Regulatory gene for improving utilization rate and tolerance of capric acid in streptomyces roseosporus and application thereof
By introducing a CRP regulatory gene into Streptomyces roseosus, the problems of low daptomycin yield and high production cost were solved, achieving efficient antibiotic production, improving the utilization rate and tolerance of decanoic acid, and enhancing fermentation yield.
Patent Information
- Application Number
- CN202010457523.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-05-26
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2040-05-26
AI Technical Summary
Daptomycin has low yield and high production cost. Too high or too low concentration of decanoic acid can cause toxicity to Streptomyces roseosus or affect the potency of fermentation broth. Existing technologies are difficult to effectively improve its utilization rate and tolerance.
By introducing a CRP regulatory gene into *Streptomyces roseosus* and using genetic engineering to improve the utilization and tolerance of decanoic acid, CRP protein was expressed using recombinant plasmids and introduced into *Streptomyces roseosus* via conjugation transfer, and strains with high antibiotic production were screened.
It significantly improved the utilization rate and tolerance of decanoic acid by Streptomyces roseosus, enhanced the fermentation yield of daptomycin, reduced production costs, and achieved efficient antibiotic production.
Smart Images

Figure CN113717259B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to a regulatory gene for improving the utilization rate and tolerance of capric acid in Streptomyces roseosporus, application thereof and a method for obtaining high antibiotic-producing Streptomyces. BACKGROUND
[0002] Daptomycin is a novel cyclic lipopeptide antibiotic produced by Streptomyces roseosporus, which interacts with the cell membrane in a calcium ion-dependent manner and exerts bactericidal activity. In December 2010, the FDA approved Cubist Pharmaceutical Company's daptomycin injection Cubicin for a new dosing regimen of 1 injection per day for 2 minutes intravenously. Cubicin was approved in the United States as early as 2003 for the treatment of complex skin and skin tissue infections caused by certain gram-positive bacteria, including methicillin-resistant Staphylococcus aureus, with a new dosing regimen of 1 injection per day for 30 minutes intravenously. In 2006, it also obtained a new indication for the treatment of bacteremia caused by methicillin-sensitive and resistant Staphylococcus aureus, including right-sided infective endocarditis. The State Food and Drug Administration of China approved the production of daptomycin for injection by Hangzhou Sino-American East China Pharmaceutical Co., Ltd., Zhejiang Haizheng Pharmaceutical Co., Ltd. and Jiangsu Hengrui Pharmaceutical Co., Ltd. in 2015 and 2016. A number of studies have shown that the proportion of drug resistance has not increased significantly in more than 10 years since daptomycin was launched, which highlights the unique advantages of daptomycin.
[0003] Daptomycin is a microbial secondary metabolite with complex structure and very low yield. Genetic engineering is an important strategy to improve daptomycin production and reduce production costs.
[0004] Decanoic acid is an exogenous precursor in the synthesis of daptomycin, which can change the secondary metabolic direction of the bacteria. In the production of daptomycin, decanoic acid is an essential substance, but excessive decanoic acid can be toxic to Streptomyces roseosporus; on the contrary, if the concentration of decanoic acid is too low, the product titer in the fermentation broth will be reduced due to insufficient precursor supply. Cyclic adenosine monophosphate receptor protein (CRP) is a conservative metabolic regulator widely existing in bacteria, which exists in both gram-negative and gram-positive bacteria, but does not exist in Bacillus and other thick-walled bacteria. The research on CRP in Escherichia coli is the most extensive. In Escherichia coli, it mediates the carbon catabolite repression process together with the allosteric effector cAMP. In actinomycetes, including Streptomyces, CRP also has important global regulation. Numerous studies have shown that CRP is directly involved in the regulation of many antibiotics in Streptomyces coelicolor, indicating that it can affect the precursor flux into secondary metabolism and play a role in primary and secondary metabolism (Gao C, Hindra, Mulder D, et al. CRP Is a Global Regulator of Antibiotic Production in Streptomyces [J]. mBio, 2012, 3(6).). The nucleotide sequence of CRP of daptomycin is 89.3% identical to that of Streptomyces coelicolor, and the amino acid sequence is 94.2% identical. Through phylogenetic tree analysis, CRP widely exists in Streptomyces and has high conservation, but its role in most Streptomyces is not the same. Some regulate spore development of Streptomyces, and some only regulate secondary metabolites, but it has not been reported that CRP gene can improve the tolerance of Streptomyces roseosporus to decanoic acid. SUMMARY
[0005] The application provides a regulatory gene for improving the utilization rate and tolerance of decanoic acid in Streptomyces roseosporus, and provides an application of the gene in preparing a high-yield daptomycin strain.
[0006] The regulatory gene for improving the utilization rate and tolerance of decanoic acid in Streptomyces roseosporus provided by the application can encode CRP protein.
[0007] As a specific implementation form, the amino acid sequence of the CRP protein is shown in SEQ ID NO. 3.
[0008] As a specific implementation form, the regulatory gene can be expressed in Streptomyces roseosporus.
[0009] As a specific implementation form, the nucleotide sequence of the regulatory gene is shown in SEQ ID NO. 1.
[0010] As a specific embodiment, the regulatory gene is obtained by subcloning the genome of Streptomyces roseosporus, and has a length of 672 base pairs.
[0011] As a specific embodiment, the regulatory gene can improve the tolerance and utilization of decanoic acid by Streptomyces roseosporus, and the nucleotide sequence of the regulatory gene is shown in SEQ ID NO. 1.
[0012] As a specific embodiment, the regulatory gene is found by homology analysis of the CRP gene of Streptomyces coelicolor, and the gene with the highest similarity in the genome sequence of Streptomyces roseosporus is CDS-7, which is annotated as CRP / Fnr family transcriptional regulator, but no relevant literature and research reports its function in daptomycin, and further phylogenetic tree and amino acid sequence motif analysis determines that it is a CRP homologous protein.
[0013] The application also provides a recombinant plasmid for expressing the protein of SEQ ID NO. 3 in Streptomyces roseosporus, and preferably, the coding gene of the protein is SEQ ID NO. 1.
[0014] As a specific embodiment, the plasmid backbone of the above-mentioned recombinant plasmid includes a shuttle plasmid that can be inserted into a strong promoter erme, and preferably pKC1139, pEST152, pOJ260 or pSOK804.
[0015] As a specific embodiment, the nucleotide sequence of the recombinant plasmid with pSET152 as the backbone is SEQ ID NO. 2.
[0016] The application provides a method for obtaining high antibiotic-producing Streptomyces by using the regulatory gene CRP for enhancing the expression of Streptomyces roseosporus to improve the utilization of decanoic acid and the tolerance to decanoic acid, and the method comprises the following steps:
[0017] (a) finding the gene with the highest similarity in the genome sequence of Streptomyces roseosporus by homology analysis of the CRP gene of Streptomyces coelicolor, and determining that it is a CRP homologous protein by further phylogenetic tree and amino acid sequence motif analysis;
[0018] (b) cloning the regulatory gene CRP fragment from Streptomyces roseosporus by PCR, and cloning the fragment into an expression vector to obtain a recombinant plasmid containing the regulatory gene CRP;
[0019] (c) transferring the recombinant plasmid containing the regulatory gene CRP into Streptomyces roseosporus by conjugation transfer;
[0020] (d) obtaining a recombinant strain of an antibiotic-producing bacterium comprising the regulatory gene CRP through antibiotic screening;
[0021] (e) performing an antibiotic assay on the recombinant strain obtained in step (d) to obtain a high-antibiotic-yield S. roseosporus strain.
[0022] As a specific embodiment, the plasmid backbone of the expression vector in step (b) comprises a shuttle plasmid insertable into a strong promoter ermE, preferably pKC1139, pEST152, pOJ260 or pSOK804.
[0023] As a specific embodiment, the S. roseosporus in step (c) is S. roseosporus CGMCC No. 4.7231.
[0024] As a specific embodiment, the S. roseosporus in step (e) has been preserved in the China General Microbiological Culture Collection Center on July 26, 2019, and the preservation address is: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China, and the preservation number is CGMCC No. 18297.
[0025] Therefore, the present application has the following beneficial effects: the present application solves the problems of high workload and high blindness in traditional Streptomyces breeding by using the global regulatory factor CRP, and obtains a daptomycin high-yield strain cultivated by genetic engineering, which has a wide application prospect; the use of this method to transform the starting bacterium S. roseosporus unexpectedly found that the CRP gene can improve the utilization rate of capric acid and improve the tolerance to capric acid during the fermentation process of S. roseosporus. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 For comparison of the fermentation yield of the high-antibiotic-yield S. roseosporus in the present application and the existing S. roseosporus under different precursor concentrations in the culture medium after normalization processing;
[0027] Figure 2 For the physical map of the recombinant plasmid pSET152CRP;
[0028] Figure 3 For the pSET152CRP enzyme digestion electrophoresis map;
[0029] Figure 4 For the pSET152CRP plasmid sequencing result;
[0030] Figure 5 For the comparison chart of the daily daptomycin titer after normalization processing of the constructed bacterium in the present application and the starting bacterium under two kinds of feeding processes in the fermentation process, i.e., daily supplement of the amount of capric acid in the normal production process and daily supplement of twice the normal amount of capric acid;
[0031] Figure 6 The comparison chart of daily capric acid utilization rate (titer / capric acid cumulative addition amount) of the constructed bacteria and the starting bacteria in the fermentation process under two feeding processes of feeding the amount of capric acid in normal production process and feeding twice the amount of capric acid in normal production process every day. DETAILED DESCRIPTION
[0032] The technical solutions of the present application will be further described below in combination with specific embodiments.
[0033] In the present application, all the equipment and raw materials can be purchased from the market or commonly used in the industry, and the methods in the following examples are conventional methods in the art unless otherwise specified.
[0034] Example 1: Construction of pSET152CRP of recombinant plasmid containing CRP gene:
[0035] By performing Blast on the nucleotide sequence of the reported homologous gene CRP in Streptomyces coelicolor and the genome sequence of Streptomyces roseosporus in NCBI (website: www.ncbi.nlm.nih.gov), the target gene CRP in Streptomyces roseosporus was obtained, and the size of the target gene CRP was 672 bp.
[0036] The primers were designed by using primer 5.0 as follows:
[0037] CRPS: ATTTCTAGAAATACCTGACCGAGCACG;
[0038] CRPA: ATTGGATCCATCGCACTGTTTTACCGT.
[0039] The total DNA of Streptomyces roseosporus was extracted, and the CRP gene was amplified to obtain the target gene fragment.
[0040] The pSET152 plasmid was extracted by using SanPerp column plasmid DNA small amount extraction kit according to the method of the kit instruction. The obtained plasmid DNA solution was stored at -20℃ or used for subsequent experiments.
[0041] The pSET152 plasmid was treated with restriction endonuclease, and after enzyme digestion, DNA agarose gel electrophoresis was performed. The SanPerp column DNA gel recovery kit was used according to the instruction manual, and the target band with a size of 858 bp was recovered. The obtained DNA solution was stored at -20℃ or used for subsequent experiments.
[0042] The amplified CRP gene and the pSET152 plasmid fragment recovered by enzyme digestion were connected, and the enzyme digestion and connection reaction system was as follows: 0.03 pmol of vector, 0.03-0.3 pmol of fragment, 1200 U of T4 DNA ligase, 5 ul of buffer, and the rest was made up with distilled water, 16 ℃ connection for 16 h, to obtain the connection product.
[0043] 200 ul of E. coli competent cells were taken, and the above connection product was added, and the contents were mixed by gently rotating, and placed in ice for 30 min. The tube was placed in a circulating water bath preheated to 42 ℃ for 90 s. The tube was quickly transferred to the water bath, and the cells were cooled for 1-2 min. 800 ul of LB medium preheated at 37 ℃ was added to each tube, and then transferred to a 37 ℃ water bath for 45 min. The appropriate volume of transformed competent cells was transferred to LB medium containing the corresponding resistance. After 12-16 h of inverted culture at 37 ℃, colonies appeared. The colonies were picked and subjected to enzyme digestion verification, and the verification results are shown in Figure 3 The verification successful colonies were taken for preservation and sequencing verification, and the sequencing results were compared and viewed seq peak chart by Snapgene as shown in Figure 4 .
[0044] The recombinant plasmid pSET152 CRP was 7033 bp in size, with an apramycin resistance gene, and could be screened in E. coli and Streptomyces roseosporus. int Φ C31 was the integrase gene, attP was the integration site, and p*erme was the erythromycin promoter.
[0045] The formula of LB medium: 10 g of tryptone, 10 g of yeast extract, 10 g of NaCl, add deionized water to 1000 ml, PH 7.0. Sterilized at 121 ℃ for 30 min, used for culturing E. coli. The solid medium added 2% agar powder.
[0046] Example 2: Recombinant plasmid was transferred to Streptomyces roseosporus by intergeneric conjugation
[0047] E. coli ET12567 containing recombinant plasmid PSET152 CRP was conjugated with Streptomyces roseosporus CGMCC No. 4.7231, and apramycin and naltrexone acid were used for screening to obtain conjugants containing PSET152 CRP plasmid, and the vector into which the empty vector PSET152 empty plasmid was used as a control.
[0048] Method for intergeneric conjugation of E. coli and Streptomyces roseosporus CGMCC No. 4.7231:
[0049] Inoculate ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152 CRP) into LB (containing kanamycin / chloramphenicol / ampicillin) medium, incubate overnight at 37°C, 220 rpm. Inoculate ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152 CRP) into fresh LB medium (containing kanamycin / chloramphenicol / ampicillin) at a ratio of 1 : 100, incubate at 37°C, 220 rpm until OD600 reaches 0.3-0.4. Resuspend the cells with the same volume of LB medium twice, and finally resuspend in 0.1 volume of LB medium. At the same time of washing the cells, resuspend 10"8spores of each in 500 ul 2xYT medium, heat shock at 50°C for 10 min, and cool to room temperature. Mix 500 ul of each of the E. coli and S. roseoflavus spore solutions well, centrifuge to remove most of the supernatant, and resuspend with the remaining liquid. Spread the mixed bacterial solution on MS solid medium containing 10 mM MgCl2, and incubate at 29°C for 16-20 h. Take 1 ml of sterile water containing 0.5 mg nalidixic acid and 1 mg apramycin, and evenly spread on the conjugation plate. Continue to incubate in a 29°C incubator for 2-3 days, and observe the conjugants. Obtain a single colony of S. roseoflavus containing pSET152 CRP by streaking, inoculate the single colony into 5 ml TSB liquid test tube containing 75 ug nalidixic acid and 250 ug apramycin for subculture, and verify the genotype of the conjugant.
[0050] 2xYT medium formula:
[0051] Tryptone 16 g, yeast extract 10 g, NaCl 5 g, add deionized water to 1000 ml, adjust the pH to 7.0 with 5N NaOH, and sterilize with high-pressure steam at 121°C for 20 min.
[0052] MS medium formula:
[0053] Mannitol 20 g, soybean cake powder 20 g, agar 20 g, add deionized water to 1000 ml, pH 7.2-7.3, sterilize twice at 115°C for 15 min, and add 1M MgCl2 to a final concentration of 10 mM / L when used. (1M MgCl2: MgCl2.7H2O)
[0054] Example 3: Fermentation process of recombinant bacteria
[0055] The constructed rose chain streptomyces strain is cultured in R5 slope medium at 30℃ for 5 days, then is transferred to a shaking flask containing 50ml YEME liquid medium, and is cultured at 30℃ with oscillation (220rpm / min) for 25h. The dodecanic acid is added as a fermentation precursor during fermentation. After the fermentation is completed, the fermentation unit is determined by HPLC, and the strain with high yield is selected. Figure 1 Compared with the existing rose chain streptomyces (starting strain), the high-antibiotic-yield rose chain streptomyces prepared in the application has higher fermentation yield, that is, better daptomycin yield, and the fermentation yield is increased by more than 200%.
[0056] TSB liquid medium formula:
[0057] Trypsin peptone 17g, soybean peptone 3g, D-glucose 2.5g, sodium chloride 5g, potassium phosphate 2.5g, and deionized water is added to 1000ml, and sterilized at 121℃ for 30min.
[0058] R5 medium formula:
[0059] Sucrose 103.0g, K2SO4 0.25g, MgCl2·6H2O 10.12g, glucose 10.0g, hydrolyzed casein 0.1g, trace element solution 2.0g, yeast extract 5.0g, TES buffer 57.3ml, KH2PO4 (0.5%) 10ml, CaCl2·H2O (5M) 4ml, L-proline (20%) 150ml, NaOH (1N) 7ml, agar 20.0g, and deionized water is added to 1000ml, and sterilized at 115℃ for 30min.
[0060] Trace element solution (per liter): ZnCl2 40mg, FeCl2·6H2O 200mg, CuCl2·2H2O 10mg, MnCl2·2H2O 10mg, Na2B4O7·10H2O 10mg, (NH4)6Mo7O 24 ·4H2O 10mg
[0061] YEME medium formula:
[0062] Yeast extract 1.5g, tryptone 5g, malt extract 3g, glucose 10g, sucrose 250g, and deionized water is added to 1000ml, and steam sterilized at 115℃ for 15min.
[0063] Example 4: HPLC determination of daptomycin fermentation unit
[0064] Chromatographic conditions: Column: Phenomenex IB-SIL C8 4.6x250mm 5um, flow rate: 1.0 mL / min, detection wavelength: 223 nm, injection volume: 25 μL, column temperature: 25 °C, gradient elution mobile phase A: 3.4 g of ammonium dihydrogen phosphate was weighed and dissolved in 1000 mL of distilled water, and the pH was adjusted to 3.1 with phosphoric acid, mobile phase B: acetonitrile.
[0065] Example 5: Test of tolerance of constructed strain to precursor concentration
[0066] Using the fermentation process of Example 3, the tolerance range of the starting strain and the constructed strain to the concentration of the fermentation precursor in the medium was compared in a shake flask. The experimental results are shown in the attached table of the description. Figure 1 As shown in the attached table of the description, the constructed strain had the highest production of daptomycin when the precursor concentration was 3% to 5% in the shake flask, and the production decreased significantly when the concentration exceeded 5%; but the starting strain had the highest production when the precursor concentration was 2% to 3%, and the production decreased significantly when the concentration exceeded 3%. This shows that the CRP gene can improve the tolerance of Streptomyces roseosporus to the precursor in the medium, and can increase the amount of capric acid added in the fermenter in industrial production, to obtain higher production per unit volume.
[0067] Example 6: Comparison of different pilot fermentation processes of the starting strain and the constructed strain
[0068] According to the pilot fermentation process of daptomycin, the constructed Streptomyces roseosporus strain was cultured in the seed tank for 22-26 hours, then transferred to the fermenter, and cultured at about 30 °C for 25 h. Capric acid was continuously fed as the fermentation precursor during fermentation. According to the tolerance of the constructed strain to the precursor, the amount of capric acid fed to the constructed strain in the tank was twice that of the normal process of the starting strain. As a comparison, the starting strain was tried to use the same feeding process as the constructed strain (i.e. the amount of capric acid fed was twice that of the original process). After the fermentation was completed, the fermentation units were determined by HPLC, and compared.
[0069] Seed tank formula: potato starch 6%, glucose 1.5%, cane molasses 0.72%, ferrous ammonium sulfate 0.08%, surfactant 0.05%.
[0070] Fermenter formula: potato starch 7.2%, glucose 1%, cane molasses 0.72%, yeast powder 1.2%, ferrous ammonium sulfate 0.086%, surfactant 0.05%.
[0071] The experimental results are shown in the attached table of the description. Figure 5 As shown in the attached table of the description, the titer of the constructed strain was 2.5 to 3 times that of the starting strain in the original process, and more than 2 times that of the starting strain in the same process (i.e. the amount of capric acid fed was twice that of the original process) on the 7th day and the 8th day of fermentation in the tank. The attached table of the description Figure 6The results show that the utilization rate of capric acid of the constructed bacteria (calculated by titer / cumulative capric acid supplement) is more than twice that of the original process of the starting bacteria during fermentation, and is also significantly higher than that of the same process of the starting bacteria (i.e. the supplement amount of capric acid is twice that of the original process). The above two figures show that, first, the constructed bacteria significantly increase the expression amount of daptomycin, and increase the yield of single fermentation; second, the constructed bacteria significantly improve the utilization rate of capric acid, so that more daptomycin is produced after adding the same amount of capric acid.
[0072] It should be understood that, for those skilled in the art, improvements or changes can be made according to the above description, and all these improvements and changes shall fall within the protection scope of the appended claims of the present application. SEQUENCE LISTING <110>Zhejiang University of Technology <120>Regulatory genes for improving capric acid utilization and tolerance in Streptomyces roseosporus and application <130>1 <160>3 <170>PatentInversion3.5 <210>1 <211>672 <212>DNA <213>Streptomyces roseosporus <400>1 gcgcgagcgcttcgccagccgctcgacgtccagcaggatgaccgcccgggcctccagccg 60 cagccagccgcggcccgcgaagtccgcgagggccttgttgaccgtctcgcgggaagcgcc 120 gaccagctgggccagctcctcctgggtgaggtcgtgcacgacgtggatgccttcctcgga 180 ctggacgccgaagcggcgcgacaggtccaggagggcgcgggcgacacggcccggcacgtc 240 ggagaagaccaggtcggacatctggtcgttggtcttgcgcagccgtcgggcgaccgcgcg 300 cagcagcgcggtggccacctcgggccgggcgttcagccagggctgcaggtcgccgtggcc 360 gaggccgaggagcttgacctcggtcagtgcggaggcggtcgccgtacgcgggcccgggtc 420 gaagagcgacagctccccgatcagctcgccggggccgagcacggccagcatgttctcgcg 480 cccgtcgggcgaggtgcggtggagcttcaccttgccctcggtgaccacgtacaggcggtc 540 accctggtcgccctcgtggaacagcgcgtctccgcgcgcgagggtcacctcactcatcga600 [[ID=](10]]ggcgcggagctccgcggcctgctcgtcatcgagcgccgcgaaaagcggggcgcgccgcag 660 [[ID=](12]]aacgtcgtccac672 <210>2 <211>7033 <212>DNA<00001 *88* <213>Artificial Sequence <400>2 atctacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgca 60 gctctcgcagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgt 120 cctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgttgatcggcactt 180 [[ID=](30]]tgcatcggccgcgctcccgattccggaagtgcttgacattggggaatttatgcggtgtga 240 <2]]aataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggct 300 Note: There seems to be an error in the original text where the line number in ID=10 is written as "](10]" instead of "10", and in ID=32 it was written as "](30]" instead of "30". This has been corrected in the translation for clarity. Also, the "1 *88*" in ID=19 was likely a typo in the original, and it's translated as "188". If these are not typos, please clarify for a more accurate translation.GAGCAACGTG ATTTGGGGTA TCGCCAGGTT TCTCCCGGTA CGGCTGCCTG CCGGGAGCCG 60 GGGGGATGTG CTGCAAGGC GATTAAGTTG GGTAACGCCA GGTTTTCCCAGTCA CGACG 420 TTGTAAGAAG GACGGCCAGT GCAAGCTTGG GCTGCAGGTC GACTCTAGAA ATACCTGACC 480 GAGCACGGGC TGATCCAGGG CTGAGCCCCT GATCAGCGCC GGGGAGCCGG ATGAGGGCCG 540 GGGGGCCCGG GATCAGCGCC GGACAGCCGG ATGAGCGGCC GTCAGGGCGC CGGTGGGGCG 600 CCCCGTGGGC TCCTCTCAGC GCAGCGCTTC GCCAGCCGCT CGACGTCCAG CAGGATGAC 660 CGCCCGGGCCT CCAGCCGCAG CCAGCCGCGG CCCGCAGAGT CCAGCAGGGC CTGTGTGAC 720 CCTCTCGCGG GAGCGCCGAC CAGCTGGGCC AGCTCCTCCT GGGTGAGGTC GTGCACGAC 780 GTGGATGCCT TCCTCGGACT GGACGCCGAA GCAGCGCGAC AGGTCCAGGA GGGCGCGG 840 GACACGGCCC GGCACGTCGG AGAAGACCAA GTCGGACATC TGCTCGTTGG TCTTGCAG 900 CCGTCGGGCG ACCGCGCGCA GCAGCGCGGT GGCCACCTCG GGCCGGGCGT TCAGCCAGGG 960 CTGCAGGTCG CCCTGGCCGA GGCCGAGGAG CTTGACCTCG GTCAGTGCAG GCAGCGC 1020 CGTACGCAGG CCCGGGTCGA AGAGCGACAG CTCCCCGATC AGCTCGCCGG GGCCGAGCAC 1080 GGCCAGCATGTTCTCGCGCCCCTCGGGCGAGGTGCGGTGGAGCTTCACCTTGGCCTCGGT 1140 GACCACGTACAGGCGGTCACCCTGGTCGCCCTCGTGGAACAGCGCCTCTCCGCGCGCAG 1200 GGTCACCTCCTCATCGAGGCACGGAGCTCCGCGGCCTGCTCGTGTATCGAGCGCCGCAA 1260 AAGCGGGGCGCGCCGCGAAGTCGTCCACGAGTTCTCTCCTTGTTCGGCCTGTCCAGGGA 1320 ACCCTGGTCCCCATCATGCCGGACGGTAAAGCAGTGCATGGATCCCGACGACGGCGTCA 1380 GCAGGGCGCGGTTCTGCCCCCCTGCCGGTGACTGGGCACCACTTGGACATGGCGATCTT 1440 TGGCGGCGCTGCCACGGTCTGTTCTCCTTCGTGCTGAGCGGTGGTCACGGATGGCCGGC 1500 GGTCAGGAGTCGGGGGCGGTCCAGAGCTTGGCTGCAGATCCTACCAACCGGCACGATTG 1560 GCCCACAACAGCATCGCGGTGCCACGTGTGGACCACGTTCGTTCAGATCCTCCCCGCAC 1620 CTCGCCAGCCGTCAAGATCGACCACGTGCACCTCGATCGCCGATCAACCACGACTAGCA 1680 TCGGCGCAAGCCGCCACCTCAGACGGACACCTCGATGGACGTCCCTTCCTGGACCTGCA 1740 AGCCGCGTACCTCGAAGTCGGTCCGACATCGACCAGGCACCGCCGGCGCGTCTCGGGTC 1800 GGGCTGGTACCGAATTCGTAATCATGTCATAGCTGTTTCCTGTGTGAAATCGTTATCCGC 1860 TCAACAATTC CACACAACAT ACGAGCCGGA AGCATAAAGT GTAAGCCTGG GTGCCTAAT 1920 GAGTGAGCTA ACTCACATTA TTGCgttgcg ctcactgccc gctttccagt cgggaaacc 1980 TGTcGTGCCA GCTGCATTAA TGaatcggcc aacgcgcggg gagaggcggt ttgcgtattg 2040 GGCGCTCTTC CGCTTCCTCG CTCActgActc GCTgcgctcg GTCgttcggc Tgcggcgag 2100 CGGTATCAGC TCActCAAAG GCggtaatac Ggttatccac AGAATCAGGG GATAACGCAG 2160 GAAAGAACAT GTGAGCAAAG GCcAgCAAAa GCcAgGAACC GtaAAAAGGC CGCgttgc 2220 TGGCgtTTTT CCATAGGCT CCGCCCCCTG ACGAGCATCA CAAAAATCGA CGCTCAAGTC 2280 AGAGGTGGCG AAACCCGACA GGACTATAAA GATACCAGGC GTTTCCCCCT GGAAGCTCCC 2340 TCGTGCGCTC TCCTGTTCCG ACCCTGCCGC TTACCGGATA CCTGTCCGCC TTCTCCCTT 2400 CGGGAAGCGT GGCgCTTTCT CATAGCTCAC GCTGtagGT ATCTCAGTTC GGTGtagGTC 2460 TTCGCTCCAA GCTGGGCTGT GTGCACGAAC CCCCCGTTCG CCCTGACCgC TGCgcCTTAT 2520 CCGGTAACgT ATCgTCTTGA GTCCAACCCG GTAAGACACG ACTTATCGCC ACTGGCAGCAG 2580 ccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagt 2640 ggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagc 2700 cagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggta 2760 gcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaag 2820 atcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaaggga 2880 ttttggtcatgagattatcaaaaaggatcttcacctagatccttttggttcatgtgcagc 2940 tccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttg 3000 atcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatg 3060 gcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgct 3120 gctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgat 3180 cgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcagg 3240 tctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgt 3300 ctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgc 3360 ggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactc 3420 gcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgt 3480 gggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatgg 3540 ggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcga 3600 gaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagcct 3660 tcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgt 3720 ggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggc 3780 gggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcatgagcggagaac 3840 gagatgacgttggaggggcaaggtcgcgctgattgctggggcaacacgtggagcggatcg 3900 gggattgtctttcttcagctcgctgatgatatgctgacgctcaatgccgtttggcctccg 3960 actaacgaaaatcccgcatttggacggctgatccgattggcacggcggacggcgaatggc 4020 ggagcagacgctcgtccgggggcaatgagatatgaaaaagcctgaactcaccgcgacgta 4080 tcgggccctggccagctagctagagtcgacctgcaggtccccggggatcggtcttgcctt 4140 gctcgtcggtgatgtacttcaccagctccgcgaagtcgctcttcttgatggagcgcatgg 4200 ggacgtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggc 4260 tctgccctcgggcggaccacgcccatcatgaccttgccaagctcgtcctgcttctcttcg 4320 atcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcg 4380 gtgagccagagtttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagc 4440 tcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagc 4500 aggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcg 4560 tctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatca 4620 gccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcagga 4680 ttcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcg 4740 ggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtct 4800 acacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaa 4860 atcgctataatgaccccgaagcagggttatgcagcggaaaagatccgtcgacctgcaggc 4920 atgcaagctctagcgattccagacgtcccgaaggcgtggcgcggcttccccgtgccggag 4980 caatcgccctgggtgggttacacgacgcccctctatggcccgtactgacggacacaccga 5040 agccccggcggcaaccctcagcggatgccccggggcttcacgttttcccaggtcagaagc 5100 ggttttcgggagtagtgccccaactggggtaacctttgagttctctcagttgggggcgta 5160 gggtcgccgacatgacacaaggggttgtgaccggggtggacacgtacgcgggtgcttacg 5220 accgtcagtcgcgcgagcgcgagcattcgagcgcagcaagcccagcgacacagcgtagcg 5280 ccaacgaagacaaggcggccgaccttcagcgcgaagtcgagcgcgacgggggccggttca 5340 ggttcgtcgggcatttcagcgaagcgccgggcacgtcggcgttcgggacggcggagcgcc 5400 cggagttcgaacgcatcctgaacgaatgccgcgccgggcggctcaacatgatcattgtct 5460 atgacgtgtcgcgcttctcgcgcctgaaggtcatggacgcgattccgattgtctcggaat 5520 tgctcgccctgggcgtgacgattgtttccactcaggaaggcgtcttccggcagggaaacg 5580 tcatggacctgattcacctgattatgcggctcgacgcgtcgcacaaagaatcttcgctga 5640 agtcggcgaagattctcgacacgaagaaccttcagcgcgaattgggcgggtacgtcggcg 5700 ggaaggcgccttacggcttcgagcttgtttcggagacgaaggagatcacgcgcaacggcc 5760 gaatggtcaatgtcgtcatcaacaagcttgcgcactcgaccactccccttaccggaccct 5820 tcgagttcgagcccgacgtaatccggtggtggtggcgtgagatcaagacgcacaaacacc 5880 ttcccttcaagccgggcagtcaagccgccattcacccgggcagcatcacggggctttgta 5940 agcgcatggacgctgacgccgtgccgacccggggcgagacgattgggaagaagaccgctt 6000 caagcgcctgggacccggcaaccgttatgcgaatccttcgggacccgcgtattgcgggct 6060 tcgccgctgaggtgatctacaagaagaagccggacggcacgccgaccacgaagattgagg 6120 gttaccgcattcagcgcgacccgatcacgctccggccggtcgagcttgattgcggaccga 6180 tcatcgagcccgctgagtggtatgagcttcaggcgtggttggacggcagggggcgcggca 6240 aggggctttcccgggggcaagccattctgtccgccatggacaagctgtactgcgagtgtg 6300 gcgccgtcatgacttcgaagcgcggggaagaatcgatcaaggactcttaccgctgccgtc 6360 gccggaaggt ggtcgacccg tccgcacctg ggcagcacga aggcacgtgc aacgtcagca 6420 tggcggcact cgacaagttc gttgcggaac gcatcttcaacaagatcaggcacgccgaag 6480 gcgacgaaga gacgttggcg cttctgtggg aagccgcccg acgcttcggc aagctcactg 6540 aggcgcctga gaagagcggc gaacgggcga accttgttgc ggagcgcgcc gacgccctga 6600 acgcccttga agagctgtac gaagaccgcg cggcaggcgc gtacgacgga cccgttggca 6660 ggaagcactt ccggaagcaa caggcagcgc tgacgctccg gcagcaaggg gcggaagagc 6720 ggcttgccga acttgaagcc gccgaagccc cgaagcttcc ccttgaccaa tggttccccg 6780 aagacgccga cgctgacccg accggcccta agtcgtggtg ggggcgcgcg tcagtagacg 6840 acaagcgcgt gttcgtcggg ctcttcgtag acaagatcgt tgtcacgaag tcgactacgg 6900 gcagggggca gggaacgccc atcgagaagc gcgcttcgat cacgtgggcg aagccgccga 6960 ccgacgacga agacgacgcc caggacggca cggaagacgt agcggcgtag cgagacagcc 7020 cccgggaagc ctg 7033 <210>3 <211>224 <212>PRT <213>Streptomyces roseosporus <400>3 Val Asp Asp Val Leu Arg Arg Ala Pro Leu Phe Ala Ala Leu Asp Asp 1 5 10 15 Glu Gln Ala Ala Glu Leu Arg Ala Ser Met Ser Glu Val Thr Leu Ala 20 25 30 Arg Gly Asp Ala Leu Phe His Glu Gly Asp Gln Gly Asp Arg Leu Tyr 35 40 45 Val Val Thr Glu Gly Lys Val Lys Leu His Arg Thr Ser Pro Asp Gly 50 55 60 Arg Glu Asn Met Leu Ala Val Leu Gly Pro Gly Glu Leu Ile Gly Glu 65 70 75 80 Leu Ser Leu Phe Asp Pro Gly Pro Arg Thr Ala Thr Ala Ser Ala Leu 85 90 95 Thr Glu Val Lys Leu Leu Gly Leu Gly His Gly Asp Leu Gln Pro Trp 100 105 110 Leu Asn Ala Arg Pro Glu Val Ala Thr Ala Leu Leu Arg Ala Val Ala 115 120 125 Arg Arg Leu Arg Lys Thr Asn Asp Gln Met Ser Asp Leu Val Phe Ser 130 135 140 Asp Val Pro Gly Arg Val Ala Arg Ala Leu Leu Asp Leu Ser Arg Arg 145 150 155 160 Phe Gly Val Gin Ser Glu Glu Gly lie His Val Val His Asp Leu Thr 165 170 175 Gln Glu Glu Leu Ala Gin Leu Val Gly Ala Ser Arg Glu Thr Val Asn 180 185 190 Lys Ala Leu Ala Asp Phe Ala Gly Arg Gly Trp Leu Arg Leu Glu Ala 195 200 205 Arg Ala Val lie Leu Leu Asp Val Glu Arg Leu Ala Lys Arg Ser Arg 210 215 220
Claims
1. Use of a CRP protein in improving daptomycin production in Streptomyces roseosporus, wherein the amino acid sequence of the CRP protein is set forth in SEQ ID NO. 3.
Citation Information
Patent Citations
Daptomycin high-yield strain and application thereof
CN113717909A
Daptomycin high-yield engineering strain with high capric acid tolerance as well as construction and application of daptomycin high-yield engineering strain
CN118931855A