Catalase gene and its applications

Abstract

The present invention discloses a catalase gene and its application. By means of genetic engineering, the present invention constructs an expression cassette of catalase and introduces it into a recombinant expression host bacterium, achieving the high-efficiency secretory expression of catalase and obtaining a high-yield catalase recombinant strain. Compared with the catalase gene before optimization, its catalase activity is significantly improved, reaching 8907 U / ml. Using the fermentation process of the present invention, in a 7L fermenter for fermentation culture, the catalase activity can reach 368900 U / mL. The obtained catalase has an optimal temperature of 40°C, with a relative enzyme activity greater than 80% at pH 5 - pH 9, and can still maintain 70% of its enzyme activity after 3 minutes at 75°C. The enzyme activity is relatively stable and has good heat resistance, and can be widely used in food, textile, medical, industrial, and paper-making industries.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly relates to a catalase gene and its application. Background Art

[0002] Catalase (Hydrogen peroxide oxidoreductase, catalase EC 1.11.1.6.) is an enzyme that uses hydrogen peroxide as a specific substrate and finally degrades it into water and oxygen by catalyzing the transfer of a pair of electrons. This enzyme is one of the key enzymes in the biological defense system established during biological evolution and has important applications in industries such as food, medicine, textile, papermaking, and environmental protection.

[0003] Catalases from different sources are located differently in cells. Catalases in animal red blood cells, liver, and bacteria are present in the cytoplasm, and the cells must be broken to extract the catalase. Therefore, the separation and purification of the enzyme are relatively complex. Although the thermal and alkali stabilities of bacterial catalases can vary depending on the source, since they are intracellular enzymes, it is not convenient to achieve high production and extraction. Catalases in yeast mainly accumulate intracellularly, while catalases in some filamentous fungi are mainly secreted extracellularly, and a certain amount of catalase is also contained intracellularly. Therefore, choosing filamentous fungi to produce catalase has great advantages in terms of application and product extraction. In addition, there are also studies on producing catalase by constructing genetically engineered bacteria.

[0004] Currently, the catalase sold on the market is mainly obtained by microbial fermentation. At present, for the catalase-producing strains reported in some literature and patents, the fermentation enzyme activity is relatively low. For example, the patent document CN107384886B discloses the construction of a highly efficient recombinant expression Aspergillus niger engineering strain using the catalase sequence of Aspergillus sp., and the shake flask fermentation enzyme activity is as high as 3150 U / mL. The patent document CN106520575B provides a strain of Aspergillus niger with high catalase production. Using this strain for industrial fermentation production, the fermentation enzyme activity level can reach more than 152000 U / mL after 190 h.

[0005] Further improving the fermentation enzyme activity in industrial fermentation production is beneficial to reducing costs, facilitating the wider application of enzyme preparations, and contributing to energy conservation and emission reduction. Therefore, developing catalase strains with high activity using genetic engineering technology means has important application value.

[0006] Known filamentous fungi have extremely high protein secretion ability and are suitable as hosts for producing recombinant proteins such as enzymes. Therefore, when the catalase gene is transformed into filamentous fungi for high-level expression in the form of recombinant proteins, the expression level of catalase will be significantly increased. Summary of the Invention

[0007] The object of the present invention is to construct a strain with high-yield recombinant expression of catalase by means of genetic engineering, and to achieve efficient secretion and expression of catalase. The present invention provides a codon-optimized catalase gene with high enzyme activity. The inventors screened an Aspergillus fumigatus strain producing catalase from the environment, cloned the gene CatO encoding catalase from its genomic DNA, and determined its base sequence. After codon optimization, high-level expression of catalase was achieved through the Aspergillus niger engineering strain VT-002.

[0008] The technical solution adopted by the present invention is as follows:

[0009] In the first aspect of the present invention, a catalase CatR gene is provided, and the sequence of the catalase CatR gene is as shown in SEQ ID NO.2.

[0010] In the second aspect of the present invention, an expression cassette is provided, and the expression cassette contains the catalase CatR gene described in the first aspect of the present invention.

[0011] In the third aspect of the present invention, an expression vector is provided, and the expression vector contains the catalase CatR gene described in the first aspect of the present invention or the expression cassette described in the second aspect of the present invention.

[0012] In some embodiments of the present invention, the expression vector further includes gene fragments of a promoter, a terminator, and a selection marker.

[0013] In some embodiments of the present invention, the promoter includes the promoter of an Aspergillus niger expression plasmid.

[0014] In some preferred embodiments of the present invention, the promoter is selected from one or more of the Aspergillus niger glucoamylase promoter, neutral amylase promoter, acid amylase promoter, Aspergillus oryzae neutral amylase promoter, and Rhizopus oryzae glucoamylase promoter.

[0015] In some preferred embodiments of the present invention, the promoter is the Aspergillus niger glucoamylase promoter and / or neutral amylase promoter.

[0016] In some more preferred embodiments of the present invention, the promoter is the Aspergillus niger glucoamylase promoter.

[0017] In some embodiments of the present invention, the selection marker is selected from one or more of acetamidase, ornithine carbamoyltransferase, hygromycin phosphotransferase, nitrate reductase, orotidine-5'-phosphate decarboxylase, sulfuryl adenyl transferase, anthranilate synthase, and their equivalents; preferably, the acetamidase of Aspergillus nidulans and hygromycin phosphotransferase are used in Aspergillus cells; more preferably, hygromycin phosphotransferase.

[0018] In a fourth aspect of the present invention, there is provided a recombinant cell, which comprises the expression vector described in the third aspect of the present invention.

[0019] In some embodiments of the present invention, the recombinant cell comprises multiple copies of the nucleotide sequence of SEQ ID NO.2.

[0020] In some embodiments of the present invention, the cell is a filamentous fungus.

[0021] In some embodiments of the present invention, the filamentous fungus is selected from one or more of Aspergillus, Penicillium, Humicola, Trichoderma, Acremonium; preferably Aspergillus and / or Trichoderma.

[0022] In some embodiments of the present invention, the cell is Aspergillus niger.

[0023] In some embodiments of the present invention, the cell is not a new variety of plant or animal.

[0024] In a fifth aspect of the present invention, there is provided the use of the gene described in the first aspect of the present invention, or the expression cassette described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the recombinant cell described in the fourth aspect of the present invention in the production of catalase.

[0025] In a sixth aspect of the present invention, there is provided a method for preparing catalase, comprising the following step: culturing the recombinant cell described in the fourth aspect of the present invention to prepare catalase.

[0026] In a seventh aspect of the present invention, there is provided the use of the catalase prepared by the gene described in the first aspect of the present invention, or the expression cassette described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the recombinant cell described in the fourth aspect of the present invention, or the method described in the sixth aspect of the present invention in scavenging hydrogen peroxide.

[0027] In the eighth aspect of the present invention, there is provided the use of catalase prepared by the gene described in the first aspect of the present invention, or the expression cassette described in the second aspect of the present invention, or the expression vector described in the third aspect of the present invention, or the recombinant cell described in the fourth aspect of the present invention, or the method described in the sixth aspect of the present invention, in the fields of food, textile, medical treatment, and papermaking.

[0028] The beneficial effects of the present invention are as follows:

[0029] The present invention provides a codon-optimized catalase CatR gene. By means of genetic engineering, an expression cassette of catalase was constructed and introduced into a recombinant expression host bacterium, realizing the high-efficiency secretory expression of catalase, and obtaining a high-yield catalase recombinant strain. Compared with the catalase gene before optimization, its catalase activity was significantly improved, reaching 8907 U / ml. Using the fermentation process of the present invention, the catalase activity can reach 368900 U / mL. The obtained catalase has an optimum temperature of 40 °C, has a relative enzyme activity greater than 80% at pH 5-9, and can still maintain 70% of the enzyme activity after 3 minutes at 75 °C. The enzyme activity is relatively stable and has good heat resistance, and can be widely used in the applications in food, textile, medical treatment, industry, and papermaking, such as the production of sodium gluconate and calcium gluconate. Description of the Drawings

[0030] Figure 1 : Map of the recombinant expression vector pAN-EXP of the present invention.

[0031] Figure 2 : Map of the recombinant expression catalase vector pAN-EXP-AFP-Cat of the present invention.

[0032] Figure 3 : Determination of enzyme activity in shake flask fermentation of the recombinant expression catalase strain of the present invention.

[0033] Figure 4 : Determination of enzyme activity in fermentor fermentation of the recombinant expression catalase strain of the present invention.

[0034] Figure 5 : Optimum reaction temperature curve of the recombinant expression catalase of the present invention.

[0035] Figure 6 : Optimum reaction pH curve of the recombinant expression catalase of the present invention.

[0036] Figure 7 : Heat resistance result graph of the recombinant expression catalase of the present invention. Detailed Embodiments

[0037] The concept of the present invention and the resulting technical effects will be clearly and completely described below in conjunction with embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts all fall within the scope of protection of the present invention.

[0038] For the molecular biology experimental methods not specifically described in the following embodiments, they are all carried out with reference to the specific methods listed in "Molecular Cloning: A Laboratory Manual" (Third Edition) by J. Sambrook, or in accordance with the kits and product specifications; the reagents and biological materials, unless otherwise specified, can be obtained from commercial channels.

[0039] The procedures and methods for constructing the vectors of the present invention use the conventional procedures and methods in the field of genetic engineering.

[0040] Definition:

[0041] "Gene" refers to a DNA fragment involved in the production of a polypeptide, including the regions before and after the coding region, as well as the intervening sequences (introns) between individual coding segments (exons).

[0042] In this specification, an "expression vector" refers to a DNA construct containing a DNA coding sequence operably linked to one or more appropriate control sequences, and the control sequences can enable the expression of the coding sequence in a host. Such control sequences include a promoter that enables transcription, an optional operator gene sequence that controls such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that control the termination of transcription and translation. The vector can be a plasmid, a phage particle, or simply a potential genomic insertion sequence. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, can integrate into the genome itself. Plasmids are the most commonly used form of expression vectors. However, the present invention is intended to include other forms of expression vectors that perform equivalent functions, and the expression vectors are or will be known in the art.

[0043] "Promoter" refers to a regulatory sequence involved in binding RNA polymerase to initiate gene transcription. The promoter can be an inducible promoter or a constitutive promoter. Non-limiting examples of inducible promoters that can be used in the present invention are glucoamylase promoters, which are inducible promoters.

[0044] The term "host cell" refers to a cell or cell line into which a recombinant expression vector for polypeptide production can be transfected to express a polypeptide.

[0045] Fungal cells can be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.

[0046] According to the invention, a vector comprising a polynucleotide sequence encoding catalase is introduced into a host cell. A polypeptide having catalase activity is expressed from a polynucleotide encoding a polypeptide and an expression vector comprising regulatory sequences operably linked to the catalase-encoding sequence.

[0047] The term "recombinant strain", when used in reference to a cell, nucleic acid, protein or vector, denotes a cell, nucleic acid, protein or vector that has been modified by the introduction of a heterologous nucleic acid or protein, or by the alteration of a native nucleic acid or protein, or the cell is derived from such a modified cell.

[0048] The term "selective marker" or "selection marker" refers to a gene capable of being expressed in a host cell, enabling easy selection of those host cells containing the introduced nucleic acid or vector.

[0049] As used herein, the term "transformation" refers to a cell having a non-native nucleic acid sequence that is integrated into its genome or maintained episomally as a plasmid over multiple generations. Any of a variety of techniques well known in the art can be used to introduce a vector comprising a polynucleotide sequence encoding a catalase polypeptide into an Aspergillus niger host cell, e.g., transformation, electroporation, nuclear microinjection, transduction, transfection, incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated microparticles, or protoplast fusion.

[0050] Filamentous fungi have a strong protein secretion capacity. The total amount of extracellular protein secreted by some filamentous fungi reaches 40 g / L, and this high-efficiency protein secretion capacity is incomparable to that of prokaryotic expression hosts such as bacteria. Filamentous fungi also possess various post-translational processing capabilities of genes, such as glycosylation modification, signal peptide cleavage, and disulfide bond formation, etc. Filamentous fungi such as Aspergillus oryzae, Aspergillus niger, and Trichoderma reesei are all food safety-grade strains and are recognized as GRAS (Generally Recognized As Safe) strains by the US Food and Drug Administration. Filamentous fungi fermentation occupies a core position in the production of industrial enzymes, and nearly 40% of the enzyme production in the international market comes from filamentous fungi fermentation.

[0051] Preferred terminators for filamentous fungal host cells are obtained from the genes of the following enzymes: Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor.

[0052] The present invention provides a filamentous fungal expression host strain with high catalase production. The filamentous fungal host cell belongs to a genus selected from the group consisting of: Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filobasidium, Fusarium, Humicola, Monographella, Mucor, Myriococcum, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, and Trichoderma; even more preferably, the filamentous fungal host cell is an Aspergillus cell; preferably Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae cell.

[0053] The host cells are cultured in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, the cells can be cultured by shake flask culture, or by small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state fermentation) in a laboratory or industrial fermenter in a suitable medium and under conditions allowing the expression and / or isolation of the polypeptide.

[0054] Experimental materials and reagents:

[0055] Strains: Aspergillus niger VT-002 strain and expression plasmid pAN-EXP have been disclosed in Chinese Patent Application CN 202011514714.6.

[0056] Instruments and equipment:

[0057] Constant temperature incubator: Shanghai Yiheng Constant Temperature Incubator LHS-150SC; Constant temperature shaker: Hualida Constant Temperature Shaker HZ2410K6; Ultra-clean bench: Suzhou Purification Ultra-clean Bench SW-CJ2FD; Shanghai Stirred Bioreactor: Bailun Biochemical Equipment Co., Ltd.

[0058] Configuration of culture medium and reagents:

[0059] TZ solid medium: Beef extract (Guangdong Huankai Microbial Sci. & Tech. Co., Ltd.) 8 g / L, yeast extract 2 g / L, peptone 5 g / L, NaCl 2 g / L, starch 10 g / L, agar 17 g / L, pH 5.8.

[0060] CD medium: Sucrose 30 g / L, NaNO3 2 g / L, K2HPO4 1 g / L, MgSO4 0.5 g / L, KCl 0.5 g / L, FeSO4 0.01 g / L, or add 15 g / L agar, pH 7.3.

[0061] Regeneration medium plate: Nutrient juice powder 8 g / L, yeast extract 2 g / L, peptone 5 g / L, NaCl 2 g / L, starch 10 g / L, agar 17 g / L, pH 5.8, and then add 0.8 M KCl (g / L) or sorbitol 1 M.

[0062] Flask fermentation medium: Maltodextrin 80 g / L, soybean cake powder 20 g / L, corn steep liquor 30 mL / L, pH 5.5, liquid volume in Erlenmeyer flask 100 mL / 500 mL, sterilized at 115 °C for 20 min.

[0063] Seed tank medium: Maltodextrin 80 g / L, soybean cake powder 40 g / L, corn steep liquor 10 mL g / L, pH 5.5, sterilized at 121 °C for 30 min.

[0064] Fermentation tank medium: Maltodextrin 40 g / L, soybean cake powder 20 g / L, corn steep liquor 20 mL / L, (NH4)2SO4 4 g / L, calcium chloride: 2 g / L, disodium hydrogen phosphate: 2 g / L, potassium dihydrogen phosphate: 3 g / L, antifoaming agent, control the pH of the fermentation tank at 5.2 - 5.5, sterilized at 121 °C for 35 min.

[0065] Lysozyme solution: 1% lywallzyme, dissolved in 1 M sorbitol.

[0066] KCl solution: 0.6 M KCl solution.

[0067] Sorbitol solution: 1 M sorbitol.

[0068] S / C solution: 1 M sorbitol, 50 mM CaCl2.

[0069] PEG solution: 25% PEG8000, 50 mM CaCl2, 10 mM Tris-Hcl, pH 7.5.

[0070] Example 1 Cloning of the Catalase CatR Gene from the Fungus Aspergillus fumigatus

[0071] 1. Cloning of the Catalase CatO Gene from the Fungus Aspergillus fumigatus

[0072] Extract the total genomic DNA of Aspergillus fumigatus. Then, using the total genomic DNA as a template, perform amplification with upstream and downstream primers.

[0073] CatO-F (5’→3’): ATGCGTCTCACGTTCATCCC (SEQ ID NO:4);

[0074] CatO-R (5’←3’): CTAGTGATCCACGGGAAACCG (SEQ ID NO:5).

[0075] The PCR amplification conditions are as follows: 98°C for 2 min; 98°C for 10 s; 55°C for 15 s, 72°C for 1.5 min for 30 cycles; 72°C for 5 min. Recover the PCR amplification product using a gel recovery kit and send it to Sangon Biotech (Shanghai) Co., Ltd. for sequencing analysis. The results show that the nucleotide sequence of the amplification product is SEQ ID NO:3, and the amino acid sequence it encodes is SEQ ID NO:1.

[0076] SEQ ID NO.1

[0077] MRLTFIPSLIGVANAVCPYMTGELNRRDEISDGDAAAATEEFLSQYYLNDNDAFMTSDVGGPIEDQNSLSAGERGPTLLEDFIFRQKIQRFDHERVPERAVHARGAGAHGVFTSYGDFSNITAASFLAKEGKQTPVFVRFSTVAGSRGSSDLARDVHGFATRFYTDEGNFDIVGNNIPVFFIQDAILFPDLIHAVKPRGDNEIPQAATAHDSAWDFFSQQPSTMHTLLWAMSGHGIPRSFRHVDGFGVHTFRFVTDDGASKLVKFHWKSLQGKASMVWEEAQQTSGKNPDFMRQDLHDAIEAGRYPEWELGVQIMDEEDQLRFGFDLLDPTKIVPEEFVPITKLGKMQLNRNPRNYFAETEQVMFQPGHIVRGVDFTEDPLLQGRLFSYLDTQLNRHGGPNFEQLPINQPRVPVHNNNRDGAGQMFIPLNPHAYSPKTSVNGSPKQANQTVGDGFFTAPGRTTSGKLVRAVSSSFEDVWSQPRLFYNSLVPAEKQFVIDAIRFENANVKSPVVKNNVIIQLNRIDNDLARRVARAIGVAEPEPDPTFYHNNKTADVGTFGTKLKKLDGLKVGVLGSVQHPGSVEGASTLRDRLKDDGVDVVLVAERLADGVDQTYSTSDAIQFDAVVVAAGAESLFAASSFTGGSANSASGASSLYPTGRPLQILIDGFRFGKTVGALGSGTAALRNAGIATSRDGVYVAQSVTDDFANDLKEGLRTFKFLDRFPVDH。

[0078] SEQ ID NO.3

[0079]

[0080] 2. Codon-optimized catalase gene CatR of the fungus Aspergillus fumigatus

[0081] According to the catalase CatO gene of the fungus Aspergillus fumigatus and the codon optimization principle of Aspergillus niger, the codon-optimized catalase gene CatR of the fungus Aspergillus fumigatus was artificially synthesized. Its nucleotide sequence is shown in SEQ ID NO:2, and it can encode the amino acid sequence shown in SEQ ID NO:1.

[0082] SEQ ID NO.2

[0083]

[0084] PCR amplification reaction conditions: 98°C for 2 min; 98°C for 10 s; 55°C for 15 s, 72°C for 1.5 min for 30 cycles; 72°C for 5 min.

[0085] CatR-F (5’→3’): ATGCGCCTGACCTTCATCCC (SEQ ID NO:6);

[0086] CatR-R (5’←3’): TCAGTGGTCCACGGGGAAGCGG (SEQ ID NO:7).

[0087] A DNA band of approximately 2.2 kb in size was obtained by PCR amplification, and the target fragment was recovered.

[0088] Example 2 Construction of recombinant vector

[0089] Using the two catalase gene fragments recovered after the above amplification as templates, a NotI (GCGGCCGC) restriction enzyme site was introduced into the upstream primer, and a PmeI (GAATTTC) restriction enzyme site was introduced into the downstream primer. The primer sequences are as follows:

[0090] NotI-CatR-F (5’→3’):

[0091] ACGGCGGCCGCATGCGCCTGACCTTCATCCCCTCCCTCATC (SEQ ID NO.8);

[0092] Pmei-CatR-R (5’←3’):

[0093] GCGAAATTTCTCAGTGGTCCACGGGGAAGCGGTCCAGGAACTTG (SEQ ID NO.9).

[0094] Reaction conditions: 98°C for 2 min; 98°C for 10 s; 55°C for 15 s, 72°C for 1.5 min for 30 cycles; 72°C for 5 min.

[0095] PCR amplification was performed using the above primers to obtain a DNA band of approximately 2.2 kb in size, and the target fragment of the catalase gene with restriction enzyme sites was recovered.

[0096] The amplified gene fragment with restriction enzyme sites and the Aspergillus niger expression plasmid pAN-EXP were respectively digested with the restriction enzymes NotI and PmeI. The pAN-EXP map is shown in Figure 1 .

[0097] The digestion conditions are as follows:

[0098] Restriction enzyme digestion conditions for the target fragment: 37 °C, reaction for 30 minutes; the reaction system is shown in Table 1.

[0099] Table 1

[0100] Reaction system (50ul) Dosage PCR fragment 25ul Reaction buffer 5ul NotI 1ul PmeI 1ul Water 18ul

[0101] Restriction enzyme digestion conditions for the Aspergillus niger expression plasmid pAN-EXP: 37 °C, reaction for 60 minutes, and the restriction enzyme digestion system is shown in Table 2;

[0102] Table 2

[0103] Reaction system (50ul) Dosage PCR fragment 15ul 10* Reaction buffer 5ul NotI 1ul PmeI 1ul Water 28ul

[0104] After digesting the target fragment and the Aspergillus niger expression plasmid pAN-EXP with restriction enzymes, these two fragments were recovered by electrophoresis respectively, and these two fragments were ligated with T4 DNA ligase. The specific ligation conditions are as follows: the ligation system is shown in Table 3, and the ligation reaction was carried out overnight at 16 °C.

[0105] Table 3

[0106] Ligation system (50ul) Dosage Digested target fragment 2ul Digested plasmid fragment 1ul T4 ligase 1ul 10* Buffer 1ul Water 5ul

[0107] After the ligation reaction, transformation of Escherichia coli Top10 competent cells was carried out. Take 100 μl of Escherichia coli competent cells, under sterile conditions, add them to the Eppendorf tube containing the ligation solution, mix well, and place them in an ice bath for 30 minutes. After the ice bath, add the cell suspension undergoing the transformation reaction to a thermostatic water bath adjusted to 42 °C, keep warm for 2 minutes, quickly pour in 1 ml of LB culture medium, and place it on a shaker at 37 °C for 1 hour. Then, spread it on an LB ampicillin culture dish, place it at room temperature for about 15 minutes to dry the spread bacterial liquid so that it does not flow. Next, invert it and place it in an incubator at 37 °C for overnight culture. Take out the culture dish the next day and pick single colonies. The transformants with correct ligation were verified by colony PCR and sent for sequencing. After correct sequencing, the plasmids of the correct transformants were extracted, thus obtaining the Aspergillus niger expression vector pAN-EXP-AFP-CatO expressing the original catalase and the Aspergillus niger expression vector pAN-EXP-AFP-CatR expressing the codon-optimized catalase. The map of the recombinant expression vector pAN-EXP-AFP-CatR is shown in Figure 2 .

[0108] Example 3 Construction of recombinant strains expressing catalase

[0109] 1. Preparation of Aspergillus niger protoplasts

[0110] The Aspergillus niger strain VT-002 was cultured on TZ medium at 32°C for 4 days. Standard colonies were selected and streaked on a CD solid medium, then cultured at 32°C for 4 days. A 4-cubic centimeter agar block was taken from the CD plate and placed in a triangular flask containing 60 ml of CD solution, and cultured at 34°C for 4 days. The mycelium was collected, washed once with 1M sorbitol, weighed for wet weight, and added with a lytic enzyme solution at a mass-to-volume ratio of 1:25. Enzymolysis was carried out at 30°C and 80 r / min for 2.5 to 3 hours. The protoplast solution was filtered to recover the filtrate. Centrifugation was performed at 4000 r / min for 10 min, and the supernatant was discarded. Centrifugation was carried out with a pre-cooled 0.6M KCl solution. The protoplast precipitate was resuspended in an appropriate amount of 0.6M KCl solution until the cell concentration reached (1-3)*10 6 cells / ml, and placed in an ice bath for standby. For protoplast regeneration, the purified protoplasts were diluted with an osmotic stabilizer and spread on a protoplast regeneration medium plate, and cultured at 32°C. After 4-5 days, the regeneration of protoplasts was observed. At the same time, the protoplasts were lysed with sterile water as a control to eliminate the error caused by the colonies formed by non-protoplasts.

[0111] 2. Aspergillus niger protoplast transformation

[0112] Take 200 ul of the prepared protoplast suspension, add about 5 ug of pAN-EXP-AFP-CatO plasmid and pAN-EXP-AFP-CatR plasmid respectively, and gently mix with a pipette tip. Add 50 ul of PEG solution, gently invert and mix, incubate in an ice bath for 20-30 min, slowly add 1 mL of PEG buffer, let it stand at room temperature for 20 min, then add 2 ml of S / C solution, gently mix, and spread on a regeneration medium plate containing 100 ug / ml hygromycin, and culture at 34°C for 5-6 days.

[0113] 3. Screening and shake flask culture of Aspergillus niger transformants

[0114] There were 249 and 281 transformants growing on the hygromycin resistance plates respectively. Sixteen single colonies with larger colonies were selected and cultured in triangular flasks containing shake flask fermentation medium, and cultured on a shaker at 32°C for 5 days.

[0115] Example 4 Screening of high-activity enzyme strains

[0116] Catalase can decompose hydrogen peroxide into water and oxygen, and its activity is expressed by the amount of hydrogen peroxide decomposed by a certain amount of enzyme within a certain time. The amount of decomposed hydrogen peroxide can be indirectly measured by the iodometric method. After the enzymatic reaction proceeds for a certain time, the reaction is terminated, and then ammonium molybdate is used as a catalyst to make the undissolved hydrogen peroxide react with potassium iodide to release free iodine, and then the iodine is titrated with sodium thiosulfate. The reaction is as follows:

[0117]

[0118] Number three 100 mL Erlenmeyer flasks, accurately add 10.0 mL of the diluted enzyme solution to each flask. Immediately add 5.0 mL of 1.8 mol / L sulfuric acid to the third flask to terminate the enzyme activity, serving as the blank solution. Add 5.0 mL of 0.01 mol / L hydrogen peroxide solution to each flask. Shake well and start timing immediately after adding each flask. After 5 minutes, immediately add 5.0 mL of 1.8 mol / L sulfuric acid solution to flasks 1 and 2 respectively.

[0119] Add 1.0 mL of 20% potassium iodide solution and 3 drops of ammonium molybdate solution to each flask. Then, titrate each flask successively with 0.02 mol / L sodium thiosulfate. After titrating until the solution turns light yellow, add 5 drops of 1% starch solution, and continue titrating until the blue color disappears to reach the end point. Record the volume of sodium thiosulfate consumed by each flask.

[0120] After the reaction, calculate the amount of hydrogen peroxide decomposed by the enzyme based on the difference between the titration values of the sample solution and the blank solution, and then calculate the enzyme activity.

[0121] Amount of hydrogen peroxide decomposed (μmol) = 1 / 2 × V Na2S2O3 (Blank titration value - Sample determination value) (mL) × 10 - 3 × 0.02 × 10 6 .

[0122]

[0123] The results of the catalase enzyme activity detection are shown in Table 4. Among the 16 pAN-EXP-AFP-CatR transformants, the flask enzyme activity of AF11 is the highest, with an enzyme activity of 8907 U / ml. Prepare the 32 transformants into Figure 3 , It can be seen that the recombinant engineering bacteria prepared by transforming Aspergillus niger with the transformants prepared after codon optimization have a significantly higher overall fermentation enzyme activity than the recombinant engineering bacteria prepared by the original transformants.

[0124] Table 4

[0125]

[0126]

[0127] Example 5 Fermentation of Catalase Strains

[0128] In this study, a 7L stirred bioreactor (Shanghai Bailun Biochemical Equipment Co., Ltd.) was used. The initial liquid loading was 4L, and the inoculation volume was 500mL. The transfer conditions were as follows: the cell concentration increased, the cells were deeply stained under microscopy, the field of view was clear without contaminants, and the enzyme activity was around 3000u / ml; at 30°C, ammonia was introduced when the pH dropped to 5.0 during the fermentation process, and the pH was controlled at 5.0 - 5.2 by adding ammonia water dropwise. The ventilation volume was 7.8 - 8.5L / min, the rotation speed was 500 - 1000rpm, and the DE value of the fed-batch was controlled at 10; from 56 hours to the end of the fermentation, the DE value of the fed-batch was controlled at 30. The rotation speed was gradually increased in the later stage, and the culture was carried out for 183h. Samples were taken regularly to measure the enzyme activity. The fermentation supernatant was obtained by centrifuging the cells, which was the crude enzyme solution, and SDS-PAGE detection of protein electrophoresis and enzyme property detection were carried out. The recombinant engineering bacteria pAN-EXP-AFP-CatR were fermented and cultured in a 7L fermenter using the fermentation medium. Among them, the total catalase activity of the recombinant strain AF11 reached 368900U / mL, which is the highest fermentation enzyme activity in the currently available data. The fermentation data of the fermenter are as Figure 4 shown.

[0129] The enzymatic properties of catalase were further detected.

[0130] (1) Optimal reaction temperature of recombinant catalase

[0131] At 25°C - 50°C, at intervals of 5°C, the activities of catalase were measured respectively. Taking the enzyme activity at 30°C as a control, the relative enzyme activities at different temperatures were measured. The results are as Figure 5 shown. The most suitable temperature for the action of catalase is 40°C.

[0132] (2) Optimal reaction pH of recombinant catalase

[0133] In buffer systems with different pH values (2.5 - 10.0), the enzyme activities of catalase were measured respectively. Taking the enzyme activity at pH 7.0 as a control, the relative enzyme activities at different pH values were measured. The results are as Figure 6 shown: The optimal pH value for the action of this catalase is 7.0. At pH 5.0 - 9.0, the relative enzyme activity is greater than 80%, and the application range is wide.

[0134] (3) Temperature tolerance characteristics of recombinant catalase

[0135] In order to study the thermal stability of catalase at different temperatures, the supernatant was respectively left standing at 70°C, 75°C, and 80°C for 3min. Taking the relative enzyme activity of the untreated sample as 100%, the results are as Figure 7 shown. After experiencing 3min at 75°C, it can still maintain 70% of the enzyme activity, and the heat resistance performance is stable.

[0136] Application of Catalase in the Production of Sodium / Calcium Gluconate

[0137] During the production of sodium / calcium gluconate, in the presence of oxygen, glucose oxidase efficiently oxidizes glucose to produce gluconic acid and hydrogen peroxide. However, the presence of hydrogen peroxide has a toxic effect on glucose oxidase, restricting the continuation of the reaction. Catalase can efficiently decompose the hydrogen peroxide produced by the oxidation of glucose into oxygen and water, eliminating the influence of hydrogen peroxide on the activity of glucose oxidase and promoting the process of sodium / calcium gluconate production. The total enzyme activity of catalase in the fermentation of this invention is high, with a wide applicable range of temperature and pH, and good compatibility with glucose oxidase. It is applicable to the production of sodium / calcium gluconate under the conditions of pH 5.0 - 9.0 and temperature 27 - 50°C.

[0138] The specific operation examples are as follows:

[0139] (1) In a 20L fermenter, add 10L of a 35% glucose solution, add the catalase obtained in Example 5 at 1500U / g glucose and 30U / g glucose oxidase, and react for 20h under the conditions of pH 5.2, temperature 40°C, tank pressure 0.1MPa, and rotation speed 500r / min. During the reaction, neutralize with 10M sodium hydroxide solution to maintain the pH stable. After the reaction, the volume of the reaction solution is 12.1L, and the concentration of sodium gluconate obtained is 34.85g / L.

[0140] (2) In a 20L fermenter, add 2000g of glucose and 590g of calcium carbonate, mix well with water, and then make up the volume to 10L with water. Add the catalase obtained in Example 5 at 800U / g glucose and 10U / g glucose oxidase, and react for 10h under the conditions of temperature 45°C, tank pressure: 0.1MPa, and rotation speed: 500r / min. After the reaction, make up the water to 10L, and the concentration of calcium gluconate is 240g / L.

[0141] The above specific embodiments have described the present invention in detail. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the purpose of the present invention. In addition, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

Claims

1. A catalase CatR gene, characterized in that, The nucleotide sequence of the catalase CatR gene is shown in SEQ ID NO.

2.

2. An expression cassette, characterized in that, Containing the catalase CatR gene described in claim 1.

3. An expression vector, characterized in that, The expression vector contains the catalase CatR gene described in claim 1 or the expression cassette described in claim 2.

4. The expression vector according to claim 3, characterized in that, The expression vector further includes gene fragments of a promoter, a terminator, and a selection marker.

5. The expression vector according to claim 4, characterized in that, The promoter is selected from at least one of the Aspergillus niger glucoamylase promoter, the neutral amylase promoter, the acidic amylase promoter, and the Rhizopus oryzae glucoamylase promoter.

6. A recombinant cell, characterized in that, The recombinant cell contains at least one of the catalase CatR gene described in claim 1, the expression cassette described in claim 2, and the expression vector described in any one of claims 3 to 5; the cell is an Aspergillus niger cell.

7. Use of the catalase CatR gene described in claim 1 or the expression cassette described in claim 2 or the expression vector described in any one of claims 3 to 5 or the recombinant cell described in claim 6 in the production of catalase.

8. A method for preparing catalase, characterized in that, Comprising the following steps: culturing the recombinant cell described in claim 6 to prepare catalase.

9. Use of the catalase prepared by the catalase CatR gene described in claim 1 or the expression cassette described in claim 2 or the expression vector described in any one of claims 3 to 5 or the recombinant cell described in claim 6 or the method described in claim 8 in scavenging hydrogen peroxide.

Images