys Thr Ala Thr Gly Gly Thr Cys Ala Gly 450 455 460 Gly Gly Cys Thr Ala Ala Gly Gly Thr Thr Thr Thr Cys Gly Ala Ala 465 470 475 480 Gly Thr Thr Gly Ala Thr Cys Thr Gly Cys Ala Ala Ala Ala Gly Cys 485 490 495 Ala Gly Cys Thr Gly Ala Gly Gly Cys Cys Cys Thr Ala Cys Ala Thr 500 505 510 Gly Gly Ala Ala Thr Cys Cys Ala Thr Gly Gly Thr Thr Cys Cys Cys 515 520 525 Cys Thr Thr Cys Cys Thr Gly Gly Thr Ala Thr Cys Thr Ala Thr Gly 530 535 540 Ala Cys Cys Cys Thr Gly Ala Cys Thr Thr Cys Ala Thr Thr Gly Cys 545 550 555 560 Gly Gly Cys Thr Ala Ala Cys Cys Ala Ala Gly Ala Ala Gly Cys Ala 565 570 575 Cys Gly Thr Gly Cys Cys Ala Ala Cys Ala Ala Cys Gly Thr Gly Ala 580 585 590 Thr Cys Ala Ala Ala Gly Gly Ala Ala Cys Cys Ala Ala Gly Ala Ala 595 600 605 Ala Gly Ala Ala Cys Ala Ala Gly Thr Thr Gly Ala Ala Cys Ala Ala 610 615 620 Ala Thr Thr Gly Thr Thr Ala Ala Ala Gly Ala Thr Ala Thr Thr Ala 625 630 635 640 Gly Gly Gly Ala Gly Thr Thr Cys Ala Ala Gly Gly Ala Gly Ala Ala 645 650 655 Gly Ala Ala Cys Ala Ala Gly Gly Thr Ala Gly Ala Cys Ala Ala Gly 660 665 670 Ala Thr Ala Gly Thr Gly Gly Thr Thr Cys Thr Ala Thr Gly Gly Ala 675 680 685 Cys Thr Gly Cys Cys Ala Ala Cys Ala Cys Cys Gly Ala Ala Ala Gly 690 695 700 Gly Thr Ala Cys Ala Gly Thr Ala Ala Thr Gly Thr Gly Gly Thr Thr 705 710 715 720 Gly Thr Thr Gly Gly Cys Cys Thr Thr Ala Ala Thr Gly Ala Cys Ala 725 730 735 Cys Cys Ala Thr Gly Gly Ala Ala Ala Ala Cys Cys Thr Thr Thr Thr 740 745 750 Ala Gly Cys Thr Gly Cys Thr Gly Thr Gly Gly Ala Thr Ala Gly Ala 755 760 765 Ala Ala Thr Gly Ala Gly Gly Cys Thr Gly Ala Ala Ala Thr Ala Thr 770 775 780 Cys Thr Cys Cys Thr Thr Cys Thr Ala Cys Ala Thr Thr Gly Cys Ala 785 790 795 800 Thr Gly Cys Thr Ala Thr Thr Gly Cys Thr Thr Gly Thr Ala Thr Thr 805 810 815 Ala Thr Gly Gly Ala Ala Ala Ala Thr Gly Thr Gly Cys Cys Thr Thr 820 825 830 Thr Cys Ala Thr Cys Ala Ala Cys Gly Gly Ala Ala Gly Cys Cys Cys 835 840 845 Thr Cys Ala Ala Ala Ala Cys Ala Cys Thr Thr Thr Thr Gly Thr Thr 850 855 860 Cys Cys Ala Gly Gly Thr Cys Thr Thr Ala Thr Thr Gly Ala Thr Thr 865 870 875 880 Thr Gly Gly Cys Cys Ala Thr Ala Ala Ala Gly Ala Gly Ala Ala Ala 885 890 895 Cys Ala Cys Thr Thr Thr Ala Ala Thr Thr Gly Gly Thr Gly Gly Thr 900 905 910 Gly Ala Thr Gly Ala Cys Thr Thr Thr Ala Ala Gly Ala Gly Thr Gly 915 920 925 Gly Thr Cys Ala Ala Ala Cys Cys Ala Ala Gly Ala Thr Gly Ala Ala 930 935 940 Gly Thr Cys Cys Gly Thr Gly Thr Thr Gly Gly Thr Thr Gly Ala Thr 945 950 955 960 Thr Thr Cys Cys Thr Thr Gly Thr Thr Gly Gly Ala Gly Cys Cys Gly 965 970 975 Gly Thr Ala Thr Thr Ala Ala Gly Cys Cys Ala Ala Cys Gly Thr Cys 980 985 990 Ala Ala Thr Ala Gly Thr Gly Ala Gly Cys Thr Ala Cys Ala Ala Thr 995 1000 1005 Cys Ala Cys Thr Thr Gly Gly Gly Thr Ala Ala Cys Ala Ala Thr 1010 1015 1020 Gly Ala Thr Gly Gly Ala Ala Thr Gly Ala Ala Thr Cys Thr Thr 1025 1030 1035 Thr Cys Thr Gly Cys Thr Cys Cys Thr Cys Ala Ala Ala Cys Cys 1040 1045 1050 Thr Thr Cys Cys Gly Gly Thr Cys Thr Ala Ala Gly Gly Ala Gly 1055 1060 1065 Ala Thr Cys Thr Cys Ala Ala Ala Ala Ala Gly Thr Ala Ala Thr 1070 1075 1080 Gly Thr Thr Gly Thr Thr Gly Ala Thr Gly Ala Cys Ala Thr Gly 1085 1090 1095 Gly Thr Thr Gly Cys Thr Ala Gly Cys Ala Ala Cys Gly Cys Cys 1100 1105 1110 Ala Thr Thr Cys Thr Cys Thr Ala Thr Gly Ala Ala Thr Cys Thr 1115 1120 1125 Gly Gly Cys Gly Ala Gly Cys Ala Cys Cys Cys Thr Gly Ala Cys 1130 1135 1140 Cys Ala Thr Gly Thr Thr Gly Thr Cys Gly Thr Gly Ala Thr Cys 1145 1150 1155 Ala Ala Gly Thr Ala Thr Gly Thr Thr Cys Cys Ala Thr Ala Thr 1160 1165 1170 Gly Thr Thr Gly Gly Ala Gly Ala Cys Ala Gly Cys Ala Ala Gly 1175 1180 1185 Ala Gly Gly Gly Cys Ala Ala Thr Gly Gly Ala Thr Gly Ala Gly 1190 1195 1200 Thr Ala Cys Ala Thr Gly Thr Cys Ala Gly Ala Gly Ala Thr Thr 1205 1210 1215 Thr Thr Cys Ala Thr Gly Gly Gly Cys Gly Gly Ala Ala Ala Gly 1220 1225 1230 Ala Gly Cys Ala Cys Thr Ala Thr Ala Gly Thr Thr Ala Thr Gly 1235 1240 1245 Cys Ala Cys Ala Ala Cys Ala Cys Thr Thr Gly Thr Gly Ala Gly 1250 1255 1260 Gly Ala Cys Thr Cys Thr Cys Thr Thr Thr Thr Gly Gly Cys Ala 1265 1270 1275 Gly Cys Thr Cys Cys Ala Ala Thr Thr Ala Thr Cys Thr Thr Gly 1280 1285 1290 Gly Ala Thr Thr Thr Gly Gly Thr Cys Cys Thr Thr Cys Thr Cys 1295 1300 1305 Gly Cys Thr Gly Ala Ala Cys Thr Cys Ala Gly Cys Ala Cys Thr 1310 1315 1320 Cys Ala Thr Thr Cys Ala Gly Cys Thr Cys Ala Ala Ala 1325 1330 1335 Gly Cys Thr Gly Ala Ala Gly Gly Gly Gly Ala Gly Gly Gly Gly 1340 1345 1350 Ala Ala Gly Thr Thr Cys Cys Ala Cys Thr Cys Cys Thr Thr Cys 1355 1360 1365 Cys Ala Cys Cys Cys Thr Gly Thr Gly Gly Cys Thr Ala Cys Thr 1370 1375 1380 Ala Thr Thr Cys Thr Cys Ala Gly Cys Thr Ala Cys Cys Thr Cys 1385 1390 1395 Ala Cys Cys Ala Ala Gly Gly Cys Thr Cys Cys Cys Cys Thr Gly 1400 1405 1410 Gly Thr Ala Cys Cys Ala Cys Cys Ala Gly Gly Thr Ala Cys Thr 1415 1420 1425 Cys Cys Ala Gly Thr Gly Gly Thr Gly Ala Ala Thr Gly Cys Cys 1430 1435 1440 Cys Thr Thr Thr Cys Ala Ala Ala Gly Cys Ala Gly Ala Gly Gly 1445 1450 1455 Gly Cys Ala Ala Thr Gly Cys Thr Thr Gly Ala Gly Ala Ala Thr 1460 1465 1470 Ala Thr Ala Ala Thr Gly Ala Gly Ala Gly Cys Thr Thr Gly Thr 1475 1480 1485 Gly Thr Thr Gly Gly Thr Thr Thr Gly Gly Cys Ala Cys Cys Ala 1490 1495 1500 Gly Ala Gly Ala Ala Cys Ala Ala Cys Ala Thr Gly Ala Thr Thr 1505 1510 1515 Thr Thr Gly Gly Ala Ala Thr Ala Cys Ala Ala Ala Thr Gly Ala 1520 1525 1530 <210> 2 <211> 954 <212> PRT <213> Artificial Sequence <400> 2 Ala Thr Gly Ala Cys Thr Ala Thr Thr Cys Thr Cys Ala Thr Thr Gly 1 5 10 15 Ala Gly Cys Ala Gly Cys Cys Thr Gly Ala Ala Thr Thr Thr Gly Gly 20 25 30 Ala Thr Cys Ala Cys Ala Ala Gly Thr Gly Gly Ala Gly Gly Ala Gly 35 40 45 Ala Ala Ala Ala Ala Ala Gly Thr Cys Thr Cys Ala Thr Thr Cys Ala 50 55 60 Ala Thr Gly Cys Cys Ala Ala Thr Gly Ala Ala Cys Thr Thr Ala Thr 65 70 75 80 Thr Thr Thr Gly Gly Ala Thr Gly Gly Thr Gly Gly Ala Thr Thr Thr 85 90 95 Ala Thr Gly Gly Thr Ala Cys Cys Ala Ala Ala Gly Ala Cys Ala Thr 100 105 110 Thr Gly Thr Cys Thr Thr Cys Thr Cys Ala Ala Gly Ala Thr Gly Ala 115 120 125 Ala Ala Thr Ala Thr Thr Thr Gly Ala Ala Gly Thr Gly Cys Cys Ala 130 135 140 Gly Ala Cys Ala Thr Ala Ala Ala Thr Gly Cys Ala Thr Thr Thr Gly 145 150 155 160 Gly Thr Cys Ala Ala Thr Cys Ala Thr Thr Thr Ala Gly Gly Gly Ala 165 170 175 Thr Thr Ala Thr Ala Ala Thr Gly Thr Ala Gly Ala Ala Ala Gly Thr 180 185 190 Gly Ala Gly Ala Gly Ala Cys Ala Ala Ala Ala Ala Thr Cys Ala Gly 195 200 205 Thr Gly Gly Ala Ala Gly Ala Ala Thr Thr Thr Thr Ala Thr Ala Gly 210 215 220 Gly Gly Thr Thr Cys Ala Ala Cys Ala Cys Ala Thr Thr Ala Ala Thr 225 230 235 240 Cys Ala Ala Ala Cys Ala Thr Ala Thr Gly Ala Cys Thr Ala Thr Gly 245 250 255 Thr Gly Ala Ala Ala Ala Ala Ala Ala Thr Gly Ala Gly Ala Ala Ala 260 265 270 Ala Gly Ala Ala Thr Ala Thr Gly Gly Ala Ala Ala Ala Thr Thr Gly 275 280 285 Ala Ala Cys Ala Ala Ala Ala Thr Thr Gly Ala Ala Ala Thr Gly Ala 290 295 300 Gly Thr Ala Thr Thr Thr Gly Gly Gly Ala Thr Thr Gly Thr Thr Gly 305 310 315 320 Thr Gly Ala Ala Cys Thr Thr Thr Thr Gly Ala Ala Thr Gly Ala Thr 325 330 335 Gly Thr Ala Gly Thr Thr Gly Ala Thr Gly Ala Thr Ala Gly Thr Gly 340 345 350 Ala Thr Cys Cys Thr Gly Ala Thr Thr Thr Gly Gly Ala Thr Gly Ala 355 360 365 Ala Cys Cys Ala Cys Ala Ala Ala Thr Thr Gly Ala Gly Cys Ala Thr 370 375 380 Thr Thr Gly Thr Thr Ala Cys Ala Ala Ala Cys Thr Gly Cys Thr Gly 385 390 395 400 Ala Ala Gly Cys Thr Ala Thr Thr Ala Gly Ala Ala Ala Ala Gly Ala 405 410 415 Thr Thr Ala Thr Cys Cys Ala Ala Ala Thr Gly Ala Ala Gly Ala Thr 420 425 430 Thr Gly Gly Cys Thr Thr Cys Ala Thr Thr Thr Gly Ala Cys Cys Gly 435 440 445 Gly Cys Cys Thr Cys Ala Thr Thr Cys Ala Cys Gly Ala Cys Cys Thr 450 455 460 Ala Gly Gly Thr Ala Ala Ala Gly Thr Ala Cys Thr Thr Cys Thr Thr 465 470 475 480 Cys Ala Thr Cys Cys Ala Ala Gly Thr Thr Thr Thr Gly Gly Ala Gly 485 490 495 Gly Gly Cys Thr Thr Cys Cys Thr Cys Ala Ala Thr Gly Gly Gly Cys 500 505 510 Thr Gly Thr Thr Gly Thr Thr Gly Gly Ala Gly Ala Cys Ala Cys Ala 515 520 525 Thr Thr Thr Cys Cys Thr Cys Thr Thr Gly Gly Thr Thr Gly Thr Gly 530 535 540 Cys Thr Thr Thr Thr Gly Ala Thr Gly Ala Ala Thr Cys Ala Ala Thr 545 550 555 560 Thr Gly Thr Thr Cys Ala Cys Cys Ala Cys Ala Ala Gly Thr Ala Thr 565 570 575 Thr Thr Thr Ala Ala Gly Gly Ala Ala Ala Ala Thr Cys Cys Ala Gly 580 585 590 Ala Cys Ala Thr Cys Ala Ala Cys Ala Ala Cys Ala Ala Thr Ala Thr 595 600 605 Thr Thr Ala Thr Ala Ala Thr Ala Cys Ala Ala Ala Ala Ala Ala Thr 610 615 620 Gly Gly Thr Gly Thr Ala Thr Ala Thr Gly Ala Ala Gly Ala Ala Gly 625 630 635 640 Gly Thr Thr Gly Thr Gly Gly Ala Cys Thr Thr Gly Ala Cys Ala Ala 645 650 655 Ala Gly Thr Thr Gly Thr Thr Ala Thr Gly Thr Cys Ala Thr Gly Gly 660 665 670 Gly Gly Ala Cys Ala Thr Gly Ala Thr Gly Ala Thr Thr Ala Thr Ala 675 680 685 Thr Gly Thr Ala Thr Thr Thr Ala Ala Thr Thr Gly Cys Ala Ala Ala 690 695 700 Gly Gly Ala Ala Ala Ala Thr Ala Ala Ala Ala Cys Thr Ala Cys Thr 705 710 715 720 Cys Thr Thr Cys Cys Thr Thr Cys Thr Gly Cys Thr Gly Cys Thr Thr 725 730 735 Thr Ala Thr Thr Thr Gly Thr Cys Ala Thr Ala Cys Gly Thr Thr Ala 740 745 750 Cys Cys Ala Cys Thr Cys Thr Thr Thr Cys Thr Ala Thr Gly Cys Ala 755 760 765 Thr Thr Ala Cys Ala Thr Ala Gly Ala Thr Cys Ala Gly Gly Ala Gly 770 775 780 Cys Ala Thr Ala Thr Ala Cys Ala Cys Ala Cys Thr Thr Gly Ala Thr 785 790 795 800 Gly Ala Ala Thr Gly Ala Gly Gly Ala Gly Gly Ala Cys Ala Ala Ala 805 810 815 Gly Ala Gly Ala Ala Cys Ala Thr Gly Ala Ala Gly Thr Gly Gly Cys 820 825 830 Thr Cys Ala Ala Cys Ala Thr Thr Thr Thr Thr Ala Ala Thr Ala Ala 835 840 845 Ala Thr Ala Thr Gly Ala Thr Thr Thr Ala Thr Ala Thr Ala Gly Cys 850 855 860 Ala Ala Gly Ala Gly Thr Ala Ala Ala Gly Thr Thr Cys Gly Ala Ala 865 870 875 880 Thr Thr Gly Ala Thr Gly Thr Gly Gly Ala Ala Ala Ala Ala Gly Thr 885 890 895 Cys Ala Ala Gly Cys Cys Ala Thr Ala Cys Thr Ala Thr Cys Thr Cys 900 905 910 Thr Cys Thr Cys Thr Thr Ala Thr Cys Gly Ala Ala Ala Ala Gly Thr 915 920 925 Ala Thr Thr Thr Thr Cys Cys Ala Ala Cys Ala Ala Ala Gly Cys Thr 930 935 940 Gly Ala Gly Gly Thr Gly Gly Thr Ala Ala 945 950 <210> 3 <211> 798 <212> PRT <213> Artificial Sequence <400> 3 Ala Thr Gly Ala Ala Ala Cys Gly Gly Cys Thr Thr Cys Thr Thr Gly 1 5 10 15 Thr Thr Ala Cys Cys Gly Gly Thr Gly Cys Gly Gly Cys Gly Gly Gly 20 25 30 Cys Cys Ala Gly Cys Thr Thr Gly Gly Cys Cys Gly Cys Gly Thr Cys 35 40 45 Ala Thr Gly Cys Gly Cys Gly Ala Gly Cys Gly Thr Cys Thr Cys Gly 50 55 60 Cys Ala Cys Cys Gly Ala Thr Gly Gly Cys Gly Gly Ala Gly Ala Thr 65 70 75 80 Ala Cys Thr Gly Cys Gly Cys Cys Thr Thr Gly Cys Cys Gly Ala Thr 85 90 95 Cys Thr Cys Thr Cys Cys Cys Cys Gly Cys Thr Cys Gly Ala Cys Cys 100 105 110 Cys Gly Gly Cys Ala Gly Gly Gly Cys Cys Gly Ala Ala Cys Gly Ala 115 120 125 Ala Gly Ala Ala Thr Gly Cys Gly Thr Gly Cys Ala Ala Thr Gly Cys 130 135 140 Gly Ala Cys Cys Thr Thr Gly Cys Cys Gly Ala Thr Gly Cys Cys Ala 145 150 155 160 Ala Thr Gly Cys Cys Gly Thr Gly Ala Ala Thr Gly Cys Cys Ala Thr 165 170 175 Gly Gly Thr Cys Gly Cys Cys Gly Gly Thr Thr Gly Cys Gly Ala Cys 180 185 190 Gly Gly Thr Ala Thr Thr Gly Thr Thr Cys Ala Thr Cys Thr Cys Gly 195 200 205 Gly Cys Gly Gly Cys Ala Thr Cys Thr Cys Gly Gly Thr Gly Gly Ala 210 215 220 Gly Ala Ala Gly Cys Cys Cys Thr Thr Cys Gly Ala Ala Cys Ala Ala 225 230 235 240 Ala Thr Cys Cys Thr Thr Cys Ala Gly Gly Gly Cys Ala Ala Thr Ala 245 250 255 Thr Cys Ala Thr Cys Gly Gly Gly Cys Thr Thr Cys Ala Thr Ala Ala 260 265 270 Thr Cys Thr Cys Thr Ala Cys Gly Ala Gly Gly Cys Cys Gly Cys Cys 275 280 285 Cys Gly Cys Gly Cys Cys Cys Ala Thr Gly Gly Ala Cys Ala Gly Cys 290 295 300 Cys Ala Cys Gly Cys Ala Thr Cys Gly Thr Cys Thr Thr Thr Gly Cys 305 310 315 320 Cys Ala Gly Cys Thr Cys Cys Ala Ala Cys Cys Ala Cys Ala Cys Gly 325 330 335 Ala Thr Cys Gly Gly Cys Thr Ala Thr Thr Ala Thr Cys Cys Gly Cys 340 345 350 Ala Gly Ala Cys Cys Gly Ala Ala Cys Gly Gly Cys Thr Cys Gly Gly 355 360 365 Thr Cys Cys Gly Gly Ala Thr Gly Thr Thr Cys Cys Gly Gly Cys Gly 370 375 380 Cys Gly Gly Cys Cys Gly Gly Ala Cys Gly Gly Thr Cys Thr Thr Thr 385 390 395 400 Ala Cys Gly Gly Cys Gly Thr Cys Thr Cys Cys Ala Ala Ala Thr Gly 405 410 415 Thr Thr Thr Cys Gly Gly Cys Gly Ala Ala Ala Ala Cys Cys Thr Cys 420 425 430 Gly Cys Cys Cys Gly Cys Ala Thr Gly Thr Ala Thr Thr Thr Cys Gly 435 440 445 Ala Thr Ala Ala Ala Thr Thr Cys Gly Gly Gly Cys Ala Gly Gly Ala 450 455 460 Gly Ala Cys Gly Gly Cys Gly Cys Thr Gly Gly Thr Gly Cys Gly Cys 465 470 475 480 Ala Thr Cys Gly Gly Cys Thr Cys Cys Thr Gly Thr Ala Cys Gly Cys 485 490 495 Cys Gly Gly Ala Ala Cys Cys Cys Ala Ala Cys Ala Ala Thr Thr Ala 500 505 510 Cys Cys Gly Cys Ala Thr Gly Cys Thr Gly Thr Cys Cys Ala Cys Cys 515 520 525 Thr Gly Gly Thr Thr Thr Thr Cys Gly Cys Ala Cys Gly Ala Thr Gly 530 535 540 Ala Thr Thr Thr Cys Gly Thr Gly Thr Cys Gly Cys Thr Gly Ala Thr 545 550 555 560 Cys Gly Ala Gly Gly Cys Gly Gly Thr Gly Thr Thr Thr Cys Gly Cys 565 570 575 Gly Cys Gly Cys Cys Gly Gly Thr Gly Cys Thr Cys Gly Gly Cys Thr 580 585 590 Gly Cys Cys Cys Gly Gly Thr Cys Gly Thr Cys Thr Gly Gly Gly Gly 595 600 605 Gly Gly Cys Ala Thr Cys Gly Gly Cys Cys Ala Ala Thr Gly Ala Thr 610 615 620 Gly Cys Gly Gly Gly Cys Thr Gly Gly Thr Gly Gly Gly Ala Cys Ala 625 630 635 640 Ala Thr Thr Cys Gly Cys Ala Thr Cys Thr Thr Gly Gly Cys Thr Thr 645 650 655 Thr Cys Thr Gly Gly Gly Cys Thr Gly Gly Ala Ala Ala Cys Cys Gly 660 665 670 Gly Ala Gly Gly Ala Thr Ala Ala Thr Gly Cys Cys Gly Ala Gly Gly 675 680 685 Cys Cys Thr Thr Cys Cys Gly Gly Cys Gly Gly Cys Ala Thr Ala Thr 690 695 700 Ala Ala Cys Cys Gly Ala Gly Ala Cys Gly Ala Cys Ala Cys Cys Gly 705 710 715 720 Cys Cys Ala Cys Cys Gly Gly Ala Cys Cys Cys Gly Ala Ala Thr Gly 725 730 735 Ala Cys Gly Cys Gly Thr Thr Gly Gly Thr Gly Cys Gly Gly Thr Thr 740 745 750 Cys Cys Ala Gly Gly Gly Cys Gly Gly Thr Ala Cys Gly Thr Thr Thr 755 760 765 Gly Thr Cys Gly Ala Cys Ala Ala Cys Cys Cys Gly Ala Thr Cys Thr 770 775 780 Thr Cys Ala Ala Ala Cys Ala Gly Ala Gly Cys Thr Gly Ala 785 790 795 <210> 4 <211> 510 <212> PRT <213> Artificial Sequence <400> 4 Met Phe Ile Glu Asn Phe Lys Val Glu Ser Pro Asn Val Lys Tyr Ile 1 5 10 15 Glu Asn Glu Ile His Ser Val Tyr Asp Tyr Glu Thr Thr Glu Leu Val 20 25 30 His Glu Glu Arg Asn Gly Thr Tyr Gln Trp Ile Val Lys Pro Lys Thr 35 40 45 Val Lys Tyr Glu Phe Lys Thr Asp Thr His Val Pro Lys Leu Gly Val 50 55 60 Met Leu Val Gly Trp Gly Gly Asn Asn Gly Ser Thr Leu Thr Gly Gly 65 70 75 80 Val Ile Ala Asn Arg Glu Gly Ile Ser Trp Ala Thr Lys Glu Lys Val 85 90 95 Gln Gln Ala Asn Tyr Phe Gly Ser Leu Thr Gln Ala Ser Thr Ile Arg 100 105 110 Val Gly Ser Phe Asn Gly Glu Glu Ile Tyr Ala Pro Phe Lys Ser Leu 115 120 125 Leu Pro Met Val Asn Pro Asp Asp Val Val Phe Gly Gly Trp Asp Ile 130 135 140 Ser Asn Met Asn Leu Ala Asp Ala Met Val Arg Ala Lys Val Phe Glu 145 150 155 160 Val Asp Leu Gln Lys Gln Leu Arg Pro Tyr Met Glu Ser Met Val Pro 165 170 175 Leu Pro Gly Ile Tyr Asp Pro Asp Phe Ile Ala Ala Asn Gln Glu Ala 180 185 190 Arg Ala Asn Asn Val Ile Lys Gly Thr Lys Lys Glu Gin Val Glu Gin 195 200 205 Ile Val Lys Asp Ile Arg Glu Phe Lys Glu Lys Asn Lys Val Asp Lys 210 215 220 Ile Val Val Leu Trp Thr Ala Asn Thr Glu Arg Tyr Ser Asn Val Val 225 230 235 240 Val Gly Leu Asn Asp Thr Met Glu Asn Leu Leu Ala Ala Val Asp Arg 245 250 255 Asn Glu Ala Glu Ile Ser Pro Ser Thr Leu His Ala Ile Ala Cys Ile 260 265 270 Met Glu Asn Val Pro Phe Ile Asn Gly Ser Pro Gin Asn Thr Phe Val 275 280 285 Pro Gly Leu Ile Asp Leu Ala Ile Lys Arg Asn Thr Leu Ile Gly Gly 290 295 300 Asp Asp Phe Lys Ser Gly Gin Thr Lys Met Lys Ser Val Leu Val Asp 305 310 315 320 Phe Leu Val Gly Ala Gly Ile Lys Pro Thr Ser Ile Val Ser Tyr Asn 325 330 335 His Leu Gly Asn Asn Asp Gly Met Asn Leu Ser Ala Pro Gin Thr Phe 340 345 350 Arg Ser Lys Glu lie Ser Lys Ser Asn Val Val Asp Asp Met Val Ala 355 360 365 Ser Asn Ala lie Leu Tyr Glu Ser Gly Glu His Pro Asp His Val Val 370 375 380 Val lie Lys Tyr Val Pro Tyr Val Gly Asp Ser Lys Arg Ala Met Asp 385 390 395 400 Glu Tyr Met Ser Glu lie Phe Met Gly Gly Lys Ser Thr lie Val Met 405 410 415 His Asn Thr Cys Glu Asp Ser Leu Leu Ala Ala Pro lie lie Leu Asp 420 425 430 Leu Val Leu Leu Ala Glu Leu Ser Thr Arg lie Gin Leu Lys Ala Glu 435 440 445 Gly Glu Gly Lys Phe His Ser Phe His Pro Val Ala Thr lie Leu Ser 450 455 460 Tyr Leu Thr Lys Ala Pro Leu Val Pro Pro Gly Thr Pro Val Val Asn 465 470 475 480 Ala Leu Ser Lys Gin Arg Ala Met Leu Glu Asn lie Met Arg Ala Cys 485 490 495 Val Gly Leu Ala Pro Glu Asn Asn Met lie Leu Glu Tyr Lys 500 505 510 <210> 5 <211> 317 <212> PRT <213> Artificial sequence <400> 5 Met Thr Ile Leu Ile Glu Gln Pro Glu Phe Gly Ser Gln Val Glu Glu 1 5 10 15 Lys Lys Val Ser Phe Asn Ala Asn Glu Leu Ile Leu Asp Gly Gly Phe 20 25 30 Met Val Pro Lys Thr Leu Ser Ser Gln Asp Glu Ile Phe Glu Val Pro 35 40 45 Asp Ile Asn Ala Phe Gly Gln Ser Phe Arg Asp Tyr Asn Val Glu Ser 50 55 60 Glu Arg Gln Lys Ser Val Glu Glu Phe Tyr Arg Val Gln His Ile Asn 65 70 75 80 Gln Thr Tyr Asp Tyr Val Lys Lys Met Arg Lys Glu Tyr Gly Lys Leu 85 90 95 Asn Lys Ile Glu Met Ser Ile Trp Asp Cys Cys Glu Leu Leu Asn Asp 100 105 110 Val Val Asp Asp Ser Asp Pro Asp Leu Asp Glu Pro Gln Ile Glu His 115 120 125 Leu Leu Gln Thr Ala Glu Ala Ile Arg Lys Asp Tyr Pro Asn Glu Asp 130 135 140 Trp Leu His Leu Thr Gly Leu Ile His Asp Leu Gly Lys Val Leu Leu 145 150 155 160 His Pro Ser Phe Gly Gly Leu Pro Gln Trp Ala Val Val Gly Asp Thr 165 170 175 Phe Pro Leu Gly Cys Ala Phe Asp Glu Ser Ile Val His His Lys Tyr 180 185 190 Phe Lys Glu Asn Pro Asp Ile Asn Asn Asn Ile Tyr Asn Thr Lys Asn 195 200 205 Gly Val Tyr Glu Glu Gly Cys Gly Leu Asp Lys Val Val Met Ser Trp 210 215 220 Gly His Asp Asp Tyr Met Tyr Leu Ile Ala Lys Glu Asn Lys Thr Thr 225 230 235 240 Leu Pro Ser Ala Ala Leu Phe Val Ile Arg Tyr His Ser Phe Tyr Ala 245 250 255 Leu His Arg Ser Gly Ala Tyr Thr His Leu Met Asn Glu Glu Asp Lys 260 265 270 Glu Asn Met Lys Trp Leu Asn Ile Phe Asn Lys Tyr Asp Leu Tyr Ser 275 280 285 Lys Ser Lys Val Arg lie Asp Val Glu Lys Val Lys Pro Tyr Tyr Leu 290 295 300 Ser Leu lie Glu Lys Tyr Phe Pro Thr Lys Leu Arg Trp 305 310 315 <210> 6 <211> 265 <212> PRT <213> Artificial Sequence <400> 6 Met Lys Arg Leu Leu Val Thr Gly Ala Ala Gly Gin Leu Gly Arg Val 1 5 10 15 Met Arg Glu Arg Leu Ala Pro Met Ala Glu lie Leu Arg Leu Ala Asp 20 25 30 Leu Ser Pro Leu Asp Pro Ala Gly Pro Asn Glu Glu Cys Val Gin Cys 35 40 45 Asp Leu Ala Asp Ala Asn Ala Val Asn Ala Met Val Ala Gly Cys Asp 50 55 60 Gly lie Val His Leu Gly Gly lie Ser Val Glu Lys Pro Phe Glu Gin 65 70 75 80 lie Leu Gin Gly Asn lie lie Gly Leu His Asn Leu Tyr Glu Ala Ala 85 90 95 Arg Ala His Gly Gin Pro Arg lie Val Phe Ala Ser Ser Asn His Thr 100 105 110 Ile Gly Tyr Tyr Pro Gin Thr Glu Arg Leu Gly Pro Asp Val Pro Ala 115 120 125 Arg Pro Asp Gly Leu Tyr Gly Val Ser Lys Cys Phe Gly Glu Asn Leu 130 135 140 Ala Arg Met Tyr Phe Asp Lys Phe Gly Gin Gin Thr Ala Leu Val Arg 145 150 155 160 Ile Gly Ser Cys Thr Pro Glu Pro Asn Asn Tyr Arg Met Leu Ser Thr 165 170 175 Trp Phe Ser His Asp Asp Phe Val Ser Leu Ile Glu Ala Val Phe Arg 180 185 190 Ala Pro Val Leu Gly Cys Pro Val Val Trp Gly Ala Ser Ala Asn Asp 195 200 205 Ala Gly Trp Trp Asp Asn Ser His Leu Gly Phe Leu Gly Trp Lys Pro 210 215 220 Glu Asp Asn Ala Glu Ala Phe Arg Arg His Ile Thr Glu Thr Thr Pro 225 230 235 240 Pro Pro Asp Pro Asn Asp Ala Leu Val Arg Phe Gin Gly Gly Thr Phe 245 250 255 Val Asp Asn Pro Ile Phe Lys Gin Ser 260 265 <210> 7 <211> 33 <212> PRT <213> Artificial Sequence <400> 7 Cys Gly Cys Gly Gly Ala Thr Cys Cys Gly Ala Thr Gly Thr Thr Thr 1 5 10 15 Ala Thr Thr Gly Ala Ala Ala Ala Thr Thr Thr Thr Ala Ala Gly Gly 20 25 30 Thr <210> 8 <211> 30 <212> PRT <213> Artificial Sequence <400> 8 Gly Cys Gly Cys Thr Gly Cys Ala Gly Gly Ala Thr Thr Thr Gly Thr 1 5 10 15 Ala Thr Thr Cys Cys Ala Ala Ala Ala Thr Cys Ala Thr Gly 20 25 30 <210> 9 <211> 33 <212> PRT <213> Artificial Sequence <400> 9 Cys Gly Gly Ala Thr Ala Thr Cys Gly Ala Thr Gly Ala Cys Thr Ala 1 5 10 15 Thr Thr Cys Thr Cys Ala Thr Thr Gly Ala Gly Cys Ala Gly Cys Cys 20 25 30 Thr <210> 10 <211> 33 <212> PRT <213> Artificial Sequence <400> 10 Cys Cys Gly Cys Thr Cys Gly Ala Gly Ala Cys Cys Ala Cys Cys Thr 1 5 10 15 Cys Ala Gly Cys Thr Thr Thr Gly Thr Thr Gly Gly Ala Ala Ala Ala 20 25 30 Thr <210> 11 <211> 30 <212> PRT <213> Artificial Sequence <400> 11 Cys Gly Cys Ala Ala Gly Cys Thr Thr Ala Thr Gly Ala Ala Ala Cys 1 5 10 15 Gly Gly Cys Thr Thr Cys Thr Thr Gly Thr Thr Ala Cys Cys 20 25 30 <210> 12 <211> 28 <212> PRT <213> Artificial Sequence <400> 12 Cys Gly Cys Thr Cys Gly Ala Gly Cys Gly Gly Thr Gly Thr Cys Gly 1 5 10 15 Thr Cys Thr Cys Gly Gly Thr Thr Ala Thr Ala Thr 20 25
Claims
1. A recombinant Escherichia coli, characterized in that, The recombinant Escherichia coli simultaneously expresses the inositol-1-phosphate synthase gene Ino1, the inositol oxidase gene MIOX, and the aldehyde dehydrogenase gene Udh; the corresponding amino acid sequences of the proteins expressed by the inositol-1-phosphate synthase gene Ino1, the inositol oxidase gene MIOX, and the aldehyde dehydrogenase gene Udh are the sequences shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively.
2. The recombinant Escherichia coli according to claim 1, characterized in that, The inositol-1-phosphate synthase gene Ino1, inositol oxidase gene MIOX, and aldehyde dehydrogenase gene Udh were expressed in an integrated manner.
3. A method for constructing the recombinant Escherichia coli according to claim 1, characterized in that, The method includes the following steps: (1) The inositol-1-phosphate synthase gene Ino1 and the inositol oxidase gene MIOX were ligated into a binary expression vector and transformed into Escherichia coli host strains to obtain recombinant Escherichia coli 1; (2) The aldehyde dehydrogenase gene Udh was ligated into the expression vector and then transformed into the recombinant Escherichia coli 1 obtained in step (1) to obtain recombinant Escherichia coli.
4. The construction method according to claim 3, characterized in that, The method specifically includes the following steps: (1) Tomato ( Solanaceae Lycopersicon Using the genome of 1706 as a template, the inositol-1-phosphate synthase gene Ino1 and the inositol oxidase gene MIOX were amplified, and appropriate restriction sites were added to them. The fragments were then ligated into the binary expression vector pETDuet1 and chemically transformed into DH5α. The correct recombinant plasmid was obtained by screening and named pETDuet1-Ino1-MIOX. The recombinant plasmid was then transformed into the host bacterium E. coli BL21(DE3) to obtain E. coli BL21(DE3) / Ino1-MIOX. (2) Using the Agrobacterium tumefaciens GV3103 genome as a template, the aldehyde dehydrogenase gene Udh was amplified, ligated into pET28a, and then chemically transformed into the expression host E.coli BL21(DE3) / Ino1-MIOX constructed in step (1). The correct recombinant E. coli was screened and named E.coli BL21(DE3) / Ino1-MIOX-Udh.
5. A method for producing gluconic acid using the recombinant Escherichia coli according to claim 1, characterized in that, This method uses glucose or inositol as a substrate to catalyze the synthesis of gluconic acid.
6. The method according to claim 5, characterized in that, The method specifically involves inoculating the recombinant Escherichia coli seed culture into the fermentation medium at an inoculation rate of 2%-5%, and culturing it at 25℃-30℃ and 160 rpm-200 rpm for 60-100 h.
7. The method according to claim 6, characterized in that, The carbon source of the fermentation medium is one or both of glucose and crude glycerol.
Citation Information
Patent Citations
Method for establishing recombinant yeast for biologically synthesizing glucuronic acid
CN104312934A
Method for producing glucaric acid by constructing recombinant yeast fermentation
CN104312935A
Biosynthesis method of glucuronic acid and glucuric acid
CN104312987A
Method for producing glucaric acid
CN104080918A