RNAi pesticide for preventing and treating sitobion avenae

By designing dsRNA targeting the Sacdc42 gene of wheat aphid and combining it with the synergist MLG2, the RNAi pesticide dsSacdc42-MLG2 was formed. This solved the problems of environmental pollution and drug resistance when using chemical insecticides to control wheat aphids, achieving efficient and specific control and increased wheat yield.

CN115956584BActive Publication Date: 2026-02-06SHANGHAI PLANT SCI BIOTECHNOLOGY LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111170545.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-08
Publication Date
2026-02-06
Estimated Expiration
2041-10-08

AI Technical Summary

Technical Problem

Existing chemical insecticides pose problems such as environmental pollution, harm to natural enemies, and increased aphid resistance when controlling wheat aphids. They also lack specific and precise control measures against wheat aphids.

Method used

A double-stranded RNA molecule, dsRNA, targeting the Sacdc42 gene of the wheat aphid was designed using RNA interference technology and combined with the synergist MLG2 to form the RNAi pesticide dsSacdc42-MLG2 for the control of the wheat aphid.

Benefits of technology

It significantly improved the control effect of wheat aphid, enhanced the inhibition and killing ability of RNAi pesticides, promoted wheat growth and increased yield, and reduced the risks of environmental pollution and aphid resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003292895640000011
    Figure HDA0003292895640000011
  • Figure HDA0003292895640000012
    Figure HDA0003292895640000012
Patent Text Reader

Abstract

The application discloses an RNAi pesticide for preventing and treating Sitobion miscanthi, which comprises a double-stranded RNA molecule dsRNA targeting a Sitobion miscanthi gene Sacdc42 with a nucleotide sequence of SEQ ID NO:1. The RNAi pesticide can effectively reduce the harm of Sitobion miscanthi to the growth of wheat and effectively improve the thousand-grain weight of the wheat.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological pesticides, and relates to an RNAi pesticide for preventing and treating Sitobion avenae and application thereof. BACKGROUND

[0002] Sitobion avenae (Fabricius) belongs to Hemiptera, Aphididae and Schizaphis, and is an insect. It is the most important and destructive aphid in wheat aphids, and affects 65% of wheat production areas in China, and seriously affects the yield and quality of wheat in China.

[0003] Sitobion avenae concentrates on the front or back of the wheat leaf in the early stage, and concentrates on the ear to suck sap in the later stage, causing the growth of the affected plant to be slow, the tillering to be reduced, and the thousand-grain weight to be decreased. It is the dominant species in wheat aphids, and 20-30 generations occur annually. In most areas, wingless parthenogenetic adult aphids and nymphs overwinter in the rhizosphere or crevices of the soil around the wheat, and some can continue to live on the sunny and leeward wheat leaves. Two high peaks of damage occur in the spring and autumn in wheat fields, and the aphid population is small in summer and winter. After the wheat turns green, the temperature is higher than 6°C, and the reproduction begins. When the temperature is higher than 16°C, the aphids migrate to the ear to cause damage, and the number of aphids rapidly increases. Until the filling and milking stages, the aphid population reaches a peak. When the temperature is higher than 22°C, a large number of winged aphids are produced, and migrate to cold areas to overwinter.

[0004] Sitobion avenae feeds on the phloem of wheat, and in addition to affecting wheat filling, the honeydew excreted by the aphids also causes a large number of fungi to proliferate and affects the photosynthetic capacity of the leaves. In addition, wheat long-tube aphids also transmit wheat virus diseases during the feeding process, and induce wheat yellowing and necrosis. At present, the prevention and control of wheat aphids still mainly relies on chemical insecticides, which not only pollute the environment and harm natural enemies, but also lead to the increase of aphid resistance. Therefore, the development of a preparation with strong specificity and precise and efficient prevention and control effect for Sitobion avenae not only has important economic value, but also has important ecological significance.

[0005] The phenomenon of RNAi was discovered by Fire et al. in 1998, and their research proved that double-stranded RNA (dsRNA) can cause the expression of target genes to be silenced. At present, RNAi is widely used as a tool for gene function research, especially in animals and plants where genetic manipulation tools are not perfect. In the field of agricultural pest control, two studies in 2002 found that silencing specific target genes can cause abnormal development of insects, deformities in the next generation of embryos, and even death, which is the starting point for the application of RNAi technology in insect research and application. Two reports in 2007 confirmed that the expression of insect dsRNA by transgenic plants can achieve the effect of killing insects, and these two studies provide strong evidence for the application of RNAi technology in pest control.

[0006] The pesticide developed by using the RNAi technology is called RNA biological pesticide, also called RNAi biological pesticide, nucleic acid pesticide, RNA pesticide or RNA interference agent, which is a new type of biological pesticide developed based on the RNA interference technology, and the core component is a double-stranded polynucleotide fragment which can specifically bind to the mRNA transcribed by the target gene in the target organism. The RNA biological pesticide can specifically silence the expression of the target gene, and has the characteristics of high efficiency and strong specificity. The basic principle is: using the specific fragment of the endogenous functional gene as a template, a double-stranded RNA (dsRNA) complementary to the template is synthesized in vitro, and then introduced into the target species. The dsRNA fragments are recognized and cut into 18-25 nt small interfering RNAs (siRNAs) by the endogenous RNAi interference mechanism of the organism. Under the action of the endogenous RNA interference mechanism of the organism, the information RNA (mRNA) of the target gene is cut, thereby inhibiting the expression of the target gene, hindering the function of the gene, and ultimately affecting the growth and development of the target species, even to death. This technology has the characteristics of target species specificity, convenient target development and easy degradation, and has most of the functions required by green pesticides, which has attracted the attention of many scientists and pesticide companies, and is called the third revolution in the history of pesticide production. At present, many international pesticide companies, such as Bayer-Monsanto, Dow AgroSciences and Syngenta, are using this technology and investing a lot of manpower and material resources in targeted insecticide research. It is reported that some products have been put on the market or will be put on the market soon. SUMMARY

[0007] We have been studying the application of RNAi technology to the control of Sitobion avenae for many years, and in recent years we have found that RNA interference of the gene Sacdc42 of Sitobion avenae as a target can achieve relatively good lethal effect. The nucleotide sequence of the gene Sacdc42 is SEQ ID NO: 1, and we designed more than 200 dsRNAs targeting the gene Sacdc42. After comparison by experiments, it was found that some of the dsRNA molecules had excellent RNAi effect on Sitobion avenae. Based on this discovery and further research, the present application comprises the following technical solutions.

[0008] An RNAi pesticide for controlling Sitobion avenae, characterized in that it comprises a double-stranded RNA molecule dsRNA targeting the gene Sacdc42 of Sitobion avenae with the nucleotide sequence of SEQ ID NO: 1. For the sake of convenience, the double-stranded RNA molecule is referred to as dsSacdc42.

[0009] For example, the sense strand nucleotide sequence of the above-mentioned dsRNA is selected from SEQ ID NOs: 2-7, and for the sake of convenience, the double-stranded RNA molecule is referred to as dsSacdc.

[0010] As will be readily understood by those skilled in the art, each of the above dsRNA molecules also has an antisense strand that is complementary to SEQ ID NOs: 2-7.

[0011] CCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUAAAAAAUGUAUUUGAUGAAGCUAUUCUUGCAGCUUUAGAGCCUCCUGAACC (SEQ ID NO: 2);

[0012] CCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACG (SEQ ID NO: 3);

[0013] AUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUAAAAAAUGUAUUUGAUGAAGCUAUUCUUGCAGCUUUAGAGCCUCCUGAACCAGUUAAGAAGAGGAAGUGUGUUAUAUUGUAAGGCUGCGGAUAAAUAAACAGUGCGACAAUUAUGUC (SEQ ID NO:4);

[0014] GUGCUGCUUAUUCACCAGUGUACACAUAGGAGUCUUUCCAUAGCGGCAACAUGCAGACCAUCAAGUGCGUGGUUGUUGGUGAUGGAGCUGUUGGUAAGACUUGUCUGCUCAUAUCGUACACGACAAACAAGUUUCCUUCAGAAUAUGUACCGACUGUUUUUGACAAUUAUGCAGUGACCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUC (SEQ ID NO:5);

[0015] UUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAAAAACACCAUUCCUGUUGGUUGGCACACAAAUAGACCUUAGAGAAGAUGCCACGACUGUAGAGAAACUAGCCAAAAAUAAACAAAAAUCAAUAUCAUCUGAACAAGGAGAGAAGCUAGCUAAAGAACUUAAAGCUGUAAAAUAUGUUGAAUGCUCAGCACUUACACAAAAAGGACUA (SEQ ID NO: 6);

[0016] GAGUCUUUCCAUAGCGGCAACAUGCAGACCAUCAAGUGCGUGGUUGUUGGUGAUGGAGCUGUUGGUAAGACUUGUCUGCUCAUAUCGUACACGACAAACAAGUUUCCUUCAGAAUAUGUACCGACUGUUUUUGACAAUUAUGCAGUGACCGUUAUGAUUGGCGGGGAGCCAUAUACAUUGGGUUUAUUUGAUACAGCAGGUCAGGAAGAUUAUGAUCGCCUCAGACCUUUGAGUUAUCCACAAACUGAUGUGUUUCUUGUUUGUUUCUCCGUGGUUUCACCAUCUUCAUUUGAAAAUGUCAAAGAAAAAUGGGUUCCAGAGAUAACACGUCACUGUCAAA (SEQ ID NO: 7).

[0017] Preferably, the sense strand nucleotide sequence of the above-mentioned dsRNA is SEQ ID NO: 2. For the convenience of description, it is referred to as dsSacdc42.

[0018] In order to enhance the RNAi effect of the above-mentioned dsRNA of the present application on inhibiting the growth and reproduction of Sitobion avenae, and improve the efficiency of the RNAi pesticide in preventing and treating Sitobion avenae, the inventors also provide a synergist capable of being combined with the above-mentioned dsRNA, which together constitute the RNAi pesticide with improved control effect. For the convenience of description, the synergist is referred to as MLG2; accordingly, the RNAi pesticide formulation is referred to as dsSacdc42-MLG2.

[0019] The synergist (MLG2) comprises the following ingredients: 1.76-30.0 g / L KCl, 0.15-1.52 g / L H8MoN2O4, 0.01-0.10 g / L Na2SeO4, 0.01-0.10 g / L Na2SeO3, 0.2-5.0 g / L potassium oleate, 0.15-0.6 g / L geraniol, and 0.01-1.0 g / L diatomite, in terms of the amount of 1 L aqueous solution.

[0020] Preferably, the synergist (MLG2) comprises the following ingredients: 4.88-6.21 g / L KCl, 0.45-0.54 g / L H8MoN2O4, 0.02-0.05 g / L Na2SeO4, 0.02-0.05 g / L Na2SeO3, 0.25-4.0 g / L potassium oleate, 0.25-0.40 g / L geraniol, and 0.2-0.8 g / L diatomite.

[0021] For example, the synergist can comprise the following ingredients: about 3.05 g / L KCl, about 0.45 g / L H8MoN2O4, about 0.03 g / L Na2SeO4, about 0.022 g / L Na2SeO3, about 0.35 g / L potassium oleate, about 0.30 g / L geraniol, and about 0.5 g / L diatomite.

[0022] In one embodiment, the pH of the RNAi pesticide dsSacdc42-MLG2 comprising the above synergist (MLG2) is pH 6.0-8.0.

[0023] In the above RNAi pesticide dsSacdc42-MLG2, the content of the dsRNA can be 0.10-0.90 g / L.

[0024] Preferably, in the above RNAi pesticide dsSacdc42-MLG2, the amount of dsRNA is 0.40-0.80 g / L.

[0025] The second object of the present application is to provide the use of the above RNAi pesticide in protecting the growth of wheat.

[0026] Specifically, the above RNAi pesticide is used for inhibiting the growth and breeding of Sitobion avenae and killing Sitobion avenae.

[0027] In one embodiment, the amount of the RNAi pesticide used in a wheat field is about 1 L per mu.

[0028] The field plot test results show that the 5-day control effect of the aphid on the wheat long tube aphid is 71.49% by spraying the dsRNA (dsSacdc42) aqueous solution with the sense strand of SEQ ID NO: 2; the 5-day control effect of the aphid on the wheat long tube aphid reaches 79.80% by spraying the RNAi pesticide formulation dsSacdc42-MLG2 containing the synergist MLG2, and the thousand-grain weight of the wheat is increased by 6.57% compared with the chemical insecticide. Therefore, the RNAi pesticide of the application can effectively control the wheat long tube aphid, which is of great significance for protecting the normal growth and yield increase of the wheat, and ensuring the food security of China. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is a statistical column chart of the 5-day control effect of the aphid on the wheat long tube aphid by using water, synergist solution MLG2, RNAi pesticide dsSacdc42 aqueous solution, RNAi pesticide formulation dsSacdc42-MLG2, and chemical insecticide imidacloprid respectively.

[0030] Figure 2 is a statistical column chart of the thousand-grain weight increase effect of the wheat after field application by using water, synergist solution MLG2, RNAi pesticide dsSacdc42 aqueous solution, RNAi pesticide formulation dsSacdc42-MLG2, and chemical insecticide imidacloprid respectively. DETAILED DESCRIPTION

[0031] Killing the pest wheat long tube aphid by RNA interference technology is a research project of the inventor for many years, and the Sacdc42 gene of the wheat long tube aphid is a target selected from a large number of functional genes, and the nucleotide sequence thereof is SEQ ID NO: 1.

[0032] gtgctgcttattcaccagtgtacacataggagtctttccatagcggcaacatgcagaccatcaagtgcgtggttgttggtgatggagctgttggtaagacttgtctgctcatatcgtacacgacaaacaagtttccttcagaatatgtaccgactgtttttgacaattatgcagtgaccgttatgattggcggggagccatatacattgggtttatttgatacagcaggtcaggaagattatgatcgcctcagacctttgagttatccacaaactgatgtgtttcttgtttgtttctccgtggtttcaccatcttcatttgaaaatgtcaaagaaaaatgggttccagagataacacgtcactgtcaaaaaacaccattcctgttggttggcacacaaatagaccttagagaagatgccacgactgtagagaaactagccaaaaataaacaaaaatcaatatcatctgaacaaggagagaagctagctaaagaacttaaagctgtaaaatatgttgaatgctcagcacttacacaaaaaggactaaaaaatgtatttgatgaagctattcttgcagctttagagcctcctgaaccagttaagaagaggaagtgtgttatattgtaaggctgcggataaataaacagtgcgacaattatgtc (SEQ ID NO: 1).

[0033] In theory, the dsRNA molecules designed for the gene SEQ ID NO: 1, including siRNA molecules, more or less should have the biological function of inhibiting the expression of the gene, thereby inhibiting the growth and reproduction of the aphids. However, unexpectedly, among the more than 200 dsRNA molecules we designed, the vast majority did not have the expected function of inhibiting the aphids, and only a few had the RNAi effect of killing the aphids, including the dsRNA whose sense strand nucleotide sequence is SEQ ID NOs: 2-7, i.e., dsSacdc, such as dsSacdc42 whose sense strand is SEQ ID NO: 2.

[0034] In this article, the terms "dsRNA", "dsRNA molecule" or "double-stranded RNA molecule" can be interchangeable, and their meanings and ranges are all refer to the double-stranded structure molecules formed by annealing of sense strand and antisense strand.

[0035] The double-stranded dsRNA is a macromolecular compound, which is also easily degraded by the nucleases RNase and DNase. In order to promote the penetration of the dsRNA molecule through the epidermis of the Sitobion avenae into the body, and to avoid the destruction of the nucleases produced by the environmental microorganisms, the present application develops the synergist MLG2 formula which can enhance the RNAi effect of the dsRNA molecule.

[0036] In a typical embodiment, the synergist MLG2 of the present application can include the following ingredients: about 3.05 g / L KCl, about 0.45 g / L H8MoN2O4, about 0.03 g / L Na2SeO4, about 0.022 g / L Na2SeO3, about 0.35 g / L potassium oleate, about 0.30 g / L geraniol, about 0.5 g / L diatomite.

[0037] It should be understood that, in the expression of numerical characteristics herein, the term "about" or "approximately" means that the indicated number can have an error range or floating range of ±10%, ±9%, ±8%, ±7%, ±6% or ±5%.

[0038] In the field test, the effect of the RNAi pesticide formula preparation dsSacdc42-MLG2 on the control of Sitobion avenae is better than that of the aqueous solution of the dsRNA molecule dsSacdc42, which proves the promoting effect of the synergist MLG2.

[0039] The present application is further described below in conjunction with specific examples and drawings. It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application. Based on the examples in the present application, all other examples obtained by those skilled in the art without making creative efforts are within the scope of protection of the present application.

[0040] In the examples of the present application, if the temperature for experimental operation is not specifically stated, the temperature generally refers to room temperature (10-30℃).

[0041] In this article, the addition amount, content and concentration of various substances are mentioned, and the percentage content mentioned herein refers to the weight percentage content, unless otherwise specified.

[0042] Examples

[0043] The primer synthesis and RNA synthesis in this article are completed by Platsyn Biotech (Shanghai) Co., Ltd., and the sequencing is completed by Shanghai Sunny Biotech Co., Ltd.

[0044] The molecular biology experiments herein include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly performed according to the Molecular Cloning Experiment Guide (3rd Edition), J. Sambrook, D. W. Russell (USA) edited, Huang Peitang et al. translated, Science Press, Beijing, 2002. The specific experimental conditions can be determined through simple tests if necessary.

[0045] The PCR amplification experiments are performed according to the reaction conditions or instructions provided by the plasmid or DNA template supplier. The specific experimental conditions can be adjusted through simple tests if necessary.

[0046] Example 1: Obtaining target gene sequence

[0047] (1) Extraction of total RNA of Sitobion miscanthi

[0048] The total RNA sample with a concentration of ≥ 300 ng / μl, a total amount of ≥ 6 μg, and OD260 / 280 of 1.8-2.2 is obtained by using the conventional Trizol method to extract, purifying by the conventional method, and treating with DNAase, using Sitobion miscanthi as the material.

[0049] (2) Isolation of mRNA and synthesis of cDNA

[0050] The mRNA with polyA is separated by using magnetic beads with oligo-dT, and then the first strand of cDNA is synthesized by using random 6-mer and the Superscript II reverse transcriptase kit of Invitrogen, so as to obtain the Sacdc42 gene, and the nucleotide sequence is SEQ ID NO: 1.

[0051] (3) Amplification and sequencing of Sacdc42 gene

[0052] The primers specific for the Sitobion miscanthi Sacdc42 gene shown in Table 1 are designed.

[0053] Table 1, primer sequences used in the present application

[0054] Primer name Sequence (5'→3') Sacdc42 F ATGATGAAGTGGTGGACGTG Sacdc42 R TTACAACTCGTTGCGTGGTC dsSacdc42 F TAATACGACTCACTATAGGGCCGTTATGATTGGCGGGGAGCC dsSacdc42 R TAATACGACTCACTATAGGGGGTTCAGGAGGCTCTAAAGCTGCAA

[0055] The Sitobion miscanthi Sacdc42 gene is amplified by using the primers Sacdc42 F / Sacdc42 R in Table 1, the obtained gene fragment is purified, connected to the PMD-18 vector (Takara Company), transformed into the Escherichia coli Top10 strain, screened by blue-white spot, and the positive strain is sequenced to verify the correctness.

[0056] (4) Synthesis of dsRNA

[0057] According to the Sacdc42 gene sequence, a total of 200 dsRNA molecules were designed. The dsRNA molecules were synthesized by using Thermo Fisher dsRNA synthesis kit MEGAscript TM T7 Transcription Kit (am1334), and the specific operation steps are described in the kit.

[0058] For example, the primer sequence for amplifying dsSacdc42 is shown in Table 1 as dsSacdc42 F / dsSacdc42 R, and the amplified dsRNA sequence has a positive strand of SEQ ID NO: 2.

[0059] According to the similar method, the obtained dsRNA molecules include dsRNA molecules with positive strands of SEQ ID NO: 3-7.

[0060] Example 2: Preparation of RNAi pesticide synergist MLG2 and formula preparation

[0061] The synergist was prepared according to the following formula: 3.05 g / L KCl, 0.45 g / L H8MoN2O4, 0.03 g / L Na2SeO4, 0.022 g / L Na2SeO3, 0.35 g / L potassium oleate, 0.30 g / L geraniol, and 0.5 g / L diatomite.

[0062] Taking dsSacdc42 as an example, the content was set to 0.4 g / L, and the RNAi formula preparation dsSacdc42-MLG2 was prepared: 0.4 g / L dsSacdc42, 3.05 g / L KCl, 0.45 g / L H8MoN2O4, 0.03 g / L Na2SeO4, 0.022 g / L Na2SeO3, 0.35 g / L potassium oleate, 0.30 g / L geraniol, and 0.5 g / L diatomite.

[0063] As a control of the formula preparation dsSacdc42-MLG2, dsSacdc42 was dissolved in water to obtain a water solution with a concentration of 0.4 g / L.

[0064] Example 3: Field control of Sitobion avenae

[0065] Field tests were carried out in the wheat fields of Xinxiang Experimental Base of Henan Academy of Agricultural Sciences and Xuchang Campus of Henan Agricultural University. After counting the number of Sitobion miscanthi in the field, water (negative control), synergist solution MLG2, dsSacdc42 aqueous solution, formula preparation dsSacdc42-MLG2 and chemical insecticide imidacloprid were uniformly sprayed on the wheat in the late heading stage, 1.0 mu for each liquid pesticide treatment, and each was repeated 3 times. The number of aphids was counted 5 days after spraying, and the control effect was calculated. The thousand-grain weight and plot yield of wheat were counted at the time of wheat harvesting, and the results are shown in Figure 1 and Figure 2 .

[0066] Referring to Figure 1 , the insecticidal effect of chemical insecticide imidacloprid on Sitobion miscanthi was the highest, reaching 86%; followed by formula preparation dsSacdc42-MLG2, which was 79.80%; dsSacdc42 aqueous solution was 71.49%, lower than the formula preparation; synergist MLG2 and water had almost no insecticidal effect. The results show that the double-stranded RNA molecule dsSacdc42 has a lethal effect on Sitobion miscanthi, and the synergist MLG2 can improve the RNAi effect.

[0067] As shown in Figure 2 , compared with the wheat field without spraying any pesticide (including water), the thousand-grain weight of the wheat treated with formula preparation dsSacdc42-MLG2 increased by 11.11%, which was the largest; the thousand-grain weight of the wheat treated with dsSacdc42 increased by 8.0%; the thousand-grain weight of the wheat treated with MLG2 increased by 7.12%; and the thousand-grain weight of the wheat treated with imidacloprid only increased by 4.54%, which was not balanced with its insecticidal effect, or perhaps it indicates that chemical insecticides have an adverse effect on the growth of wheat. The results show that the synergist MLG2 does not affect the growth of wheat, and even has a promoting effect; the RNAi pesticide of the application, especially the formula preparation dsSacdc42-MLG2, can have a yield-increasing effect on wheat.

[0068] Although the technical solutions of the application are described above by taking the double-stranded RNA molecule dsSacdc42 as an example, according to the disclosure of the application, the RNAi pesticide of the application is also applicable to other RNA molecules, which is obvious to those skilled in the art. Therefore, those skilled in the art can make various modifications or changes to the application on this basis without deviating from the idea of the application, and various modified or equivalent forms made by the modifications or changes shall also belong to the scope of the application.

Claims

1. Use of an RNAi pesticide for controlling Sitobion avenae in the protection of the growth of wheat, characterized in that, The RNAi pesticide comprises a double-stranded RNA molecule dsRNA, the sense strand nucleotide sequence of which is SEQ ID NO: 2, targeting the nucleotide sequence of the Sitobion avenae gene of SEQ ID NO: 1 Sacdc42 ​ 2. Use according to claim 1, wherein The RNAi pesticide also comprises a synergist of the RNAi pesticide, which comprises the following components: 1.76-30.0 g / L KCl, 0.15-1.52 g / L H8MoN2O4, 0.01-0.10 g / L Na2SeO4, 0.01-0.10 g / L Na2SeO3, 0.2-5.0 g / L potassium oleate, 0.15-0.6 g / L geraniol, and 0.01-1.0 g / L diatomite, in terms of the amount of 1 L aqueous solution.

3. Use according to claim 2, wherein the compound is ###0002### The synergist comprises the following components: 4.88-6.21 g / L KCl, 0.45-0.54 g / L H8MoN2O4, 0.02-0.05 g / L Na2SeO4, 0.02-0.05 g / L Na2SeO3, 0.25-4.0 g / L potassium oleate, 0.25-0.40 g / L geraniol, and 0.2-0.8 g / L diatomite.

4. The use according to claim 2, wherein the compound is ###0002### The synergist comprises the following components: 3.05 g / L KCl, 0.45 g / L H8MoN2O4, 0.03 g / L Na2SeO4, 0.022 g / L Na2SeO3, 0.35 g / L potassium oleate, 0.30 g / L geraniol, and 0.5 g / L diatomite.

5. The use according to claim 2, wherein the compound is ###0002### The pH of the RNAi pesticide is pH 6.0-8.

0.

6. The use according to claim 2, wherein The content of dsRNA in the RNAi pesticide is 0.10-0.90 g / L.

7. The use according to claim 1, wherein The amount of the RNAi pesticide used in a wheat field is 1 L per mu.

Citation Information

Patent Citations

  • Formula for improving dsRNA insecticidal effect

    CN113100235A