Phytophthora sojae stt3 protein and its encoding gene and application

Abstract

This invention discloses an oligosaccharide syltransferase STT3 subunit from *Phytophthora sojae*, its encoding gene, and its applications. The protein sequence of the oligosaccharide syltransferase STT3 subunit provided by this invention is shown in Sequence 2; its encoding gene is shown in Sequence 1. Experiments have demonstrated that the protein provided by this invention plays an important role in the growth and development of *Phytophthora sojae*, specifically manifested in the slowed mycelial growth, reduced number of sporangia and zoospores, and decreased pathogenicity of *Phytophthora sojae* after its deletion. These conclusions provide a technical basis for exploring the molecular mechanisms of *Phytophthora sojae* development and pathogenicity, and provide molecular targets for the future development of novel fungicides.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the STT3 (staurosporine and temperature-sensitive) protein PsSTT3 from Phytophthora sojae, its encoding gene, and its applications. Background Technology

[0002] Phytophthora soda is a typical oomycete pathogen of the Phytophthora genus, and in 2015 it was selected by the journal *Molecular Plant Pathology* as one of the 10 most important oomycetes. Phytophthora soda is the pathogen that causes soybean blight, and it is a typical soil-borne plant pathogen. In the United States, root rot and stem rot caused by Phytophthora soda result in billions of dollars in economic losses annually. Phytophthora soda can cause soybean seed rot, root rot, stem rot, and seedling wilting. The typical symptoms of infected soybean plants are rotting starting from the roots and gradually spreading upwards along the stem, forming visible brown lesions on the stem, especially at the base.

[0003] The life cycle of *Phytophthora sojae* consists of asexual and sexual stages. In the sexual stage, *Phytophthora sojae* forms oospores through homozygous mating. These oospores have thick walls and are rich in contents, enabling them to withstand extreme environments and survive in the soil for several years. Under suitable conditions, they serve as a primary source of infection, directly germinating to produce mycelium that infects the host plant. In the asexual stage, the sporangia of *Phytophthora sojae* can directly germinate to form mycelium or differentiate into zoospores, indirectly carrying out the disease infection cycle. Zoospores have a short lifespan and can differentiate into resting spores, which then germinate into mycelium or directly form secondary zoospores. Zoospores form resting spores on the root surface, which directly invade the roots through germinating mycelium or through wounds and natural openings. They live as mycelium within the plant and continuously expand. After approximately 15 hours, they transform into necrotic parasites, and necrotic spots begin to appear on the surface of the host plant.

[0004] In summary, the growth rate of *Phytophthora soybeanis* mycelium and the formation of sporangia and zoospores are important factors affecting the occurrence and development of the disease. Slowing down the growth rate of *Phytophthora soybeanis* mycelium and blocking the formation of sporangia and zoospores can reduce the pathogen's ability to infect the host plant, thus controlling the damage caused by *Phytophthora soybeanis* root rot. Summary of the Invention

[0005] The inventors' research revealed that knocking out the PsSTT3 gene in *Phytophthora sojae* leads to its lethality, suggesting its potential as a novel target for fungicides. The PsSTT3 protein in *Phytophthora sojae* is closely related to the growth rate of *Phytophthora sojae* mycelia, as well as the production of sporangia and zoospores. Furthermore, the normal infection cycle of plant diseases is positively correlated with mycelial growth rate, sporangia production, and zoospore production. Therefore, by regulating the STT3 protein, mycelial growth can be slowed down, and normal sporangia and / or zoospore production can be blocked, thereby weakening the ability of *Phytophthora sojae* to infect the host and controlling the occurrence and development of *Phytophthora sojae* root rot.

[0006] Therefore, one of the objectives of this invention is to provide a class of soybean Phytophthora STT3 proteins, named PsSTT3, derived from soybean Phytophthora strain P6497, and which is as follows: A1) or A2) or A3) or A4):

[0007] A1) The amino acid sequence of the protein is as shown in sequence 2;

[0008] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein as shown in Sequence 2;

[0009] A3) Proteins derived from the protein shown in Sequence 2 that have the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2.

[0010] A4) An amino acid sequence that has a similarity of 75% or more, preferably 85% or more, and more preferably 95% or more to the amino acid sequence shown in Sequence 2, and has the same function as the amino acid sequence shown in Sequence 2.

[0011] To facilitate the purification of proteins in A1, tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), and C-myc (EQKLISEEDL) can be attached to the amino or carboxyl terminus of proteins with amino acid sequences as shown in Sequence 2 of the sequence listing.

[0012] The proteins in A1)-A4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically. The encoding genes of the proteins in A2)-A4) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in Sequence 1 of the sequence listing, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching the coding sequence of the above tag to its 5' end and / or 3' end.

[0013] In A1), sequence 2 (PsSTT3) in the sequence listing consists of 888 amino acid residues.

[0014] A second objective of this invention is to provide a nucleic acid molecule encoding the STT3 protein. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; or it may be RNA, such as mRNA, hnRNA, or tRNA.

[0015] The gene encoding the STT3 protein is either B1) or B2) or B3):

[0016] B1) The DNA molecule represented by the nucleotide sequence described in Sequence 1 of the sequence listing;

[0017] B2) has 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1), and is a cDNA molecule or DNA molecule encoding the above-mentioned STT3 protein;

[0018] B3) hybridizes with the nucleotide sequence defined by B1) or B2) under strict conditions, and is a cDNA molecule or DNA molecule encoding the above-mentioned STT3 protein.

[0019] The above-mentioned coding gene consists of 2756 nucleotides in sequence 1 of the sequence listing; the coding sequence is the nucleotides from position 1 to 270 and position 360 to 2756 from the 5' end of sequence 1, which encodes the protein (PsSTT3) shown in sequence 2 of the sequence listing.

[0020] The RNA molecule mentioned above is the RNA molecule obtained by transcribing the coding gene mentioned above;

[0021] Preferably, the sequence of the RNA molecule is as follows (C1) or (C2):

[0022] C1) The RNA sequence transcribed from the DNA sequence shown in Sequence 1 has a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more, and has the same function as the RNA sequence transcribed from the DNA sequence shown in Sequence 1.

[0023] C2) An RNA sequence transcribed from a DNA sequence as shown in Sequence 1.

[0024] The DNA sequence of the present invention can hybridize with the DNA sequence shown in Sequence 1 under stringent conditions and encodes the STT3 protein shown in Sequence 2. The stringent conditions can be hybridization with a solution of 6×SSC, 0.5% SDS at 65°C, followed by washing once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0025] A third objective of this invention is to provide the above-mentioned nucleic acid molecule-related biological materials, including recombinant vectors, expression cassettes, recombinant microorganisms, or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector; the microorganism can be yeast, bacteria, algae, or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, it can be any one of the following D1) to D10):

[0026] D1) An expression cassette containing the gene encoding as described in claim 2;

[0027] D2) A recombinant vector containing the encoding gene of claim 2, or a recombinant vector containing the expression cassette of D1);

[0028] D3) A recombinant microorganism containing the encoding gene of claim 2, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2;

[0029] D4) A transgenic plant cell line containing the encoding gene of claim 2, or a transgenic plant cell line containing the expression cassette of D1);

[0030] D5) Transgenic plant tissue containing the encoding gene of claim 2, or transgenic plant tissue containing the expression cassette of claim 2;

[0031] D6) A transgenic plant organ containing the encoding gene of claim 2, or a transgenic plant organ containing the expression cassette of claim 2;

[0032] D7) Inhibit the nucleic acid molecules encoding the gene as described in claim 2;

[0033] D8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in D7);

[0034] D9) Nucleic acid molecules that inhibit the translation of the aforementioned RNA molecules;

[0035] D10) produces expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines that generate the nucleic acid molecules described in D9).

[0036] The fifth objective of this invention is to provide the application of soybean Phytophthora STT3 protein and nucleic acid molecules encoding STT3 protein or biomaterials containing nucleic acid molecules encoding STT3 protein.

[0037] The application is any one or more of the following 1)-5):

[0038] 1) Application in regulating (increasing or decreasing) the production of soybean Phytophthora sporangia and / or zoospores;

[0039] 2) Application in regulating (increasing or decreasing) the growth rate of *Phytophthora indicum* mycelium;

[0040] 3) Application in regulating (increasing or decreasing) the ability of soybean Phytophthora to infect hosts;

[0041] 4) Application in regulating (increasing or decreasing) the pathogenicity of soybean Phytophthora in the host;

[0042] 5) Application in inhibiting and / or killing soybean Phytophthora;

[0043] Preferably, the application includes the implementation of the applications described in 1)-5) by inhibiting or inactivating transcription in the coding gene of sequence 1, or inhibiting translation of the RNA molecule, or inhibiting and / or inactivating the activity of the STT3 protein of sequence 2.

[0044] In the aforementioned applications, the production of sporangia, zoospore production, mycelial growth rate, and host infection ability of Phytophthora soybeanis are regulated by inhibiting the transcription of the coding genes described above, or inhibiting the translation of the RNA sequences described above, or inhibiting and / or inactivating the activity of the STT3 protein described above, thereby inhibiting and / or killing the growth of Phytophthora soybeanis.

[0045] The sixth objective of this invention is to provide the application of the STT3 protein shown in sequence 2 of the above sequence listing and the coding gene shown in sequence 1 of the above sequence listing in screening antibacterial or fungicidal agents for soybean Phytophthora.

[0046] The seventh objective of this invention is to provide a method for screening or assisting in the screening of antibacterial and / or fungicidal agents against Phytophthora soybeanis. The method includes applying a test substance to the Phytophthora soybeanis pathogen. When the test substance can inhibit the transcription of the DNA sequence as shown above, or inhibit the translation of the RNA sequence as shown above, or inhibit and / or inactivate the STT3 protein as shown above, the test substance is a candidate antibacterial and / or fungicidal agent against Phytophthora soybeanis pathogen.

[0047] The eighth objective of this invention is to provide a method for reducing the activity of Phytophthora in soybean, comprising the following steps: inhibiting or deleting the transcription of the coding gene as described above, or inhibiting the translation of the RNA molecule described above, or inhibiting and / or inactivating the activity of the STT3 protein as described above.

[0048] The reduction of the activity of Phytophthora in soybean is to reduce the infectivity and / or pathogenicity of Phytophthora in soybean to the host, and / or reduce the growth rate of Phytophthora in soybean, and / or inhibit the production of sporangia and zoospores of Phytophthora in soybean.

[0049] In the above method, protein inactivation is achieved by inhibiting or reducing the expression of the gene encoding the protein whose activity is to be inhibited or inactivated. Specifically, this can be achieved through gene knockout or gene silencing.

[0050] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0051] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level by specifically inhibiting target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0052] Preferably, the protein represented by sequence 1 in the sequence listing of *Phytophthora indicum* is knocked out and silenced to inactivate the protein represented by sequence 2 in the sequence listing;

[0053] In two embodiments of the present invention, the methods for knocking out the above-mentioned genes are CRISPR / Cas9-based gene knockout and antisense RNA-based gene silencing.

[0054] Specifically, the CRISPR / Cas9-based gene knockout method involves transfecting the Donor vector of the target gene, sgRNA, and Cas9 co-expression plasmid into Phytophthora soybean and screening to obtain recombinant bacteria with inactivated target knockout proteins.

[0055] The Donor vector is a recombinant vector containing a sequence of 800-1500 bp upstream of the gene to be knocked out, a Doodor DNA sequence (which can be a gene sequence such as NPTII, GFP, or RFP), and a sequence of 800-1500 bp downstream of the gene to be knocked out, connected in sequence.

[0056] The sgRNA and Cas9 co-expression plasmid is a vector that co-expresses the sgRNA fragment targeting the gene to be knocked out and the encoding of Cas9. The gene to be knocked out is the PsSTT3 gene, and the sgRNA sequence targeting the PsSTT3 gene is GAACAGGAAGTAGAGACCCA.

[0057] Preferably, the sgRNA and Cas9 co-expression plasmid is obtained by using the pYF515 vector as the starting vector, inserting the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PsSTT3 gene between the Nhe I and Bsa I enzyme recognition sites of the pYF515 vector.

[0058] The application of substances that inhibit the expression and / or activity of STT3 protein in the preparation of fungicides against Phytophthora sojae is also within the scope of protection of this invention.

[0059] In the above applications, the substance that inhibits STT3 protein expression and / or activity is a substance that inhibits STT3 protein expression and / or inhibits the transcription of the gene encoding STT3 protein and / or inhibits the translation of RNA molecules obtained from the transcription of the gene encoding STT3 protein.

[0060] Experiments have demonstrated that the PsSTT3 protein provided in this invention plays a role in the growth and development of *Phytophthora sojae*. Homozygous PsSTT3 gene knockout transformants could not be obtained using CRISPR / Cas9 gene editing technology, and PsSTT3 gene knockout leads to lethality in *Phytophthora sojae*. PsSTT3 gene-silenced transformants obtained using CaCl2-PEG-mediated protoplast transformation exhibited significant changes in growth and development compared to the wild-type parent strain, primarily including slower mycelial growth rate, reduced sporangium and zoospore production, and weakened ability to infect host plants. Therefore, the STT3 protein in *Phytophthora sojae* plays a crucial role in the vegetative growth, asexual reproduction, and host infection processes of *Phytophthora sojae*. This invention provides technical support for research on the pathogenic mechanism of *Phytophthora sojae* and offers a potential molecular target for the future development of novel fungicides. Attached Figure Description

[0061] Figure 1 Colony diameter bar charts of *Phytophthora sojae* strain P6497 (WT), empty vector control transformant F3 (CK), and PsSTT3 gene-silenced transformant series (S1-8, S1-31, and S1-68 represent PsSTT3 gene-silenced transformants) (cultured on V8 solid medium for 5 days).

[0062] Figure 2 Bar chart showing the pathogenicity of *Phytophthora sojae* strain P6497 (WT), empty vector control transformant CK (F3), and PsSTT3 gene-silenced transformant series (S1-8, S1-31, and S1-68 represent PsSTT3 gene-silenced transformants). Detailed Implementation

[0063] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0064] Soybean Phytophthora strain P6497: This is a standard strain donated by Professor Brett M. Tyler of Oregon State University, USA, and is stored in the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It is available to the public from China Agricultural University.

[0065] Culture medium or reagent formulation:

[0066] 10% V8 solid culture medium: 100ml V8 vegetable juice, 1.4g CaCO3, stir well, dilute 10 times with deionized water, i.e., add 900ml deionized water, add 15g agar, autoclave at 121℃ for 20min.

[0067] 10% V8 liquid culture medium: 100ml V8 vegetable juice, 1.4g CaCO3, stir well, centrifuge at 12000rpm for 5min, take the supernatant, dilute 10 times with deionized water, and autoclave at 121℃ for 20min.

[0068] S+L solid culture medium: 10ml basal culture medium (100mg (NH4)2SO4, 100mg MgSO4·7H2O, 30mg CaCl2·2H2O, 3mg ZnSO4·7H2O, 60mg K2HPO4, 30mg KH2PO4, distilled water added to 100ml), 100mg lecithin, 40mg glucose, KOH to adjust pH to 7.0, mix thoroughly, 15g agar powder, add water to 1L, autoclave at 121℃ for 20min.

[0069] Nutrient pea broth (NPB): Add 125g of peas to 1L of deionized water, autoclave at 121℃ for 20min, and filter through gauze to obtain the pea nutrient solution. Mix 2.0g yeast extract, 5.0g glucose, 5.0g mannitol, 5.0g sorbitol, 2.0g CaCO3, 0.1g CaCl2, 0.5g MgSO4, 3.0g KNO3, 1.0g K2HPO4, and 1.0g KH2PO4. Centrifuge at 3000rpm for 10min or let stand for 30min, collect the supernatant, and bring the volume to 1L with the pea nutrient solution. Add 15g agar powder to the solid culture medium (NPBA), and autoclave for 20min. Before use, add 2ml of vitamin stock solution (Biotin 6.7×10⁻⁶) in a sterile operating room. -7g / ml; Folic acid 6.7×10 -7 g / ml; L-inositol 4.0×10 -5 g / ml; Nicotinic acid 4.0×10 -5 g / ml; Pyridoxine-HCl 6.0×10 -4 g / ml; Riboflavin 5.0×10 - 5 g / ml; Thiamine-HCl 1.3×10 -3 g / ml) and 2 ml of trace element stock solution (FeC6H5O7·3H2O 5.4×10 g / ml) -4 g / ml; ZnSO4·7H2O 3.8×10 -4 g / ml; CuSO4·5H2O 7.5×10 -4 g / ml; MgSO4·H2O 3.8×10 -5 g / ml; H3BO3 2.5×10 -5 g / ml; Na2MoO4·H2O 3.0×10 -5 g / ml).

[0070] Pea Mannitol (PM) medium: 91.1g mannitol, 1g CaCl2, 2g CaCO3, add to about 900ml pea nutrient solution, stir and mix for about 30min, centrifuge at 3000rpm for 10min or let stand for 30min, take the supernatant, and make up to 1L with pea nutrient solution. Add 15g agar powder to solid medium (PMA), and sterilize by moist heat for 20min.

[0071] Mycelial enzymatic hydrolysate (20ml): 10ml 0.8M mannitol, 0.8ml 0.5M KCl, 0.8ml 0.5M 4-morpholinoethanesulfonic acid, 0.4ml 0.5M CaCl2, 0.12g cellulase (Calbiochem, CAT. No. 219466), 0.12g lyase (Sigma, CAT. No. L1412), and sterile ultrapure water to a final volume of 20ml. Mix well to dissolve, filter through a 0.22μm membrane for sterilization, and prepare fresh before use.

[0072] MMG solution (250ml): 18.22g mannitol, 0.76g MgCl2·6H2O, 2.0ml 0.5M 4-morpholinoethanesulfonic acid (pH=5.7), ultrapure water to a final volume of 250ml, sterilized by filtration through a 0.22μm filter membrane.

[0073] W5 solution: 0.1g KCl, 4.6g CaCl2·2H2O, 2.25g NaCl, 7.8g glucose, dissolved in ultrapure water and brought to a final volume of 250ml, then filtered through a 0.22μm filter membrane for sterilization.

[0074] PEG-CaCl2 solution (40% w / v): 12g PEG 4000, 3.75ml 0.5M CaCl2, 3ml sterile ultrapure water, sterilized by filtration through a 0.22μm filter membrane.

[0075] Example 1: Obtaining the soybean Phytophthora STT3 protein PsSTT3 and its encoding gene

[0076] In this embodiment, the PsSTT3 protein and its encoding gene (or cDNA) of *Phytophthora sojae* STT3 were obtained by amplification using the DNA (or cDNA) of the standard strain P6497 of *Phytophthora sojae* as a template, through the primers listed in Table 1. The DNA or RNA extraction material can be the hyphae of the standard strain P6497 of *Phytophthora sojae*. The encoding gene PsSTT3 is shown in Sequence 1 of the sequence listing, which consists of 2756 nucleotides. The coding sequence is located at positions 1-270 and 360-2756 from the 5' end of Sequence 1, encoding the protein PsSTT3 shown in Sequence 2 of the sequence listing. The above protein or gene can also be synthesized artificially.

[0077] Table 1. Primers for amplifying the full-length coding gene of PsSTT3

[0078]

[0079] Example 2: Construction of the PsSTT3 gene knockout vector for Phytophthora soybean and obtaining PsSTT3 gene knockout heterozygous transformants

[0080] The method for constructing gene knockout vectors based on CRISPR / Cas9, the sequence of related vectors, and the NPT II gene sequence in this embodiment have been disclosed in the literature “Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.” and “Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.” The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA and Cas9 co-expression plasmid pYF515 used in this embodiment were all donated by Professor Brett M. Tyler of Oregon State University, USA.

[0081] The Donor vector pBS-NPTII-STT3 and the sgRNA and Cas9 co-expression plasmid pYF515-STT3 used in this embodiment are constructed as follows:

[0082] 1) Construction of pBS-NPTII-STT3: Using DNA from *Phytophthora sojae* strain P6497 as a template, primers were designed using the TaKaRa-In-Fusion Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the 1000bp upstream sequence of the target gene PsSTT3 (as shown in Sequence 3 in the sequence listing, as shown in Table 2). The sequences were obtained by amplification using primers pBS-NPTII-STT3-F1 and pBS-NPTII-STT3-R1, the NPTII gene sequence (obtained by amplification using pYF515 backbone plasmid as template with primer sequences pBS-NPTII-STT3-F2 and pBS-NPTII-STT3-R2 as shown in Table 2), and the downstream 1000bp sequence of PsSTT3 (sequence 4 in the sequence listing, obtained by amplification using primers pBS-NPTII-STT3-F3 and pBS-NPTII-STT3-R3 as shown in Table 2). In- The HD Cloning Kit sequentially fused the three amplified fragments into the cloning vector pBluescript II SK+ (EcoR V digestion). The ligation product was transformed into E. coli DH5α competent cells and cultured overnight at 37°C. The clone was then amplified and sequenced using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3'). The verified recombinant expression vector containing the sequentially linked 1000bp upstream sequence of PsSTT3, the NPTII gene sequence, and the 1000bp downstream sequence of PsSTT3 was named pBS-NPTII-STT3.

[0083] 2) Construction of pYF515-STT3: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the online RNA structure analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), an sgRNA sequence specifically targeting the PsSTT3 gene and with a weak secondary structure (sgSTT3: GAACAGGAAGTAGAGACCCA, targeting positions 1348-1367 of SEQ ID No. 1 of the PsSTT3 gene) was selected and sent to a company to synthesize forward and reverse sgRNA primers containing NheI and BsaI restriction sites and HH ribozyme. The primers were dissolved in sterile water to prepare a 100 μM solution. The double-stranded sgRNA sequence was synthesized by annealing. The reaction system consisted of 3 μl forward strand solution, 3 μl reverse strand solution, 3 μl 10×T4 DNA Ligase Buffer (NEB), 4 μl 0.5M NaCl, and 21 μl ultrapure sterile water. The mixture was pipetted and stirred, and reacted at 100℃ for 2 min. The mixture was then allowed to cool naturally at room temperature for 4 h. After that, the reaction solution was diluted 500 times. Take 2 μl of 10×T4 DNA Ligase Buffer (NEB), 50 ng of pYF515 vector (double digested with Nhe I / Bsa I), 4 μl of diluted double-stranded sgRNA solution, 1 μl of T4 DNA Ligase, and sterile ultrapure water to bring the total volume to 20 μl. Incubate at room temperature for 30 min. Transform 5 μl of the ligation product into E. coli DH5α competent cells and culture overnight at 37°C. Then, use primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGAC TG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') for colony PCR verification and sequence to verify positive clones. The recombinant vector that is verified to express the above sgRNA is named pYF515-STT3.

[0084] Table 2. Primer sequences used for vector construction

[0085]

[0086] 3) Obtaining heterozygous transformants of the PsSTT3 gene knockout in soybean Phytophthora:

[0087] PsSTT3 gene knockout transformants were prepared using the CaCl2-PEG mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0088] Specifically, the knockout transformants were obtained by co-transforming the Donor vector containing the knockout gene PsSTT3 obtained in Example 1, along with sgRNA and Cas9 co-expression plasmids (pBS-NPTII-STT3 and pYF515-STT3), into protoplasts of *Phytophthora sojae* P6497. The resulting transformants were screened by incubating them on G418 resistant V8 solid medium plates at 25°C. Mycelia of suspected transformants were collected, and DNA was extracted for PCR sequencing verification. After multiple experiments, no homozygous PsSTT3 knockout transformants were obtained; only a heterozygous PsSTT3 knockout transformant (ΔSTT3-81) was obtained.

[0089] Example 3: Obtaining the F2 generation of single oospore progeny from PsSTT3 gene knockout heterozygous transformants

[0090] The PsSTT3 knockout heterozygous transformant (ΔSTT3-81) was used as the F1 generation and inoculated into V8 medium. It was cultured in the dark at 25°C for 45 days. Approximately 60 dishes containing hyphae were harvested, and 150 ml of sterile water was added. The mixture was homogenized using a tissue homogenizer (10 s / time x 16 times). The homogenate was centrifuged at 4000 g for 10 min to enrich the oospores, and the supernatant was discarded. Sterile water was added to a final volume of 50 ml, mixed, and centrifuged at 650 g for 5 min with gentle shaking. The supernatant was discarded. Sterile water was added to a final volume of 30 ml, and the mixture was centrifuged at 650 g for 5 min with gentle shaking. The supernatant was discarded. Sterile water was added to a final volume of 15 ml, mixed, filtered through a 100 μm filter, and centrifuged at 650 g for 5 min. The supernatant was discarded. 20 ml of lysin buffer (0.3 g lysin, 0.12 g cellulase, and water to a final volume of 20 mL) was added, and the mixture was incubated at 25°C with gentle shaking for 1 h (55 rpm). Centrifuge at 650g for 5 min and remove the supernatant. Add 25 ml of sucrose solution (10%, 10 g sucrose, diluted with water to 100 ml), mix well, centrifuge at 400g for 5 min, gently shake, and remove the supernatant. Add 20 ml of sterile water, mix well, centrifuge at 400g for 5 min, remove the supernatant, and wash the oospores. Spread on S+L medium and irradiate with a black light lamp (wavelength 365 nm) at 25℃ for 3-10 days. Pick the germinated oospores and transfer them to V8 medium for DNA extraction and verification.

[0091] The results showed that, using the PsSTT3 knockout heterozygous transformant (ΔSTT3-81) as the F1 generation, in the F2 generation of 170 oospores of the PsSTT3 gene knockout heterozygous transformants, the genotype ratio of STT3 / STT3:STT3 / NPT2II:NPT2II / NPT2II was 64:106:0. No PsSTT3 gene knockout homozygous transformants with the genotype NPT2II / NPT2II were obtained. This demonstrates that PsSTT3 knockout leads to lethality of soybean Phytophthora, and that the PsSTT3 protein can serve as a potential molecular target for future novel fungicides.

[0092] Example 4: Construction of the PsSTT3 gene silencing vector for Phytophthora soybeanis and obtaining PsSTT3 gene silencing transformants

[0093] 1) Construction of pTOR-STT3: Using cDNA from *Phytophthora sojae* strain P6497 as a template, primers containing restriction enzyme sites were designed to amplify the target gene PsSTT3 412-911bp sequence (as shown in Sequence 1 of the sequence listing, obtained by amplification using primers pTOR-XbaI-STT3-F and pTOR-EcoRI-STT3-R as shown in Table 3). The amplified fragment was reverse-ligated into the cloning vector pTOR241 (digested with XbaI and EcoRI) using T4 ligase. The ligation product was transformed into *E. coli* DH5α competent cells and cultured overnight at 37°C. The clone was then amplified and sequenced using primers pTOR-F (sequence: 5'-TCACTCTCACGTGCCCAAGTCC-3') / pTOR-R (sequence: 5'-TTGTATTAAATGCATAGACACA-3'). The recombinant expression vector containing the sequentially ligated reverse sequence of PsSTT3 412-911bp was named pTOR-STT3.

[0094] 2) Obtaining soybean Phytophthora PsSTT3 gene silencing transformants

[0095] PsSTT3 gene-silencing transformants were prepared using the CaCl2-PEG-mediated protoplast transformation method. The method of oomycete genetic transformation was disclosed in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojaeusing CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0096] Specifically, the PsSTT3 gene silencing transformants were obtained by transforming the PsSTT3 silencing gene vector pTOR-STT3 obtained in Example 4 into protoplasts of *Phytophthora sojae* P6497. The resulting transformants were screened by culturing on G418 resistant V8 solid medium plates at 25°C. Mycelia of suspected transformants were collected, and DNA was extracted for PCR and Q-PCR verification, yielding a series of PsSTT3 silencing transformant strains (S1-8, S1-31, S1-68). Transformants transformed into an empty vector plasmid and undergoing the same transformation steps without PsSTT3 silencing were used as control transformants F3 (CK).

[0097] Table 3. Primers for amplifying the full-length coding gene of PsSTT3

[0098]

[0099] Example 5: Biological morphology analysis of soybean Phytophthora PsSTT3 gene-silenced transformants

[0100] I. Mycelial Growth Rate Detection

[0101] Wild-type Phytophthora soybean strain P6497 (WT), control transformant F3 (CK), and the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in Example 4 were inoculated in the center of sterile Petri dishes (9 cm in diameter) containing 15 ml of V8 solid medium and cultured at 25°C in the dark for 5 days. The colony diameter of each strain was measured using the cross-crossing method, and each strain was replicated three times.

[0102] The results showed that the mycelial growth rate of all tested PsSTT3 silent transformant strains (S1-8, S1-31, S1-68) was significantly lower than that of wild-type Phytophthora soybean strain P6497 (WT) and control transformant F3 (CK). Figure 1 The experimental results indicate that the PsSTT3 protein is involved in regulating the mycelial growth of Phytophthora soybeanis.

[0103] II. Detection of the number and morphology of sporangia and zoospores

[0104] Prepare 10% V8 solid and liquid culture media. Wild-type Phytophthora soybean strain P6497 (WT), empty vector control transformant F3 (CK), and the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in Example 4 were inoculated onto V8 solid culture media and cultured in the dark at 25℃ for 5-7 days. Ten mycelial cakes were punched from each strain using a 5mm punch and placed in a sterile petri dish (9cm in diameter) containing 20ml of V8 liquid culture medium. After culturing in the dark at 25℃ for 3 days, the mycelial cakes were rinsed with 20ml of sterile deionized water every 30 minutes for a total of 5 rinses. Then, 10ml of deionized water was added to make up the volume and the mixture was placed in the dark at 25℃ for 4-6 hours. The number and morphology of sporangia produced on the mycelial cakes were observed under a microscope. After 8-10 hours, the number and morphology of zoospores produced in the sterile water were observed under a microscope. The experiment was repeated 3 times.

[0105] The results showed that, compared with the wild-type Phytophthora soybean strain P6497 (WT) and the control transformant F3 (CK), the number of sporangia and the number of released zoospores of the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in Example 4 were significantly reduced, but the morphology of sporangia and zoospores was normal. This indicates that the PsSTT3 protein mainly affects the number of sporangia and zoospores of Phytophthora soybean (Table 4).

[0106] Table 4. Sporulation of PsSTT3 silent transformants

[0107]

[0108] Note: a P6497(WT) represents the parental strain; F3(CK) represents the strain transformed with the empty vector plasmid; S1-8, S1-31, and S1-68 represent three PsSTT3 silent transformants.

[0109] The values ​​in Table b represent the mean ± standard deviation. In the univariate ANOVA analysis in DPS software, the Turkey method was used to calculate the differences in biological traits between wild-type strains and different transformants. The same letter in the same column indicates that there is no significant difference (P<0.01).

[0110] III. Detection of Oospore Quantity and Morphology

[0111] Wild-type Phytophthora soybean strain P6497 (WT), control transformant F3 (CK), and PsSTT3 silent transformants (S1-8, S1-31, S1-68) obtained in Example 4 were inoculated in the center of a sterile culture dish (9 cm in diameter) containing 15 ml of V8 solid medium and cultured at 25°C in the dark for 14 days. The number and morphology of oospores were observed under a microscope, with three replicates.

[0112] The results showed that the number of oospores in the PsSTT3 silent transformants (S1-8, S1-31, S1-68) obtained in Example 4 was not significantly different from that of the wild-type strain P6497 (WT) and the control transformant F3 (CK), and the morphology was normal.

[0113] IV. Pathogenicity Detection

[0114] The tested soybean variety was Japanese Green, planted in seedling trays (540mm×280mm, 80 plants per hole). The culture medium was a 2:1 mixture of peat moss and vermiculite, with an appropriate amount of deionized water added. The plants were cultured in a greenhouse (27±2℃; 24h darkness) for 7 days. A 5mm mycelial cake was created on Phytophthora soybeane V8 solid medium after 5-7 days of culture. One mycelial cake was inoculated approximately 1cm from the hypocotyl of a soybean seedling. Each mycelial cake was inoculated onto 10-20 seedlings. After 3 days of dark, moist cultivation at 25℃, the length (mm) of lesions on the hypocotyl of the seedlings infected by Phytophthora soybeane was investigated.

[0115] The results showed that the pathogenicity of the PsSTT3 silent transformant series strains (S1-8, S1-31, S1-68) obtained in Example 4 was significantly reduced compared with the wild-type soybean Phytophthora pylori strain P6497 (WT) and the control transformant F3 (CK). Figure 2 This indicates that the PsSTT3 protein has the ability to participate in regulating the infection of soybean plants by Phytophthora infestans.

Claims

1. Use of knocking out the coding gene of STT3 subunit protein shown in SEQ ID No. 1 in Phytophthora sojae, characterized in that: The application is any one or several of the following 1)-3): 1) application in reducing the number of sporangia and / or the number of zoospores released by Phytophthora sojae; 2) application in reducing the growth rate of mycelium of Phytophthora sojae; 3) application in reducing the pathogenicity of Phytophthora sojae to the host.

2. A method for reducing the activity of Phytophthora sojae, which is to knock out the gene encoding the STT3 subunit protein shown in SEQ ID No. 1 in Phytophthora sojae; the method for gene knockout is CRISPR / Cas9-based gene knockout method; the sgRNA sequence targeting the encoding gene is 5'- GAACAGGAAGTAGAGACCCA -3'; wherein The reduced activity of Phytophthora sojae is the reduced pathogenicity of Phytophthora sojae to the host, and / or the reduced growth rate of mycelium of Phytophthora sojae, and / or the reduced number of sporangia and / or the number of zoospores released by Phytophthora sojae.

Images