Primers and detection method for detecting bovine-derived DNA
By designing primer pairs and probes that specifically bind to specific sequences of the bovine genome, the problem of insufficient sensitivity and specificity in the detection of bovine DNA residues in medical devices has been solved, achieving highly sensitive and specific quantitative analysis, which is suitable for the detection of bovine DNA residues in biological materials.
Patent Information
- Application Number
- CN202210873455.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-22
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2042-07-22
AI Technical Summary
Existing detection methods lack sufficient sensitivity and specificity for detecting bovine DNA residues in medical devices, making it difficult to meet high-standard risk control requirements, especially in biological materials where quantitative bias and false negatives occur.
A primer pair was designed to bind to a specific sequence in the bovine genome for highly sensitive and specific quantitative PCR detection. The primer pair includes a forward primer and a reverse primer, with an amplification length of 138-156 bp and a Tm temperature of 60-61℃. It can specifically bind to bovine genomic DNA and is equipped with probes to improve detection accuracy.
It achieves highly sensitive detection of bovine DNA residues, can distinguish bovine DNA from other interfering DNAs, with a detection sensitivity of 5 fg/reaction, is simple to operate and highly specific, and is suitable for quantitative analysis of bovine DNA residues in biological materials.
Smart Images

Figure BDA0003760457770000091 
Figure BDA0003760457770000101 
Figure BDA0003760457770000102
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection. Specifically, this invention relates to primers and detection methods for detecting bovine DNA residues in biological materials. Background Technology
[0002] Animal-derived extracellular matrix (EBM) scaffolds possess characteristics such as low immunogenicity and good biocompatibility, and have been widely used in clinical tissue regeneration, repair, and reconstruction surgeries for tendons, skin, cardiovascular systems, and the gastrointestinal tract. These EBMs are primarily derived from human and other mammalian tissues and organs, including the dermis, bladder, heart valves, and pericardium. Due to the limited availability of human tissues, tissues from some mammals, such as cattle, are extensively used to manufacture EBM materials.
[0003] In the manufacturing process of bio-based medical devices, bovine DNA residues may remain in the extracellular matrix derived from bovine tissues and organs. These residual DNAs are considered potentially hazardous and could lead to biocompatibility issues or inflammatory reactions during xenogeneic biomaterial implantation. Decellularization techniques can remove major cellular components from tissues, reducing the risk of immunogenicity while preserving the natural three-dimensional structure. However, existing decellularization techniques cannot completely remove all cellular components and nucleic acid residues. Therefore, quantitatively detecting the residual amounts of cellular components such as double-stranded DNA is an important measure to control and reduce the immunogenicity risks of animal-derived biomaterials.
[0004] Real-time quantitative PCR (qPCR) technology utilizes specifically fluorescently labeled TaqMan probes to quantitatively detect and analyze residual DNA in samples. The probes, carrying fluorescent groups, continuously excite fluorescence signals during thermal cycling. By monitoring changes in the accumulated fluorescence signal, the increase in PCR products is reflected, thus enabling quantitative analysis of DNA in the sample. TaqMan probe-based quantitative PCR detection technology offers advantages such as high specificity, high accuracy, and high speed.
[0005] Existing research largely focuses on adulteration and identification of meat, feed, gelatin, and other foods. Furthermore, existing qPCR target sequences for bovine DNA identification are mostly single-copy genes or mitochondrial genes. The low copy number or non-constant copy number of these genes may lead to low sensitivity, quantitative bias, and false negatives. For the risk and safety control of medical devices, the control of bovine DNA residues is even more stringent, requiring higher sensitivity detection technologies. Therefore, the medical device field urgently needs a more standardized quantitative detection method for bovine DNA residues.
[0006] Highly repetitive sequences have the characteristics of high copy number and wide distribution in the genome. The qPCR method based on bovine highly repetitive sequence targets has higher detection sensitivity and accuracy, and is suitable for accurate quantitative analysis of trace residual DNA in biological medical devices. The verified detection method is used for safety control in the production process of medical devices to avoid potential risks in the use process of patients. SUMMARY
[0007] The purpose of the present application is to provide a primer pair for detecting bovine DNA residues in biological materials with high sensitivity and high specificity, and a detection reagent or PCR kit comprising the primer pair.
[0008] Another purpose of the present application is to provide a method or PCR method for detecting bovine DNA residues in biological materials using the primer pair or detection reagent provided by the present application.
[0009] In a first aspect, the present application provides a primer pair for detecting bovine genomic DNA, comprising a forward primer and a reverse primer, wherein the forward primer binds to positions 90-125, preferably 99-118, of the sequence shown in SEQ ID NO: 1 on bovine genomic DNA; the reverse primer binds to positions 210-245, preferably 218-236, of the sequence shown in SEQ ID NO: 1 on bovine genomic DNA; and the length of the amplification product obtained by amplification of the primer pair is 138-156 bp.
[0010] In a preferred embodiment, the length of the forward primer and the reverse primer is 16-22 bp; preferably 20 bp.
[0011] In a preferred embodiment, the Tm temperature of the forward primer and the reverse primer is 60-61℃, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤1℃.
[0012] In a specific embodiment, in the primer pair, the forward primer is as shown in SEQ ID NO: 2, and the reverse primer is as shown in SEQ ID NO: 3.
[0013] In a second aspect, the present application provides a detection reagent comprising the primer pair of the first aspect.
[0014] In a preferred embodiment, the detection reagent further comprises a probe.
[0015] In a preferred embodiment, the probe is as shown in SEQ ID NO: 4.
[0016] In a third aspect, the present application provides a detection kit, which comprises the primer pair of the first aspect or the detection reagent of the second aspect, and optionally further comprises an instruction for detecting bovine-derived DNA using the primer pair or the detection reagent.
[0017] In a specific embodiment, the detection reagent further comprises a probe.
[0018] In a preferred embodiment, the probe is as shown in SEQ ID NO: 4.
[0019] In a specific embodiment, the forward primer in the primer pair is as shown in SEQ ID NO: 2, the reverse primer is as shown in SEQ ID NO: 3, and the probe is as shown in SEQ ID NO: 4.
[0020] In a preferred embodiment, the detection reagent has a detection sensitivity of 5 fg per reaction.
[0021] In a fourth aspect, the present application provides a method for detecting bovine genomic DNA, which comprises performing PCR on a sample to be tested using the primer pair of the first aspect or the detection reagent of the second aspect or the detection kit of the third aspect, and detecting the PCR amplification product.
[0022] In a fifth aspect, the present application provides a PCR kit, which comprises a container and the primer pair of the first aspect in the container.
[0023] In a preferred embodiment, the forward primer and the reverse primer have a length of 16-22 bp; preferably 20 bp.
[0024] In a preferred embodiment, the forward primer and the reverse primer have a Tm temperature of 60-61℃, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤1℃.
[0025] In a preferred embodiment, the kit further comprises a probe.
[0026] In a preferred embodiment, the probe is as shown in SEQ ID NO: 4.
[0027] In a preferred embodiment, the detection reagent has a detection sensitivity of 5 fg per reaction.
[0028] In a preferred embodiment, the kit further comprises a standard control.
[0029] In a sixth aspect, the present application provides a PCR method, which comprises the following steps:
[0030] In a PCR detection system, the primer pair of the first aspect is used to amplify the target product.
[0031] In a preferred embodiment, the forward primer and the reverse primer have a length of 16-22 bp; preferably 20 bp.
[0032] In a preferred embodiment, the forward primer and the reverse primer have a Tm temperature of 60-61℃, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤1℃.
[0033] In a preferred embodiment, the kit further comprises a probe.
[0034] In a preferred embodiment, the probe is as shown in SEQ ID NO: 4.
[0035] In a seventh aspect, the present application provides the use of the primer pair of the first aspect or the detection reagent of the second aspect or the detection kit of the third aspect for detecting whether bovine genomic DNA exists in a subject to be tested.
[0036] In a preferred embodiment, the subject to be tested is bovine-derived extracellular matrix; preferably extracellular matrix derived from bovine dermis, bladder, heart valve and pericardium; more preferably oral cavity repair membrane and dura (spinal) repair membrane, collagen, ophthalmic implant cornea, artificial skin, medical suture material, etc.
[0037] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described below (e.g. in the examples) can be combined with each other to form a new or preferred technical solution. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0038] Figure 1 The amplification curve of the reference product is shown, wherein the primer pair used is SEQ ID NO: 2 and SEQ ID NO: 3;
[0039] Figure 2 The standard curve of the reference product is shown, wherein the primer pair used is SEQ ID NO: 2 and SEQ ID NO: 3.
[0040] Figures 3-5 The amplification curves of concentrations of 3 fg / μL, 1 fg / μL and 0.5 fg / μL in the sensitivity determination are shown respectively, wherein the primer pair used is SEQ ID NO: 2 and SEQ ID NO: 3. DETAILED DESCRIPTION
[0041] After in-depth and extensive research, the inventors unexpectedly found that primers designed against the sequence shown in SEQ ID NO: 1 in the bovine genome can not only highly sensitively detect bovine-derived DNA residues, but also distinguish interfering DNA from porcine sources and the like. The method of the present application is simple and fast to operate, and has high specificity and sensitivity. On this basis, the present application is completed.
[0042] Primer pair of the present application
[0043] The term "primer" as used herein has the meaning conventionally understood by those skilled in the art. The bovine genome DNA-specific primer of the present application is not designed against the exogenous gene itself or the viral vector itself, but against the segment shown in SEQ ID NO: 1 on the bovine genome DNA. In other words, the primer of the present application can specifically bind to the segment shown in SEQ ID NO: 1 on the bovine genome DNA.
[0044] In view of the teachings of the present application and the common general knowledge of the art, those skilled in the art should understand that a plurality of primer pairs can be designed against the segment shown in SEQ ID NO: 1. Therefore, the primer pair of the present application is not limited to the primer pairs specifically obtained in the examples.
[0045] In a specific embodiment, the forward primer of the present application binds to positions 90-125, preferably 99-118, of the sequence shown in SEQ ID NO: 1; the reverse primer binds to positions 210-245, preferably 218-236, of the sequence shown in SEQ ID NO: 1, and the length of the amplified product obtained by amplification of the primer pair is 138-156 bp.
[0046] In a preferred embodiment, the length of the forward primer and the reverse primer is 16-22 bp; preferably 20 bp.
[0047] In a preferred embodiment, the Tm temperature of the forward primer and the reverse primer is 60-61℃, and the absolute value of the difference between the Tm of the forward primer and the Tm of the reverse primer is ≤1℃.
[0048] In a specific embodiment, the forward primer in the primer pair of the present application is shown in SEQ ID NO: 2, and the reverse primer is shown in SEQ ID NO: 3.
[0049] Probe
[0050] The term "primer" as used herein has the meaning conventionally understood by those skilled in the art, i.e. a small piece of single-stranded DNA or RNA fragment for detecting nucleic acid sequences complementary thereto.
[0051] In view of the teachings of the present application and the common general knowledge of the art, those skilled in the art should understand that, given the primer pair, the skilled person can design a probe according to the template sequence between the forward primer and reverse primer binding sites and detect the technical effect of the probe in combination with the primer pair. In specific embodiments, the probe can be designed by the person of ordinary skill in the art as needed, which can be in a liquid phase or immobilized on a solid phase; and can be combined before or after amplification. Therefore, the probe of the present application is not limited to the probe specifically disclosed in the examples. The primer pair of the present application is also not limited to pairing with the probe specifically disclosed in the examples.
[0052] In specific embodiments, the probe of the present application is as shown in SEQ ID NO: 4.
[0053] Detection reagent of the present application
[0054] The present application also provides a detection reagent for detecting bovine genomic DNA, which comprises the primer pair of the present application and other components required for performing PCR, such as Taq enzyme, dNTP, Mg 2+ , and the like.
[0055] In specific embodiments, the detection reagent of the present application comprises the forward primer as shown in SEQ ID NO: 2, the reverse primer as shown in SEQ ID NO: 3, and the probe as shown in SEQ ID NO: 4.
[0056] In specific embodiments, the detection sensitivity of the detection reagent of the present application reaches 5 fg / reaction.
[0057] On the basis of the primer pair or detection reagent of the present application, the present application further provides a method for detecting bovine genomic DNA, which comprises performing PCR on the sample to be tested by using the primer pair or detection reagent of the present application, and detecting the PCR amplification product.
[0058] On the basis of the primer pair of the present application, the present application also provides a PCR kit, which comprises a container and the above-mentioned primer pair or detection reagent of the present application in the container.
[0059] In specific embodiments, the PCR kit of the present application is further provided with other required components for performing PCR and instructions for using the kit to perform PCR detection. In preferred embodiments, the kit is further provided with a standard control.
[0060] On the basis of the primer pair of the present application, the present application also provides a PCR method for amplifying the target product by using the primer pair of the present application.
[0061] The biological material
[0062] The primer pairs, detection reagents, or detection kits of this invention can be used to detect bovine DNA residues in biological materials. The biological materials described herein are biologically derived extracellular matrix. In a preferred embodiment, the biologically derived extracellular matrix is bovine extracellular matrix. In specific embodiments, the bovine extracellular matrix is derived from the extracellular matrix of bovine dermis, bladder, heart valves, and pericardium; including but not limited to oral and dura mater repair membranes, collagen, ophthalmic implantable corneas, artificial skin, and medical suture materials.
[0063] The advantages of this invention include:
[0064] 1. The primer pairs or detection reagents of the present invention can detect bovine genomic DNA with high sensitivity;
[0065] 2. The primer pairs or detection reagents of the present invention can distinguish interfering DNAs such as porcine, CHO, Vero, human, NSO, MDCK, E. coli, Pichia pastoris, and Sf9;
[0066] 3. The detection method of the present invention is simple and quick to operate, and has high specificity and sensitivity.
[0067] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2001), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.
[0068] Example
[0069] Materials and Methods
[0070] 1. The bovine genomic DNA standard was obtained from Huzhou Shenke Biotechnology Co., Ltd.
[0071] 2. Sample pretreatment reagents
[0072] The sample pretreatment reagents were from Huzhou Shenke Biotechnology Co., Ltd., and included proteinase K, proteinase K buffer, magnetic beads, binding solution, glycogen, yeast tRNA, washing solution A, washing solution B, and elution solution.
[0073] 3. qPCR detection system
[0074] qPCR detection kit from Huzhou Shenko Biotechnology Co., Ltd., including qPCR Reaction buffer, DNA diluent, primer, probe, DNA standard, internal quality control.
[0075] 4. Instrument: Applied biosystems 7500 fluorescence quantitative PCR instrument.
[0076] Experimental operation and process
[0077] 1. Sample pretreatment
[0078] 1) Accurately weigh 5-10 mg of sample and record, and put it into a 1.5 mL DNase-free sterile centrifuge tube.
[0079] 2) After the sample is processed into small pieces as much as possible, add 1000 μL of proteinase K buffer, 200 μL of proteinase K, and DEPC water to a final volume of 2000 μL. Digest at 56°C for 1 h until the sample to be tested is completely digested and no visible granular material is left.
[0080] 3) After digestion, add 200 μL of sample to 200 μL of working binding solution, 9 μL of glycogen, and 0.2 μL of yeast tRNA, and mix well.
[0081] 4) Add 200 μL of isopropanol and 30 μL of magnetic beads, shake for 5 min, and centrifuge quickly for 10 s, and stand on the magnetic stand. After the solution is clear and the magnetic beads are completely separated, carefully remove the supernatant.
[0082] 5) Add 700 μL of washing solution A, shake well, then quickly centrifuge for 10 s, and stand on the magnetic stand. After the solution is clear and the magnetic beads are completely separated, remove the supernatant.
[0083] 6) Add 700 μL of washing solution B, shake well, then quickly centrifuge for 10 s, and stand on the magnetic stand. After the solution is clear and the magnetic beads are completely separated, remove the supernatant.
[0084] 7) Quickly centrifuge again for 10 s, stand on the magnetic stand, and remove the residual liquid completely after the magnetic beads are completely separated.
[0085] 8) Open the tube cap and dry for 5-10 s at room temperature to remove residual ethanol. Observe carefully during the drying process to avoid drying the magnetic beads too much, which will not completely dissolve during elution.
[0086] 9) Add 50 μL of elution solution, gently shake to mix the magnetic beads and elution solution, 70°C water bath for 7 min, shake every 2 min during the water bath process, and mix well for 2-3 times.
[0087] 10) Fast centrifuge for 10s, stand on magnetic stand, transfer supernatant to a new centrifuge tube after magnetic bead separation.
[0088] 2. Detection
[0089] 2.1 Preparation of reference
[0090] The reference is bovine kidney cell extracted genomic DNA with a concentration of 30 ng / μL.
[0091] 2.2 Preparation of standard curve samples
[0092] The reference is diluted by 10 times gradient dilution with DNA diluent to prepare standard solution of 3000 pg / μL, 300 pg / μL, 30 pg / μL, 3 pg / μL, 0.3 pg / μL and 0.03 pg / μL.
[0093] 2.3 qPCR reaction system
[0094] Detection system 30 μL: 20 μL qPCR reaction solution + 10 μL template.
[0095] Take 10 μL of the sample to be detected, no template control and standard curve sample, respectively, and add to 20 μL of qPCR reaction solution, set 3 replicates. After adding sample, centrifuge for 3s, and then put into qPCR instrument. Set the reaction program: 95℃ pre-denaturation for 10 min; 95℃ for 15s, 63℃ for 40s, 40 cycles; reaction volume 30 μL.
[0096] 2.4 Standard curve drawing
[0097] After amplification, set the threshold line, read the amplification efficiency, slope, R 2 and detection value of each sample.
[0098] 2.5 Result determination
[0099] a) The correlation coefficient R 2 of the standard curve equation should be greater than 0.990, and the slope should be -3.1 to -3.8 (i.e. the amplification efficiency is 83.3% to 110%).
[0100] b) The Ct value of no template control (NTC) is not detected or ≥ 35.
[0101] Example 1. Design of primer pair and probe
[0102] The inventors designed a primer pair and a probe for detecting the target sequence
[0103] The following sequence in bovine genome is selected as the qPCR target sequence:
[0104] GGAGAAGGCAATGGCACCCCACTCCAGTACTCTTGCCTGGAAAATCCCATGGACGGAGGAGCCTGGTAGGCTGCAGTCCATGGGGTCGCTAAGAGTCGGACACGACTGAGCGACTTCACTTTCACTTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACCCACTCCAGTGTTCTTGCCTGGAGAATCCCAGGGACGGGGGAGCCTGGTGGGCTGCCGTCTATGGGGTCGCACAGAGTCGGACACGACTGAAGCGACTT (SEQ ID NO: 1)
[0105] 2. Primer and probe design
[0106] Based on the sequence shown in SEQ ID NO: 1, the inventors designed the following primer pair and probe:
[0107] Forward primer: GACACGACTGAGCGACTTCA (SEQ ID NO: 2)
[0108] Reverse primer: CTGTGCGACCCCATAGACG (SEQ ID NO: 3)
[0109] Probe: FAM-TTTCACTTTTCACTTTC-MGB (SEQ ID NO: 4)
[0110] Example 2. Detection of linear range
[0111] The inventors detected the linear range of the primer pair of the present application. The specific experimental procedure is described above in the section “Experimental procedures and processes”.
[0112] The results showed that the concentration range of bovine DNA detection was 30 ng / reaction ~ 300 fg / reaction (see Table 1), the curve parameter R 2 : 0.999, and the amplification efficiency was 97.84% (as shown in Figures Figure 1 and 2).
[0113] Table 1. Mean Ct values of amplification of standard curve
[0114] Tagged curves Mean Ct values St1 (30 ng / reaction) 10.57 St2 (3 ng / reaction) 13.93 St3 (300 pg / reaction) 17.22 St4 (30 pg / reaction) 20.73 St5 (3 pg / reaction) 24.04 St6 (300 fg / reaction) 27.43
[0115] Example 3. Detection of specificity
[0116] DNA of multiple species of cells: pig, CHO, Vero, human, NS0, MDCK, E. coli, Pichia pastoris and Sf9 were selected for interference experiment, and the interference DNA of 30 ng / reaction was used as template for qPCR amplification. The results showed that the detection Ct value of 9 kinds of interference DNA (30 ng / reaction) was greater than 30 (see Table 2), and the detection of bovine DNA had no effect.
[0117] Table 2. Detection Ct value results of 9 kinds of interference DNA
[0118]
[0119]
[0120] Example 4. Detection sensitivity determination
[0121] 1. In this example, the inventors determined the sensitivity of the detection system of the present application.
[0122] The bovine genomic DNA reference was diluted to concentrations of 3 fg / μL, 1 fg / μL and 0.5 fg / μL, respectively, 8 replicate wells were detected for each concentration, and 3 repeated independent experiments were performed, and a total of 24 detection data were statistically analyzed. The results showed that the 24 detection results of 3 fg / μL, 1 fg / μL and 0.5 fg / μL had detection values and obvious amplification curves (see Table 3, Figures 3-5 ). The detection sensitivity can reach 0.5 fg / μL, i.e. 5 fg / reaction.
[0123] Table 3. Sensitivity 24 detection data results
[0124]
[0125]
[0126] Example 5. Detection of actual samples
[0127] The detection system of the present application was used to quantitatively detect the bovine DNA residues in the oral repair membrane and the hard brain (spine) repair membrane biomaterial samples. The results showed that the residual amount of bovine DNA in the oral repair membrane and the hard brain (spine) repair membrane samples was 90.3 and 282.5 ng / mg, respectively (see Table 4).
[0128] Table 4. Actual sample detection results
[0129]
[0130] All documents referred to in the present application are incorporated herein by reference as if each were individually incorporated. In addition, it is to be understood that the application can be carried out by specifically different embodiments and that embodiments can be practiced without the specific details that are set forth herein. Further, it should be noted that, in this application, "exemplary" or "for example" is used on a purely illustrative basis to aid the reader in understanding the application. Any process steps, or sequences of steps, or examples, or embodiments, or materials, or components, or compounds, or elements, or techniques described herein are understood not to be limiting, but are exemplary.
Claims
1. A primer pair for detecting bovine genomic DNA, the primer pair comprising a forward primer and a reverse primer, wherein the forward primer is shown in SEQ ID NO:2 and the reverse primer is shown in SEQ ID NO:
3.
2. A detection reagent comprising the primer pair of claim 1.
3. A detection kit comprising the primer pair of claim 1 or the detection reagent of claim 2, and optionally further comprising instructions for use in detecting bovine DNA using the primer pair or the detection reagent.
4. The detection kit as described in claim 3, characterized in that, The detection reagent also includes a probe.
5. The detection kit as described in claim 4, characterized in that, The forward primer in the primer pair is shown in SEQ ID NO:2, the reverse primer is shown in SEQ ID NO:3, and the probe is shown in SEQ ID NO:
4.
6. A method for detecting bovine genomic DNA, the method comprising: Using the primer pair described in claim 1, the detection reagent described in claim 2, or the detection kit described in any one of claims 3-5, PCR is performed on the sample to be tested, and the PCR amplification products are detected.
7. A PCR kit comprising a container and a primer pair of claim 1 located in the container.
8. A PCR method, comprising the following steps: In a PCR detection system, the target product is amplified using the primer pair described in claim 1.
9. The use of the primer pair of claim 1, the detection reagent of claim 2, or the detection kit of any one of claims 3-5, for detecting the presence of bovine genomic DNA in a test subject.
Citation Information
Patent Citations
Fluorescent PCR detection reagent for identifying cattle gene source in heparin, preparation method and application
CN103937881A