Highly expressed nicotine chimeric gene, its expression vector and application

Abstract

The present invention discloses a high-expression nicotine chimeric gene, an expression vector and an application thereof, aiming to solve the technical problem of low nicotine biosynthesis efficiency in current tobacco. PMT1 The promoter contains the G-box element sequence "ATGCACGTTGTAAT", which realizes the regulation of the tobacco nicotine biosynthesis gene PMT, and the relevant chimeric genes and engineered bacteria are modified and designed. When applied to tobacco transformation, they can significantly increase the biosynthesis of tobacco nicotine.

Description

Technical Field

[0001] The present invention relates to the technical field of biological gene engineering, and in particular to a high-expression nicotine chimeric gene, an expression vector and an application thereof. Background Art

[0002] Nicotin, also known as nicotine, has a chemical name of 1-methyl-2-(2-pyridyl)pyrrolidine and a molecular formula of C 10 H4N2 is a natural alkaloid found in tobacco plants. Nicotine can produce certain physiological stimulation to humans and is one of the main factors that make tobacco valuable as a commodity.

[0003] At present, nicotine, as an important industrial raw material, has been used in many fields such as food, health care, medicine and daily chemical industry. For example, the production of tobacco substitutes requires a large amount of nicotine: current treatments for tobacco dependence include drug therapy, psychotherapy, acupuncture and traditional Chinese medicine treatment, etc. The treatment plans and drugs approved by the US FDA mainly include nicotine replacement therapy such as nicotine patches, oral gums, nasal sprays and inhalers, and nAChR inhibitor drug treatment, such as bupropion, varenicline tartrate, mekara, nortriptyline, clonidine and anti-anxiety drugs. The production of these nicotine substitutes requires a large amount of nicotine as raw material; in addition, nicotine is also widely used in the development of environmentally friendly pesticides, such as nicotine series pesticides, which are plant insecticides. Because of their steam fumigation, stomach poison, contact killing functions and rapid degradation without residue, they are widely used as insecticides for crops such as grain, oil, vegetables, fruits, and forage. They are ideal high-efficiency insecticides and biological pesticides for the production of green food; nicotine is also widely used in the pharmaceutical industry, and is a special raw material for the development of drugs for the treatment of cardiovascular, skin diseases, snake venom and other diseases; nicotine can also be used to prepare nicotine citrate, which can be used as a component of the variety improver for high-end cigarettes. Moreover, with the rapid development of tobacco industry, fine chemicals, pharmaceuticals, organic synthesis, pesticides, etc., the market demand for nicotine is increasing day by day, especially the demand for high-purity nicotine, but the current method of obtaining nicotine by biosynthesis of tobacco is difficult to meet the demand.

[0004] Studies have shown that proteins involved in plant nicotine biosynthesis include ornithine decarboxylase (ODC), quinolinate synthetase (QS), aspartate oxidase (AO), quinolinate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), and diamine oxidase (DAO); further studies have found that PMT (putrescine N-methyltransferase) is the rate-limiting enzyme in nicotine biosynthesis, which is encoded by three genes (PMT1, PMT2, PMT3). Therefore, based on the regulation of nicotine biosynthesis-related control genes, it is also an important way to regulate the amount of nicotine biosynthesis in tobacco that is worth exploring.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] The G-Box element with a highly conserved core sequence CACGTT is generally considered to be a regulatory element for plants to respond to external environmental stimuli (light-responsive element of light-controlled genes); however, the inventors found through in-depth research that a certain strategy of doubling tobacco PMT1 The promoter contains the sequence "ATGCACGTTGTAAT" of the G-box (CACGTT) element, which can initiate downstream transcription at a high level. PMT1 Gene expression, thereby increasing the biosynthesis of nicotine.

[0007] According to one aspect of the present disclosure, a high-expression nicotine chimeric gene is provided, containing nicotine NtPMT1 A promoter and a sequence encoding a target gene operably linked thereto; the nicotine NtPMT1 The nucleotide sequence of the promoter is:

[0008] (1) as shown in SEQ ID NO.1; or

[0009] (2) Based on the nucleotide sequence shown in SEQ ID NO.1, the sequence containing the G-box element ATGCACGTTGTAAT was doubled.

[0010] In some embodiments of the present disclosure, the doubling multiple is 2-10.

[0011] In some embodiments of the present disclosure, the nicotine NtPMT1 The nucleotide sequence of the promoter is shown in SEQ ID NO.2 or SEQ ID NO.3.

[0012] In some embodiments of the present disclosure, the target gene is GUS Gene or PMT1 Gene.

[0013] In some embodiments of the present disclosure, the nucleotide sequence of the chimeric gene is shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6.

[0014] According to another aspect of the present disclosure, an expression vector is provided, comprising the high-expression nicotine chimeric gene.

[0015] According to another aspect of the present disclosure, an engineered bacterium is provided, comprising the high-expression nicotine chimeric gene.

[0016] In some embodiments of the present disclosure, the use of the high-expression tobacco chimeric gene, the expression vector or the engineered bacteria in regulating tobacco nicotine biosynthesis is disclosed.

[0017] According to another aspect of the present disclosure, there is provided a method for increasing the biosynthesis of nicotine in tobacco, comprising the following steps:

[0018] (1) The highly expressed nicotine NtPMT1 The promoter was inserted into the multiple cloning site of the pCAMBIA-NPT-GUS vector to obtain a plant expression vector;

[0019] (2) Using tobacco cDNA as a template, primers were designed based on the tobacco PMT1-mRNA sequence to amplify NtPMT1 Gene CDS sequence;

[0020] (3) Use Spe I and BstE II The plant expression vector obtained in the double enzyme digestion step (1) is amplified in step (2) PMT1 Gene ligated to pCAMBIA-NPT- NtPMT1 -Pro- GUS Carrier Spe I and BstE II site, replace the original GUS Gene, obtain recombinant plasmid;

[0021] (4) The recombinant plasmid obtained in the previous step is transformed into tobacco plants using the Agrobacterium transformation method. Positive plants are selected for kanamycin resistance and transplanted normally after rooting culture.

[0022] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0023] 1. Based on the improved high-expression nicotine chimeric gene, a nicotine biosynthesis regulatory expression vector was constructed and used to transform tobacco plants. GUS Gene or NtPMT1 High level expression of genes in tobacco.

[0024] 2. Chimeric genes NtPMT1 The promoter can be specifically expressed in tobacco and can initiate downstream NtPMT1 The expression of genes and the subsequent enhancement of nicotine biosynthesis are of great significance for the biological preparation of nicotine raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 In one embodiment of this application NtPMT1 Promoter PCR amplification electrophoresis diagram, where NtPMT1 by N.tabacumK326 as template; NsPMT1 in tobacco N.sylvestris As a template.

[0026] Figure 2 For the tobacco nicotine promoter vector plasmid PCR and SpeⅠ and SacⅡ Double enzyme digestion verification electrophoresis diagram, where 1: pCAMBIA-NPT- PMT1 -1N-Pro-GUS double enzyme digestion; 2: pCAMBIA-NPT- NtPMT1 -4N-Pro-GUS double enzyme digestion; 3: pCAMBIA-NPT- NtPMT1 -10N-Pro-GUS double restriction enzyme digestion; M2: 10000 bp DNA Maker.

[0027] Figure 3 This is an electrophoresis diagram of plasmid PCR identification after the recombinant expression vector was transformed into Agrobacterium in one embodiment of the present application, wherein A: pCAMBIA-NPT NtPMT1 -1N-Pro:GUS plasmid PCR identification after transformation of Agrobacterium; M: Maker; 1: 1N-GUS strain; B: pCAMBIA-NPT- NtPMT1 -4N-Pro:GUS transformed into Agrobacterium and identified by plasmid PCR M:Maker 1:4N-GUS strain; C:pCAMBIA-NPT- NtPMT1 -10N-Pro: Plasmid PCR identification after GUS transformation into Agrobacterium; M: Maker; 1: 10N-GUS strain.

[0028] Figure 4 In one embodiment of the present application, pC-NPT- NtPMT1 -1N-Pro:GUS, pC-NPT- NtPMT1 -4N-Pro:GUS, pC-NPT-NtPMT1-10N-Pro:GUS transformed tobacco genetic transformation diagram: A is the negative control, untransformed tobacco leaves; B is the positive control, differentiation of untransformed tobacco leaves; C is the differentiation of transgenic tobacco; D is the rooting of transgenic tobacco.

[0029] Figure 5 This is a PCR identification diagram of transgenic tobacco in an embodiment of the present application, wherein M: Maker; Yang: positive control; Yin: negative control; 1-3: transfection of pCAMBIA-NPT- NtPMT1 -1N-Pro-PMT1;4-6: transfer to pCAMBIA- NtPMT1 -4N-Pro-PMT1;7-8: transfer to pCAMBIA- NtPMT1 -10N-Pro-PMT1.

[0030] Figure 6 This is the GUS staining image of the transgenic tobacco leaves in one embodiment of the present application, wherein A: negative control, is the staining image of the untransformed tobacco leaves; B and E are positive controls, are the staining images of the pC-NPT-1N-Pro:GUS transgenic tobacco leaves; C and F are positive controls, are the staining images of the pC-NPT-4N-Pro:GUS transgenic tobacco leaves; D and G: are positive controls, are the staining images of the pC-NPT-10N-Pro:GUS transgenic tobacco leaves.

[0031] Figure 7 In one embodiment of the present application, pC-NPT- NtPMT1 -10N-Pro:GUS transgenic tobacco T0 generation seedlings GUS expression analysis diagram, where 1N: pC-NPT- NtPMT1 -1N-Pro:GUS;4N:pC-NPT- NtPMT1 -4N-Pro:GUS; 10N:pC-NPT NtPMT1 -10N-Pro:GUS.

[0032] Figure 8 In one embodiment of this application NtPMT1 PCR amplification of gene CDS and PCR identification of connected T vector, where A: NtPMT1 PCR amplification of mRNA; B: NtPMT1 PCR identification of gene T vector-connected colonies; in the figure, M: Marker; positive: positive control negative: negative control 1: NtPMT1 Gene amplification; 2-7: T vector ligation colonies.

[0033] Figure 9 In one embodiment of this application NtPMT1 Schematic diagram of gene expression vector construction.

[0034] Figure 10 For the transfer of one embodiment of this application NtPMT1 PCR verification diagram of gene vector, where M: Maker; 1: pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 Vector; 2: pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 Vector; 3: pCAMBIA-NPT- NtPMT1 -10N-Pro- PMT1 carrier.

[0035] Figure 11 In one embodiment of this application PMT1Photos of genetically transformed tobacco plants, where A and F: positive controls; B and G: negative controls; CE: differentiation of transformed tobacco K326; HJ: differentiation of transformed tobacco NC89.

[0036] Figure 12 For the transfer of one embodiment of this application NtPMT1 DNA identification diagram of gene plants, where M: Maker; Yang: positive control; Yin: negative control; 1-3: transfected with pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 B 4-6: Transfection with pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 ; 7-9: Transform pCAMBIA-NPT- NtPMT1 -10N-Pro- PMT1 .

[0037] Figure 13 For the transfer of one embodiment of this application NtPMT1 Comparison of nicotine content in transgenic tobacco at 40 days after transplantation, among which WT1, WT2: non-transgenic control 1N8, 1N13, 1N17: transgenic pCAMBIA-NPT- NtPMT1 -1N-Pro- NtPMT1 Tobacco; 4N12, 4N13, 4N20: Transformed with pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 Tobacco; 10N2, 10N15, 10N23: Transformed to pCAMBIA-NPT NtPMT1 -10N-Pro- PMT1 tobacco.

[0038] Figure 14 For the transfer of one embodiment of this application PMT1 Comparison of organ expression analysis of nicotine synthesis-related genes in transgenic tobacco, among which WT1 and WT2 are non-transgenic controls, 1N8 and 1N13 are transgenic controls with pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 Tobacco; 4N12, 4N20: Transformed with pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 Tobacco; 10N2, 10N21: Transformed with pCAMBIA-NPT- PMT1 -10N-Pro- PMT1 Tobacco; *: significant difference; **: extremely significant difference.

[0039] Figure 15 For the transfer of one embodiment of this application NtPMT1Comparison of nicotine synthesis gene expression in transgenic tobacco, among which WT1, WT2: non-transgenic control 1N8, 1N13: transgenic pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 Tobacco; 4N12, 4N20: Transformed to pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 Tobacco; 10N2, 10N21: Transformed with pCAMBIA-NPT- NtPMT11 -10N-Pro- PMT1 Tobacco; *: significant difference; **: extremely significant difference. DETAILED DESCRIPTION

[0040] The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified; those skilled in the art should understand that the reagents, enzymes, carriers, etc. used in the following embodiments are analytically pure reagents, enzymes, and carriers commercially available from reagent companies unless otherwise specified. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.

[0041] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0042] Example 1 Obtaining Nicotine from Tobacco NtPMT1 Promoter:

[0043] (1) Preparation of tobacco genomic DNA

[0044] Take tobacco grown in the greenhouse for two months N. tabacum K326, the young leaves were taken, the genomic DNA was extracted by CTAB method, and the DNA was detected by agarose gel electrophoresis and stored at -20℃.

[0045] (2) Nicotine NtPMT1 Promoter cloning and sequence analysis

[0046] Using tobacco genomic DNA as template, PCR amplification was performed using PMT1-Pro upstream primer (CGGCGCGCCAAGCTTATTTTTTATTAAATACTATC) and downstream primer (TACAGCCATGAATTCGATATGACTTCCATTTTC).

[0047] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 10 min, denaturation at 94°C for 30 min, annealing at 55°C for 45 s, extension at 72°C for 45 min, for a total of 30 cycles, and storage at 4°C.

[0048] The PCR product was connected to the commercially available pCAMBIA-NPT-GUS vector and the existing 35S promoter in the vector was replaced to obtain the recombinant plasmid pCAMBIA-NPT- NtPMT1 -Pro:GUS. Perform plasmid PCR detection. For PCR amplification electrophoresis, see Figure 1 .

[0049] Then, combined with long-term practical research and the use of PLACE software (http: / / www.dna.affrc.go.jp / PLACE / ), we conducted a predictive analysis of the cis-acting elements in the promoter sequence and found that in addition to the basic conserved elements of eukaryotic promoters, TATA-box and CAAT-box, the promoter also contained plant hormone response elements such as MeJA and gibberellin, as well as elements such as G-Box (as shown in Table 1).

[0050] Table 1 Cis-acting elements in the promoter PMT1-Pro sequence and their predicted functions

[0051] .

[0052] (3) Improvement of nicotine PMT1 promoter

[0053] Mainly promoter NtPMT1 The sequence "ATGCACGTTGTAAT" containing the G-box (CACGTT) element was doubled, and three sequences containing 1, 4, and 10 G-box sequences were designed. NtPMT1 The promoter sequences were synthesized and named as PMT1-1N, PMT1-4N and PMT1-10N promoters, as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0054] Example 2: Nicotine NtPMT1 Verification of promoter activity:

[0055] Construction of plant expression vector: Take pCAMBIA-NPT-GUS vector, cut it with EcoRI / HindIII, and recover the large fragment for later use.

[0056] The PMT1-1N, PMT1-4N and PMT1-10N promoters designed in Example 1 were synthesized by a gene company, and the target fragment was ligated into pCAMBIA-NPT-GUS after restriction digestion. In a 10 μl system, the target fragment and the vector fragment were ligated with T4 ligase to obtain a recombinant plasmid, which was identified by PCR and double restriction digestion ( Figure 2 ) to determine the positive recombinant. GUSGene fusion, expression GUS Plant recombinant expression vector pCAMBIA-NPT- NtPMT1 -1N-Pro:GUS, pCAMBIA-NPT- NtPMT1 -4N-Pro:GUS and pCAMBIA-NPT- NtPMT1 -10N-Pro:GUS.

[0057] (1) Agrobacterium-mediated plant transformation

[0058] will express GUS Plant recombinant expression vector pCAMBIA-NPT- NtPMT1 -1N-Pro:GUS, pCAMBIA-NPT- NtPMT1 -4N-Pro:GUS and pCAMBIA-NPT- NtPMT1 -10N-Pro:GUS was used to transform Agrobacterium tumefaciens LBA4404, and the transformed Agrobacterium was cultured and the plasmid was extracted for PCR identification. Figure 3 , and then confirmed that the plasmid was transferred into Agrobacterium.

[0059] Take tobacco seeds, disinfect them with alcohol and sodium hypochlorite, and then sow them on MS culture medium. When the tobacco seedlings grow to 5-8 leaves, cut the tobacco leaves and put them into the Agrobacterium liquid transformed with the plasmid for infection. The specific operation is:

[0060] The above Agrobacterium was cultured in a 28°C incubator. 600 =0.8, add 20 mg / L AS (acetosyringone), put the cut tobacco leaves into Agrobacterium bacterial solution for infection for 8 min, dry the excess bacterial solution from the infected leaves and place them in the culture medium for culture and screening, and screen them on MS medium containing kanamycin (pCAMBIA-NPT-PMT1-Pro:GUS vector carries kanamycin resistance) to obtain T0 generation transgenic tobacco. Figure 4 .

[0061] When the transgenic tobacco leaves grew to about 6 leaves, DNA was extracted from the T0 generation tobacco leaves and the primers PMT1-Pro upstream (CGGCGCGCCAAGCTTATTTTTTATTAAATACTATC) and GUS PCR identification was performed with the downstream primer (TGTTCGGCGTGGTGTAGAGCA). If a PCR amplification product of about 1300 bp was displayed (see Figure 5), the plant is a PMTI-10N-Pro transgenic plant. The PCR reaction conditions are: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 min, 58℃ annealing for 45 s, 72℃ extension for 45 min, a total of 30 cycles, and storage at 4℃.

[0062] (2) Transgenic plants GUS Expression activity analysis

[0063] GUS buffer: composed of solvent and solute. The solvent is pH 7.0, 50 mmol / L sodium hydrogen phosphate buffer. Solute and its concentration: 10 mmol / L EDTA, 0.1% Triton X-100 (volume ratio), 2 mmol / L potassium ferrohydride and 2 mmol / L potassium ferrohydride; stored at 4°C for future use. GUS staining solution: dissolve X-Gluc powder in N,N-dimethylformamide to make a 20 mmol / L solution, and store at -20°C for future use.

[0064] The leaves of the transgenic tobacco T0 generation were taken for GUS histochemical staining. When the transgenic tobacco leaves grew to about 6 leaves, one leaf was taken for GUS histochemical staining. The results are shown in Figure 6. Figure 6 As can be seen, the cells with strong GUS activity show a deep blue color, while the absence of blue indicates low GUS activity.

[0065] (3) Transgenic plants GUS Gene expression analysis

[0066] Transgenic tobacco T0 seeds were sterilized with alcohol and sodium hypochlorite and then sown on MS medium. When the tobacco seedlings grew to 5 leaves, 5 seedlings were taken to extract RNA. After reverse transcription of cDNA, RT-PCR was performed using GUS primers to analyze the GUS expression level ( Figure 7 ); Figure 7 The results showed that the GUS expression level in PMTI-10N-Pro transgenic tobacco T0 seedlings was significantly higher than that in the control.

[0067] Example 3 Obtaining transgenic chimeric plants:

[0068] (1) NtPMT1 PCR amplification and identification of gene CDS sequences

[0069] Using K326 cDNA as template, Nicotiana tabacum PMT1 -mRNA sequence design primer amplification NtPMT1 Gene sequence ( Figure 8 A), and connected to the T vector for sequencing and identification, and finally obtained 1162bp PMT1 Gene CDS sequence ( Figure 8 B).

[0070] (2) NtPMT1 Construction of gene expression vector and PCR identification

[0071] like Figure 9 As shown, use Spe I and BstE II Double enzyme digestion of the three constructed NtPMT1 Promoter plant expression vector, the amplified PMT1 Gene ligation into pCAMBIA-NPT-PMT1-Pro-GUS vector Spe I and BstE II site, replace the original GUS Gene, three recombinant plasmids containing chimeric genes (as shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6) were obtained: pCAMBIA-NPT- NtPMT1 -1N-Pro-PMT1(1N-PMT1), pCAMBIA-NPT- NtPMT1 -4N-Pro-PMT1 (4N-PMT1) and pCAMBIA-NPT- NtPMT1 -10N-Pro-PMT1(10N-PMT1).

[0072] The above three recombinant plasmids were identified by PCR. The results showed that PMT1 The gene has been successfully constructed into pCAMBIA-NPT- NtPMT1 -Pro-GUS vector (see Figure 10 ).

[0073] (3) NtPMT1 Genetic transformation of tobacco

[0074] The constructed recombinant plasmid was transformed into tobacco K326 and NC89 by Agrobacterium transformation, and positive plants were screened by kanamycin resistance. Sterile leaves that had not been infected were placed in differentiation medium without kanamycin as positive control ( Figure 11 A and F), and uninfected sterile leaves were placed on differentiation medium containing 30 mg / L kanamycin as negative control ( Figure 11 (B and G). After culturing on the selection medium for a period of time, the positive control differentiated normally, the leaves of the negative control gradually turned white and died, and the transgenics differentiated normally.

[0075] (4) Transfer NtPMT1 DNA Identification of Genetic Plants

[0076] Total DNA was extracted from the positive tobacco plants screened with kanamycin, and total DNA from untransformed tobacco K326 and NC89 plants was extracted as negative controls to verify the correct recombinant plasmid as a positive control. NtPMT1 Gene-specific primers were used to detect transgenic tobacco plants by PCR (results are shown in Figure 12 ).

[0077] Example 4 Analysis of conventional chemical components and related gene expression levels of transgenic chimeric plants:

[0078] (1) Transfer PMT1 Routine chemical analysis of genetically modified tobacco

[0079] Transgenic NtPMT1 The gene-positive plants were rooted and cultured for about 30 days before being transplanted. Samples were taken 40 days after transplanting, and the nicotine, reducing sugar, total sugar and potassium contents were determined by conventional chemical content determination using continuous flow analysis. The results showed that the nicotine content of the three transgenic lines was significantly increased compared to the non-transgenic control. The nicotine content of the 1N-PMT1 transgenic line was more than doubled compared to the control on average, and the nicotine content of the 4N-PMT1 and 10N-PMT1 transgenic lines was more than twice as high as the control on average. The highest nicotine content in the 4N-PMT1 and 10N-PMT1 transgenic lines was 2.5 times higher than that in the control. Among the three transgenic lines, the nicotine content of the 4N-PMT1 and 10N-PMT1 transgenic lines was significantly higher than that of the 1N-PMT1 transgenic line. There was no significant difference in nicotine content between the 4N-PMT1 and 10N-PMT1 transgenic lines (see Figure 13 ).

[0080] (2) Transfer PMT1 Tissue expression analysis of nicotine biosynthesis genes in tobacco

[0081] RNA was extracted from the roots and leaves of tobacco plants, and the expression of genes related to nicotine synthesis was determined by fluorescence quantitative PCR. The expression of nicotine synthesis-related genes in the roots of each strain was used as a control to analyze the data and draw a bar graph. Figure 14 As shown in Figure 1, seven nicotine biosynthesis genes are specifically expressed in roots and not expressed or expressed in trace amounts in leaves. PMT1 Genetic tobacco PMT1 The proportion of gene expression in leaves increased, but was still significantly lower than its expression in roots.

[0082] (3) Transfer PMT1 Gene Tobacco Nicotine Synthesis Gene Expression

[0083] Total RNA was extracted from the roots of the transgenic lines 40 days after transplantation, and then fluorescent quantitative PCR was performed. Figure 15As shown: the expression levels of MYC2a and MYC2b in the transgenic strains were significantly higher than those in the control strains. PMT1 The gene expression level was significantly higher than that of the control, but there was no obvious difference between the three transgenics.

[0084] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0085] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of this application and their equivalents, the present invention is also intended to include these modifications and variations. SEQUENCE LISTING <110> Henan Agricultural University <120> Highly expressed nicotine chimeric gene, its expression vector and application <130> / <160> 6 <170> PatentIn version 3.2 <210> 1 <211> 587 <212> DNA <213> PMT1-pro1N <400> 1 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttggggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atgatttttt 420 aactctatta tatcgagttg cgccctccac tcctcggtgt ccaaattgta tataaatgca 480 tatgtgtcta ttgggagtgt acatcaagct ttcataaagt acaaatcgta atacttgttg 540 aaacataata ctttctcttc tccaatttgt ttagtttaat tttgaaa 587 <210> 2 <211> 629 <212> DNA <213> PMT1-pro4N <400> 2 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatgatttt ttaactctat tatatcgagt 480 tgcgccctcc actcctcggt gtccaaattg tatataaatg catatgtgtc tattgggagt 540 gtacatcaag ctttcataaa gtacaaatcg taatacttgt tgaaacataa tactttctct 600 tctccaattt gtttagttta attttgaaa 629 <210> 3 <211> 713 <212> DNA <213> PMT1-pro10N <400> 3 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatat gcacgttgta 480 atatgcacgt tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatga 540 ttttttaact ctattatatc gagttgcgcc ctccactcct cggtgtccaa attgtatata 600 aatgcatatg tgtctattgg gagtgtacat caagctttca taaagtacaa atcgtaatac 660 ttgttgaaac ataatacttt ctcttctcca atttgtttag tttaattttg aaa 713 <210> 4 <211> 1754 <212> DNA <213> PMT1-pro1N+mRNA <400> 4 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atgatttttt 420 aactctatta tatcgagttg cgccctccac tcctcggtgt ccaaattgta tataaatgca 480 tatgtgtcta ttgggagtgt acatcaagct ttcataaagt acaaatcgta atacttgttg 540 aaacataata ctttctcttc tccaatttgt ttagtttaat tttgaaagaa ttcatggaag 600 tcatatctac caacacaaat ggctcgacca tcttcaagaa tggtgccatt cccatgaatg 660 gccaccagag tggcacttcc aaacacctca acggctacca gaacggcact tccaaacacc 720 aaaacggcca ccataatggc acttccgaac atcggaacgg ccaccagaat gggatttccg 780 aacaccaaaa cggccaccag aatgggactt ccgaacaaca gaacgggaca atcagccatg 840 acaatggcaa cgagctactg ggaaactcca actctattaa gcttggttgg ttttcagagt 900 ttagcgcatt atggccaggt gaagcattct cccttaaggt tgagaagtta ctatttcagg 960 ggaagtctga ctaccaagat gtcatgctct ttgagtcagc aacatatggg aaggttttga 1020 ctttggatgg agcaattcaa cacacagaga atggtggatt tccatacact gaaatgattg 1080 ttcatcttcc acttggttcc atcccaaacc caaaaaaggt tttgatcatc ggcggaggaa 1140 ttggttttac attattcgaa atgcttcgtt atcctacaat cgaaaaaatt gacattgttg 1200 aaatcgatga cgtggtagtt gatgtatcta gaaaatcttt cccttatctc gcagctaatt 1260 ttaatgatcc tcgtgtaacc ctcgttctcg gagatggggc tgcatttgta aaggctgcac 1320 aagcaggata ttatgatgct attatagtgg actcttctga tcccattggt ccagcaaaag 1380 atttgtttga gaggccattc tttgaggcag tagccaaagc cctaaggcca ggaggagttg 1440 tatgcacaca ggccgaaagc atttggcttc atatgcatat tattaagcaa atcattgcta 1500 actgtcgtca agtctttaag ggctctgtca actacgcttg gactactgtt ccaacatatc 1560 ccactggtgt aattgggtat atgctctgct ctactgaagg gccagaagtt gacttcaaga 1620 atccaataaa tccaattgac aaagagacaa ctcaagtcaa gtccaaatta gcacctctca 1680 agttttacaa ttctgatatt cacaaagcag cattcattt gccatctttc gccagaagta 1740 tgatcgagtc ttaa 1754 <210> 5 <211> 1796 <212> DNA <213> PMT1-pro4N+mRNA <400> 5 attttttat aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattat taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatgatttt ttaactctat tatatcgagt 480 tgcgccctcc actctcggt gtccaaattg tatataaatg catatgtgtc tattgggagt 540 gtacatcaag ctttcataaa gtacaaatcg taatacttgt tgaaacataa tactttctct 600 tctccaattt gtttagttta attttgaaag aattcatgga agtcatatct accaacacaa 660 atggctcgac catcttcaag aatggtgcca ttcccatgaa tggccaccag agtggcactt 720 ccaaacacct caacggctac cagaacggca cttccaaaca ccaaaacggc caccataatg 780 gcacttccga acatcggaac ggccaccaga atgggatttc cgaacaccaa aacggccacc 840 agaatgggac ttccgaacaa cagaacggga caatcagcca tgacaatggc aacgagctac 900 tgggaaactc caactctatt aagcttggtt ggttttcaga gtttagcgca ttatggccag 960 gtgaagcatt ctcccttaag gttgagaagt tactatttca ggggaagtct gactaccaag 1020 atgtcatgct ctttgagtca gcaacatatg ggaaggtttt gactttggat ggagcaattc 1080 aacacacaga gaatggtgga tttccataca ctgaaatgat tgttcatctt ccacttggtt 1140 ccatcccaaa cccaaaaaag gttttgatca tcggcggagg aattggtttt acattattcg 1200 aaatgcttcg ttatcctaca atcgaaaaaa ttgacattgt tgaaatcgat gacgtggtag 1260 ttgatgtatc tagaaaatct ttcccttatc tcgcagctaa ttttaatgat cctcgtgtaa 1320 ccctcgttct cggagatggg gctgcatttg taaaggctgc acaagcagga tattatgatg 1380 ctattagt ggactcttct gatcccattg gtccagcaaa agatttgttt gagaggccat 1440 tctttgaggc agtagccaaa gccctaaggc caggaggagt tgtatgcaca caggccgaaa 1500 gcatttggct tcatatgcat attattaagc aaatcattgc taactgtcgt caagtcttta 1560 agggctctgt caactacgct tggactactg ttccaacata tcccactggt gtaattgggt 1620 atatgctctg ctctactgaa gggccagaag ttgacttcaa gaatccaata aatccaattg 1680 acaaagagac aactcaagtc aagtccaaat tagcacctct caagttttac aattctgata 1740 ttcacaaagc agcattcatt ttgccatctt tcgccagaag tatgatcgag tcttaa 1796 <210> 6 <211> 1880 <212> DNA <213> PMT1-pro10N+mRNA <400> 6 atttttatt aataactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatat gcacgttgta 480 atatgcacgt tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatga 540 ttttttaact ctattatatc gagttgcgcc ctccactcct cggtgtccaa attgtatata 600 aatgcatatg tgtctattgg gagtgtacat caagctttca taaagtacaa atcgtaatac 660 ttgttgaaac ataatacttt ctcttctcca atttgtttag tttaattttg aaagaattca 720 tggaagtcat atctaccaac acaaatggct cgaccatctt caagaatggt gccattccca 780 tgaatggcca ccagagtggc acttccaaac acctcaacgg ctaccagaac ggcacttcca 840 aacaccaaaa cggccaccat aatggcactt ccgaacatcg gaacggccac cagaatggga 900 tttccgaaca ccaaaacggc caccagaatg ggacttccga acaacagaac gggacaatca 960 gccatgacaa tggcaacgag ctactgggaa actccaactc tattaagctt ggttggtttt 1020 cagagtttag cgcattatgg ccaggtgaag cattctccct taaggttgag aagttactat 1080 ttcaggggaa gtctgactac caagatgtca tgctctttga gtcagcaaca tatgggaagg 1140 ttttgacttt ggatggagca attcaacaca cagagaatgg tggatttcca tacactgaaa 1200 tgattgttca tcttccactt ggttccatcc caaacccaaa aaaggttttg atcatcggcg 1260 gaggaattgg ttttacatta ttcgaaatgc ttcgttatcc tacaatcgaa aaaattgaca 1320 ttgttgaaat cgatgacgtg gtagttgatg tatctagaaa atctttccct tatctcgcag 1380 ctaattttaa tgatcctcgt gtaaccctcg ttctcggaga tggggctgca tttgtaaagg 1440 ctgcacaagc aggatattat gatgctatta tagtggactc ttctgatccc attggtccag 1500 caaaagattt gtttgagagg ccattctttg aggcagtagc caaagcccta aggccaggag 1560 gagttgtatg cacacaggcc gaaagcattt ggcttcatat gcatattatt aagcaaatca 1620 ttgctaactg tcgtcaagtc tttaagggct ctgtcaacta cgcttggact actgttccaa 1680 catatcccac tggtgtaatt gggtatatgc tctgctctac tgaagggcca gaagttgact 1740 tcaagaatcc aataaatcca attgacaaag agacaactca agtcaagtcc aaattagcac 1800 ctctcaagtt ttacaattct gatattcaca aagcagcatt cattttgcca tctttcgcca 1860 gaagtatgat cgagtcttaa 1880

Claims

1. A high expression nicotine chimeric gene containing nicotine NtPMT1 A promoter and a sequence encoding a target gene operably linked thereto; the nicotine NtPMT1 The nucleotide sequence of the promoter is: based on the nucleotide sequence shown in SEQ ID NO.1, the sequence ATGCACGTTGTAAT containing the G-box element is doubled, and the doubling multiple is 4 times or 10 times; the nicotine NtPMT1 The nucleotide sequence of the promoter is shown in SEQ ID NO.2 or SEQ ID NO.3; the target gene is PMT1 Gene.

2. The high-expression nicotine chimeric gene according to claim 1, characterized in that: Its nucleotide sequence is shown as SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.

6.

3. An expression vector comprising the high-expression nicotine chimeric gene according to claim 1.

4. An engineered bacterium comprising the high-expression nicotine chimeric gene according to claim 1.

5. Use of the high-expression nicotine chimeric gene according to claim 1, the expression vector according to claim 3 or the engineered bacteria according to claim 4 in regulating tobacco nicotine biosynthesis or cultivating high-expression tobacco strains.

6. A method for increasing the biosynthesis of nicotine in tobacco, comprising the following steps: (1) Synthesizing the nicotine described in claim 1 NtPMT1 promoter and inserted into the pCAMBIA-NPT-GUS vector EcoR I and Hind III The 35S promoter was replaced by the site to obtain the plant expression vector pCAMBIA-NPT- NtPMT1 - GUS ; (2) Using tobacco cDNA as a template, primers were designed based on the tobacco PMT1-mRNA sequence to amplify PMT1 Gene CDS sequence; (3) Use Spe I and BstE The plant expression vector obtained in the double enzyme digestion step (1) is amplified in step (2) NtPMT1 Gene ligated to pCAMBIA-NPT- NtPMT1 - GUS Carrier Spe I and BstE site, replace the original GUS Gene, obtain recombinant plasmid; (4) The recombinant plasmid obtained in the previous step is transformed into tobacco plants using the Agrobacterium transformation method. Positive plants are selected for kanamycin resistance and transplanted normally after rooting culture.

Images