Primers, probes and kits for simultaneous detection of bovine herpes virus 4, 5 type

Abstract

The application discloses primers, probes and kits for simultaneously detecting bovine herpes virus 4 and 5, relates to the field of molecular biology virus detection, comprises primers, a probe combination and a kit, and further provides a detection method and application for non-diagnostic treatment purposes. The kit has the technical advantages of simple operation, high specificity, high sensitivity, good repeatability, simultaneous qualitative detection of BHV4 and BHV5, and accurate quantification.

Description

Technical Field

[0001] This invention relates to the field of molecular biology virus detection technology, and more specifically to primers, probes and kits for the simultaneous detection of bovine herpesvirus types 4 and 5. Background Technology

[0002] Bovine herpesvirus 4 (BHV4) belongs to the family Gammaherpesviridae. African buffalo are the natural host of BHV4, with infected and carrier animals being the primary sources of infection. The disease exhibits no obvious seasonality. After infection, cattle can periodically shed the virus under natural conditions, which is closely related to its spread. Transmission occurs through direct and indirect contact. Contact with the secretions and excrement of infected animals can lead to infection via the digestive tract, respiratory tract, conjunctiva, and uterus. Artificial insemination is also a potential route of transmission. The disease primarily progresses asymptomatically, but co-infection, stress, social factors, estrus, and parturition may be associated with its onset. This virus also presents with various clinical signs, such as conjunctivitis, pneumonia and upper respiratory tract inflammation, skin lesions, mastitis, enteritis, postpartum metritis, and chronic metritis in cattle. Furthermore, BHV4 is also associated with abortion and has been found in aborted fetuses. Studies have found that BHV4 in orchitis can also be transmitted through semen. This disease is often a latent infection in cattle, and the presence of other pathogens can exacerbate clinical symptoms and lead to diverse manifestations, posing significant challenges to diagnosis and treatment and constituting a serious threat to the cattle industry.

[0003] Bovine herpesvirus 5 (BHV5) belongs to the family Alphaherpesviridae, subfamily Herpesvirusinae, and genus Varicellavirus. This virus can cause fatal meningoencephalitis in cattle. It can enter the central nervous system, causing severe and fatal meningoencephalitis in calves and subclinical symptoms in adult cattle. The natural host is cattle, with calves under six months of age being highly susceptible; infection is rapid and fatal. Adult cattle are relatively less susceptible. Latently infected animals can carry the virus, and reactivation can infect susceptible animals. Sheep and goats can also be infected. This causes significant losses to the cattle industry.

[0004] With the development of the cattle industry, large-scale and intensive farming has increased physical contact between cattle, thus accelerating the spread of infectious diseases. Currently, there are no specific drugs for treating BHV4 and BHV5 infections, either domestically or internationally. Developed dairy countries use inactivated or attenuated vaccines to prevent these diseases, while my country does not yet have any commercially available vaccines. There are few reports in China on fluorescent quantitative PCR detection methods for BHV4 and BHV5 pathogens.

[0005] Therefore, whether it is possible to provide primers, probes, and kits for the simultaneous detection of bovine herpesvirus types 4 and 5 is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides primers, probes, and a kit for the simultaneous detection of bovine herpesvirus types 4 and 5. A rapid and sensitive detection method is established to enable timely and more effective targeted control measures, thereby reducing the economic losses caused by this virus to the cattle industry. Combining spectroscopic techniques, traditional PCR techniques, and computer technology, this method offers high sensitivity and specificity, can monitor all stages of PCR amplification, and can accurately quantify samples. It can simultaneously detect two viral infections, saving time and effort.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A primer and probe combination for simultaneous detection of bovine herpesvirus 4 and 5 includes: an upstream primer BHV4-F, a downstream primer BHV4-R, and a probe BHV4-P for detecting bovine herpesvirus 4; and an upstream primer BHV5-F, a downstream primer BHV5-R, and a probe BHV5-P for detecting bovine herpesvirus 5.

[0009] The nucleotide sequence of the upstream primer BHV4-F is shown in SEQ ID NO:1;

[0010] The nucleotide sequence of the downstream primer BHV4-R is shown in SEQ ID NO:2;

[0011] The nucleotide sequence of probe BHV4-P is shown in SEQ ID NO:3;

[0012] The nucleotide sequence of the upstream primer BHV5-F is shown in SEQ ID NO:4;

[0013] The nucleotide sequence of the downstream primer BHV5-R is shown in SEQ ID NO:5;

[0014] The nucleotide sequence of probe BHV5-P is shown in SEQ ID NO:6.

[0015] Preferably, the probe has a fluorescent group attached to its 5' end and a fluorescence quencher attached to its 3' end.

[0016] Preferred: Probe BHV4-P has the following fluorescent group: FAM and fluorescence quencher group: TAMRA; Probe BHV5-P has the following fluorescent group: ROX and fluorescence quencher group: BHQ2.

[0017] The present invention also provides a detection kit based on any of the above combinations.

[0018] Preferred: also includes 2×ChamQ Geno-SNP Probe MasterMix, reference, negative control and positive control.

[0019] Preferred: The reference is a set of references containing different concentrations, each concentration of which includes a reagent of a mixture of two recombinant plasmids of the same concentration, the two recombinant plasmids being: BHV4 recombinant plasmid and BHV5 recombinant plasmid;

[0020] Methods for constructing BHV4 recombinant plasmids:

[0021] Referencing the existing gene sequence, the BHV4 gB gene was synthesized, with the nucleotide sequence shown in SEQ ID NO:7. It was then amplified by PCR, purified, and ligated into the pUC57 Vector.

[0022] Construction method of BHV5 recombinant plasmid: Refer to the existing gene sequence to contract the BHV5 gC gene, the nucleotide sequence is shown in SEQ ID NO:8, PCR amplification, purification, and then ligation with pUC57 Vector.

[0023] Preferred concentrations are: upstream primer BHV4-F 200 nmol / L, downstream primer BHV4-R 200 nmol / L, probe BHV4-P 200 nmol / L; upstream primer BHV5-F 200 nmol / L, downstream primer BHV5-R 200 nmol / L, probe BHV5-P 300 nmol / L.

[0024] Ligation: Add 1 μl of pUC57 Simple Vector and 4 μl of PCR amplification product sequentially to a 0.2 ml EP tube, then add sterile water to a total volume of 10 μl. Gently pipette to mix thoroughly and incubate at 25°C for 30 min. The specific concentrations of the two recombinant plasmids are 1 × 10⁻⁶. 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL.

[0025] Preferred: Negative control: process water; Positive control: a mixture of BHV4 and BHV5 recombinant plasmids, with each recombinant plasmid having a concentration of 1×10⁻⁶. 10 copies / μL.

[0026] The present invention also provides a method for qualitative and quantitative detection for non-diagnostic therapeutic purposes based on any of the above-mentioned reagent kits, comprising the following steps:

[0027] 1) Establishment of a standard curve for quantitative real-time PCR;

[0028] 2) Extract genomic DNA from the sample to be tested, and perform dual real-time quantitative PCR using the extracted genomic DNA as a template;

[0029] 3) Result Interpretation: Qualitative detection of BHV4 and / or BHV5 bovine samples is performed using the obtained Cq value or changes in fluorescence signal. The appearance of an "S"-shaped amplification curve indicates that the sample contains BHV4 and / or BHV5. Then, based on the intensity of the fluorescence signal and the standard curve in step 1), the copy number of BHV4 and / or BHV5 in the sample is obtained, thus achieving quantitative detection.

[0030] The dual real-time quantitative PCR reaction system includes: 2 μL template, 12.5 μL 2×ChamQ Geno-SNP Probe MasterMix, 0.5 μL 10 μmol / L BHV4 upstream primer, 0.5 μL 10 μmol / L BHV4 downstream primer, 1 μL 10 μmol / L BHV4 probe, 0.5 μL 10 μmol / L BHV5 upstream primer, 0.5 μL 10 μmol / L BHV5 downstream primer, 0.75 μL 10 μmol / L BHV5 probe, and 7.25 μL RNase-Free ddH2O. The dual real-time quantitative PCR reaction conditions are: 95℃ for 2 min; then 95℃ for 10 s, 60℃ for 30 s, for 45 cycles.

[0031] Step 3) Specific determination method:

[0032] ① If the amplification curve of the sample to be tested is a standard S-shaped curve only in the FAM channel, and the CT value is ≤37, then the result is determined to be positive for BHV4 viral nucleic acid;

[0033] ② If the amplification curve of the sample to be tested is a standard S-shaped curve only in the ROX channel, and the CT value is ≤37, then the result is determined to be positive for BHV5 viral nucleic acid;

[0034] ③ If the amplification curves of the sample in both the FAM and ROX channels are standard S-shaped curves and the CT value is ≤37, the result is determined to be positive for BHV4 and BHV5 viral nucleic acid.

[0035] ④ If the sample to be tested has a CT value of 37 < CT value ≤ 40 and an “S” type amplification curve appears, the result is considered suspicious, meaning the sample needs to be retested.

[0036] ⑤ If the CT value of the sample to be tested is >40, the result is judged as negative.

[0037] The present invention also provides the application of any combination of the above three, or any of the above kits, or methods in livestock farming.

[0038] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a primer, probe and kit for simultaneous detection of bovine herpesvirus 4 and 5. The technical effect achieved is that the kit of the present invention has the advantages of simple operation, high specificity, high sensitivity and good repeatability, and can simultaneously achieve qualitative detection and accurate quantification of BHV4 and BHV5. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0040] Figure 1 The attached figure shows the standard curve of dual fluorescence quantitative PCR in Example 3 provided by the present invention.

[0041] Figure 2 The attached figure shows the sensitivity detection results of BHV4 dual fluorescence quantitative PCR in Example 4 provided by the present invention, where 1-7: 1×10 1 ~1×10 7 copies / μL, 0 is the negative control.

[0042] Figure 3 The attached figure shows the sensitivity detection results of BHV5 dual fluorescence quantitative PCR in Example 4 provided by the present invention, wherein 1-7: 1×10 1 ~1×10 8 copies / μL, 0 is the negative control.

[0043] Figure 4The attached figure shows the specific detection results of Example 5 provided by the present invention, wherein 1: BHV4 positive plasmid; 2: BHV5 positive plasmid; 3: negative control and other viral nucleic acids.

[0044] Figure 5 The attached figure shows the results of the dual real-time PCR experiment in Example 6 provided by the present invention, wherein the left figure shows the results of the intra-group repeatability test of dual real-time PCR for BHV4 and BHV5; and the right figure shows the results of the inter-group repeatability test.

[0045] Figure 6 The attached figure is an overall technical flow diagram provided by the present invention. Detailed Implementation

[0046] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0047] This invention discloses primers, probes, and a kit for the simultaneous detection of bovine herpesvirus types 4 and 5.

[0048] In the examples, all raw materials and reagents not mentioned were commercially available. For example, ChamQ Geno-SNP ProbeMasterMix, RNase-Free ddH2O, and agarose gel DNA recovery kit were purchased from Nanjing Novizan Biotechnology Co., Ltd.; plasmid mini-extraction kit was purchased from Aisjin Biotechnology (Hangzhou) Co., Ltd.; JM109 competent cell kit was purchased from Takara Bio Engineering (Dalian) Co., Ltd.; pUC57 Vector, high GC content PCR amplification kit, and ready-to-use PCR amplification kit (Taq, with dye) were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0049] Experimental procedures not mentioned are standard experimental steps and will not be elaborated upon here.

[0050] See technical process Figure 6 .

[0051] Example 1

[0052] The examples referenced the gB gene sequences of the BHV4 oocyte_h3 isolate (KP209031.1), 4864 / V99 isolate (AJ617688.1), YL isolate (GQ375280.1), TR2011-TGVS550 isolate (MK543551.), and KAS24-LOK-TR2017 isolate (MG181945.1) published in GenBank. Multiple sequence alignment was performed using the MegAlign program in Lasergener software. Conserved sequences on the gB gene fragment were selected to design and synthesize a pair of specific primers and a probe. The upstream and downstream primers and probe were named BHV4-F, BHV4-R, and BHV4-P, respectively. The fluorescent reporter group at the 5' end of the probe was FAM, and the fluorescent quencher group at the 3' end was TAMRA.

[0053] Based on the gC full-length gene sequences of BHV5 TX89 isolate (U35883.1), UruguaiT4 isolate (KJ143571.1), Swiss isolate (Z49224.1), and EVI-190 isolate (AY052396.1) published in GenBank, multiple sequence alignment was performed using the MegAlign program in Lasergener software. A pair of specific primers and a probe were designed and synthesized based on conserved sequences on the gC gene fragment. The upstream and downstream primers and probe were named BHV5-F, BHV5-R, and BHV5-P, respectively. The fluorescent reporter group at the 5' end of the probe was ROX, and the fluorescent quencher group at the 3' end was BHQ2. The specific primer and probe sequences are shown in Table 1.

[0054] Table 1

[0055]

[0056] Example 2

[0057] A kit for simultaneous detection of bovine herpesvirus 4 and 5 based on the above primers and probes includes nucleic acid amplification reagents: the concentration of the upstream primer BHV4-F for detecting bovine herpesvirus 4 is 200 nmol / L, the concentration of the downstream primer BHV4-R is 200 nmol / L, and the concentration of the probe BHV4-P is 200 nmol / L.

[0058] For the detection of bovine herpesvirus type 5, the concentration of the upstream primer BHV5-F is 200 nmol / L, the concentration of the downstream primer BHV5-R is 200 nmol / L, and the concentration of the probe BHV5-P is 300 nmol / L.

[0059] Optionally, the nucleic acid amplification reagent also contains 2×ChamQ Geno-SNP Probe MasterMix.

[0060] Optionally, the kit contains a reference for quantification, which contains two recombinant plasmids: BHV4 recombinant plasmid and BHV5 recombinant plasmid.

[0061] The synthesis of the BHV4 recombinant plasmid (pUC57-BHV4) was carried out as follows:

[0062] Based on the gB gene sequences of the BHV4 oocyte_h3 isolate (KP209031.1), 4864 / V99 isolate (AJ617688.1), YL isolate (GQ375280.1), TR2011-TGVS550 isolate (MK543551.), and KAS24-LOK-TR2017 isolate (MG181945.1) published in GenBank, a full-length 430bp BHV4 gene sequence was synthesized. The gB gene sequence (TCGCTCTAATTAAGGTATGCAGTTTCAACCAGACCACTACACANTCAACCACAACCTCACCAAGTATTTCATCAACCACCTCTTCCACAACAACATCAACAAGCCAGCCATCAAACACAACCTCAACAAATAGTTCATTAGCTGCCTCTCCCCAGAACACGTCAACAAGCAAGCCATCCACTGATAATCAGGGTACCAGTACCCCCACTATTCCAACTGTTACTGATGACACAGCCAGTAAAAATTTTTATAAATACAGAGTATGCAGTGCATCATCTTCCTCTGGAGAACTATTCAGATTTGACCTTGATCAGACATGTCCAGATACAAAAGATAAAAAACATGTGGAAGGCATCCTGCTGGTACTAAAAAAGAATATTGTCCCATACATCTTCAAAGTGAGGAAATATAGAAAAATTGCCACCTCAGT, as shown in SEQ ID NO:7) was ligated into the pUC57Vector cloning vector to obtain the recombinant plasmid.

[0063] Synthesis of BHV5 recombinant plasmid (pUC57-BHV5):

[0064] Based on the gC gene sequences of BHV5 TX89 isolate (U35883.1), UruguaiT4 isolate (KJ143571.1), Swiss isolate (Z49224.1), and EVI-190 isolate (AY052396.1) published in GenBank, a full-length 418bp BHV5 gene sequence was synthesized. gC gene sequence (AGCTGGGCGGCAACTACATCTTCCCCTCGCCCGCCGACCCCGCAGACTGCCCCTGACCGTGCGCTCCCTGACCGCCGCAGACGAGGGCGTGTACACCTGGCGCCGCGACGGGCGCCAAGTCGCAGCGCAAGGTCGTGACCGTCACGACGTACCGCGCACCCGCCGTCTCCGTCGAGCCCCGGCCGACGCTGGAGGGCGCCGGCTAC GCGGCCGTGTGCCGCGCCGCCGAGTACTACCCGCCGCGCTCCACGCGCCTGCGCTGGTTCCGCAACGGCTACCCCGTGGAGGCTCGGCACGCGCGCGACGTCTTTACGGTCGACGACTCCGGGCTCTTTTCGCGCACGTCCGTCCTCACGCTCGAGGACGCGACGCCAACCGCCCACCCGCCCAACCTGCGCTGCGAGGTTTCCTGGTT, such as SEQID shown in NO:8), and connect the sequence to the pUC57Vector cloning vector to obtain the recombinant plasmid.

[0065] Recombinant plasmid extraction and identification

[0066] (1) Entrust Sangon Biotech (Shanghai) Co., Ltd. to handle the specific matters:

[0067] After PCR amplification is completed, the product is detected by electrophoresis and purified using a PCR product purification kit for ligation.

[0068] BHV4 PCR amplification reaction: Add the following reagents sequentially to a 0.2 ml EP tube: 25 μl of Taq PCR Master Mix (2×, blue dye), 2 μl of upstream primer (TCGCTCTAATTAAGGTATGCA GTT), 2 μl of downstream primer (ACCACCCTCTGTAAACTGTCA), 1 μl of DNA containing the target sequence, and sterile water to a total volume of 50 μl. Gently pipette to mix thoroughly. The amplification program is as follows: pre-denaturation 94℃, 4 min; 94℃, 30 s, 54℃, 30 s, 72℃, 30 s, for 32 cycles; final extension 72℃, 10 min; store at 4℃.

[0069] BHV5 PCR amplification reaction: Add the following reagents sequentially to a 0.2 ml EP tube: 2× High GC PCR Buffer (with Mg) 2+ 25 μl of dNTP Mix, 0.5 μl of Taq DNA Polymerase, 2 μl of upstream primer (AGCTGGGCGGCAACTACATC), 2 μl of downstream primer (AACCAGGAAACCTCGCAGC), and 1 μl of DNA containing the target sequence were added. Sterile water was added to a total volume of 50 μl, and the mixture was gently pipetted to mix thoroughly. The amplification program was as follows: pre-denaturation at 95°C for 2 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for final extension at 72°C for 7 min; storage at 4°C.

[0070] (2) Ligation reaction: Add the following reagents sequentially to a 0.2 ml EP tube: 1 μl of pUC57 Simple Vector, 4 μl of product recovery, and sterile water to a total volume of 10 μl. After gently mixing by pipetting, incubate at room temperature (25℃) for 30 min.

[0071] Add 5–10 μl of the reaction sample from the previous step to 50–100 μl of DH5α or other competent cells (note that the volume of the added DNA sample should not exceed 1 / 10 of the competent cell volume), mix gently, and place the mixture on ice for 30 min. Perform heat shock in a 42°C water bath for 90 s, then quickly return to the ice bath and let stand for 3–5 min. Add 500 μl of antibiotic-free SOC or LB culture medium, mix gently, and incubate at 37°C with shaking for 1 h. Centrifuge the bacterial culture at 5000 rpm for 1 min to precipitate the cells. Aspirate most of the culture medium, leaving approximately 50–100 μl of culture medium to resuspend the cells. Then, evenly spread the entire amount onto LB agar plates containing appropriate antibiotics and incubate overnight at 37°C. The next day, clones were picked from the plate for colony PCR or plasmids were extracted for enzyme digestion identification. The enzyme digestion sites of the BHV4 recombinant plasmid were XbaI / BamHI; the enzyme digestion sites of the BHV5 recombinant plasmid were XbaI / BamHI.

[0072] PCR reaction for BHV4 or BHV5 colony identification: Add the following reagents sequentially to a 0.2 ml EP tube: 12.5 μl of Taq PCR Master Mix (2×, blue dye), 1 μl of M13 universal upstream primer (CGCCAGGGTTTTCCCAGTCACGAC), 1 μl of M13 universal downstream primer (AGCGGATAACAATTTCACACAGGA), 1 μl of colony DNA, and sterile water to a total volume of 25 μl. Gently pipette to mix thoroughly. The amplification program is as follows: pre-denaturation 95℃, 2 min; 95℃, 30 s, 55℃, 30 s, 72℃, 30 s, for 35 cycles; final extension 72℃, 7 min; store at 4℃.

[0073] (3) The recombinant plasmid synthesized by Sangon Biotech (Shanghai) Co., Ltd. was transformed into Escherichia coli JM109 competent cells to prepare recombinant Escherichia coli pUC57-BHV4-JM109 and pUC57-BHV45-JM109 strains. After expansion culture, plasmid DNA was extracted and the concentration was determined by Nanodrop to obtain recombinant plasmids, which were named BHV4 recombinant plasmid and BHV5 recombinant plasmid, respectively.

[0074] Before using the plasmid extraction kit for the first time, add all of the RNase A to the Resuspension Solution and store at 4°C (it can be used for 6 months). Before use, add the specified volume of anhydrous ethanol (35 mL) to the Wash Solution, Lysis Solution, and Neutralization Solution to check for precipitation. If precipitation occurs, dissolve it in a 37°C incubator and allow it to cool to room temperature before use.

[0075] The specific extraction process is as follows:

[0076] (1) Take 5-8 mL of bacterial culture that has been cultured overnight in ampicillin-resistant liquid LB medium, centrifuge at 8000g for 5 min, and discard the supernatant.

[0077] (2) Add 250 μL of Resuspension Solution, suspend evenly, and then transfer to a clean 1.5 mL EP tube.

[0078] (3) Add 250 μL of Lysis Solution, and invert the centrifuge tube 4 to 6 times to mix thoroughly until the bacteria are lysed into a clear solution. This step should not exceed 5 minutes.

[0079] (4) Add 350 μL of Neutralization Solution, gently invert and mix thoroughly 4 to 6 times, and centrifuge at 13000 rpm for 5 min.

[0080] (5) Transfer the supernatant from the centrifugation in step (4) to a 2 mL preparation tube, centrifuge at 13000 rpm for 1 min, and discard the filtrate.

[0081] (6) Place the preparation tube back into the centrifuge tube, add 500 μL Wash Solution, centrifuge at 13000 rpm for 1 min, and discard the filtrate.

[0082] (7) Repeat step (6).

[0083] (8) Place the preparation tube back into the centrifuge tube and centrifuge at 13000 rpm for 1 min.

[0084] (9) Place the preparation tube into a new 1.5 mL EP tube, add 50 μL of Elution Buffer to the center of the preparation membrane, let stand at room temperature for 2 min, centrifuge at 13000 rpm for 2 min, discard the column and store the purified plasmid DNA at -20℃.

[0085] Copy number calculation and dilution

[0086] The concentrations of the two recombinant plasmids were determined and calculated using the formula: Plasmid copy number (copies / μL) = 6.02 × (recombinant plasmid concentration ng / μL × 10⁻⁶). -9 )×10 23 The plasmid copy number is calculated as (660 × number of recombinant plasmid bases).

[0087] The concentration of the BHV4 recombinant plasmid was 270 ng / μL, and the plasmid copy number could be calculated to be 7.84 × 10⁻⁶ using the corresponding formula. 10 copies / μL.

[0088] The concentration of the BHV5 recombinant plasmid was 100 ng / μL, and the plasmid copy number could be calculated to be 5.87 × 10⁻⁶ using the corresponding formula. 10 copies / μL.

[0089] Optionally, the reference sample is a reagent containing a mixture of the above two recombinant plasmids (BHV4 recombinant plasmid and BHV5 recombinant plasmid) at different concentrations, with each recombinant plasmid having a specific concentration of 1×10⁻⁶. 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL.

[0090] Optionally, the kit contains a negative control and a positive control. The negative control is process water, and the positive control contains a mixture of the two recombinant plasmids (BHV4 recombinant plasmid and BHV5 recombinant plasmid). The positive control contains equal volumes of the two recombinant plasmids with the same copy number.

[0091] Details are as shown in Table 2:

[0092] Table 2

[0093]

[0094] Example 3

[0095] Based on the kit provided in the examples, a qualitative and quantitative detection method for non-disease diagnostic purposes was developed to simultaneously detect bovine herpesvirus 4 and bovine herpesvirus 5.

[0096] 1) Establishment of a standard curve for quantitative real-time PCR:

[0097] With a concentration of 1x10 10 Equal volumes of BHV4 and BHV5 recombinant plasmids were mixed, and the recombinant plasmid mixture was diluted to 1×10⁻¹⁰ using a 10-fold gradient. 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1Gradient concentrations of copies / μL were used as references, with each reference sample performed in triplicate. Different concentrations of reference samples were used as templates for dual quantitative PCR detection.

[0098] The real-time fluorescence quantitative PCR amplification curves of each recombinant plasmid are shown below. Figure 1 As shown, from Figure 1 The standard curve regression equation for BHV4 obtained from the analysis is y1 = -3.203x1 + 38.485, with a correlation coefficient of 0.999 and relatively small error, indicating that the standard curve is usable. The standard curve regression equation for BHV5 is y2 = -3.561x2 + 40.780, with a correlation coefficient of 0.999 and relatively small error, indicating that the standard curve is also usable. Therefore, the standard curves can be used for dual real-time quantitative PCR detection of BHV4 and BHV5.

[0099] 2) Sample processing:

[0100] Perform nucleic acid extraction (commercial kits are recommended for DNA extraction), and process the negative control and sample simultaneously. It is advisable to test the extracted nucleic acid immediately; otherwise, store it below -20°C.

[0101] Preparation of amplification reagents:

[0102] Each dose of the dual quantitative PCR reaction solution was prepared as follows: 12.5 μL 2×ChamQ Geno-SNPProbe Master Mix + 0.5 μL BHV4 upstream and downstream primers (10 μmol / L) + 0.5 μL BHV5 upstream and downstream primers (10 μmol / L) + 0.5 μL BHV4 probe (10 μmol / L) + 0.75 μL BHV5 probe (10 μmol / L) + 7.25 μL RNase-Free ddH2O. The prepared dual quantitative PCR premix solution was aliquoted into each PCR tube in a volume of 23 μL.

[0103] Adding samples:

[0104] Remove the control, reference, and sample processing solutions from the kit, thaw and mix at room temperature, then centrifuge at 1500 rpm for 15 seconds. Add 2 μL to each of the PCR premixed solutions in a PCR tube. The total volume of each reaction system is 25 μL. Tightly cap the PCR tubes, centrifuge at 1500 rpm for 15 seconds, and then transfer them to the detection amplification area.

[0105] Dual-fluorescence quantitative PCR amplification: The specific conditions for dual-fluorescence quantitative PCR amplification are shown in Table 3:

[0106] Table 3

[0107] Pre-variation 95 2min 1 transsexual 95 10s 45 Annealing extension 60 30s 45

[0108] The 25 μL reaction system for dual-fluorescence quantitative PCR is shown in Table 4:

[0109] Table 4

[0110] 2×ChamQ Geno-SNP Probe Master Mix 12.5μL BHV4 forward and reverse primers (10 μmol / L) 0.5μL BHV5 forward and reverse primers (10 μmol / L) 0.5μL BHV4 probe (10 μmol / L) 0.5μL BHV5 probe (10 μmol / L) 0.75μL <![CDATA[RNase-Free ddH2O]]> 7.25μL template 2.0μL

[0111] 3) Criteria for judging test results:

[0112] The changes in CT values ​​or fluorescence signals are used to qualitatively detect BHV4 and BHV5. The appearance of standard "S"-shaped amplification curves in different fluorescence channels indicates that the sample contains BHV4 and / or BHV5 viruses. Based on the intensity of the fluorescence signal and the standard curves provided above, the copy number of BHV4 and / or BHV5 viruses in the sample is obtained, thus achieving quantitative detection.

[0113] Specific determination method:

[0114] ① If the amplification curve of the sample to be tested is a standard S-shaped curve only in the FAM channel, and the CT value is ≤37, then the result is determined to be positive for BHV4 viral nucleic acid;

[0115] ② If the amplification curve of the sample to be tested is a standard S-shaped curve only in the ROX channel, and the CT value is ≤37, then the result is determined to be positive for BHV5 viral nucleic acid;

[0116] ③ If the amplification curves of the sample in both the FAM and ROX channels are standard S-shaped curves and the CT value is ≤37, the result is determined to be positive for BHV4 and BHV5 viral nucleic acid.

[0117] ④ If the sample to be tested has a CT value of 37 < CT value ≤ 40 and an “S” type amplification curve appears, the result is considered suspicious, meaning the sample needs to be retested.

[0118] ⑤ If the CT value of the sample to be tested is >40, the result is judged as negative.

[0119] Example 4

[0120] Sensitivity test of dual-fluorescence quantitative PCR

[0121] The template is 1×10 1 copies / μL, 1×10 2 copies / μL, 1×10 3 copies / μL, 1×10 4 copies / μL, 1×10 5 copies / μL, 1×10 6 copies / μL, 1×10 7A total of 7 standard positive mixed plasmids (copies / μL) were used, with ddH2O as the negative control. Quantitative PCR was performed to determine the lowest detection limit of the quantitative PCR detection method.

[0122] The experimental results obtained are as follows Figure 2 and Figure 3 As shown.

[0123] according to Figure 2 , 3 It can be seen that the detection limit of the established quantitative PCR sensitivity for BHV4 and BHV5 is 1×10⁻⁶. 1 copies / μL.

[0124] Specificity test of dual-fluorescence quantitative PCR

[0125] To determine the specificity of this method, quantitative PCR was performed using nucleic acids from bovine infectious rhinotracheitis virus (bovine herpesvirus type I), bovine parainfluenza virus, Clostridium perfringens types A, B, C, and D, and Pasteurella multocida types A and B as templates. Positive controls were positive plasmids from BHV4 and BHV5, and negative controls were ddH2O. The experimental results are as follows: Figure 4 As shown.

[0126] from Figure 4 It can be seen that, apart from the positive plasmids of BHV4 and BHV5 producing amplification curves, the nucleic acids of other viruses did not produce amplification curves.

[0127] Repeatability test of dual-fluorescence quantitative PCR

[0128] Three mixed standards with different copy numbers were selected, i.e., 1×10⁻⁶. 4 copies / μL, 1×10 5 copies / μL and 1×10 6 The template was prepared in μL and subjected to three replicates within and between groups. The experimental data were analyzed to verify the stability of the quantitative PCR method established in the examples. The template was 1×10⁻⁶ copies / μL. 4 copies / μL~1×10 6 Three different concentrations of positive mixed plasmids (copies / μL) were used for quantitative PCR. The experimental results are shown in Table 5. Figure 5 As shown.

[0129] From Table 5 and Figure 5 As can be seen, the CT values ​​of the same template showed little difference, and the amplification curves converged; the coefficients of variation for CT values ​​within and between groups of the same concentration of positive mixed plasmids were all less than 2%.

[0130] This demonstrates that the method in the embodiments of the present invention has good repeatability and stability.

[0131] Table 5

[0132]

[0133] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0134] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer and probe combination for simultaneous detection of bovine herpesvirus types 4 and 5, characterized in that, include: For detecting bovine herpesvirus 4, the upstream primer BHV4-F, the downstream primer BHV4-R, and the probe BHV4-P are used; for detecting bovine herpesvirus 5, the upstream primer BHV5-F, the downstream primer BHV5-R, and the probe BHV5-P are used. The nucleotide sequence of the upstream primer BHV4-F is shown in SEQ ID NO:1; The nucleotide sequence of the downstream primer BHV4-R is shown in SEQ ID NO:2; The nucleotide sequence of probe BHV4-P is shown in SEQ ID NO:3; The nucleotide sequence of the upstream primer BHV5-F is shown in SEQ ID NO:4; The nucleotide sequence of the downstream primer BHV5-R is shown in SEQ ID NO:5; The nucleotide sequence of probe BHV5-P is shown in SEQ ID NO:

6.

2. The combination as described in claim 1, characterized in that, The probe has a fluorescent group attached to its 5' end and a fluorescence quencher attached to its 3' end.

3. The combination as described in claim 2, characterized in that, The fluorescent group of probe BHV4-P is FAM, and the fluorescence quencher group is TAMRA; the fluorescent group of probe BHV5-P is ROX, and the fluorescence quencher group is BHQ2.

4. A test kit comprising any combination of claims 1 to 3.

5. The detection kit as described in claim 4, characterized in that, It also includes 2×ChamQ Geno-SNPProbe Master Mix, a reference, a negative control, and a positive control.

6. The detection kit as described in claim 5, characterized in that, The reference material is a set of reference materials containing different concentrations. Each concentration of reference material includes a reagent of a mixture of two recombinant plasmids of the same concentration. The two recombinant plasmids are: BHV4 recombinant plasmid and BHV5 recombinant plasmid. The method for constructing the BHV4 recombinant plasmid: The BHV4 gB gene was synthesized based on existing gene sequences. The nucleotide sequence is shown in SEQ ID NO:

7. The gene was amplified by PCR, purified, and then ligated into the pUC57 Vector. The method for constructing the BHV5 recombinant plasmid is as follows: the BHV5 gC gene is synthesized with reference to existing gene sequences, the nucleotide sequence of which is shown in SEQ ID NO:

8. The gene is then amplified by PCR, purified, and ligated into the pUC57 Vector.

7. The kit according to claim 6, characterized in that, The concentration of the upstream primer BHV4-F was 200 nmol / L, the concentration of the downstream primer BHV4-R was 200 nmol / L, and the concentration of the probe BHV4-P was 200 nmol / L. The concentration of the upstream primer BHV5-F was 200 nmol / L, the concentration of the downstream primer BHV5-R was 200 nmol / L, and the concentration of the probe BHV5-P was 300 nmol / L. The connection is as follows: Add 1 μl of pUC57 Simple Vector and 4 μl of PCR amplification product to a 0.2 ml EP tube in sequence, add sterile water to a total volume of 10 μl, gently pipette to mix well, and incubate at 25°C for 30 min. The specific concentrations of the two recombinant plasmids with the same concentration were both 1×10⁻⁶. 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL.

8. The kit according to claim 7, characterized in that, The negative control was process water; the positive control was a mixture of BHV4 and BHV5 recombinant plasmids, with each recombinant plasmid having a concentration of 1 × 10⁻⁶. 10 copies / μL.

9. A method for qualitative and quantitative detection for non-diagnostic therapeutic purposes based on the kit described in any one of claims 4 to 8, characterized in that, Includes the following steps: 1) Establishment of a standard curve for quantitative real-time PCR; 2) Extract genomic DNA from the sample to be tested, and perform dual real-time quantitative PCR using the extracted genomic DNA as a template; 3) Result Interpretation: Qualitative detection of BHV4 and / or BHV5 bovine samples is performed using the obtained Cq value or changes in fluorescence signal. The appearance of an "S"-shaped amplification curve indicates that the sample contains BHV4 and / or BHV5. Then, based on the intensity of the fluorescence signal and the standard curve in step 1), the copy number of BHV4 and / or BHV5 in the sample is obtained, thus achieving quantitative detection. The dual real-time quantitative PCR reaction system includes: 2 μL template, 12.5 μL real-time quantitative PCR 2 × ChamQ Geno-SNP Probe Master Mix, 0.5 μL 10 μmol / L BHV4 upstream primer, 0.5 μL 10 μmol / L BHV4 downstream primer, 1 μL 10 μmol / L BHV4 probe, 0.5 μL 10 μmol / L BHV5 upstream primer, 0.5 μL 10 μmol / L BHV5 downstream primer, 0.75 μL 10 μmol / L BHV5 probe, and 7.25 μL RNase-Free ddH2O. The dual real-time quantitative PCR reaction conditions were: 95℃ for 2 min; then 95℃ for 10 s, 60℃ for 30 s, for 45 cycles; Step 3) Specific determination method: ① If the amplification curve of the sample to be tested is a standard S-shaped curve only in the FAM channel, and the CT value is ≤37, then the result is determined to be positive for BHV4 viral nucleic acid; ② If the amplification curve of the sample to be tested is a standard S-shaped curve only in the ROX channel, and the CT value is ≤37, then the result is determined to be positive for BHV5 viral nucleic acid; ③ If the amplification curves of the sample in both the FAM and ROX channels are standard S-shaped curves and the CT value is ≤37, the result is determined to be positive for BHV4 and BHV5 viral nucleic acid. ④ If the sample to be tested has a CT value of 37 < CT value ≤ 40 and an "S"-shaped amplification curve appears, the result is considered suspicious, meaning the sample needs to be retested. ⑤ If the CT value of the sample to be tested is >40, the result is judged as negative.

Images