A method for detecting plant genome-wide RNA-chromatin interaction
By using the GRADIS-seq method and Tn5 transposase to cleave RNA/DNA complexes, the complexity of detecting RNA-chromatin interactions in polyploid plants has been solved, enabling efficient detection across the entire genome, simplifying experimental procedures and improving data resolution.
Patent Information
- Application Number
- CN202111096559.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-09-16
- Publication Date
- 2026-08-04
- Estimated Expiration
- 2041-09-16
AI Technical Summary
Existing RNA-chromatin interaction technologies are difficult to apply effectively in polyploid plants, especially due to the complexity of plant genomes and the low uniqueness of repetitive sequences, which prevents efficient detection across the entire genome.
The GRADIS-seq method utilizes the Tn5 transposase to cleave RNA/DNA complexes. Combined with specific adapter design and processing procedures, it simplifies experimental steps and improves detection sensitivity and resolution, making it suitable for studying RNA-chromatin interactions across the entire plant genome.
It significantly simplifies the experimental procedure, shortens the experimental cycle, thereby increasing the effective length of RNA-DNA pairs and the subsequent alignment rate, and enhancing the resolution and efficiency of data analysis.
Smart Images

Figure CN115820824B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method for detecting RNA-chromatin interactions in the whole genome of plants. Background Technology
[0002] Previously, it was believed that RNA primarily played a mediating role in protein construction based on DNA templates, with ribosomal RNA being the only exception. However, large-scale genome sequencing and transcriptome sequencing have led to a significant discovery—a large number of non-coding RNAs (lncRNAs) longer than 200 nt in plant and animal genomes. Several long non-coding RNAs have been found to play important roles in various crucial regulatory processes, including X chromosome silencing, genomic imprinting and chromatin modification, transcriptional activation, transcriptional interference, and nuclear transport. How to systematically evaluate the roles of lncRNAs, and to obtain the important functions of long non-coding RNAs in chromatin composition, regulation, and gene expression, especially their roles in human diseases and crop stress resistance and high yield, is a hot topic in basic theoretical and applied research in life sciences and modern agriculture.
[0003] Existing technologies include techniques for locating specific RNA interactions on chromatin, such as ChIRP, CHART, and RAP-DNA. These techniques utilize complementary sequences (probes) to capture specific RNAs, followed by high-throughput sequencing to identify the chromatin targeted by that RNA. However, these methods can only study one known RNA at a time, and cannot investigate all RNA-chromatin interactions across the entire genome. To address the throughput limitations, at least four unbiased techniques for detecting all chromatin-RNA interactions have been developed to date—GRID-seq, MARGI, ChAR-seq, and RADICL-seq. Their widespread application across the genome will help us understand the fundamental roles of non-coding RNAs in regulating genome activity.
[0004] Taking the representative GRID-seq as an example, GRID-seq was invented in 2017 by a research team led by Xiangdong Fu from the University of California. The method first designs a special adapter with one end being single-stranded RNA and the other end being double-stranded DNA. RNA-DNA interactions are fixed using DSG and formaldehyde, and cell nuclei are extracted. Then, genomic DNA is digested with AluI to break it into fragments. The adapter is added, and the RNA of the adapter is ligated to the RNA to be captured. Reverse transcription is performed to amplify the ligated RNA. Free adapters are removed. The adapter DNA is ligated to the DNA to be captured. DNA is captured using streptavidin magnetic beads. ssDNA is released from the magnetic beads, dsDNA is synthesized, and MmeI is used to cut the designed restriction sites on the adapter. After gel electrophoresis, two DNA fragments are obtained: an 85bp adapter that ligates both RNA and DNA, and a 65bp adapter that ligates only RNA or DNA. Through further high-throughput sequencing and subsequent bioinformatics analysis, specific RNA-chromatin interactions can be discovered.
[0005] In 2019, a technology called RADICL-seq (nature communication) was developed to comprehensively locate each RNA in animal cells, while capturing all genomic regions targeted by the RNA to map the interactions between RNA and chromatin in the cell nucleus. Technically, RADICL-seq is similar to the existing GRID-seq in its basic library preparation approach, but there are also some technical differences.
[0006] First, unlike GRID-seq, RADICL-seq uses two single-stranded DNA adapter sequences. The longer adapter sequence (50-nt) is pre-adenylated at 5', and then annealed with the biotinylated shorter adapter sequence (23-nt) to form a double-stranded adapter. Second, RADICL-seq uses DNase I to cleave genomic DNA. Because DNase I cleavage produces overhanging ends, T4 is used after cleavage. DNA polymerase and Klenow fragments were used for completion. Furthermore, in GRID-seq, the single-stranded DNA of the RNA-DNA chimera generated by reverse transcription was first released, and then used as a template to synthesize double-stranded DNA. Finally, it was digested with the restriction endonuclease MmeI, generating 20bp RNA and 20bp DNA end pairing fragments. In contrast, in RADICL-seq, due to the inclusion of an EcoP15I recognition site in the adapter, EcoP15I digestion of the reverse-transcribed RNA-DNA chimera generated 27bp pairing sequences (signals) at both the RNA and DNA ends, 7bp longer than the GRID-seq signal sequence. This altered endonuclease-induced sequence length significantly improved the uniqueness rate of genome alignments in subsequent analyses. Data showed that in animal cells, the unique alignment rate increased from 14% (GRID-seq) to 45% (RADICL-seq), greatly improving the resolution of the RNA-DNA pairing signal.
[0007] All of the above RNA-chromatin interaction techniques are based on animal cells. Animals are generally diploid. Compared to animals, plant genomes are much larger and more complex. During their evolutionary history, plants often undergo polyploidy or whole genome duplication (WGD) events, resulting in the duplication of all genes within the genome. On the one hand, polyploidy provides primitive genetic material for biological evolution and is considered an accelerator of evolution. On the other hand, polyploidy also complicates the frequently occurring identical or symmetrical DNA sequence fragments (repetitive sequences, accounting for 10%–85% of the entire plant genome) in the plant genome, making plant genomics and functional genomics research more difficult. For example, in RADICL-seq, short reads (27 bp) often result in extremely low uniqueness in polyploid plants, and there are currently no reports of successful RADICL-seq analysis in plants. Polyploid plants are widely found in nature, such as cotton, wheat, and rapeseed. The highly repetitive sequences and complex genome structures of plants, especially polyploid plants, mean that RNA-chromatin interaction techniques developed in animal systems cannot be effectively applied to plant analysis. Summary of the Invention
[0008] This invention overcomes the defects and shortcomings of existing RADICL-seq technology in plants, and provides a method for studying RNA-chromatin interaction in plants, especially polyploid plants, thus promoting the development of new technologies and methods in epigenetic regulation research.
[0009] The specific technical solution is as follows:
[0010] This invention provides a method for detecting RNA-chromatin interactions across the entire plant genome, the method comprising:
[0011] (i) Formaldehyde cross-linking treatment of plant tissues to fix the interaction state of RNA and chromatin in the cell nucleus;
[0012] (ii) Two single-stranded DNA adapter primers of different lengths were synthesized. The short adapter primer was biotinylated and the long adapter primer was adenylated at the 5' end. The 5' adenylated long adapter primer and the biotinylated short adapter primer were then annealed to prepare a double-stranded adapter.
[0013] (III) Extract the cell nuclei from plant tissues, and use DNase I to cleave chromatin to fragment it; then use DNA polymerase and Klenow fragment to fill in the protruding ends of the DNA produced after DNase I cleavage; then use Klenow enzyme to add adenosine to the 3' end of the blunt-ended chromatin DNA fragments to obtain chromatin DNA fragments with adenosine at the 3' end; finally use RNase H to digest and remove the background of the RNA product of gene transcription binding to chromatin in situ;
[0014] (iv) Add the double linker generated in step (ii) to the chromatin DNA fragment generated in step (iii), use RNA ligase to connect the 5' end of the long linker primer in the double linker to the 3' end of the RNA, and then use DNA ligase to connect the other end of the double linker to the fragmented chromatin DNA to obtain an RNA / linker / DNA chimera.
[0015] (v) Using the short linker of the double linker as a reverse transcription primer, and the RNA chain in the RNA / linker / DNA chimera as a template, reverse transcription is performed using reverse transcriptase to synthesize a complete RNA-DNA double-stranded complex.
[0016] (vi) Incubate streptavidin magnetic beads with RNA-DNA double-stranded complex to obtain RNA-DNA double-stranded complex linked with streptavidin magnetic beads;
[0017] (vii) The RNA-DNA double-stranded complex linked to streptavidin magnetic beads was fragmented and purified using Tn5 transposase to obtain fragmented RNA / adaptor / DNA products.
[0018] (viii) Amplify the fragmented RNA / adaptor / DNA products using PCR to obtain amplified products and form a DNA library;
[0019] (ix) Perform high-throughput sequencing and subsequent bioinformatics analysis on the DNA library to obtain the results of RNA-chromatin DNA interaction.
[0020] The “RNA / adapter / DNA chimera” mentioned above refers to the sequence formed after RNA and chromatin DNA fragments are attached to both ends of the adapter, respectively; the “RNA-DNA double-stranded complex” refers to the complex sequence formed after the RNA sequence attached to one end of the adapter is reverse transcribed into a cDNA sequence, with one end of the adapter attached to an RNA / DNA dimer and the other end attached to double-stranded DNA; the “fragmented RNA / adapter / DNA product” refers to the portion of the sequence remaining attached to the adapter / magnetic bead after the Tn5 transposase cleaves the sequences at both ends of the adapter, and the complex product composed of the adapter and magnetic beads. The complex product contains both the adapter and magnetic beads, as well as the DNA sequences attached to both ends of the adapter. Figure 1 ).
[0021] Gene expression regulation plays a crucial role in the growth and development of multicellular organisms. Long non-coding RNAs play important roles in various crucial regulatory processes, including X chromosome silencing, genomic imprinting, chromatin modification, transcriptional activation, transcriptional interference, and nuclear transport, and are essential factors in gene expression regulation. This invention relates to a method for studying RNA and chromatin interactions across the entire plant genome (Genome-wide RNA and DNA Interaction Study (GRADIS) sequencing, abbreviated as GRADIS-seq). This invention discloses the principles and specific operational procedures of GRADIS-seq technology. GRADIS-seq technology creatively applies the Tn5 cleavage property of RNA / DNA complexes to RNA and chromatin interaction techniques (RNA and DNA Interacting Complexes Ligated and Sequenced, RADICL-seq) developed in animals, resulting in substantial improvements in both the simplicity of the operational procedure and the sensitivity and resolution of the generated data. Specifically, it simplifies the experimental procedure and reagents by at least 50% and shortens the experimental cycle of RNA and chromatin interaction techniques, which typically takes 4-5 days, to 3 days. More importantly, it increases the size of the generated library fragments, thereby improving the effective length of RNA-DNA pairs and increasing the uniqueness of subsequent alignments across the entire genome. This technology, derived from RADICL-seq established using diploid animal cells, introduces novel Tn5 cleavage characteristics, resulting in a method for RNA-chromatin interactions applicable to complex plant genomes. GRADIS-seq technology will provide a broad application strategy for studying RNA-chromatin interactions across the entire genome of plants and animals.
[0022] Further, in step (ii), the base sequence of the 5' adenosine-modified long adapter primer is shown in SEQ ID NO.1 (i.e., 5′- / 5Phos / CTGCTGCTCCTTCCCTTTCCCCTTTTGGTCCGACGGTCCAAGTCAGCAGT-3′), and the base sequence of the biotinylated short adapter primer is shown in SEQ ID NO.2 (i.e., 5′- / 5Phos / CTGCTGACT / ibiodT / GGACCGTCGGACC-3′).
[0023] After the adapter primers are annealed, the double linker is characterized by a 26-nt protruding end at the 5' end and adenylation, and a protruding thymine nucleotide (T) at the 3' end, so that it can be TA-ligated with the chromatin DNA fragment with an A at the 3' end generated in step (3).
[0024] The specific steps of step (two) are as follows:
[0025] (a) Long linker 5' adenosineization: Long linker primers were 5' adenosineized using a DNA 5' adenosineization kit.
[0026] (b) Linker annealing: Add biotin-labeled short linker primers to the product of step (a);
[0027] Annealing conditions were as follows: PCR instrument with heated lid, 75℃ for 15 min, 60℃ for 10 min, 50℃ for 10 min, 40℃ for 10 min, 25℃ for 30 min;
[0028] (c) Adapter purification: The product from step (b) was purified using a size exclusion chromatography column to obtain the adapter solution.
[0029] The concentration of the long-link primer was 100 μM, and the concentration of the long-link primer added to the reaction system was 100 pmol; the concentration of the short-link primer was 100 μM, and the concentration of the short-link primer added to the reaction system was 100 pmol.
[0030] Furthermore, the size exclusion chromatographic column is a BioRad column, MICRO BIO-SPIN 6, Cat. No. 7326200.
[0031] Furthermore, the specific steps of step (iii) are as follows:
[0032] (A) DNase I cleavage of chromatin: The plant cell nuclei were resuspended in DNase I digestion buffer, followed by the addition of RNase inhibitor, protease inhibitor and DNase I for digestion.
[0033] (B) Product purification: After the reaction in step (A) is completed, EDTA and SDS are added to terminate DNase I digestion, and cell nuclei are collected by centrifugation immediately. The cell nuclei are resuspended in nuclease-free water, and AMPure XP magnetic beads are added. After incubation at room temperature, the magnetic beads are separated using a magnetic rack, washed with ethanol, and dried to obtain purified magnetic bead-cell nucleus precipitate.
[0034] (C) Chromatin end completion: The purified magnetic bead-nucleus precipitate was resuspended in end completion reaction buffer, and RNase inhibitor, T4 DNA polymerase and Klenow fragment were added for incubation.
[0035] (D) Adding adenosine to the chromatin ends: Add SDS to the product obtained in step (C) to terminate the end-completion reaction; then centrifuge, resuspend in the end-completion reaction buffer, add RNase inhibitor, and incubate the Klenow fragment at 37°C.
[0036] (E) RNase H digestion: RNase H was added to the product obtained in step (D) and incubated at 37°C to remove the background of the RNA product of gene transcription being bound to chromatin in situ; after the reaction was completed, the reaction was terminated by adding SDS, and finally a magnetic bead-nucleus mixture was obtained.
[0037] The DNase I digestion buffer formulation is as follows: 10 mM pH 8 Tris, 15 mM NaCl, 10 mM CaCl2, 5 mM MnCl2; the DNase I is DNase I RQ from Progema; the end-completion reaction buffer formulation is as follows: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, 0.25 mM dNTPs, 0.5% Triton, pH 7.5; the end-adenosine addition reaction buffer formulation is as follows: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, 0.5 mM dATP, 0.5% Triton X-100, pH 7.9.
[0038] Furthermore, the specific steps of step (iv) are as follows:
[0039] (i) Purification of the product: The magnetic bead-nucleus mixture obtained in step (E) was centrifuged and resuspended in ddH2O; to remove soluble RNA, NaCl containing polyethylene glycol PEG8000 was added to the mixture and incubated at room temperature; the magnetic beads were collected using a magnetic rack, washed once with 80% ethanol, and resuspended in ddH2O.
[0040] (ii) Adapter and RNA ligation: The product after step (i) is resuspended in water, and 10×T4 RNA ligase buffer, the double-linked adapter obtained in step (2), RNase inhibitor and T4 RNA ligase 2 truncated form are added; incubate overnight at 20°C to allow the 5' protruding end of the adapter to be attached to the 3′-OH of the RNA molecule;
[0041] (iii) Purification of product: After step (ii) is completed, SDS is added to terminate the reaction, centrifuged and resuspended in ddH2O; then NaCl containing PEG is added and incubated at room temperature; then the beads are collected with a magnetic rack, washed once with 80% ethanol and resuspended in ddH2O; then the product is dried.
[0042] (iv) Ligate the adapter to adjacent DNA; resuspend the product from step (iii) in T4 DNA ligase buffer containing ATP and T4 DNA ligase, and incubate at room temperature;
[0043] Furthermore, the specific steps of step (five) are as follows:
[0044] (I) Extraction of RNA / adaptor / DNA chimera: The product from step (iv) was centrifuged, the supernatant was discarded, and the mixture was resuspended in ddH2O. SDS, EDTA, NaCl, and ribonucleoside complex (RVC) were added simultaneously. The mixture was incubated overnight at 65°C to decrosslink. Chloroform extraction was performed using Phase Lock Gel (PLG). The supernatant was precipitated at -20°C with GlycoBlue (Invitrogen), sodium acetate, and isopropanol, followed by centrifugation. Finally, the precipitate was dissolved in ddH2O, and nucleic acid quantification was performed using a Nanodrop micro spectrophotometer.
[0045] (II) Reverse transcription of RNA / adaptor / DNA chimera: The product obtained in step (I) is reverse transcribed using reverse transcriptase. In the reverse transcription reaction, the reverse transcriptase uses the short strand of the double-stranded linker in the RNA / adaptor / DNA chimera as the reverse transcription primer and the RNA in the chimera as the template to reverse transcribe and synthesize a complete double-stranded RNA-DNA complex without overhanging ends. The reverse transcription reaction conditions are 25℃ for 5 minutes, 50℃ for 60 minutes, and 85℃ for 2 minutes.
[0046] Further, the specific steps of step (vi) are as follows: purify the RNA-DNA double-stranded complex with streptavidin magnetic beads: add the RNA-DNA double-stranded complex described in step (v) to the washed streptavidin magnetic beads, rotate and incubate at room temperature for 30-40 minutes to bind the RNA-DNA double-stranded complex to the streptavidin magnetic beads, wash and remove impurities to obtain the RNA-DNA double-stranded complex linked to the streptavidin magnetic beads;
[0047] The concentration of the streptavidin magnetic beads is 10 mg / ml, wherein each milligram of magnetic beads can bind 500-3500 pmol of biotinylated DNA fragments; the amount of the streptavidin magnetic beads used is 20-50 μl, and the mass ratio of the streptavidin magnetic beads to the RNA-DNA double-stranded complex is approximately 20:1-50:1.
[0048] Further, the pre-washing method for the streptavidin magnetic beads is as follows: wash the streptavidin magnetic beads twice with 500 μl of 1×WB buffer containing 5 μl of 200 mM RVC, then wash once with 500 μl of 2×WB buffer containing 5 μl of 200 mM RVC, and finally resuspend them in 150 μl of 2×WB buffer;
[0049] The formulation of the 1×WB buffer is: 5mM Tris-HCl, pH 7.5, 0.5mM EDTA, 1M NaCl, 0.02% Tween-20; the formulation of the 2×WB buffer is: 10mM Tris-HCl, pH 7.5, 1mM EDTA, 2M NaCl, 0.04% Tween-20.
[0050] The cleaning and impurity removal method is as follows: wash twice with 500 μl of 1×WB buffer containing 5 μl of 200 mM RVC, and then wash twice with 500 μl of 10 mM Tris containing 5 μl of 200 mM RVC to remove other unbound impurity RNA or DNA.
[0051] Furthermore, the specific steps of step (vii) are as follows:
[0052] 1) Tn5 transposase digestion for library construction: The RNA-DNA double-stranded complex obtained in step (vi) and linked with streptavidin magnetic beads was resuspended in Tn5 fragmentation buffer, Tn5 transposase was added, and the mixture was digested at 37°C for 0.5 to 1 hour.
[0053] 2) Washing fragmented products: Wash the product from step 1) with 1×WB buffer containing 200mM RVC, then wash with 10mM Tris containing 200mM RVC, and finally resuspend the magnetic beads in water to obtain fragmented RNA / adaptor / DNA products.
[0054] Furthermore, the Tn5 fragmentation buffer is formulated as follows: pH 7.6, 10mM Tris-Cl, 5mM MgCl2, 9% PEG8000, and 0.85mM ATP.
[0055] The formulation of the 1×WB buffer is: 5mM Tris-HCl, pH 7.5, 0.5mM EDTA, 1M NaCl, 0.02% Tween-20; the formulation of the 2×WB buffer is: 10mM Tris-HCl, pH 7.5, 1mM EDTA, 2M NaCl, 0.04% Tween-20; the concentration of RVC is 200mM; and the concentration of Tris is 10mM.
[0056] Furthermore, the specific steps of step (eight) are as follows:
[0057] (1) Completion of fragmented products: The fragmented RNA / adaptor / DNA products from step (VII) are completed by DNA polymerase.
[0058] (2) PCR amplification: The fragmented product after gap filling is subjected to PCR amplification to obtain the fragmented amplification product.
[0059] Further, the reaction system for step (1) is: 5 μl 10× amplification buffer, 3 μl 100 mM MgSO4, 7 μl 10 mM dNTP mixture, 1 μl Bst 2.0 WarmStart DNA polymerase; the reaction conditions are extension at 72°C for 15 minutes.
[0060] The amplification reaction system for step (2) is as follows: product from step (1) (50 μl), 4 μl primer N701, 4 μl primer N501, 10 μl 5×TAB, 2 μl TAE; the reaction program is as follows: 72℃ for 10 min, 98℃ for 30 s; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 18-20 cycles, 72℃ for 5 min;
[0061] The base sequence of primer N701 is shown in SEQ ID NO.3 (i.e., 5′-CAAGCAGAAGACGGCATACGAGATTAAGGCGA GTCTCGTGGGCTCGG-3′); the base sequence of primer N501 is shown in SEQ ID NO.4 (i.e., 5′-AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC-3′).
[0062] After transposase cleaves the RNA-DNA complex, it simultaneously attaches the transposon adapter carried by the transposase to both ends of the "RNA fragment-adaptor-DNA fragment" structure, thereby forming the "transposon adapter-RNA fragment-adaptor-DNA fragment-transposon adapter" structure.
[0063] Compared with the prior art, the present invention has the following beneficial effects:
[0064] This invention applies the ability of Tn5 transposase to cleave RNA / DNA complexes to the existing RADICL-seq method, successfully cleaving and constructing libraries from the RNA-DNA complexes generated by reverse transcription in the RADICL-seq method. This greatly simplifies the RADICL-seq process, reducing experimental steps by at least half and shortening the experimental cycle from 4-5 days to 3 days. Furthermore, the resulting DNA library fragments are between 250bp and 400bp in size, increasing the length of the final effective RNA / DNA fragment pairs and thus significantly improving the efficiency of subsequent bioinformatics analysis for alignment to plant genomes. Attached Figure Description
[0065] Figure 1This is a schematic diagram of the GRADIS-seq method for detecting RNA-chromatin interactions in the plant genome, as described in this invention. It illustrates the key processes and the structural features of "RNA / adaptor / DNA chimera", "RNA-DNA double-stranded complex", and "fragmented RNA / adaptor / DNA products".
[0066] Figure 2 A flowchart comparing the GRADIS-seq method with the original RADICL-seq method provided in Example 1 and Comparative Example 1.
[0067] Figure 3 This is a capillary electrophoresis image of the GRADIS library construction results in the GRADIS-seq method provided in Example 1.
[0068] Figure 4 The GRADIS-seq sequencing results provided in Example 1 show the length and distribution of RNA / DNA pairs.
[0069] Figure 5 This is a statistical result graph showing the alignment effect of the cotton leaf GRADIS library on the genome and the alignment effect after the GRADIS library was artificially cut to the length of the RADICL library RNA / DNA sequence (27bp).
[0070] Figure 6 Example 1 shows the sequencing results of the GRADIS library construction in Example 1, displaying the position of the corresponding adapter sequence (underlined), the RNA / DNA sequence information on the left and right sides, and the genome alignment results; it also shows that when the DNA sequence is manually cut to only 27bp of RADICL-seq, it is still a unique alignment in the genome, but when the corresponding RNA sequence is manually cut to only 27bp of RADICL-seq, the RNA sequence changes from a unique alignment to a multiple alignment.
[0071] Figure 7 Example 2 shows the sequencing results of the GRADIS library construction in Example 1, displaying the position of the corresponding adapter sequence (underlined), the RNA / DNA sequence information on both sides, and the genome alignment results. It also shows that when the sequence was manually cut to only 27 bp (RADICL-seq), both the DNA and RNA sequences showed multiple alignments in the genome. Detailed Implementation
[0072] The present invention will be further described below with reference to the accompanying drawings, tables, and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.
[0073] Unless otherwise specified, the reagents and materials used in the following examples are all conventional commercially available reagents and consumables.
[0074] The method for detecting plant whole-genome RNA-chromatin interactions provided by this invention is abbreviated as GRADIS-seq method. Figure 1 ).
[0075] Example 1: Establishment of the experimental procedure for the GRADIS-seq method
[0076] Upland cotton is an allotetraploid plant with a genome size of 2.5G. The majority (>60%) of its genome consists of repetitive sequences, making it the species with the highest proportion of repetitive sequences among sequenced dicotyledonous plants to date. Using cotton leaves as experimental material, the following GRADIS-seq operations were performed.
[0077] From a procedural perspective, GRADIS-seq eliminates the need for repeated purification steps, significantly reducing sample loss at each step. It also eliminates the need for complex library construction, greatly simplifying RNA-chromatin interaction studies. Figure 1 , Figure 2 ).
[0078] The specific steps are as follows:
[0079] Day 1:
[0080] Joint preparation:
[0081] (1) Dilute the long linker strand (5′- / 5Phos / CTGCTGCTCCTTCCCTTTCCCCTTTTGGTCCGACGGTCCAAGTCAGCAGT-3′) to a concentration of 100 μM with ddH2O. Take 1 μl (100 pmol) of the linker and perform adenosylation using a DNA 5′ adenylation kit (e.g., NEB's 5′ DNA Adenylation Kit, catalog number E2610S) according to the kit instructions. Incubate at 65°C for 2 h, then terminate the reaction at 85°C for 2 min.
[0082] (2) Add an equimolar amount of 100 pmol (1 μl 100 uM) of biotin-labeled short linker strand (5′- / 5Phos / CTGCTGACT / ibiodT / GGACCGTCGGACC-3′) and anneal to form double-stranded DNA linkers using the following PCR program: heat cap, 75℃ for 15 min, 60℃ for 10 min, 50℃ for 10 min, 40℃ for 10 min, 25℃ for 30 min.
[0083] (3) Add 10 μl of ddH2O to adjust the adapter solution volume to 30 μl. Purify the adapter using a size exclusion column (BioRadcolumns, MICRO BIO-SPIN 6, Cat. No. 7326200); autoclave the column at 121℃ for 20-30 minutes. Mix well, remove the pipette tip and cap, place in a 2 ml tube, and purge the column; centrifuge at 1000g for 2 minutes; place the column in a new 1.5 ml tube; add the adapter solution; centrifuge at 1000g for 4 minutes to collect; finally, ~25 μl of purified adapter solution can be obtained. Store the adapter at -20℃ for later use.
[0084] Cell fixation and nuclear extraction:
[0085] (4) Fix 1 gram of plant tissue in two tubes of 25 ml fixation buffer (containing 1% formaldehyde, 10 mM Tris pH 8.0, 10 mM KCl, 1 mM EDTA) under vacuum for 10 minutes. After fixation, add 2.5 ml of 2 M glycine to each tube and stop cross-linking under vacuum for another 5 minutes. Wash 3 times with sterile water.
[0086] (5) Complete cell nuclei were isolated according to the method described in the literature (Tao X, Feng S, Zhao T, Guan X. Efficient chromatin profiling of H3K4me3 modification in cotton using CUT&Tag. Plant Methods. 2020 Aug 31; 16:120. doi:10.1186 / s13007-020-00664-8. PMID:32884577; PMCID:PMC7460760.).
[0087] Chromatin digestion, end-completion, and treatment with A and RNase H:
[0088] (6) Resuspend ~50 μl of cell nuclei in 500 μl of DNase I digestion buffer (10 mM Tris pH 8, 15 mM NaCl, 10 mM CaCl2, 5 mM MnCl2) containing 2 μl of RNase inhibitor and 2 μl of protease inhibitor cocktail (centrifuge at 300 × g), then add 1 μl of DNase I RQ (progema) and digest at 37 °C for 10 min.
[0089] (7) Add 30 μl of 0.5 M EDTA and 25 μl of 10% SDS to a final SDS concentration of 0.5% to terminate DNase I digestion. Then immediately centrifuge at 300 x g for 3 minutes to collect cell nuclei.
[0090] (8) The cell nuclei were resuspended in 150 μl of nuclease-free water and purified with twice the volume (300 μl) of AMPureXP magnetic beads.
[0091] (9) After incubating at room temperature for 5 minutes, separate the beads using a magnetic rack, wash twice with 500 μl of 80% ethanol, and dry for 5 minutes.
[0092] (10) The purified magnetic bead-nucleus precipitate was resuspended in 200 μl of 1×T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 7.5 @ 25℃, NEB), which contained 2 μl RNaseOut, 0.25 mM dNTPs, 0.5% Triton, 0.075 U / μl (total 15 U) T4 DNA polymerase (Yesen), and 6 μl (total 30 U) Klenow fragment (MO210S, neb, 5 u / μl), and then incubated at room temperature (25 degrees) for 1 hour.
[0093] (11) Add 5 μl of 10% SDS to terminate the end-completion reaction.
[0094] (12) Centrifuge the magnetic bead-nucleus mixture at 300×g for 3 minutes; resuspend in 200μl of 1×NEBuffer 2 (50mMNaCl, 10mM Tris-HCl, 10mM MgCl2, 1mM DTT, pH 7.9@25℃, NEB), which contains 1μl RNaseOut, 0.5mM dATP, 0.5% Triton X-100 and 0.375U / μl (total 75U) Klenow (exo-) (NEB, MO212S, 5u / μl), and then incubate at 37℃ for 1h.
[0095] (13) Add 0.122 U / μl (30.5 U total) of RNase H (Yesen) and incubate at 37°C for another 40 minutes. Terminate the reaction by adding 5 μl of 10% SDS.
[0096] Adapter and RNA ligation:
[0097] (14) The magnetic bead-nucleus mixture was centrifuged at 300g for 30 seconds and then resuspended in 200 μl H2O. To remove soluble RNA, 165 μl of 2.5 M NaCl in 20% polyethylene glycol (PEG8000) was added to the mixture, and then incubated at room temperature for 5 minutes. The beads were collected using a magnetic rack, washed once with 80% ethanol, and resuspended in 200 μl H2O. This purification step was repeated once.
[0098] (15) After a second ethanol wash, the dried magnetic bead-nucleus mixture was resuspended in 38 μl H2O, 6 μl 10×T4 RNA ligase buffer, 10 μl (20 pmol) pre-adenylated and biotinylated adapters, 2 μl RNaseOut (ThermoFisher Scientific), and 4 μl (800 U total) T4 RNA ligase 2, truncated KQ (NEB, 200,000 units / ml, 2000 u total). The mixture was incubated overnight at 20 °C to ligate the pre-adenylated adapters to the 3′-OH of the RNA molecule (60 μl total).
[0099] the next day:
[0100] (16) Add 5 μl of 10% SDS to terminate the reaction, then centrifuge the magnetic bead-nucleus mixture at 300×g for 3 minutes and resuspend it in 200 μl of ddH2O.
[0101] (17) To remove excess unconnected linkers, 165 μl of 2.5 M NaCl in 20% PEG was added to the mixture, and the reaction was incubated at room temperature for 5 min. The beads were then collected using a magnetic rack, washed once with 80% ethanol, and resuspended in 200 μl of ddH2O. This purification step was repeated once. The magnetic bead-nucleus mixture was dried for 5 min.
[0102] Adapters connect to the proximal end of DNA:
[0103] (18) In situ proximity ligation was performed by resuspending the dried magnetic bead-nucleus mixture in 500 μl of 1×T4 DNA ligase buffer containing ATP, 4 U / μl (total 2000 U, 5 μl) T4 DNA ligase (New England Biolabs, 400,000 units / ml, total 20,000 U, 50 μl) and incubating at room temperature for 4 hours.
[0104] De-crosslinking:
[0105] (19) Centrifuge at 300x g, discard the supernatant, resuspend in 230μl ddH2O, and add 30μl 10% SDS, 10μl 0.5M EDTA, 30μl 5M NaCl, and 3μl 200mM RVC. Incubate overnight at 65℃ to decrosslink.
[0106] Day 3:
[0107] RNA / linker / DNA chimera extraction and purification:
[0108] (20) RNA-DNA chimeras were extracted with 300 μl of chloroform using a gel-lock method. The supernatant was precipitated at -20°C for 1 hour with 1 μl of GlycoBlue (Ambion), 30 μl of 3M sodium acetate (pH 5.2), and 300 μl of isopropanol, followed by centrifugation at 14,000 g at 4°C for 10 minutes. DNA was eluted with 20 μl of H2O and quantified using a nanodrop.
[0109] RNA / linker / DNA chimera reverse transcription:
[0110] (21) Since reverse transcriptase can use DNA sequences as primers for polymerization, the short strand of the double-stranded region of the adapter is used as a primer for the reverse transcription reaction. After concentrating the sample to a final volume of 20 μl, the RNA ligated to the adapter is reverse transcribed. The reaction conditions are: 25℃ for 5 minutes, 50℃ for 60 minutes, and 85℃ for 2 minutes. After the reaction, 130 μl of water is added to a volume of 150 μl. Thus, the RNA / adaptor / DNA chimera generates a complete double-stranded RNA-DNA complex.
[0111] Biotin-streptavidin purification of biotinylated double-stranded RNA-DNA complexes (from this step onwards, GRADIS-seq differs fundamentally from the original RADICL-seq procedure):
[0112] (22) Wash 20 μl of streptavidin magnetic beads twice with 500 μl of 1x WB buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl, 0.02% Tween-20) containing 5 μl of 200 mM RVC, wash once with 500 μl of 2x WB buffer containing 5 μl of 200 mM RVC, and finally resuspend in 150 μl of 2× WB buffer.
[0113] (23) Add the product of step (21), i.e. 150 μl of biotinylated double-stranded RNA-DNA complex, to the streptavidin magnetic beads washed in step (22), and incubate by rotation at room temperature for 30 minutes (rotate the hybridization oven at room temperature) to link the biotinylated double-stranded RNA-DNA complex to the streptavidin magnetic beads. Wash the unbound RNA or DNA impurities twice with 500 μl of 1×WB buffer (5 μl of 200 mM RVC), and then wash twice with 500 μl of 10 mM Tris buffer (5 μl of 200 mM RVC).
[0114] Tn5 fragmentation cutting:
[0115] (24) The product of step (23), namely streptavidin beads bound to biotinylated RNA-DNA complex, was resuspended in 50 μl of Tn5 fragmentation buffer (10 mM Tris-Cl (pH 7.6), 5 mM MgCl2, 9% PEG8000, 0.85 mM ATP), 0.5 μl of Tn5 transposase (4 pmol) was added, and the mixture was cleaved at 37 °C for 1 hour to obtain the fragmented RNA-adaptor-DNA product.
[0116] (25) The product of step (24), namely streptavidin magnetic beads bound to fragmented RNA-adaptor-DNA products, was washed twice with 500 μl 1×WB buffer (containing 5 μl 200 mM RVC) and twice with 500 μl 10 mM Tris buffer (containing 5 μl 200 mM RVC). Finally, the magnetic beads were resuspended in 34 μl of water.
[0117] PCR library construction and target fragment purification:
[0118] (26) Transfer 34 μl of magnetic beads containing fragmented RNA-adaptor-DNA products to a PCR tube, add 5 μl of 10x amplification buffer, 3 μl of MgSO4 (100 mM), 7 μl of dNTP mixture (10 mM), and 1 μl of Bst 2.0 WarmStart DNA polymerase. Extend at 72°C for 15 minutes. Then, add 4 μl of primer N501 (5′-AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC-3′), 4 μl of primer N701 (5′-CAAGCAGAAGACGGCATACGAGATTAAGGCGAGTCTCGTGGGCTCGG-3′), 10 μl of 5x TAB, and 2 μl of TAE (Vazyme), mix well, and add 100 μl of paraffin oil for sealing. Set up the PCR program as follows: 72℃ for 10 minutes, 98℃ for 30 seconds; then 98℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 30 seconds, for 18-20 cycles, then 72℃ for 5 minutes.
[0119] (27) After PCR, the beads were removed by centrifugation and the supernatant was collected.
[0120] (28) Detect the library preparation effect by gel electrophoresis. If there are bands, add DNA purification magnetic beads for recovery. If the bands are not obvious, you can add 1-2 cycles as appropriate.
[0121] (29) Quality testing of the library and sequencing.
[0122] The above GRADIS operation was performed using cotton leaves as material. Library quality control results showed that the peak sizes were mainly concentrated in the 250bp-400bp DNA library. Figure 3 The obtained library had a qbit detection concentration of 40 ng / μl and a qPCR concentration of 13 nM, indicating successful library construction.
[0123] Comparative Example 1: Experimental Procedure of RADICL-seq
[0124] From a procedural perspective, the reported RADICL-seq procedure is more cumbersome than GRADIS-seq in terms of experimental workflow, requires more complex reagents and consumables, and is more time-consuming. To better compare it with GRADIS-seq, a comparative example summarizing the RADICL-seq procedure is also provided. Figure 2 ).
[0125] The specific steps are as follows:
[0126] From adapter preparation to reverse transcription, i.e., steps (1) to (21), it is the same as described in Example 1.
[0127] cDNA second-strand synthesis
[0128] (22) The double-stranded RNA-DNA complex generated in step (21) was converted into double-stranded DNA. 30 μl of 5× second-strand synthesis buffer (Thermo Fisher Scientific), 3 μl of 10 mM dNTPs (Thermo Fisher Scientific), 3 μl of RNase H (2 U / μl, Thermo Fisher Scientific), 4 μl of E. coli DNA polymerase I (New England Biolabs), and 1 μl of E. coli ligase (New England Biolabs) were added to 20 μl of the reverse transcription product generated in step (21). 89 μl of water was added to a final volume of 150 μl. The mixture was incubated at 16°C for 2 h.
[0129] (23) Add 10 μl of 0.5 M EDTA to stop the reaction.
[0130] Purification of target fragment
[0131] (24) The sample was purified using a nucleotide removal kit (Qiagen). 1.6 ml of buffer PNI was added to the sample, and finally eluted in 50 μl of H2O.
[0132] (25) Use a vacuum concentrator to concentrate the sample volume to 8 μl.
[0133] Hairpin connectors are RNA-bound junctions.
[0134] (26) Hairpin ligation of the sample (5′- / 5Phos / GGCCCTCCAAAAGGAGGGCA-3′); ligation of the adapter that ligates only to RNA prevents ligation to sequencing adapters in subsequent experiments. Mix 100 pmol of hairpin adapter with 10 μl of 2× Quick ligase buffer (New England Biolabs), 8 μl of sample, and 1 μl of Quick ligase (New England Biolabs). Incubate at room temperature for 15 minutes.
[0135] Purification of target fragment
[0136] (27) Then, the DNA was purified using the DNA Clean & Concentrator-5 kit (Zymo) according to the manufacturer's instructions. The sample was washed with 50 μl of water.
[0137] (28) Use a vacuum concentrator to concentrate the sample volume to 30 μl.
[0138] EcoP15I enzyme digestion
[0139] (29) The sample concentration was detected using the Qubit dsDNA High Sensitivity Kit (Invitrogen).
[0140] (30) Based on the concentration measured in step (29), add 10U EcoP15I, 5μl NEBuffer 3.1 (New England Biolabs), 5μl 10×ATP, and 0.5μl 10mM sinefungin (Calbiochem) to every 1.5μg of DNA, and add water to a final volume of 50μl. Incubate overnight at 37℃.
[0141] Purification of target fragment
[0142] (31) The sample was purified using a nucleotide removal kit (Qiagen). 1.3 ml of buffer PNI was added to the sample, and finally eluted in 50 μl of H2O.
[0143] (32) Use a vacuum concentrator to concentrate the sample volume to 20 μl.
[0144] End filling and adding A
[0145] (33) The product from step (32) was added to 6.5 μl of 10×reaction buffer, 3 μl of End Prep EnzymeMix from NEB Next Ultra End-Repair / dA-Tailing Module (New England Biolabs) for leveling and adding A to the end, and water was added to a final volume of 65 μl. The mixture was reacted at 20 °C for 30 min, and then at 65 °C for 30 min.
[0146] Sequencing adapter preparation
[0147] (34) The forward sequence (5′- / 5Phos / GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′) and reverse sequence (5′-CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3′) of the Y-type sequencing adapter were annealed in 1×NEBuffer 2 (New England Biolabs) under the following annealing conditions: hot cap, 75℃ for 15 min, 60℃ for 10 min, 50℃ for 10 min, 40℃ for 10 min, and 25℃ for 30 min.
[0148] Target fragment ligated to sequencing adapter
[0149] (35) The target fragment was ligated to the sequencing adapter using the NEB Next Ultra Ligation Module kit. 20 pmol of the Y-type sequencing adapter generated in step (34) was added to the product of step (33), and the ligation was carried out at 20°C for 15 minutes.
[0150] (36) Use a vacuum concentrator to concentrate the sample volume to 40 μl.
[0151] Purification of target fragment
[0152] (37) Wash 20 μl of streptavidin magnetic beads twice with 500 μl of 1x WB buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl, 0.02% Tween-20) containing 5 μl of 200 mM RVC, wash once with 500 μl of 2x WB buffer containing 5 μl of 200 mM RVC, and finally resuspend in 40 μl of 2× WB buffer.
[0153] (38) Add 40 μl of the product from step (36) to the streptavidin beads washed in step (37), and incubate by rotation at room temperature for 30 minutes (rotation in a hybridization oven at room temperature). Attach the biotinylated target fragment to the streptavidin beads. Wash twice with 500 μl of 1×WB buffer (5 μl of 200 mM RVC), and then twice with 500 μl of 10 mM Tris buffer (5 μl of 200 mM RVC). Finally, resuspend the beads in 30 μl of 10 mM Tris buffer.
[0154] PCR cycle number detection
[0155] (39) The required number of PCR cycles was determined using the Phusion High Fidelity PCR Kit (Thermo Fisher Scientific). The reaction mixture consisted of: FW primers (5′-AATGATACGGCG ACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′; Invitrogen), Index RV primers (5′-CAAGCAGAAGACGGCATACGAGATBBBBBBCTCGGCATTCCTGCTGAACCGC TCTTCCGATCT-3′; Invitrogen), where BBBBBB is the 6-nucleotide barcode sequence used in the construction of multiple libraries), and 4 μl of the product from step (38). The PCR conditions were: 98℃ for 30s, 98℃ for 10s, 65℃ for 15s, 72℃ for 15s, for 8, 11, or 14 cycles.
[0156] (40) After 8, 11, and 14 cycles, 10 μl of product was taken from each cycle, and the band concentration and size were detected using a 6% polyacrylamide gel (Invitrogen). The electrophoresis conditions were 145 V for 60 min. The size of the RNA–DNA complex was 225 bp. The minimum number of PCR cycles required to visualize the 225 bp target band was determined as the final number of PCR cycles.
[0157] PCR library construction and purification of target fragments
[0158] (41) After determining the minimum number of PCR cycles in step (40), the product from step (38) is subjected to PCR.
[0159] (42) The concentration and size of the bands were determined using a 6% polyacrylamide gel (Invitrogen). The electrophoresis conditions were 145V for 60 min.
[0160] (43) Cut rubber to recover 225-bp target strips.
[0161] (44) The library concentration was detected using the High Sensitivity DNA Bioanalyzer Kit (Agilent), and the effective concentration of the library was detected using qPCR.
[0162] (45) Sequencing on the machine.
[0163] We performed the above RADICL operation on cotton leaves. After 25 cycles of PCR in step (39), the target band was still not observed. Analysis of the reasons for the failure of the RADICL experiment in cotton leaves suggests that the multiple purification steps, including steps (24), (27), and (31), resulted in low recovery efficiency of the target fragment, significantly reducing the concentration of the target fragment in the system, thus causing PCR failure. Another possibility is that the overnight enzyme digestion operation (step 30) prolonged the operation time, increasing the risk of RNA or DNA degradation in the system. Finally, the extensive use of purification kits and library preparation kits in the RADICL operation increased the experimental cost, yet the desired results were still not achieved.
[0164] Example 2: High-throughput sequencing and bioinformatics analysis of GRADIS libraries
[0165] We performed next-generation sequencing (Illumina PE150 platform) on the library constructed in Example 1. Subsequent bioinformatics analysis yielded RNA and DNA sequence information linked to the adapter sequence, respectively. 27,004 valid sequences were obtained. These valid sequences shared the following characteristics: they contained complete adapter sequence information, and the adapter sequence was flanked by RNA and DNA sequence information, respectively.
[0166] We first analyzed the lengths and distribution of RNA / DNA sequences flanking the adapter sequence. Since the original RADICL-seq obtained RNA / DNA sequences were a fixed 27 bp length, we used 27 bp as the classification boundary for summarizing sequence length distribution. The results show that RNA and DNA sequences with lengths greater than or equal to 27 bp accounted for 17,910 (66%) and 16,122 (60%), respectively. Figure 4 Our GRADIS process significantly increases the length of RNA / DNA sequence pairs.
[0167] Next, to verify that increasing the length of the RNA / DNA sequence can improve alignment efficiency in plants, especially polyploids with high repetitive sequences and complex genomic information, we analyzed the unique alignment rate of the sequences on the genome. The results showed that of a total of 16,122 DNA sequences longer than 27 bp (including 27 bp), 10,388 were aligned to the cotton genome (alignment rate 64.43%), of which 7,829 were unique alignments, accounting for 48.6% of the total DNA sequences.
[0168] Meanwhile, to compare the differences between GRADIS and the original RADICL, we artificially shortened the length of the RNA / DNA sequences generated by GRADIS, retaining only the 27 bp sequence near the adapter to simulate an effect similar to RADICL-seq. The results showed that 11,462 out of a total of 16,122 27 bp DNA sequences aligned to the cotton genome (alignment rate 71.09%), of which 5,562 were unique alignments, accounting for 34.5% of the total DNA sequences. Figure 5 GRADIS achieved a 14.1% higher unique alignment rate than artificially simulated RADICL (i.e., cut GRADIS).
[0169] Therefore, the GRADIS process of this invention can generate longer sequence information than the existing RADICL process, thereby achieving better genome alignment resolution.
[0170] To more intuitively demonstrate the difference in genome alignment resolution between GRADIS-seq and RADICL-seq, Figure 6 , Figure 7 Examples show the alignment results of specific sequences, displaying the sequence name, sequence information (underlined letters indicate adapter sequences, with RNA and DNA sequences flanking the adapter sequence), RNA sequence alignment results, and DNA sequence alignment results. Figure 6 The sequence shown, obtained from GRADIS-seq, remains uniquely aligned across the genome when the DNA sequence is artificially cut to only 27 bp (similar to RADICL-seq). However, when the corresponding RNA sequence is artificially cut to only 27 bp (similar to RADICL-seq), the RNA sequence changes from a unique alignment to multiple alignments. This indicates that when cut to only the length of RADICL-seq, although the DNA sequence interacting with the RNA remains unique, the RNA sequence presents two ambiguous possibilities. Figure 7 This paper presents a sequence obtained from GRADIS-seq. When the sequence was artificially cut down to 27 bp, which is only the size of RADICL-seq, multiple alignments were found in both the DNA and RNA sequences in the genome.
[0171] Therefore, we can conclude that GRADIS-seq provides higher RNA / DNA sequence length resolution than RADICL-seq, which makes a significant difference in the complex genomes of polyploid crops such as cotton. Our GRADIS-seq pipeline provides a method for RNA and chromatin interactions applicable to complex plant genomes, offering a broad application strategy for studying RNA and chromatin interactions across the entire plant and animal genome. sequence list <110> Zhejiang Academy of Agricultural Sciences <120> A method for detecting RNA-chromatin interactions in the whole plant genome. <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 50 <212> DNA <213> Artificial Sequence <400> 1 ctgctgctcc ttccctttcc ccttttggtc cgacggtcca agtcagcagt 50 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 ctgctgactt ggaccgtcgg acc 23 <210> 3 <211> 47 <212> DNA <213> Artificial Sequence <400> 3 caagcagaag acggcatacg agattaaggc gagtctcgtg ggctcgg 47 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <400> 4 aatgatacgg cgaccacccga gatctacact agatcgctcg tcggcagcgt c 51 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 ggccctccaa aaggagggca 20 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 gatcggaaga gcgtcgtgta gggaaagagt gt 32 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <400> 7 ctcggcattc ctgctgaacc gctcttccga tct 33 <210> 8 <211> 58 <212> DNA <213> Artificial Sequence <400> 8 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <210> 9 <211> 63 <212> DNA <213> Artificial Sequence <400> 9 caagcagaag acggcatacg agatbbbbbb ctcggcattc ctgctgaacc gctcttccga 60 tct 63
Claims
1. A method for detecting RNA-chromatin interactions across the entire plant genome, characterized in that, include: (i) Formaldehyde cross-linking treatment of plant tissues to fix the interaction state of RNA and chromatin in the cell nucleus; (II) Two single-stranded DNA adapter primers of different lengths were synthesized, wherein the base sequence of the long adapter primer is shown in SEQ ID NO.1 and the base sequence of the short adapter primer is shown in SEQ ID NO.2; the short adapter primer was biotinylated and the long adapter primer was adenylated at the 5' end; the 5' adenylated long adapter primer and the biotinylated short adapter primer were then annealed under the following annealing conditions: 75℃ for 15 min, 60℃ for 10 min, 50℃ for 10 min, 40℃ for 10 min, and 25℃ for 30 min to prepare a double-stranded adapter. The annealing product was purified using a size exclusion chromatography column to obtain a binder solution; (III) Nuclei were extracted from plant tissues, and chromatin was fragmented by cleaving with DNase I. DNA polymerase and Klenow fragments were then used to fill in the protruding ends of the DNA fragments produced by DNase I cleavage. The reaction was terminated by adding EDTA and SDS, and AMPure XP magnetic beads were added for purification, ultimately yielding a magnetic bead-nucleus mixture. Then, Klenow enzyme was used to add adenosine to the 3' end of the blunt-ended chromatin DNA fragments, resulting in chromatin DNA fragments with adenosine at the 3' end. Finally, RNase H was used for digestion to remove the background of in situ binding of RNA products from gene transcription with chromatin. (iv) Add the double linker generated in step (ii) to the magnetic bead-nucleus mixture generated in step (iii), add NaCl solution containing polyethylene glycol PEG8000 for purification to remove soluble RNA; use RNA ligase to ligate the 5' end of the long linker primer in the double linker to the 3' end of the RNA, and then use DNA ligase to ligate the other end of the double linker to the fragmented chromatin DNA to obtain an RNA / linker / DNA chimera; (V) Then, cross-linking, chloroform extraction and isopropanol precipitation were performed to extract the RNA / adaptor / DNA chimera. Using the short adapter of the double-stranded head as the reverse transcription primer, and the RNA strand in the RNA / adaptor / DNA chimera as the template, reverse transcription was performed using reverse transcriptase to synthesize the complete RNA-DNA double-stranded complex. (vi) Incubate streptavidin magnetic beads with RNA-DNA double-stranded complex, wash twice with 1×WB buffer containing vanadium ribonucleoside complex, and then wash twice with Tris buffer containing RVC to remove other unbound impurities RNA or DNA, to obtain RNA-DNA double-stranded complex linked with streptavidin magnetic beads. (vii) The RNA-DNA double-stranded complex linked to streptavidin magnetic beads was fragmented and purified using Tn5 transposase to obtain fragmented RNA / adaptor / DNA products. (viii) The fragmented RNA / adaptor / DNA product from step (vii) is filled in by DNA polymerase and amplified by PCR. The base sequence of primer N701 is shown in SEQ ID NO.3 and the base sequence of primer N501 is shown in SEQ ID NO.
4. The amplified product is obtained and a DNA library is formed. (ix) Perform high-throughput sequencing and subsequent bioinformatics analysis on the DNA library to obtain the results of RNA-chromatin DNA interaction.
2. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, In step (iii): DNase I digestion is performed in a buffer containing RNase inhibitors and protease inhibitors; chromatin end-completion reaction uses T4 DNA polymerase and Klenow fragment; end-adenosine addition reaction uses Klenow fragment and is incubated at 37°C; RNase H is added and incubated again at 37°C to remove the background of in situ binding of RNA products transcribed from genes with chromatin; after the reaction is completed, the reaction is terminated by adding SDS, and finally a magnetic bead-nucleus mixture is obtained.
3. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, The specific steps of step (five) are as follows: (I) Extraction of RNA / adaptor / DNA chimera: Centrifuge the product from step (IV), discard the supernatant, resuspend in ddH2O, and simultaneously add SDS, EDTA, NaCl, and vanadate ribonucleoside complex. Incubate overnight at 65°C to decrosslink; extract with chloroform using PhaseLock Gel. Precipitate the supernatant with sugar blue doped co-precipitant GlycoBlue, sodium acetate, and isopropanol at -20°C, and centrifuge again; finally, dissolve the precipitate with ddH2O and quantify the nucleic acid using a Nanodrop micro spectrophotometer; (II) Reverse transcription of RNA / adaptor / DNA chimera: The product obtained in step (I) is reverse transcribed using reverse transcriptase. In the reverse transcription reaction, the reverse transcriptase uses the short strand of the double-stranded linker in the RNA / adaptor / DNA chimera as the reverse transcription primer and the RNA in the chimera as the template to reverse transcribe and synthesize a complete double-stranded RNA-DNA complex without overhanging ends. The reverse transcription reaction conditions are 25℃ for 5 minutes, 50℃ for 60 minutes, and 85℃ for 2 minutes.
4. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, In step (six): The concentration of the streptavidin magnetic beads is 10 mg / ml, wherein each milligram of magnetic beads can bind 500-3500 pmol of biotinylated DNA fragments; the amount of the streptavidin magnetic beads used is 20-50 μl, and the mass ratio of the streptavidin magnetic beads to the RNA-DNA double-stranded complex is 20:1-50:
1.
5. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 4, characterized in that, The pre-cleaning method for the streptavidin magnetic beads is as follows: wash the streptavidin magnetic beads twice with 1×WB buffer containing vanadium ribonucleoside complex, then wash once with 2×WB buffer containing vanadium ribonucleoside complex, and finally resuspend them in 2×WB buffer. The formulation of the 1×WB buffer is: 5mM Tris-HCl, pH 7.5, 0.5mM EDTA, 1M NaCl, 0.02% Tween-20; the formulation of the 2×WB buffer is: 10mM Tris-HCl, pH 7.5, 1mM EDTA, 2M NaCl, 0.04% Tween-20.
6. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, The specific steps of step (seven) are as follows: 1) Tn5 transposase digestion for library construction: The RNA-DNA double-stranded complex obtained in step (vi) and linked with streptavidin magnetic beads was resuspended in Tn5 fragmentation buffer, Tn5 transposase was added, and the mixture was digested at 37°C for 0.5-1 h. 2) Cleaning fragmented products: The product from step 1) was washed with 1×WB buffer containing vanadium ribonucleoside complex, then washed with Tris buffer containing vanadium ribonucleoside complex, and finally the magnetic beads were resuspended in water to obtain fragmented RNA / adaptor / DNA products. The formulation of the 1×WB buffer is as follows: 5mM Tris-HCl, pH 7.5, 0.5mM EDTA, 1M NaCl, 0.02% Tween-20.
7. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 6, characterized in that, The Tn5 fragmentation buffer solution was formulated as follows: pH 7.6, 10 mM Tris-HCl, 5 mM MgCl2, 9% PEG8000, and 0.85 mM ATP.
8. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, The specific steps of step (eight) are as follows: (1) Completion of fragmented products: The fragmented RNA / adaptor / DNA products from step (VII) are completed by DNA polymerase. (2) PCR amplification: The fragmented product after gap filling is subjected to PCR amplification to obtain the fragmented amplification product.
9. The method for detecting plant whole-genome RNA-chromatin interactions as described in claim 1, characterized in that, The balancing reaction system for step (viii) is as follows: 5 μl 10× amplification buffer, 3 μl 100 mM MgSO4, 7 μl 10 mM dNTP mixture, 1 μl Bst 2.0 WarmStart DNA polymerase; the reaction conditions are extension at 72°C for 15 minutes. The amplification reaction system consisted of: 50 μl of the compensation product from step (viii), 4 μl of primer N701, 4 μl of primer N501, 10 μl of 5×TAB, and 2 μl of TAE; the reaction program was: 72℃ for 10 min, 98℃ for 30 s; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 18-20 cycles, 72℃ for 5 min.