Smbhlh92 gene cloning primer, expression vector, function of regulating salvianolic acid biosynthesis and application
By cloning the SmbHLH92 gene of Salvia miltiorrhiza and constructing an RNAi vector, we verified its negative regulation of salvianolic acid biosynthesis in Salvia miltiorrhiza, which solved the problem of insufficient research on the molecular mechanism of salvianolic acid biosynthesis and achieved a significant increase in the content of salvianolic acid compounds and enzyme gene expression.
Patent Information
- Application Number
- CN201910571110.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-06-28
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2039-06-28
AI Technical Summary
There are few studies on the molecular mechanisms of biosynthesis of salvianolic acid compounds in the existing technology, and there are insufficient reports on the regulation of salvianolic acid compound biosynthesis by bHLH transcription factor in tanshinone.
The SmbHLH92 gene in Salvia miltiorrhiza was cloned, and its localization in the cell nucleus and its negative regulation of salvianolic acid biosynthesis were verified by constructing recombinant plasmids and RNAi vectors. SmbHLH92-RNAi positive hairy roots were obtained by infecting Salvia miltiorrhiza leaves with Agrobacterium rhizogenes, and the content of salvianolic acid compounds and the expression level of key enzyme genes were detected.
It significantly increased the content of salvianolic acid compounds and the expression of key enzyme genes, verified the negative regulatory function of SmbHLH92, and laid the foundation for the study of the molecular mechanism of salvianolic acid biosynthesis.
Smart Images

Figure CN112143734B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant molecular biology and genetic engineering, and particularly relates to gene cloning and function research of a SmbHLH92 transcription factor for regulating biosynthesis of salvianolic acid. BACKGROUND
[0002] Salvia miltiorrhiza Bunge is a perennial herbaceous plant of the Labiatae family, and its roots and rhizomes are medicinal. The Shennong's Classic of Materia Medica lists it as the top grade. Salvia miltiorrhiza is slightly cold in nature and bitter in taste, and has the effects of activating blood and removing stasis, dredging channels and relieving pain, clearing the heart and relieving restlessness, and cooling blood and resolving abscesses. The main active components of salvia miltiorrhiza include liposoluble tanshinone compounds and water-soluble salvianolic acid compounds. Salvianolic acid compounds mainly include rosmarinic acid (RA), salvianolic acid B (Sal B), salvianolic acid A (Sal A) and lithospermic acid (LA), etc., which play an important role in antioxidant, free radical scavenging, etc., and can effectively treat cardiovascular and cerebrovascular diseases, liver fibrosis and some cancers. At present, the biosynthetic pathway of salvianolic acid compounds has been relatively in-depth, but there are few reports on the molecular mechanism of regulating the biosynthesis of these compounds.
[0003] bHLH transcription factors are one of the largest transcription factor gene families in plants, and their protein structures can specifically bind to a specific sequence of the cis-acting element in the promoter region of the target gene, thereby initiating gene transcription. bHLH transcription factors play an important role in regulating plant growth and development, secondary metabolism, stress response and signal transduction. It has been verified that bHLH transcription factors have the functions of regulating anthocyanin, alkaloid and terpenoid biosynthesis in Arabidopsis thaliana, tobacco and Taxus chinensis, etc. There are few reports on bHLH transcription factors regulating the biosynthesis of salvianolic acid compounds in Salvia miltiorrhiza. SUMMARY
[0004] The purpose of the present application is to provide a bHLH transcription factor gene for regulating the biosynthesis of salvianolic acid and the protein encoded thereby.
[0005] Another purpose of the present application is to verify the function of members of the bHLH transcription factor family.
[0006] The SmbHLH92 gene provided by the present application has a nucleotide sequence as shown in SEQ ID No. 1.
[0007] The protein encoded by the SmbHLH92 gene provided by the present application has an amino acid sequence as shown in SEQ ID No. 2.
[0008] The application designs primers for amplifying the specific fragment of SmbHLH92 gene, and the base sequences are shown as SEQ ID NO. 3 and SEQ ID NO. 4.
[0009] The object of the application can be achieved by the following technical scheme: screening the SmbHLH92 coding gene of the bHLH gene family member which can regulate the synthesis of active components of Salvia miltiorrhiza based on the whole genome of Salvia miltiorrhiza and the differential expression analysis of the transcriptome of different organs / tissues of Salvia miltiorrhiza.
[0010] The recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 is constructed, the Agrobacterium tumefaciens GV3101 is transformed, the tobacco leaf is transiently infected, the GFP fluorescence is observed by fluorescence confocal microscope, and it is found that SmbHLH92 is located in the cell nucleus.
[0011] A plant RNAi binary expression vector containing the forward and reverse sequences of the specific fragment of SmbHLH92 gene is constructed.
[0012] The SmbHLH92-RNAi positive hairy root strain is obtained by infecting the Salvia miltiorrhiza leaf by Agrobacterium rhizogenes (ACCC10060).
[0013] The UPLC technology is used to detect that the content of the salvianolic acid compound in the SmbHLH92-RNAi transgenic hairy root is significantly increased.
[0014] The real-time fluorescent quantitative PCR technology is used to detect that the expression amount of the key enzyme gene related to the synthesis of salvianolic acid is significantly increased in the SmbHLH92-RNAi positive strain.
[0015] The SmbHLH92 provided by the application has the function of negatively regulating the biosynthesis of the active component of Salvia miltiorrhiza, that is, salvianolic acid, and lays a foundation for analyzing the molecular mechanism of regulating the biosynthesis of salvianolic acid. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 As shown in the subcellular localization experiment, SmbHLH92 is located in the cell nucleus.
[0017] Figure 2 As shown in the subcellular localization experiment, SmbHLH92 is located in the cell nucleus.
[0018] Figure 3 As shown in the subcellular localization experiment, SmbHLH92 is located in the cell nucleus.
[0019] Figure 4 The content of four salvianolic acids in SmbHLH92-RNAi transgenic hairy roots was significantly increased.
[0020] Figure 5 The content of four salvianolic acids in SmbHLH92-RNAi transgenic hairy roots was significantly increased.
[0021] Figure 6 The expression of key enzyme genes in the salvianolic acid synthesis pathway in SmbHLH92-RNAi transgenic hairy roots was significantly increased. DETAILED DESCRIPTION
[0022] The present application is described in detail below in conjunction with examples. The implementation is for better understanding of the present application, but is not limited to the present application. The experimental methods in the following implementation methods are all conventional methods, and the experimental reagents involved are all conventional biochemical reagents.
[0023] Example 1 Cloning of SmbHLH92 gene of Salvia miltiorrhiza
[0024] The full-length amplification primer was designed according to the open reading frame of SmbHLH92 sequence, and the nucleotide sequence of SmbHLH92 gene was obtained by PCR amplification using cDNA of Salvia miltiorrhiza as a template, as shown in SEQ ID No. 1, and the full-length of the gene was 666 bp. The amino acid sequence of SmbHLH92 was deduced after translation of the nucleotide sequence, and contained 221 amino acid residues, as shown in SEQ ID No. 2.
[0025] Example 2 Subcellular localization experiment of SmbHLH92 of Salvia miltiorrhiza
[0026] 1) Construction of recombinant plasmid pCAMBIA1302-GFP-SmbHLH92. The full-length amplification primer (R primer without stop codon) with a restriction site was designed, F: 5'-CATG CCATGG ATGCTTCCTATTTCGAGCGATG-3' R: 5'-GCTGTCGTCAGCTGCCG-3'. ACTAGT ATGCTTCCTATTTCGAGCGATG-3' R: 5'-GCTGTCGTCAGCTGCCG-3'.
[0027] 2) Recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 transformed Agrobacterium tumefaciens GV3101. The competent cells of Agrobacterium tumefaciens GV3101 were transformed with the recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 and empty vector pCAMBIA1302-GFP, as follows: 10 μL of the constructed recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 and empty vector pCAMBIA1302-GFP were added to 100 μL of GV3101 Agrobacterium competent cells, mixed gently, and then placed in ice water for 30 min. The cells were then frozen in liquid nitrogen for 3 min, placed in a 37°C water bath for 3 min, and then placed in ice for 3 min. Then, 1 mL of YEB liquid medium without antibiotics was added, and the mixture was cultured at 28°C and 150 rpm for 4-6 h. The cells were then centrifuged at 4000 rpm for 4 min, and 100-200 μL of supernatant was retained. The bacterial cells were gently resuspended with a syringe tip and evenly spread on YEB plates containing 50 mg / L Rif, 15 mg / L Gm, and 50 mg / L Kan. The plates were then incubated at 28°C for 48 h until single colonies appeared.
[0028] 3) Agrobacterium tumefaciens transiently infected tobacco leaves. The correct GV3101 positive clones containing the recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 and GV3101 clones containing only the empty vector pCAMBIA1302-GFP and p19 monoclone (p19 functions to prevent gene silencing and promote gene expression) were selected and inoculated in YEB liquid medium containing 50 mg / L Rif, 15 mg / L Gm, and 50 mg / L Kan. The mixture was cultured at 28°C and 180 rpm for 24 h. Then, 500 μL of bacterial solution was added to 50 mL of YEB liquid medium containing 50 mg / L Rif, 15 mg / L Gm, and 50 mg / L Kan, and the mixture was cultured overnight at 28°C until the OD 600 was 0.4-0.6. The mixture was then placed on ice for 30 min and centrifuged at 8000 g for 10 min. The bacterial cells were resuspended with 1 mL of tobacco injection solution. The tobacco injection solution was prepared as follows: 1 mL of 1 M MgCl2, 1 mL of 1 M MES, 100 μL of 0.2 M acetyl-piperitone, and 98 mL of ddH2O. The mixture was mixed at a ratio of SmbHLH92:p19 = 1:0.6 and then placed in the dark at 28°C for 2-4 h. The tobacco leaves with good growth were selected (generally 3-4 weeks old), and 1 mL of the mixed solution of bacterial solution and tobacco injection solution was injected into the lower epidermis of the tobacco leaves using a 1 mL syringe.
[0029] 4) Laser confocal microscope observation of leaf fluorescence. The tobacco plants after injection were taken out after 2-4 days of culture in the culture room, and the leaves about 0.5 cm around the syringe needle eye were cut off, and the leaves of about 0.5 cm in size were placed in DAPI staining solution, and stained at room temperature for 5-10 min, and the DAPI staining solution was aspirated, and washed with PBS for 2-3 times, each time for 3-5 min, and the fluorescence of the leaves was observed by using a confocal microscope, as shown in 2 FIG. 2. Figure 1
[0030] Example 3 Obtaining and expanding culture of Salvia miltiorrhiza SmbHLH92-RNAi transgenic hairy root positive lines
[0031] 1) RNAi primer design and PCR amplification. A specific fragment of 123 bp in length in the SmbHLH92 gene was selected as the RNAi target region (located at 529-651 bp of the gene), and primers were designed at both ends of the target region, and according to the Gateway operation principle, attB sequences were added at the 5' end of the primers, wherein attB1 sequence was added to the F primer: GGGGACAAGTTTGTACAAAAAAGCAGGCT, and attB2 sequence was added to the R primer: GGGGACCACTTTGTACAAGAAAGCTGGGT. The primer sequences of SmbHLH92 RNAi are as follows:
[0032] SmbHLH92 RNAi F:
[0033] 5'- ACCACCACAGCACCCTCAAC-3' GGGGACAAGTTTGTACAAAAAAGCAGGCT
[0034] SmbHLH92 RNAi R:
[0035] 5'- CTAGCTGTCGTCAGCTGCCG-3' GGGGACCACTTTGTACAAGAAAGCTGGGT
[0036] 2) Construction of SmbHLH92-RNAi vector. BP reaction: add 25 ng attB-PCR product, 75 ng pDONR221 entry vector, 1 μL BP clonase II enzyme into the PCR reaction tube, supplement ddH2O to 5 μL of reaction system; mix gently, incubate at 25 °C for more than 1 hour; then add 0.5 μL of protein kinase K, mix and incubate at 37 °C for 10 min; transfer into DH5α competent cells, screen and culture with LB solid medium containing 50 mg / L Kan resistance, and detect the obtained clones by PCR. LR reaction: add 75 ng pDONR221-RNAi recovery product, 75 ng pK7GWIWG2D(II) receptor vector, 1 μL LR clonase II enzyme into the PCR reaction tube, supplement ddH2O to 5 μL of reaction system; mix gently, incubate at 25 °C for more than 1 hour; then add 0.5 μL of protein kinase K, mix and incubate at 37 °C for 10 min; transfer into DH5α competent cells, screen and culture with LB solid medium containing 50 mg / L Spec (spectinomycin) resistance, and sequence the positive clones after PCR detection; extract the recombinant plasmid pK7GWIWG2D(II)-SmbHLH92 from the correct sequencing clone, and transfer into Agrobacterium tumefaciens ACCC10060.
[0037] 3) Agrobacterium tumefaciens ACCC10060 infection of Salvia miltiorrhiza leaf. Use Agrobacterium tumefaciens with pK7GWIWG2D(II) vector as a control strain to infect Salvia miltiorrhiza leaves. Select vigorous Salvia miltiorrhiza tissue culture seedlings, take their young leaves, cut into 0.5 cm 2 leaf discs, and place on MS medium plates at 25 °C for 2-3 days of pre-culture; use 50 mg / L Spec + 50 mg / L Rif liquid YEB medium to culture Agrobacterium tumefaciens ACCC10060 strains containing recombinant plasmid (pK7GWIWG2D(II)-SmbHLH92) and empty vector (pK7GWIWG2D(II)), respectively, and shake culture at 28 °C to OD 6000.4-0.6; centrifuge the bacterial solution, enrich the bacterial bodies, and then resuspend the bacterial bodies in an equal volume of MS liquid medium (MS-plasmid). Place the pre-cultured leaf discs in the MS-plasmid, soak for 10 min, and then use a sterile filter paper to absorb the excess bacterial solution. Place the leaf discs on an MS plate, and co-culture for 48-72 h under dark conditions at 25°C. Soak the co-cultured leaf discs in sterile water and sterile water containing 500 mg / L Car (carbenicillin) for 10 min, respectively. Absorb the excess water with a filter paper, and then place the leaf discs on an MS plate containing 500 mg / L Car+50 mg / L Kan, and select and culture under dark conditions at 25°C. Replace the culture medium every 10 days. Select the hairy roots with a good growth, and cut the hairy roots when the length of the hairy roots is 2.0-3.0 cm. Place the hairy roots on a 6,7-V plate containing 200 mg / L Car+15 mg / L Kan+0.1 mg / L IAA, and stimulate for one week. Then, transfer the hairy roots to a plate without IAA. When more lateral roots grow, use a fluorescence microscope to detect the expression of GFP to determine whether the transgenic hairy roots are positive strains. Transfer the positive strains to a 6,7-V liquid culture medium, and culture under dark conditions at 25°C at 120 rpm.
[0038] 4) After the hairy roots are cultured in a liquid culture medium for one month, extract the RNA of the hairy roots, and use a real-time fluorescent quantitative PCR method to detect the degree of inhibition of the expression of the gene in the SmbHLH92-RNAi transgenic positive strains (92i-4, 92i-5, 92i-10), as shown in Table 1. Figure 2 Compared with the control strain (pki) (set the relative expression amount of the gene as 100%), the relative expression amounts of the gene in the strains 92i-4, 92i-5, and 92i-10 are 30%, 55%, and 54%, respectively.
[0039] Example 4: Detection of the content of salvianolic acid compounds in transgenic hairy roots
[0040] In the present application, UPLC technology is used to detect the chemical components of the transgenic hairy roots of Salvia miltiorrhiza, and the steps are as follows:
[0041] 1) Sample processing: take out the hairy roots after being cultured for 5 months, and take a photo, as shown in Table 2. Figure 3 Dry the hairy roots in an oven at 40°C, weigh the hairy roots, use a ball mill to grind the hairy roots into powder, use 2 ml of 75% methanol to extract 100 mg of the hairy roots, treat the extract with ultrasonic waves for 30 min, centrifuge the extract at 8000 g for 10 min, and then filter the supernatant to a brown liquid phase vial using a 0.22 μm filter, and then inject the sample;
[0042] 2) UPLC conditions: An ACQUITY UPLC BEH C18 column (2.1×100mm, 1.7μm; Waters) was used; the detection wavelength was 280nm; the column temperature was 25℃; the flow rate was 0.3ml / min; the injection volume was 1μL; the mobile phase was acetonitrile (A) - 0.5% formic acid solution (B), using a gradient elution method: 5-25% A (0-10min), 25-40% A (10-20min), 40-90% A (20-25min), 90% A (25-30min); three biological replicates were set up for different transgenic lines and control lines. The results of the determination of salvianolic acid compounds are as follows: Figure 4 , 5 As shown.
[0043] Example 5: Detection of expression levels of key enzyme genes in the biosynthesis pathway of salvianolic acid in transgenic hairy roots
[0044] Primers were designed to amplify specific fragments of key enzyme genes PAL1, C4H1, 4CL2, TAT1, HPPR1, RAS1, and CYP98A14 in the tanshinone biosynthesis pathway. Real-time quantitative PCR was used to detect the relative expression levels of these genes in transgenic hairy root lines and control lines. Actin, the housekeeping gene of *Salvia miltiorrhiza*, was used as an internal control gene. -ΔΔCt The method calculates the relative expression levels of genes. Primers for key enzyme genes in the salvianolic acid biosynthesis pathway are as follows:
[0045]
[0046]
[0047] This invention is the first to clone the SmbHLH92 gene into Salvia miltiorrhiza, and verification revealed that SmbHLH92 has the function of negatively regulating the biosynthesis of salvianolic acid compounds, laying the foundation for conducting research on the biosynthesis of salvianolic acid and the cultivation of superior germplasm.
[0048] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the technical principles of the present invention, and these should also be considered within the protection scope of the present invention. sequence list <110> Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences <120> SmbHLH92 gene cloning primers, expression vectors, function and application in regulating salvianolic acid biosynthesis <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 666 <212> DNA <213> Salvia miltiorrhiza Bunge <400> 1 atgcttccta tttcgagcga tggggtatct gaggatcctt ccatattttt ggagctagaa 60 gatctgcttg ccgattgtcc cattccagat ggcaatcaaa atactgtgaa aaagtcgtcg 120 gccagcagcc aagttgaaga gaacaatcaa gactctaaga agactgctca tagatttact 180 gaaaggcaga gaaggcaaga aatgtcagcc ctttatgctt cactcaggtc tcttcttccc 240 ctccaatatg tcaaggggaa gcgcgctgta tctgatcaca tgcaccaggc tgtgaattat 300 gttaacgata tgaagaagaa cattgaacaa ctgcagaaaa ggagagacaa attgaggaat 360 attaccactt ctgctgatcc aaccactcct cgttgtgtga agataaacct ttttaaagat 420 gggatggaga tcttgattac tcatagcctc agcaacaaga gtttccccct ttcaaaggtg 480 cttgcatatt tgcttgatag acagctcaac gtagttcact gcgtttctac caccacagca 540 ccctcaactt tcctccaaac aattcatatc gagcttaatg attcgagtag cgttaatcta 600 cctgagctac aagagcggct ggacaatttg ataagatttg cttatacggc agctgacgac 660 agctag 666 <210> 2 <211> 221 <212> PRT <213> Salvia miltiorrhiza Bunge <400> 2 Met Leu Pro Ile Ser Ser Asp Gly Val Ser Glu Asp Pro Ser Ile Phe 1 5 10 15 Leu Glu Leu Glu Asp Leu Leu Ala Asp Cys Pro Ile Pro Asp Gly Asn 20 25 30 Gln Asn Thr Val Lys Lys Ser Ser Ala Ser Ser Gln Val Glu Glu Asn 35 40 45 Asn Gln Asp Ser Lys Lys Thr Ala His Arg Phe Thr Glu Arg Gln Arg 50 55 60 Arg Gln Glu Met Ser Ala Leu Tyr Ala Ser Leu Arg Ser Leu Leu Pro 65 70 75 80 Leu Gln Tyr Val Lys Gly Lys Arg Ala Val Ser Asp His Met His Gln 85 90 95 Ala Val Asn Tyr Val Asn Asp Met Lys Lys Asn Ile Glu Gln Leu Gln 100 105 110 Lys Arg Arg Asp Lys Leu Arg Asn Ile Thr Thr Ser Ala Asp Pro Thr 115 120 125 Thr Pro Arg Cys Val Lys Ile Asn Leu Phe Lys Asp Gly Met Glu Ile 130 135 140 Leu Ile Thr His Ser Leu Ser Asn Lys Ser Phe Pro Leu Ser Lys Val 145 150 155 160 Leu Ala Tyr Leu Leu Asp Arg Gln Leu Asn Val Val His Cys Val Ser 165 170 175 Thr Thr Thr Ala Pro Ser Thr Phe Leu Gln Thr Ile His Ile Glu Leu 180 185 190 Asn Asp Ser Ser Ser Val Asn Leu Pro Glu Leu Gln Glu Arg Leu Asp 195 200 205 Asn Leu Ile Arg Phe Ala Tyr Thr Ala Ala Asp Asp Ser 210 215 220 <210> 3 <211> 49 <212> DNA <213> Artificial Sequence <400> 3 ggggacaagt ttgtacaaaa aagcaggcta ccaccacagc accctcaac 49 <210> 4 <211> 49 <212> DNA <213> Artificial Sequence <400> 4 ggggaccact ttgtacaaga aagctgggtc tagctgtcgt cagctgccg 49
Claims
1. The application of a plant RNAi binary expression vector in increasing the content of tanshinone compounds, characterized in that, The plant RNAi binary expression vector contains a specific fragment sequence of SmbHLH92 and forward and reverse primer sequences; the specific fragment sequence is 529-651 bp of SEQ ID No. 1; the primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 4.
Citation Information
Patent Citations
Screening, identification and application of SmAP2 / ERF8 transcription factor for regulation of salvianolic acid biosynthesis
CN107699577A