A kind of brewing yeast and its application

Abstract

The invention provides a brewer's yeast and its application, and relates to the field of microbial fermentation. The brewer's yeast provided by the invention is specifically brewer's yeast (Saccharomyces cerevisiae) mei2101.1, and the deposit number is CGMCC No.25928. It can not only simultaneously convert inorganic selenium and zinc into organic selenium and zinc, but also has high temperature resistance and acid and alkali resistance. The brewer's yeast provided by the invention is cultured in a selenium-zinc-rich medium to obtain selenium-zinc-rich yeast, which is added to soft candy as a selenium supplement and a zinc supplement, and can resist the damage of high temperature and acidic environment to yeast activity during the soft candy production process. The soft candy can also play an embedding role for the selenium-zinc-rich yeast, and has a strong ability to resist digestion by gastric juice and intestinal juice. The selenium-zinc-rich yeast contained in the soft candy is highly active, so that the soft candy is rich in selenium and zinc, and the active yeast can maintain the stability of organic selenium and organic zinc, thereby promoting the body's absorption of selenium and zinc, and achieving a strengthening nutritional effect.

Description

Technical Field

[0001] The invention relates to the field of microbial fermentation, and in particular to brewer's yeast and applications thereof. Background Art

[0002] Zinc and selenium are essential trace elements for the life activities of humans and animals, and play important roles in promoting growth and development, improving reproductive capacity and regulating immune function. Traditional selenium and zinc supplements exist in the form of inorganic salts, which have many disadvantages in application, such as being not conducive to absorption and utilization, and poor synergistic compatibility with other additives. In recent years, organic selenium and zinc from different sources have been adopted due to their stability and effectiveness in nutritional applications. However, at present, due to high costs and imperfect manufacturing processes, it is still difficult to enrich metal elements in industrial production and widely use microorganisms. In the past decade, the use of microorganisms as carriers to enrich trace elements necessary for humans and animals to obtain organic, low-cost trace element additives has attracted increasing attention from various countries.

[0003] Selenium-enriched yeast and zinc-enriched yeast are produced by adding selenium and zinc respectively during the yeast cultivation process. The yeast absorbs and utilizes selenium and zinc during growth, and the selenium and zinc are organically combined with the amino acids and polysaccharides in the yeast body to be converted into organic selenium and zinc, thereby eliminating the toxic side effects and gastrointestinal irritation of inorganic selenium (such as sodium selenite) and inorganic zinc on the human body, so that selenium and zinc can be efficiently and safely absorbed and utilized by the human body. At present, researchers have isolated and cultivated a variety of trace element-enriched brewer's yeast, among which selenium-enriched brewer's yeast is the most common. There are few reports of brewer's yeast that are simultaneously enriched in selenium and zinc, two essential trace elements for the human body, and the ability of existing brewer's yeast to simultaneously enrich selenium and zinc still needs to be improved.

[0004] Gelatin soft candy refers to a soft candy made by adding edible gelatin as a gelling agent and auxiliary materials such as white sugar or starch sugar. It is deeply loved by teenagers. Therefore, the purpose of supplementing selenium and zinc can be achieved by increasing the selenium and zinc content in the soft candy to promote the growth and development of teenagers. The preparation steps of gelatin soft candy include sol, sugar boiling, cooling, seasoning and mold pouring. In order to give the gelatin soft candy a sweet and sour taste, acidulants such as citric acid are often added during seasoning, making the environment before mold pouring acidic. In addition, since gelatin soft candy is easy to form a gel after cooling, the temperature of the soft candy before mold pouring should be maintained at 50-60°C. This acidity and high temperature will kill most microorganisms, which is not conducive to the application of selenium-zinc-rich microbial nutrient enhancers in soft candy.

[0005] Therefore, a brewer's yeast is provided that can efficiently enrich selenium and zinc and has strong high temperature resistance and acid resistance. After enriching selenium and zinc, it is added to soft candies as a nutritional enhancer. This has important application value and practical significance for promoting the growth and development of teenagers by supplementing selenium and zinc in the form of food that teenagers like to eat. Summary of the invention

[0006] Therefore, the technical problem to be solved by the present invention is to provide a brewer's yeast that can efficiently enrich selenium and zinc and has strong high temperature resistance and acid resistance. After enriching selenium and zinc, it is added to soft candies as a nutritional enhancer, thereby achieving the purpose of supplementing selenium and zinc in the form of a food that teenagers like to eat and promoting their growth and development.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] In the first aspect, the present invention provides a brewer's yeast, specifically brewer's yeast (Saccharomyces cerevisiae) mei2101.1, which was deposited in the General Microbiology Center of China Culture Collection Administration on October 17, 2022. The address of the deposit unit is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 25928.

[0009] In a second aspect, the present invention provides a bacterial agent containing the brewer's yeast.

[0010] In a third aspect, the present invention provides the use of the brewer's yeast in the preparation of selenium-zinc-enriched yeast.

[0011] In a fourth aspect, the present invention provides a soft candy comprising selenium-zinc-enriched yeast, wherein the selenium-zinc-enriched yeast is obtained by culturing the brewer's yeast in a selenium-zinc-enriched culture medium.

[0012] Furthermore, the selenium-zinc-rich culture medium contains 30 to 120 mg / L Se 4+ and 100~500mg / LZn 2+ Yeast extract peptone glucose medium.

[0013] Furthermore, the selenium-zinc-rich medium contains 60 mg / L Se 4+ and 300mg / L Zn 2+ Yeast extract peptone glucose medium.

[0014] Furthermore, the preparation method of the selenium-zinc-enriched yeast comprises the following steps: under sterile conditions, the brewer's yeast is inoculated into the selenium-zinc-enriched culture medium, cultured at 28-37° C. for 16-24 hours, and the enriched cultured bacteria are collected after centrifugation at 8000-10000 rpm for 10-15 minutes.

[0015] Furthermore, the soft candy comprises the following raw material components in parts by weight: 25-30 parts of water, 25-30 parts of maltitol, 25-30 parts of maltose syrup, 8-12 parts of concentrated fruit juice, 6-8 parts of gelatin, 0.3-0.5 parts of citric acid, and 0.1-0.2 parts of sodium citrate, wherein, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 1×10 8 ~5×10 8 CFU viable bacterial count of selenium-zinc-enriched yeast.

[0016] Furthermore, the soft candy comprises the following raw material components in parts by weight: 30 parts of water, 30 parts of maltitol, 30 parts of maltose syrup, 10 parts of concentrated fruit juice, 7.5 parts of gelatin, 0.4 parts of citric acid, and 0.1 parts of sodium citrate, wherein, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 3×10 8 CFU viable bacterial count of selenium-zinc-enriched yeast.

[0017] In a fifth aspect, the present invention provides a method for preparing the soft candy, comprising the following steps:

[0018] (1) Mixing raw materials: uniformly mixing 25 to 30 parts of water, 25 to 30 parts of maltitol, 25 to 30 parts of maltose syrup, and 8 to 12 parts of concentrated fruit juice according to a certain proportion to obtain a raw material mixture;

[0019] (2) boiling: heating the raw material mixture to boil at 102-106° C., stopping the heating, and adding 6-8 portions of gelatin pre-soaked in cold water to obtain a boiling liquid;

[0020] (3) Acid adjustment: when the temperature of the cooking liquid drops to 60-80° C., add 0.3-0.5 parts of citric acid and 0.1-0.2 parts of sodium citrate to obtain an acidic cooking liquid;

[0021] (4) Mold pouring: When the temperature of the acidic boiled liquid drops to 50-60°C, add the bacterial solution of selenium-zinc-enriched yeast, mix well, and then pour it into a mold to cool. In which, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 1×10 8 ~5×10 8 Selenium-zinc-enriched yeast with CFU viable count;

[0022] (5) Demolding and drying: After the soft candy is formed, it is removed from the mold and dried.

[0023] Furthermore, in step (1), the weight proportions of water, maltitol, maltose syrup, and concentrated fruit juice are 30 parts, 30 parts, 30 parts, and 10 parts, respectively; in step (2), the weight proportion of gelatin is 7.5 parts; in step (3), the weight proportions of citric acid and sodium citrate are 0.4 parts and 0.1 parts, respectively; in step (4), based on the sum of the weights of water, maltitol, maltose syrup, and concentrated fruit juice, 3×10 8 CFU viable bacterial count of selenium-zinc-enriched yeast.

[0024] The technical solution of the present invention has the following advantages:

[0025] 1. The brewer's yeast provided by the present invention can not only convert inorganic selenium and zinc into organic selenium and zinc at the same time, but also has high temperature resistance and acid and alkali resistance. Specifically, when brewer's yeast mei2101.1 is enriched with selenium and zinc at the same time, the biomass is 2.58 mg / L, the selenium enrichment is 1.99 mg / g, and the zinc enrichment is 48.80 mg / g. It has a strong ability to enrich selenium and zinc, which can reduce the use of culture medium materials and save production costs; brewer's yeast mei2101.1 has excellent stress resistance, can withstand high temperatures of 50 to 60°C, withstand pH 4.5 to 5.6 acidity, and withstand pH 11 to 12 alkalinity.

[0026] 2. The brewer's yeast provided by the present invention is cultured in a selenium-zinc-rich medium to obtain selenium-zinc-rich yeast, which is added to soft candies as a selenium supplement and a zinc supplement, and can resist the damage to the yeast activity caused by high temperature and acidic environment during the production of the soft candies, with a survival rate of 30.71-44.28%; the soft candies can also encapsulate the selenium-zinc-rich yeast, and have a strong ability to resist digestion by gastric juice and intestinal juice. The selenium-zinc-rich yeast contained in the soft candies has a survival rate of 24.71-36.84% after being digested in simulated gastric juice for 2 hours, and a survival rate of 46.91-68.82% after being digested in simulated intestinal juice for 2 hours; the selenium-zinc-rich yeast contained in the soft candies has high activity, so that the soft candies are rich in selenium and zinc, and the active yeast can maintain the stability of organic selenium and organic zinc, thereby promoting the body's absorption of selenium and zinc, and achieving the effect of strengthening nutrition. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 is the growth curve of Saccharomyces cerevisiae mei2101.1 in Example 2 of the present invention, wherein (a) is a selenium-resistant growth curve, and (b) is a zinc-resistant growth curve;

[0029] Figure 2 These are the growth curves of Saccharomyces cerevisiae mei2101.1 and commercial Saccharomyces cerevisiae in Example 3 of the present invention under different temperature conditions, wherein (a) is the growth curve under the condition of a temperature of 50° C.; (b) is the growth curve under the condition of a temperature of 60° C.;

[0030] Figure 3 These are the growth curves of Saccharomyces cerevisiae mei2101.1 and commercial Saccharomyces cerevisiae in Example 3 of the present invention under different pH conditions, wherein (a) is the growth curve under pH=4.5; (b) is the growth curve under pH=5.6; (c) is the growth curve under pH=11; (d) is the growth curve under pH=12;

[0031] Figure 4 This is a picture of the finished soft candy prepared in Example 5 of the present invention;

[0032] Figure 5 It is a micrograph of the change in the activity of brewer's yeast before and after the preparation of the soft candy in Example 5 of the present invention, wherein a1 is a control group of commercial brewer's yeast soft candy, a2 is a 50°C commercial brewer's yeast soft candy, a3 is a 60°C commercial brewer's yeast soft candy, b1 is a selenium-zinc-enriched yeast soft candy control group, b2 is a 50°C selenium-zinc-enriched yeast soft candy, and b3 is a 60°C selenium-zinc-enriched yeast soft candy;

[0033] Figure 6 It is a micrograph of the change in the amount of brewer's yeast before and after digestion of the soft candy in Example 5 of the present invention, wherein a1, b1, c1, and d1 are respectively undigested 50°C commercial brewer's yeast soft candy, 60°C commercial brewer's yeast soft candy, 50°C selenium-enriched zinc yeast soft candy, and 60°C selenium-enriched zinc yeast soft candy; a2, b2, c2, and d2 are respectively 50°C commercial brewer's yeast soft candy, 60°C commercial brewer's yeast soft candy, 50°C selenium-enriched zinc yeast soft candy, and 60°C selenium-enriched zinc yeast soft candy after 2 hours of simulated gastric juice digestion; a3, b3, c3, and d3 are respectively 50°C commercial brewer's yeast soft candy, 60°C commercial brewer's yeast soft candy, 50°C selenium-enriched zinc yeast soft candy, and 60°C selenium-enriched zinc yeast soft candy after 2 hours of simulated intestinal juice digestion. DETAILED DESCRIPTION

[0034] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0035] The yeast extract peptone glucose medium (HB5193-1, Haibo Biotechnology Co., Ltd.) in the embodiment of the present invention is composed of the following components: 20 g of peptone, 20 g of glucose, 10 g of yeast extract powder, pH 6.5±0.2, and its preparation method is as follows: weigh 50.0 g of this product, heat and dissolve it in 1000 mL of distilled water, and sterilize it at 121° C. for 15 minutes before use.

[0036] The potato dextrose agar medium (Solarbio, P8931-250g) in the embodiment of the present invention is composed of the following components: 6g potato powder, 20g agar, 20g glucose, pH 5.6±0.2, and the preparation method is as follows: weigh 46g of the product, heat and dissolve it in 1000mL distilled water, and sterilize it at 115°C for 20 minutes before use.

[0037] The red Bengal culture medium (Shanghai Shengsi Biochemical Technology Co., Ltd., MSS009) in the embodiment of the present invention is composed of the following components: 5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium sulfate, 0.033g red Bengal, 20g agar, 0.1g chloramphenicol, pH 7.0-7.4, and its preparation method is as follows: take 36.6g of this product, add 1000mL of distilled water, soak for several minutes, heat and boil until completely dissolved, package, and sterilize at 121°C for 15 minutes before use.

[0038] The commercial brewer's yeast in the embodiments of the present invention is Angel high-activity dry yeast, produced by Angel Yeast Co., Ltd.

[0039] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the art can be used. The raw materials or instruments used are all conventional products that can be obtained commercially, including but not limited to the raw materials or instruments used in the examples of this application.

[0040] Example 1 Isolation and identification of Saccharomyces cerevisiae mei2101.1

[0041] 1. Strain Isolation

[0042] Saccharomyces cerevisiae mei2101.1 was screened from soil samples collected from a high-selenium-rich area where fruits and vegetables are grown in Luoshi Town, Fengcheng City, Jiangxi Province. The method for screening the strain is as follows: the collected soil sample is sieved, crushed, and mixed evenly, 20g is weighed, added to 180mL of yeast extract powder peptone glucose medium containing 1mg / L sodium selenite (Na2SeO3), placed in a shaking incubator at 28°C and 180r / min for 4h, and allowed to stand for 30min; 1mL of soil suspension is added to 9mL of sterilized 0.85% saline, and diluted to 10 -1 and 10 -2, take 100 μL of the dilution and spread it on a potato dextrose agar medium solid plate containing 150 mg / L sodium selenite, place it upside down and culture it at 30°C until colonies grow, pick out single colonies with different colony morphology characteristics and white or pink color, and use the plate streak method to repeatedly separate and purify to obtain a pure culture of the strain; pick a ring of single colonies obtained by screening, add it to 10 mL of yeast extract peptone glucose medium to prepare a seed solution, take 50 μL of the obtained seed solution and inoculate it in a gradient potato dextrose agar solid medium with sodium selenite concentrations of 0, 30, 60, 120 and 240 mg / L, respectively, and culture it at 28°C for 12 hours, observe its growth and colony color, and thus screen out a strain with vigorous growth and strong selenium resistance, i.e., the target strain.

[0043] 2. Strain identification

[0044] The strains obtained by screening were used for DNA extraction using a kit and PCR amplification, and then sent to Shanghai Bioengineering for gene sequencing. The sequencing results were compared with homologous sequences in NCBI using the BLAST tool to clarify the species relationship of the strains, and the strain was confirmed to be Saccharomyces cerevisiae.

[0045] The 16S rDNA sequence of the strain is shown in SEQ ID NO.1:

[0046] TATGCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTGGCCCAGTGAAATGCGAGAT TCCCCTACCCACAAGGAGCAGAGGGCACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTC TCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAAACAACTCGACTCTTCGAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGG AACATAGACAAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTCCC

[0047] Example 2 Determination of Selenium-Zinc Tolerance and Selenium-Zinc Enrichment Capacity of Saccharomyces cerevisiae mei2101.1

[0048] 1. Determination of the range of selenium and zinc concentration tolerance of Saccharomyces cerevisiae mei2101.1

[0049] (1) Method for determining selenium tolerance concentration range

[0050] As described in Example 1, the target strain was cultured and screened by inoculating seed liquid into gradient potato dextrose agar solid culture medium with sodium selenite concentrations of 0, 30, 60, 120 and 240 mg / L, and its tolerance to selenium is shown in Table 1.

[0051] (2) Method for determining zinc tolerance concentration range

[0052] The brewer's yeast mei2101.1 screened in Example 1 was inoculated into 10 mL of yeast extract peptone glucose medium to prepare a seed solution, which was cultured at 28° C. for 12 h. 50 μL of the obtained seed solution was inoculated into potato dextrose agar solid medium with zinc chloride concentrations of 0, 200, 300, 400 and 500 mg / L, respectively, and cultured at 28° C. for 12 h. The growth was observed. The results are shown in Table 1.

[0053] (3) Results

[0054] Table 1 Tolerance of Saccharomyces cerevisiae mei2101.1 to selenium and zinc

[0055] Sodium selenite concentration (mg / L) Growth of Saccharomyces cerevisiae Zinc chloride concentration (mg / L) Growth of Saccharomyces cerevisiae 0 +++++ 0 +++++ 30 ++++ 200 +++++ 60 ++++ 300 +++++ 120 ++++ 400 ++++ 240 ++++ 500 +++

[0056] Note: + represents the growth of the strain, the more +, the better the growth.

[0057] As shown in Table 1, Saccharomyces cerevisiae mei2101.1 can tolerate a sodium selenite concentration of 0 to 240 mg / L, and has a strong selenium tolerance, and the strain can tolerate a zinc chloride concentration of 0 to 500 mg / L, and has a strong zinc tolerance.

[0058] 2. Determination of selenium-zinc tolerance growth curve of Saccharomyces cerevisiae mei2101.1

[0059] (1) Determination method of selenium-resistant growth curve

[0060] The brewer's yeast mei2101.1 obtained in Example 1 was inoculated into a yeast extract peptone glucose medium for activation for 12 h. -1 ~10 -10 Gradient serial dilutions were applied, and plates with evenly dispersed single colonies were selected for counting. Then, the number of viable bacteria in the culture medium was calculated based on the number of colonies formed and the dilution multiple. The activated bacterial solution was diluted to a viable bacterial count of approximately 1×10 5 CFU / mL, then take 200μL of bacterial solution and add it to the well plates with sodium selenite concentrations of 0, 30, 60, 120 and 240mg / L, and use the microplate reader to measure the growth curve with the detection wavelength of 600nm. The results are as follows Figure 1 As shown in a.

[0061] (2) Determination method of zinc resistance growth curve

[0062] The brewer's yeast mei2101.1 obtained in Example 1 was inoculated into a yeast extract peptone glucose medium for activation for 12 h. -1 ~10 -10Gradient serial dilutions were applied, and plates with evenly dispersed single colonies were selected for counting. Single cells grew and multiplied to form colonies visible to the naked eye, and then the number of viable bacteria in the culture medium was calculated based on the number of colonies formed and the dilution multiple. The activated bacterial solution was diluted to a viable count of approximately 1×10 5 CFU / mL, then 200 μL of bacterial solution was added to the well plates with zinc chloride concentrations of 0, 200, 300, 400 and 500 mg / L, and the growth curve was determined using an ELISA instrument. The results are as follows: Figure 1 As shown in b.

[0063] (3) Results

[0064] like Figure 1 As shown, Saccharomyces cerevisiae mei2101.1 can grow in an environment with a sodium selenite concentration of 0 to 240 mg / L, and the strain can grow in an environment with a zinc chloride concentration of 0 to 500 mg / L.

[0065] 3. Determination of zinc and selenium content in Saccharomyces cerevisiae mei2101.1

[0066] (1) Method for determining the amount of selenium enrichment

[0067] ① Preparation of selenium-enriched culture medium: Sodium selenite was added to yeast extract peptone glucose culture medium to a concentration of 60 mg / L. The culture medium was sterilized and cooled for later use;

[0068] ② Inoculation and culture: Under sterile conditions, inoculate Saccharomyces cerevisiae mei2101.1 into selenium-enriched medium and culture at 28°C for 24 hours;

[0069] ③ Collect mycelium: collect the enriched mycelium after centrifugation at 8000rpm for 10min, wash it three times with physiological saline, dry it and weigh it;

[0070] ④ Determination of selenium enrichment: The selenium content in the bacteria was determined by hydride generation atomic fluorescence spectrometry in accordance with the national food safety standard GB 5009.93-2017. The results are shown in Table 2.

[0071] (2) Method for determining the amount of zinc enrichment

[0072] ① Preparation of zinc-rich culture medium: Add zinc chloride to the yeast extract peptone glucose medium to make its concentration 300 mg / L. Sterilize the culture medium and cool it for later use;

[0073] ② Inoculation and culture: Under sterile conditions, inoculate Saccharomyces cerevisiae mei2101.1 into zinc-rich medium and culture at 28°C for 24 hours;

[0074] ③ Collect mycelium: collect the enriched mycelium after centrifugation at 8000rpm for 10min, wash it three times with physiological saline, dry it and weigh it;

[0075] ④ Determination of zinc content: According to the national standard GB 5009.14-2017 Determination of zinc in food, the bacteria were digested by wet method, and the zinc content in the bacteria was determined by flame atomic absorption spectrometry. The results are shown in Table 2.

[0076] (3) Method for determining the amount of enrichment when selenium and zinc are simultaneously enriched

[0077] ① Preparation of selenium-zinc-enriched culture medium: Sodium selenite and zinc chloride were added to yeast extract peptone glucose culture medium to make their concentrations 60 mg / L and 300 mg / L respectively. The culture medium was sterilized and cooled for later use;

[0078] ② Inoculation and culture: Under sterile conditions, inoculate Saccharomyces cerevisiae mei2101.1 into selenium-zinc-rich medium and culture at 28°C for 24 hours;

[0079] ③ Collect mycelium: collect the enriched mycelium after centrifugation at 8000rpm for 10min, wash it three times with physiological saline, dry it and weigh it;

[0080] ④ Determination of selenium-rich zinc content: According to the national food safety standard GB 5009.93-2017, the selenium content in the bacteria was determined by hydride atomic fluorescence spectrometry; according to the national standard GB 5009.14-2017, the determination of zinc in food, the bacteria were wet digested and the zinc content in the bacteria was determined by flame atomic absorption spectrometry. The results are shown in Table 2.

[0081] (4) Results

[0082] Table 2 Biomass and enrichment of Saccharomyces cerevisiae mei2101.1 in enriched medium

[0083]

[0084] As shown in Table 2, when Saccharomyces cerevisiae mei2101.1 was enriched with selenium and zinc separately, the biomass was 1.98 mg / L and 4.13 mg / L, respectively, and the enrichment amounts were as high as 1.71 mg / g and 40.25 mg / g, respectively. When selenium and zinc were enriched at the same time, the biomass was 2.58 mg / L, the selenium enrichment amount was 1.99 mg / g, and the zinc enrichment amount was 48.80 mg / g, proving that Saccharomyces cerevisiae mei2101.1 has the ability to simultaneously and efficiently enrich selenium and zinc.

[0085] Example 3 Analysis of stress resistance of Saccharomyces cerevisiae mei2101.1

[0086] 1. Analysis of resistance to high temperature

[0087] Saccharomyces cerevisiae mei2101.1 was inoculated into a conical flask containing 50 mL of yeast extract peptone glucose medium, and activated and cultured in a constant temperature shaking incubator at 28°C to the logarithmic phase. The activated bacterial liquid was inoculated into yeast extract peptone glucose medium, and cultured at 50°C and 60°C, respectively. The absorbance at a wavelength of 600 nm was measured every 1 hour using an ELISA reader (repeated 3 times independently). The growth curve of Saccharomyces cerevisiae mei2101.1 was drawn according to the change in its absorbance value, and commercial Saccharomyces cerevisiae was used as a control group. The results are shown in FIG. Figure 2 As shown. At 50°C, the growth curve of Saccharomyces cerevisiae mei2101.1 first rises and then stabilizes, while at 60°C, the growth curve of Saccharomyces cerevisiae mei2101.1 keeps rising, which indicates that Saccharomyces cerevisiae mei2101.1 can still grow under high temperature culture at 50°C and 60°C. And whether the temperature is 50 or 60°C, the growth curve of Saccharomyces cerevisiae mei2101.1 is always higher than that of commercial Saccharomyces cerevisiae, which further indicates that Saccharomyces cerevisiae mei2101.1 has a high resistance to high temperatures.

[0088] 2. Analysis of resistance to acidity and alkalinity

[0089] Saccharomyces cerevisiae mei2101.1 was inoculated into a conical flask containing 50 mL of yeast extract peptone glucose medium, and activated and cultured in a constant temperature shaking incubator at 28°C to the logarithmic phase. The activated bacterial solution was inoculated into yeast extract peptone glucose medium with different pH values ​​(4.5, 5.6, 11, 12), and cultured continuously at 28°C for 20 h. The absorbance at a wavelength of 600 nm was measured every 1 hour using an ELISA reader (repeated independently 3 times). The growth curve of Saccharomyces cerevisiae mei2101.1 was drawn based on the change in its absorbance value, and commercial Saccharomyces cerevisiae was used as a control group. The results are shown in FIG. Figure 3 As shown. Under acidic conditions of pH 4.5 or 5.6, the growth curve of Saccharomyces cerevisiae mei2101.1 first rises and then stabilizes, while under alkaline conditions of pH 11 or 12, the growth curve of Saccharomyces cerevisiae mei2101.1 first rises and then slightly decreases, indicating that Saccharomyces cerevisiae mei2101.1 can still grow in acidic or alkaline environments. And regardless of whether the growth environment is acidic or alkaline, the growth curve of Saccharomyces cerevisiae mei2101.1 is always higher than that of commercial Saccharomyces cerevisiae, which further shows that Saccharomyces cerevisiae mei2101.1 has a high acid and alkali resistance.

[0090] Example 4 Application of Saccharomyces cerevisiae mei2101.1 in the preparation of selenium-zinc-enriched yeast

[0091] This example provides a method for preparing selenium-zinc-enriched yeast using Saccharomyces cerevisiae mei2101.1:

[0092] Under sterile conditions, Saccharomyces cerevisiae mei2101.1 was inoculated into a selenium-zinc-enriched culture medium and cultured at 28°C for 24 hours. The enriched cultured bacteria were centrifuged at 8000 rpm for 10 minutes and then the bacterial sludge was collected to obtain selenium-zinc-enriched yeast.

[0093] The preparation method of selenium-zinc-enriched culture medium is as follows: sodium selenite and zinc chloride are added to yeast extract peptone glucose culture medium to make their concentrations 60 mg / L and 300 mg / L respectively, and the culture medium is sterilized and cooled for use.

[0094] Example 5 Application of selenium-zinc-enriched yeast in the preparation of soft candy

[0095] 1. Preparation of soft candy

[0096] Steps for preparing soft candy:

[0097] (1) Raw material mixing: 30 g of water, 30 g of maltitol, 30 g of maltose syrup, and 10 g of concentrated passion fruit juice were mixed uniformly by a stirrer to obtain a raw material mixture;

[0098] (2) Boiling: When the raw material mixture is heated to 106° C., the heating is stopped and 7.5 g of gelatin pre-soaked in cold water is added to obtain a boiling liquid;

[0099] (3) Acid adjustment: When the temperature of the boiling liquid drops to 80°C, add 0.4 g of citric acid and 0.1 g of sodium citrate to obtain an acidic boiling liquid;

[0100] (4) Mold pouring: When the temperature of the acidic cooking liquid drops to 60°C, add the bacterial solution of selenium-enriched zinc yeast (the number of live bacteria of selenium-enriched zinc yeast added per gram of raw material mixture is 3×10 8 CFU, the bacterial solution was prepared by adding water to the bacterial sludge prepared in Example 4, and the number of viable bacteria in the prepared selenium-zinc yeast solution was 3.9×10 9 CFU / mL), mix well, and then pour into a mold to cool;

[0101] (5) Demolding and drying: After the soft candy is formed, it is removed from the mold and placed in a drying room for drying;

[0102] (6) Packaging: The dried soft candies are sealed and packaged.

[0103] The finished soft candy prepared by this method is as follows Figure 4 shown.

[0104] 2. Changes in the activity of brewer's yeast during the preparation of soft candy

[0105] (1) Experimental samples

[0106] Commercial brewer's yeast soft candy control group: according to the dosage recorded in the first part above, water, maltitol, maltose syrup, concentrated passion fruit juice, gelatin, citric acid and sodium citrate were mixed evenly, and then the bacterial solution of commercial brewer's yeast was added (replaced according to the same number of live bacteria of selenium-zinc-enriched yeast);

[0107] 50℃ commercial brewer's yeast soft candy: refer to the soft candy preparation method in the first part above, except that the bacterial liquid of commercial brewer's yeast is used to replace the bacterial liquid of selenium-zinc yeast (replaced in the same amount according to the number of viable bacteria), and the casting temperature is 50℃;

[0108] 60℃ commercial brewer's yeast soft candy: refer to the soft candy preparation method in the first part above, the only difference is that the bacterial liquid of commercial brewer's yeast is used to replace the bacterial liquid of selenium-zinc yeast (replaced in the same amount according to the number of viable bacteria), and the casting temperature is 60℃;

[0109] The preparation method of the aforementioned commercial brewer's yeast solution is as follows: commercial brewer's yeast powder is inoculated into yeast extract powder peptone glucose medium for activation for 12 hours, and then the yeast is inoculated with a 10% ethanol solution for 10 minutes. -1 ~10 -10 Gradient serial dilutions were applied, and plates with evenly dispersed single colonies were selected for counting. Then, the number of viable bacteria in the culture medium was calculated based on the number of colonies formed and the dilution multiple. The activated bacterial solution was diluted to a viable bacteria count of 3.9×10 9 CFU / mL.

[0110] Selenium-zinc-enriched yeast soft candy control group: Mix all the raw materials (water, maltitol, maltose syrup, concentrated passion fruit juice, gelatin, citric acid, sodium citrate, selenium-zinc-enriched yeast liquid) added in the soft candy preparation process according to the dosage recorded in the first part above;

[0111] 50℃ selenium-enriched zinc yeast soft candy: refer to the soft candy preparation method in the first part above, and the casting mold temperature is 50℃;

[0112] 60℃ selenium-zinc yeast soft candy: refer to the soft candy preparation method in the first part above, and the casting mold temperature is 60℃.

[0113] (2) Microscopic observation of brewer's yeast in soft candy

[0114] Commercial brewer's yeast soft candy control group and selenium-zinc-enriched yeast soft candy control group: 5 g of the control group sample was mixed with 15 mL of normal saline, and then stirred evenly with a high-speed disperser. One drop of the mixed liquid was placed on a glass slide and covered with a cover glass.

[0115] 50℃ commercial brewer's yeast soft candy, 60℃ commercial brewer's yeast soft candy, 50℃ selenium-zinc-enriched yeast soft candy, 60℃ selenium-zinc-enriched yeast soft candy: cut the soft candy into pieces, take 5g of the sample and mix it with 15mL of normal saline, then stir it evenly with a high-speed disperser, take 1 drop of the mixed liquid and place it on a slide, and cover it with a cover glass.

[0116] The prepared sample was placed under a microscope (400 times) to observe the brewer's yeast. Figure 5 As shown (the oval substance in the figure is brewer's yeast).

[0117] like Figure 5 As shown, the number of Saccharomyces cerevisiae in the control group ( Figure 5 a1, b1) is higher than the amount of brewer's yeast in soft candy ( Figure 5 a2, a3, b2, b3), indicating that the preparation process of soft candy will destroy the activity of brewer's yeast, which is related to the need for heating and acidification during the preparation of soft candy. Figure 5 a3, b3) The amount of brewer's yeast in the soft candy when the mold temperature is 60℃ ( Figure 5 a2, b2) is higher, indicating that the higher the mold temperature, the greater the damage to the yeast activity. The number of yeast in the soft candy with commercial brewing yeast is lower than that in the soft candy with selenium-zinc-enriched yeast, indicating that the activity of selenium-zinc-enriched yeast in soft candy is greater than that of commercial brewing yeast.

[0118] (3) Determination of the activity of brewer's yeast before and after the preparation of soft candy

[0119] 50℃ commercial brewer's yeast soft candy, 60℃ commercial brewer's yeast soft candy, 50℃ selenium-zinc-enriched yeast soft candy, 60℃ selenium-zinc-enriched yeast soft candy: Cut the soft candy into pieces, take 5g of the sample and mix it with 15mL of normal saline, then heat the mixed liquid for 10 -1 ~10 -6 The gradient serial dilution was spread on the Bengal red medium, cultured at 28℃ for 24h, and the plates with evenly dispersed single colonies were selected for counting, and then the number of viable bacteria in the medium was calculated based on the number of colonies formed and the dilution multiple. The actual number of viable bacteria measured in the commercial brewer's yeast soft candy control group and the selenium-enriched zinc yeast soft candy control group were used as controls. The results are shown in Table 3. Under the same preparation conditions, the survival rate of selenium-enriched zinc yeast before and after the preparation of soft candy was 30.71-44.28%, which was significantly higher than the survival rate of commercial brewer's yeast before and after the preparation of soft candy, that is, 21.92-27.20%. This shows that selenium-enriched zinc yeast is more resistant to the destruction of its activity by heat and acidic environment than commercial brewer's yeast, which is related to the high heat and acid resistance of selenium-enriched zinc yeast.

[0120] Table 3 Changes in the activity of brewer's yeast before and after the preparation of soft candy

[0121]

[0122] 3. Digestion of soft candies in simulated gastric and intestinal fluids

[0123] (1) Experimental samples

[0124] Same as above Part 2.

[0125] (2) Preparation of simulated gastric and intestinal fluid

[0126] The simulated gastric fluid consisted of 2 mg / mL NaCl, 7 mL / L HCl, and 3.2 mg / mL pepsin solution, with a pH of 3.0;

[0127] The simulated intestinal fluid consisted of 36.7 mg / mL CaCl·2H2O, 218.7 mg / mL NaCl, 24 mg / mL lipase, and 54 mg / mL bile salt solution with a pH of 8.0.

[0128] (3) Simulated gastric digestion

[0129] After cutting the soft candy into pieces, 5 g of the sample was mixed with 15 mL of simulated gastric juice and then digested in a 37°C constant temperature shaking water bath (100 r / min) for 2 h.

[0130] (4) Simulated intestinal digestion

[0131] After cutting the soft candy into pieces, 5 g of the sample was mixed with 15 mL of simulated intestinal fluid and then digested in a 37°C constant temperature shaking water bath (100 r / min) for 2 h.

[0132] (5) Microscopic observation of soft candy digestive juice

[0133] Take a drop of the digested liquid and place it on a slide, cover it with a cover slip, and observe the amount of brewer's yeast in the digested liquid under a microscope (400 times). Use the undigested soft candy as the control group. The results are as follows: Figure 6 Compared with the control group (a1, b1, c1, d1), the amount of Saccharomyces cerevisiae decreased after the soft candy was digested in simulated gastric juice (a2, b2, c2, d2) and intestinal juice (a3, b3, c3, d3), but the amount of Saccharomyces cerevisiae retained when the soft candy was digested in intestinal juice was greater, indicating that the survival rate of Saccharomyces cerevisiae in the soft candy was higher when digested in intestinal juice than in gastric juice.

[0134] (6) Determination of the number of live yeast cells in soft candies

[0135] The digested liquid was washed with saline for 10 -1 ~10 -6The gradient series dilution was spread on the Bengal red medium and cultured at 28℃ for 24h. The plates with evenly dispersed single colonies were selected for counting, and then the number of live bacteria in the medium was calculated based on the number of colonies formed and the dilution multiple. The actual number of live bacteria measured before the digestion of the soft candy was used as the control group. The results are shown in Table 4. The survival rate of selenium-zinc-enriched yeast in the soft candy in gastric juice was 24.71-36.84%, and the survival rate in intestinal juice was 46.91-68.82%, which was much higher than the survival rate of commercial brewer's yeast in the soft candy. This is related to the strong resistance of selenium-zinc-enriched yeast to high temperature and acid and alkali.

[0136] Table 4 Number of viable bacteria before and after digestion of soft candies in simulated gastric and intestinal fluids

[0137]

[0138] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A brewer's yeast, characterized in that The brewer's yeast is specifically brewer's yeast (Saccharomyces cerevisiae) mei2101.1, and its deposit number is CGMCC No.25928.

2. A bacterial agent containing the brewer's yeast according to claim 1.

3. Use of the brewer's yeast according to claim 1 in preparing selenium-zinc-enriched yeast.

4. A soft candy, characterized in that: The selenium-rich zinc yeast is obtained by culturing the brewer's yeast according to claim 1 in a selenium-rich zinc medium, wherein the selenium-rich zinc medium contains 30 to 240 mg / L Se 4+ and 100~500mg / L Zn 2+ Yeast extract peptone glucose medium.

5. The soft candy according to claim 4, characterized in that The selenium-zinc-rich culture medium contains 60 mg / L Se 4+ and 300mg / L Zn 2+ Yeast extract peptone glucose medium.

6. The soft candy according to claim 4, characterized in that The preparation method of the selenium-zinc-enriched yeast comprises the following steps: under sterile conditions, inoculating the brewer's yeast into the selenium-zinc-enriched culture medium, culturing at 28-37° C. for 16-24 hours, and collecting the enriched cultured bacteria after centrifugation at 8000-10000 rpm for 10-15 minutes.

7. The soft candy according to claim 4, characterized in that: The invention comprises the following raw material components in parts by weight: 25-30 parts of water, 25-30 parts of maltitol, 25-30 parts of maltose syrup, 8-12 parts of concentrated fruit juice, 6-8 parts of gelatin, 0.3-0.5 parts of citric acid, and 0.1-0.2 parts of sodium citrate, wherein, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 1×10 8 ~5×10 8 CFU viable bacterial count of selenium-zinc-enriched yeast.

8. The soft candy according to claim 4, characterized in that: The invention comprises the following raw material components in parts by weight: 30 parts of water, 30 parts of maltitol, 30 parts of maltose syrup, 10 parts of concentrated fruit juice, 7.5 parts of gelatin, 0.4 parts of citric acid, and 0.1 parts of sodium citrate, wherein, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 3×10 8 CFU viable bacterial count of selenium-zinc-enriched yeast.

9. A method for preparing the soft candy according to any one of claims 4 to 8, characterized in that: The following steps are involved: (1) Mixing raw materials: uniformly mixing 25 to 30 parts of water, 25 to 30 parts of maltitol, 25 to 30 parts of maltose syrup, and 8 to 12 parts of concentrated fruit juice according to a certain proportion to obtain a raw material mixture; (2) boiling: heating the raw material mixture to boil at 102-106° C., stopping the heating, and adding 6-8 portions of gelatin pre-soaked in cold water to obtain a boiling liquid; (3) Acid adjustment: when the temperature of the cooking liquid drops to 60-80° C., add 0.3-0.5 parts of citric acid and 0.1-0.2 parts of sodium citrate to obtain an acidic cooking liquid; (4) Mold pouring: When the temperature of the acidic boiled liquid drops to 50-60°C, add the bacterial solution of selenium-zinc-enriched yeast, mix well, and then pour it into a mold to cool. In which, based on the sum of the weight of water, maltitol, maltose syrup and concentrated fruit juice, 1×10 8 ~5×10 8 Selenium-zinc-enriched yeast with CFU viable count; (5) Demolding and drying: After the soft candy is formed, it is removed from the mold and dried.

Images