Construction method of transgenic mice with systemic overexpression of human α-Syn-NLS
Transgenic mice systemically overexpressing the nuclear input human α-Syn protein were constructed through the lentiviral vector LV-EGFP:T2A:Puro-EF1A>hSNCA/SV40 NLS, which solved the problem of systemic, stable and long-term expression of existing models, and achieved research on neurological diseases related to Parkinson's disease.
Patent Information
- Application Number
- CN202211624399.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-16
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2042-12-16
AI Technical Summary
The existing α-Syn protein mouse models cannot achieve systemic, stable and long-term expression, and cannot effectively simulate the systemic symptoms of Parkinson's disease, especially neurological diseases other than the brain.
The lentiviral vector LV-EGFP:T2A:Puro-EF1A>hSNCA/SV40 NLS was used to construct transgenic mice systemically overexpressing nuclear input human α-Syn protein by pronuclear injection of fertilized eggs. PCR and enzyme cleavage technology were used to construct recombinant expression vectors, packaging and purifying the virus to achieve systemic, stable and long-term expression.
A transgenic mouse model systemically overexpressing the nuclear input human α-Syn protein was successfully constructed, showing motor dysfunction similar to those in patients with Parkinson's disease, with efficient, stable and long-term expression characteristics, helping to study the relationship between α-Syn nuclear localization and neurodegenerative diseases.
Smart Images

Figure BDA0004003424530000033 
Figure BDA0004003424530000041 
Figure BDA0004003424530000042
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a lentiviral vector overexpressing human α-Syn-NLS and a construction method of transgenic mice. Background Art
[0002] Parkinson's disease (PD) is an age-related chronic progressive neurological disease, and its main pathological features are the degeneration or death of dopaminergic neurons in the substantia nigra striatum of the midbrain and the formation of Lewy bodies, which are formed by abnormal aggregation of proteins mainly composed of α-synuclein (SNCA, simply referred to as α-Syn). However, the function and pathogenic mechanism of α-Syn protein in PD have not been fully understood. Mouse animal models are an important tool for studying the function of α-Syn protein and the pathogenesis of PD. Although many models have been developed, such as transgenic animal models of α-Syn protein, some can show a decrease in dopaminergic neurons in the substantia nigra and striatum or a decrease in dopamine levels and behavioral disorders, but obvious degeneration of the substantia nigra and striatum has not been found in most mice, and the pathological features of PD cannot be perfectly reproduced, which brings troubles to the study of PD. Moreover, under physiological conditions, α-Syn protein is mainly distributed in the cytoplasm and a small amount is distributed in the nucleus. And because α-Syn protein co-localizes with Lewy bodies in the cytoplasm, most previous studies on α-Syn protein have mainly focused on the cytoplasm, ignoring the α-Syn protein in the nucleus. With the discovery of the nuclear localization phenomenon of α-Syn protein in the brain tissue of PD patients in recent years, people have gradually realized the importance of α-Syn protein in the nucleus. Research results show that in the brains of patients with Alzheimer's disease (AD) and Parkinson's disease (PD) and cells with oxidative stress, α-Syn protein tends to aggregate in the nucleus, and these abnormal nuclear aggregations are related to cytotoxicity. Therefore, more and more research has been carried out on α-Syn protein in the nucleus. Although in our previous study, an α-Syn-3*NLS recombinant adeno-associated virus vector was constructed using the overexpression viral vector pAAV-IRES-hrGFP, and transgenic mice overexpressing nuclear translocation human α-Syn protein were obtained by injecting this virus into the lateral ventricle. The advantage of this transgenic mouse is that because it is locally injected into the brain region, the brain region can quickly show relevant pathological symptoms. The disadvantage is that it cannot be expressed systemically, and the expression duration also needs to be studied. For the study of gastrointestinal reactions or nervous systems other than the brain caused by abnormal aggregation of α-Syn, the pAAV-IRES-hrGFP-Syn-3*NLS transgenic mouse has defects.
[0003] Lentivirus is a type of retrovirus, with the basic structure of retrovirus, but also having components and characteristics different from retroviruses. It has been developed as a gene therapy vector and has recently been used in the preparation of transgenic animals. Like other retroviruses, the genome of lentivirus can be integrated into the host DNA after reverse transcription. Since the viral vector has been modified and does not proliferate in host cells and does not cause the death of host cells, the infected or transformed animal cells can be continuously passaged; the greatest advantage of this vector is that it can infect quiescent cells, does not produce chimeric animals, and has stable inheritance. Summary of the Invention
[0004] The present invention provides a method for constructing a transgenic mouse with systemic overexpression of human α-Syn-NLS. First, the human α-Syn coding sequence and the SV40 nuclear translocation signal sequence are obtained by PCR, and then an entry clone vector containing the target sequence is obtained through a BP reaction. After digestion with BsaI, the entry clone vector is constructed into a recombinant expression vector α-Syn-SV40NLS containing the target sequence through an LR reaction. After digestion with ApaLI + NheI, using the lentivirus LV overexpression vector pLV-EGFP:T2A:Puro-EF1A as the backbone vector, the recombinant expression vector α-Syn-SV40NLS containing the target sequence is constructed into the lentivirus vector, and virus packaging and purification are carried out to obtain the pLV virus (LV-EGFP:T2A:Puro-EF1A>hSNCA / SV40 NLS) overexpressing nuclear import α-Syn. The virus is injected by the method of pronuclear injection of fertilized eggs to obtain a transgenic mouse with systemic overexpression of nuclear import human α-Syn protein, and it successfully shows motor dysfunction similar to that of PD patients. This model helps to clarify the close relationship between long-term α-Syn nuclear localization and neurodegenerative diseases, and also helps to better understand the relationship between α-Syn nuclear localization and systemic diseases other than neurological diseases and neurological diseases other than the brain, thus facilitating the development of relevant disease diagnosis and related drug research and development work.
[0005] The advantages and effects of the present invention are as follows:
[0006] 1. Human α-synuclein will not cause strong immune rejection and be cleared in mice, can be expressed and exist for a long time, and the model made by it is closer to the human PD model;
[0007] 2. Lentiviral vectors have the following advantages: a. Lentiviral vectors are a type of vector tool that can very efficiently and stably integrate foreign genes into mammalian cells. The DNA fragments located between the two LTRs and the viral genome will be stably integrated into the genome; b. Lentiviral vectors can infect not only dividing cells but also quiescent cells. The genotype of animal cells infected or transformed by them can be changed and inherited by offspring.
[0008] Therefore, the vector LV-EGFP:T2A:Puro-EF1A>hSNCA / SV40 NLS used in the present invention can be stably integrated into the mouse genome and continuously passed on.
[0009] 3. The packaged virus only has the ability to transfect and cannot replicate in large quantities in target cells, so it has high biosafety.
[0010] 4. The method for establishing this model has the characteristics of systemic, stable, long-term and highly efficient expression, and has systematicness, integrity and representativeness for studying gene and protein functions and mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 For the restriction enzyme digestion identification of the finally constructed lentiviral vector, lane 55 in the figure shows correct digestion by ApaLI+NheI (2066, 3985, 1246, 2521), and P55 is the original plasmid without digestion.
[0012] Figure 2 Schematic diagram of the structure of the lentiviral human α-Syn-NLS overexpression vector;
[0013] Figure 3 Results of Western blot detection of transgenic mice;
[0014] Figure 4 Systemic immunofluorescence map of transgenic mice. DETAILED DESCRIPTION OF THE INVENTION
[0015] The present invention will be further described in detail below with reference to the drawings and examples. However, the protection scope of the present invention is not limited to the described content. The reagents and methods used in the examples are all conventional reagents and conventional methods unless otherwise specified.
[0016] Example 1: Construction of a vector (plasmid) using the Gateway technology
[0017] The Gateway technology based on the λ phage site-specific recombination system was used to construct a vector (plasmid). The Gateway technology includes two-step reactions: the BP reaction to construct an entry clone vector containing the target sequence; the LR reaction to construct a recombinant expression vector containing the target sequence.
[0018] Main reagents: BP Clonase TM II Enzyme Mix (Invitrogen), LR Clonase TM II Plus Enzyme Mix (Invitrogen), PrimeSTAR TM HS DNA Polymerase (Takara), Sanprep column gel recovery kit (Sangon Biotech), plasmid miniprep kit (TIANGEN), Taq DNA Polymerase (Fermentas), dNTP Mix (Fermentas), GeneRuler TM 100bp DNA Ladder (Fermentas), VBUltraStable competent cells (VectorBuilder), various other restriction endonucleases (NEB).
[0019] 1. Acquisition of target fragment
[0020] 1.1 Primer design: (BsaI)
[0021] Primer - F: atcg GGTCTC G GGC TGCCACCATGGATGTATTCATGAAAGGACTTTCAAAG
[0022] Primer - R:
[0023] atcg GGTCTC G GGGT TCATACCTTTCTCTTCTTTTTTGGGGCTTCAGGTTCGTAGTCTTGATAC
[0024] The underlines are the recognition sites of BasI, the lowercase letters are the protection bases, and the underlined italics will form sticky ends after digestion;
[0025] 1.2 PCR amplification
[0026] The template source of the human α - Syn coding sequence is NM_001375286.1, as shown in SEQ ID NO:1; the SV40 nuclear translocation signal sequence is: CCA AAAAAGAAGA GAAAGGTATGA;
[0027] 1.2.1 The PCR reaction system is as follows: 10 μL of 5×Primer STARTM Buffer, 4 μL of dNTP Mixture (10 μM), 1 μL of Primer - F (10 μM), 1 μL of Primer - R (10 μM), 1 μL of template DNA, 0.5 μL of Primer STARTM HS DNA Polymerase, and ddH2O is added to 50 μL;
[0028] 1.2.2 The amplification procedure is as follows:
[0029]
[0030] 1.2.3 The reaction is terminated with 6×loading buffer.
[0031] 1.2.4 The 1% agarose gel electrophoresis of the PCR product is carried out with reference to the instruction manual of the Sangon Sanprep column - type gel recovery kit. The specific steps are as follows:
[0032] a. Cut the agarose gel block containing the target DNA fragment with a clean surgical blade, put it into a 1.5 mL centrifuge tube, and weigh it; b. Add Buffer B2 which is 3 - 6 times the weight of the gel block, and incubate in a 50 °C water bath for 5 - 10 minutes to dissolve the gel.
[0033] c. Transfer all the melted solution into the adsorption column, centrifuge at 80000 g for 30 s, pour out the liquid in the collection tube, and put the adsorption column into the same collection tube;
[0034] d. Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 g for 30 s, pour out the liquid in the collection tube, and put the adsorption column into the same collection tube;
[0035] e. Repeat step (4) once;
[0036] f. Put the empty adsorption column and the collection tube into the centrifuge, centrifuge at 9000 g for 1 min;
[0037] g. Add 15 - 40 μL of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1 - 2 min, centrifuge at 9000 g for 1 min, and store the DNA solution.
[0038] 2. Construction of the entry vector (pDown - hSNCA / SV40NLS) by BP reaction
[0039] 2.1 BP reaction. Through the BP reaction, an entry cloning vector is constructed. The reaction system is as follows:
[0040]
[0041] 2.2 React the BP at 25 °C for 3 h. After the reaction is completed, add Proteinase K to terminate the reaction for 10 min;
[0042] 2.3 Transform Escherichia coli competent cells: The volume of the competent cells is 100 μL. Add 2 μL of the BP reaction product to the competent cells and incubate on ice for 30 min;
[0043] 2.4 Heat shock at 42 °C for 90 s, incubate on ice for 2 min, add 250 μL of SOC medium, and culture with shaking at 37 °C and 225 rpm for 1 h;
[0044] 2.5 Plate coating: Spread 100 μL of the product onto an LB plate and incubate overnight at 37 °C;
[0045] 2.6 Pick monoclonal colonies for PCR identification. Mark the colonies to be detected on the LB plate. The colony PCR reaction system is as follows:
[0046]
[0047]
[0048] The reaction program is 94 °C, 3 min; 94 °C, 30 s; 60 °C, 30 s; 72 °C, 1 min / 1 - 2 Kb; 18 - 25 cycles, 72 °C 5 - 10 min;
[0049] 2.7 Perform electrophoresis on a 1% agarose gel to determine positive monoclonal colonies. Culture the positive monoclonal colonies with shaking for plasmid extraction, restriction digestion, and sequencing.
[0050] 3. LR reaction to construct the final vector pLV[Exp]-EGFP:T2A:Puro-EF1A>hSNCA / SV40 NLS
[0051] 3.1 LR reaction. Recombine the target sequence into the final backbone vector through the LR reaction to obtain a recombinant expression vector containing the target sequence. The reaction system is as follows:
[0052]
[0053] 3.2 React at 25 °C for 3 h. After the reaction is completed, add Proteinase K to terminate the reaction for 10 min.
[0054] 3.3 Transform Escherichia coli competent cells: The volume of the competent cells is 100 μL. Add 2 μL of the LR reaction product to the competent cells and incubate on ice for 30 min;
[0055] 3.4 Heat shock at 42 °C for 90 s, incubate on ice for 2 min, add 250 μL of SOC medium, and culture with shaking at 37 °C and 225 rpm for 1 h;
[0056] 3.5 Plate coating: Coat 100 μL of the product onto an LB plate and incubate overnight at 37 °C;
[0057] 3.6 Pick monoclonal colonies for PCR identification, mark the colonies to be detected on the LB plate. The colony PCR reaction system is as follows:
[0058]
[0059]
[0060] Reaction procedure:
[0061] 94 °C for 3 min
[0062] 94 °C, 30 s; 60 °C, 30 s; 72 °C, 1 min / 1 - 2 Kb; 18 - 25 cycles
[0063] 72 °C for 5 - 10 min.
[0064] 3.7 Perform electrophoresis using 1% agarose gel to determine positive monoclonal colonies. Culture the positive clones by shaking and extract plasmids, perform restriction digestion and send for sequencing. The restriction digestion results are shown in Figure 1 .
[0065] Example 2: Lentivirus packaging and virus harvesting:
[0066] Instruments related to the experiment: Clean bench SW-CJ-2FD (Suzhou Jing'an Antai); Research-grade inverted microscope IX73 (OLYMPUS); Low-speed refrigerated centrifuge (Sorvall); Thermo ultra-high-speed refrigerated centrifuge (Optima XPN Beckman); Carbon dioxide incubator (SteriThermo);
[0067] Reagents: Lipofectamine (Invitrogen); Opti-MEM I culture medium (Invitrogen); Sucrose (Sigma); HEK293 cells (ATCC).
[0068] 1. Transfect HEK293 cells by the liposome method and harvest the virus
[0069] 1.1 One day before transfection, seed HEK293 cells into a 100 mm culture dish, add DMEM medium containing 10% FBS, and culture at 37 °C and 5% CO2 for 24 h. The cell confluence rate is about 80% - 90% before transfection;
[0070] 1.2 Change the medium 1 h before transfection and add culture medium and continue culturing;
[0071] 1.3 Mix solutions A and B separately. Solution A is 1.5 mL of Opti-MEM and 4 μg of DNA, gently invert to mix well; Solution B is 1.5 mL of Opti-MEM and 40 μL of Lipofectamine 2000, gently invert to mix well, and incubate at room temperature for 5 min; Mix the above two tubes of solution gently by inverting, and let stand at room temperature for 20 min;
[0072] 1.4 Slowly add the incubated transfection complex drop by drop to the cells with the medium changed, gently shake to mix well, culture overnight at 37 °C and 5% CO2. After 16 h of transfection, change the medium to DMEM containing 10% FBS, and continue to culture at 37 °C and 5% CO2; 1.5 Collect the culture supernatant after 48 h of transfection for concentration, centrifuge at 4 °C and 2000 g for 30 min, and filter the centrifuged supernatant through a 0.45 μM filter to remove cell debris;
[0073] 1.6 Add the filtrate to a centrifuge tube, centrifuge at 50000 g for 2 h to collect the lentivirus particles, and discard the supernatant;
[0074] 1.7 Resuspend each tube of precipitate with 200 μL of HBSS buffer, aliquot and store at -80 °C. The finally constructed lentiviral vector is shown in Figure 2 。
[0075] 2. Virus purification
[0076] 2.1 Add 200 μL of virus concentrate to a centrifuge tube, add 1.5 mL of 20% sucrose solution on the top, balance and centrifuge at 50000 g for 2 h;
[0077] 2.2 Centrifuge to remove the supernatant, collect the precipitated virus particles, resuspend each tube of precipitate with 200 uL of HBSS buffer, and measure the virus titer.
[0078] 3. Lentivirus titer detection
[0079] 3.1 Titer determination (fluorescence counting method)
[0080] 3.1.1 Seed HEK293 cells into a 96-well plate, seed 100 μL of cell suspension (10 4 cels / well) in each well, with DMEM medium containing 10% FBS, and culture overnight at 5% CO2 and 37 °C;
[0081] 3.1.2 The next day, gradient-dilute the virus stock solution with DMEM medium containing 10% FBS by the limited dilution method, from 10 -1 to 10 -10 , aspirate the culture medium in the cell wells, and add the diluted solutions with dilution factors from 10 -4 to -10Viral solution, add 3 wells for each dilution, and add 100 μL of the virus dilution suspension to each well;
[0082] 3.1.3 After transduction for 16 h, change the medium to DMEM containing 10% FBS, and continue to culture at 37 °C and 5% CO2.
[0083] 3.1.4 Measure the virus titer by p24 ELISA method (ELISA method)
[0084] Capture the HIV-1 p24 antigen through the microtiter wells coated with anti-p24, and bind it to the biotinylated secondary anti-p24 antibody. Subsequently, add streptavidin-HRP conjugate and substrate to color in the solution. Measure the color intensity by spectrophotometry to indicate the level of p24 in the sample, and then perform precise quantification with the p24 standard curve. The final virus titer is: 1.18×10 9 TU / m.
[0085] Example 3: Construction of transgenic mice
[0086] Main reagents: M2 solution (Millipore, USA); tri-gas incubator (FORMA, USA); dissection microscope and inverted microscope (NIKON Corporation, Japan); micromanipulation system (EPPENDORF Corporation, Germany); culture dishes, Pasteur pipettes (FALCON Corporation, USA); pipettes (EPPENDORF Corporation, Germany); pregnant mare serum gonadotropin (PMSG) for injection and human chorionic gonadotropin (HCG) for injection are purchased from Ningbo Sansheng Pharmaceutical; mineral oil (Sigma, USA).
[0087] 1. Preparation of recipient female mice
[0088] Select ICR mice aged 4 - 6 weeks and weighing 20 - 25 g as recipient mice. Mate them with vasectomized ICR mice the night before transplantation, and select the female mice with sperm plugs the next day as recipient transplants.
[0089] 2. Ovulation induction in mice
[0090] Select c57bl / 6J female mice aged 4 - 10 weeks and inject 5 international units (IU) of pregnant mare serum gonadotropin (PMSG) intraperitoneally. Approximately 48 - 54 h later, inject 2.5 - 5.0 IU of human chorionic gonadotropin (hCG) into the same mouse intraperitoneally, and then cage them with sexually mature male c57bl / 6J mice aged 8 - 12 weeks.
[0091] 3. Collection of fertilized eggs
[0092] On the day after coitus, mice with visible sperm plugs were selected to collect fertilized eggs. The cumulus complexes were digested with hyaluronidase and rinsed 2-3 times with pre-warmed M2 culture medium for 1-2 hours. After removing the cumulus cells, the fertilized eggs were placed in M2 culture medium with a sterile pipette, covered with mineral oil (Sigma, catalog number: M8410-1L) on the top, and cultured in an incubator at 37°C and 5% CO2.
[0093] 4. Microinjection
[0094] During the incubation of the fertilized eggs, observe the formation of pronuclei. Generally, obvious pronuclei appear after culturing the fertilized eggs for 2-4 hours. At this time, microinjection is immediately performed. The concentration of the lentiviral vector injection is about 1n-5ng / mL (1×10 -5 μL). After injection, the fertilized eggs are transferred to another fresh M2 culture medium and cultured for 1-2 hours.
[0095] 5. Tubal transplantation
[0096] 5.1 Transplantation
[0097] Use a glass capillary with a diameter of 150-160μm and a length of about 7-10cm. First, aspirate about 0.05cm of M2 solution, then aspirate a 0.05cm air segment, then aspirate about 0.05cm of M2 solution, and then aspirate a 0.05cm air column. After completing 2 liquid columns and 2 air columns, finally aspirate 15 fertilized eggs, and then aspirate a 0.05cm air column. The last segment is 0.05cm of M2 solution. That is, the order of the entire transplantation liquid column is: M2 liquid column - air column - M2 liquid column - air column - embryo liquid column - air column - M2 liquid column; 5.2 Anesthetize the pseudopregnant female mouse with 1.25% avertin by intramuscular injection at a dose of 0.2mL / 10g and place it on a 37°C thermostatic pad. Wipe the back of the mouse with iodine cotton, and then wipe it with 70% alcohol. Make a vertical small incision (0.3-0.5cm) about 0.5 cm to the left of the midline, between the dorsal hump and the hip joint of the hind leg. Bluntly separate the tissues with an ophthalmic forceps, and gently remove the fat pad, ovary and fallopian tube. Fix the fat pad with a small spring clip. Move the thermostatic pad so that the mouse is under the dissecting microscope, and appropriately adjust the microscope and the position of the mouse so that the ampulla of the fallopian tube is clearly visible. Make a small incision about 0.02cm at the transparent capsule membrane of the infundibulum with an ophthalmic small scissors, gently insert the prepared transplantation tube into the fallopian tube about 0.1-0.2cm deep from this opening, and gently blow the fertilized eggs into the infundibulum. When 3 bubbles are seen in the infundibulum, slowly withdraw the transplantation tube. Then remove the spring clip and use a blunt forceps to restore the fat pad and fallopian tube to their original positions, suture the wound, and apply erythromycin eye ointment to the wound surface after suturing; transplant the right fallopian tube of the mouse in the same steps.
[0098] After transplantation, the mouse wakes up on the thermostatic pad and is transferred to the original cage for feeding.
[0099] 6. Identification of transgenic mice
[0100] Seven days after the offspring mice were born, the tail tips of the mice could be taken to extract proteins for Western blot detection of the positive expression of α-Syn-NLS. The results are shown in Figure 3 ; The newborn offspring mice were placed on the stage of a fluorescence microscope for observation and photography. The results are shown in Figure 4 . As can be seen from the figure, the mice produced systemic immunofluorescence. Therefore, the first two experiments indicated that the transgenic mice were successfully constructed.
Claims
1. A method for constructing a transgenic mouse with systemic overexpression of human α-Syn-NLS, characterized in that: Construct the recombinant expression vector pDown-hSNCA / SV40NLS containing the human α-Syn sequence and the SV40 nuclear translocation signal sequence, and then construct the recombinant expression vector pDown-hSNCA / SV40NLS into the lentiviral vector. After virus packaging and purification, a lentiviral human α-Syn-NLS overexpression vector is obtained. Inject the lentiviral human α-Syn-NLS overexpression vector into mouse fertilized eggs to obtain transgenic mice with systemic overexpression of human α-Syn-NLS.
Citation Information
Patent Citations
RNA interference recombinant lentiviral vectors targeting HSP70 gene and construction method of RNA interference recombinant lentiviral vectors
CN105925611A
SiRNA targeting to synaptotagmin-11 (Syt11), expression vector, virions and pharmaceutical applications of SiRNA, expression vector and virions
CN107893078A