A recombinant orf virus expressing porcine circovirus type 3 cap protein and a preparation method and application thereof

Abstract

The application discloses a recombinant orf virus for expressing PCV3 Cap protein, and the recombinant orf virus is obtained by the following steps: firstly, replacing the 132 gene of the orf virus with a nucleotide sequence, such as the gene sequence 1 of SEQ ID NO: 5, to obtain a recombinant virus 1; and secondly, replacing the nucleotide sequence, such as the gene sequence 1 of SEQ ID NO: 5, in the recombinant virus 1 with a nucleotide sequence, such as the gene sequence 2 of SEQ ID NO: 6, to obtain the recombinant orf virus. The application replaces the 132 gene of the ORFV virus with the optimized Cap gene of the PCV3 to prepare the recombinant orf virus. The recombinant orf virus can stably express the PCV3 Cap protein, and provides a vaccine candidate strain for preventing the PCV3 related diseases and a feasible technical platform for developing the recombinant orf virus of other viruses.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular, to a recombinant orf virus expressing porcine circovirus type 3 Cap protein and a preparation method and application thereof. BACKGROUND

[0002] Porcine circovirus type 3 (PCV3) belongs to the Circoviridae family Circovirus and is a single-stranded, circular DNA virus with a genome size of 2000 nt, containing three major open reading frames (ORF), ORF1 encodes a replication enzyme-related protein (Rep) through viral forward DNA transcription, ORF2 encodes a capsid protein (Cap) through viral DNA complementary chain transcription and translation, and ORF3 is transcribed in the same direction as ORF1, but the function of the encoded protein is still unknown. The Cap protein is an immunogenic protein of PV3 that can stimulate the body to produce specific immune responses and is currently an important protein for pathogenesis and immune-related research. Since the first discovery of porcine circovirus type 3 in the United States in 2015, the virus has been widely prevalent in pig populations in Asia, Europe and the Americas.

[0003] PCV3 infection mainly causes porcine dermatitis nephropathy syndrome and sow reproductive disorders, and the necropsy of the diseased pigs shows varying degrees of pulmonary edema and emphysema, accompanied by enlarged pulmonary and inguinal lymph nodes, hemorrhagic lesions in the kidney, small intestine and large intestine, and congestion in organs such as the heart, liver, spleen and brain. Related studies have shown that PCV3 can evade the host's innate immune response, leading to poor development and necrosis of lymphocytes, causing damage to the immune system, and is often co-infected with porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), classical swine fever virus (CSFV) and other pathogens, bringing not small challenges to the prevention and immunization of pig farms, and causing serious threats to the healthy development of the pig industry.

[0004] Currently, the prevention and control of PCV3 still remains in conventional strategies such as disinfection, early detection and early elimination, and there is a lack of effective prevention and control measures for the disease. Vaccines are one of the important means for the prevention and control of viral diseases, and PCV2 vaccines have no cross-immune protection for PCV3, so the development of PCV3 vaccines is an important method for controlling the disease; however, there is still no stable cell proliferation system for PCV3, which also brings great difficulties to the development of PCV3 related vaccines. SUMMARY

[0005] The present application aims to overcome the above-mentioned deficiencies in the prior art and provide a recombinant orf virus expressing porcine circovirus type 3 Cap protein and a preparation method and application thereof.

[0006] Orf virus (ORFV) belongs to Poxviridae and Parapoxvirus, and is a DNA virus like PCV3. Studies have shown that exogenous inserted genes can be well expressed in the coding region of ORFV, and this feature determines that ORFV can be used as a live virus vector for expression of exogenous genes. In addition, the advantages of ORFV as a post-virus vector include: ① strict host selectivity and skin adaptability; ② the damage caused is skin-limited, heals quickly, and does not cause systemic infection of the virus; ③ rapidly activates the body's non-specific cellular immune response, and dendritic cells are involved in the response, even in non-hosts; ④ can rapidly activate the body's specific immune response, including rapid activation of natural killer cells, macrophages, cytotoxic and helper T cells, and complement-mediated cell killing; ⑤ no neutralizing serum antibodies are produced after immunization, and there is no cross-reaction with other viruses such as poxviruses, and repeated immunization is possible. All these advantages ensure the feasibility of repeated immunization using ORFV as a live vector vaccine.

[0007] The first object of the present application is to provide a recombinant Orf virus expressing Cap protein of porcine circovirus type 3.

[0008] The second object of the present application is to provide a preparation method of a recombinant Orf virus expressing Cap protein of porcine circovirus type 3.

[0009] The third object of the present application is to provide a recombinant Orf virus prepared by the above preparation method.

[0010] The fourth object of the present application is to provide the use of the above-mentioned recombinant Orf virus as a viral vector in the preparation of a porcine circovirus type 3 vaccine.

[0011] The fifth object of the present application is to provide a porcine circovirus type 3 vaccine.

[0012] In order to achieve the above-mentioned objects, the present application is realized by the following scheme:

[0013] A recombinant Orf virus expressing Cap protein of porcine circovirus type 3, wherein the recombinant Orf virus is obtained by replacing the 132 gene of Orf virus with a nucleotide sequence of SEQ ID NO: 5 to obtain a recombinant virus 1, and then replacing the nucleotide sequence of SEQ ID NO: 5 in the recombinant virus 1 with a nucleotide sequence of SEQ ID NO: 6 to obtain a recombinant Orf virus.

[0014] Preferably, the preparation method of the recombinant orf virus is that: the orf virus and the recombinant plasmid 1 are subjected to homologous recombination in a host cell to obtain a recombinant virus 1, and the recombinant virus 1 is subjected to homologous recombination with the recombinant plasmid 2 to obtain the recombinant orf virus.

[0015] The nucleotide sequence of the recombinant plasmid 1 is shown as SEQ ID NO: 1, and the nucleotide sequence of the recombinant plasmid 2 is shown as SEQ ID NO: 2.

[0016] More preferably, the host cell is an ovine fetal turbinates cell (OFTu).

[0017] A preparation method of a recombinant orf virus expressing a porcine circovirus type 3 Cap protein, comprising the following steps:

[0018] S1. An orf virus is used to infect a host cell to obtain an infected cell 1, a recombinant plasmid 1 with a nucleotide sequence shown as SEQ ID NO: 1 is transfected into the infected cell 1, homologous recombination is performed, and a recombinant virus 1 is harvested;

[0019] S2. The recombinant virus 1 obtained in step S1 is used to infect a host cell to obtain an infected cell 2, a recombinant plasmid 2 with a nucleotide sequence shown as SEQ ID NO: 2 is transfected into the infected cell 2, homologous recombination is performed, and a virus is harvested, that is, a recombinant orf virus is obtained.

[0020] Preferably, the MOI value of the orf virus in step S1 is 0.1-1.

[0021] More preferably, the MOI value of the orf virus in step S1 is 0.2.

[0022] Preferably, the MOI value of the recombinant virus 1 in step S2 is 0.1-1.

[0023] More preferably, the MOI value of the recombinant virus 1 in step S2 is 0.2.

[0024] Preferably, the host cell in step S1 and step S2 is an ovine fetal turbinates cell (OFTu).

[0025] The application also protects the recombinant orf virus prepared by the above preparation method.

[0026] The application also protects the application of the recombinant orf virus in any of the above and / or the recombinant orf virus prepared by the above preparation method as a viral vector in the preparation of a porcine circovirus type 3 vaccine.

[0027] The application also claims a porcine circovirus type 3 vaccine, wherein the virus strain expressing the antigen is the recombinant orf virus described above and / or the recombinant orf virus prepared by the preparation method described above.

[0028] Compared with the prior art, the application has the following beneficial effects:

[0029] The application provides a recombinant orf virus expressing a porcine circovirus type 3 Cap protein, which is obtained by replacing a 132 gene of an orf virus with a nucleotide sequence such as a gene sequence 1 of SEQ ID NO: 5 to obtain a recombinant virus 1, and then replacing the nucleotide sequence such as the gene sequence 1 of SEQ ID NO: 5 in the recombinant virus 1 with a nucleotide sequence such as a gene sequence 2 of SEQ ID NO: 6. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 FIG. 1 is a schematic diagram of recombinant plasmids pEGFP-132LF-7SC7E-132RF and pEGFP-132LF-7SC-132RF;

[0031] Figure 2 FIG. 6 is an amplification electrophoresis identification diagram; M: DL 2000 DNA Marker; 1: 132LF fragment; 2: 132RF fragment; 3: VV7.5 promoter fragment; 4: ORFV 127 gene signal peptide fragment (SP fragment); 5: EGFP fragment; 6: truncated PCV3 Cap fragment;

[0032] Figure 3 FIG. 7 is a double enzyme digestion electrophoresis identification diagram of plasmids; A: double enzyme digestion electrophoresis identification diagram of pEGFP-7E plasmid; B: double enzyme digestion electrophoresis identification diagram of pEGFP-132LF-7E plasmid; C: double enzyme digestion electrophoresis identification diagram of pEGFP-132LF-7E-132RF plasmid;

[0033] Figure 4 FIG. 8 is a double enzyme digestion electrophoresis identification diagram of pEGFP-132LF-7SC7E-132RF plasmid and pEGFP-132LF-7SC-132RF plasmid; A: double enzyme digestion electrophoresis identification diagram of pEGFP-132LF-7SC7E-132RF plasmid; B: double enzyme digestion electrophoresis identification diagram of pEGFP-132LF-7SC-132RF plasmid;

[0034] Figure 5 Figure 1 is a schematic diagram of homologous recombination of pEGFP-132LF-7SC7E-132RF plasmid and ORFV GDZC strain of OFTu cells carrying ORFV virus;

[0035] Figure 6 Figure 3 is a fluorescence observation result diagram of the recombinant virus rORFVΔ132-PCV3Cap-EGFP; wherein, GFP is a fluorescence field; BF is a white light field; Merge is a superposition of the fluorescence field and the white light field;

[0036] Figure 7 Figure 4 is a PCR identification diagram of the recombinant virus; wherein, A is an ORFV 132 gene identification diagram: M: DL 2000 DNA Marker; 1: 132 gene amplification product of the recombinant virus rORFVΔ132-PCV3Cap-EGFP; 2: 132 gene amplification product of the recombinant orf virus (rORFVΔ132-PCV3Cap); 3: 132 gene amplification product of the ORFV GDZC strain; B is a Cap gene identification diagram: M: DL 2000 DNA Marker; 1: Cap gene amplification product of the recombinant virus rORFVΔ132-PCV3Cap-EGFP; 2: Cap gene amplification product of the recombinant orf virus (rORFVΔ132-PCV3Cap); 3: Cap gene amplification product of the ORFV GDZC strain;

[0037] Figure 8 Figure 5 is a Western blot identification diagram of the recombinant virus rORFVΔ132-PCV3Cap-EGFP and the recombinant orf virus (rORFVΔ132-PCV3Cap). DETAILED DESCRIPTION

[0038] The present application will be further described below in conjunction with the accompanying drawings and specific embodiments, which are used to explain the present application and are not intended to limit the scope of the present application. In the following examples, the test methods used are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0039] Example 1 Construction of recombinant plasmids pEGFP-132LF-7SC7E-132RF and pEGFP-132LF-7SC-132RF

[0040] The schematic diagram of the recombinant plasmids pEGFP-132LF-7SC7E-132RF and pEGFP-132LF-7SC-132RF is shown in Figure 1 the accompanying drawings.

[0041] (1) Extract the whole genome of the Orf virus GDZC strain (ORFV GDZC) and the porcine circovirus type 3 GDHN strain (PCV3 GDHN, SEQ ID NO: 37) using the Aikewei general genome DNA extraction kit (AG21009 / AG21010) to obtain the ORFV GDZC whole genome DNA and the PCV3 GDHN whole genome DNA.

[0042] (2) Design the left and right arm primers of the ORFV 132 gene and the signal peptide primers of the ORFV 127 gene according to the genomic sequence of the ORFV whole genome sequence (No. KF234407) disclosed in GenBank; the nucleotide sequence of the left arm primer of the ORFV 132 gene is shown in SEQ ID NO: 7 and SEQ ID NO: 8, the nucleotide sequence of the right arm primer of the ORFV 132 gene is shown in SEQ ID NO: 9 and SEQ ID NO: 10, and the nucleotide sequence of the signal peptide primer of the ORFV 127 gene is shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0043] According to the PCV3 GDHN whole genome DNA obtained in step (1), confirm the Cap gene sequence, remove its nuclear localization sequence using the NovoPro online tool, and then optimize and synthesize the truncated PCV3 Cap gene (SEQ ID NO: 3) according to the codon bias of OFTu cells; design PCV3 Cap gene primers according to the truncated PCV3 Cap gene, and the nucleotide sequence of the PCV3 Cap gene primers is shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0044] Design EGFP gene-specific primers according to the pEGFP-N1 vector sequence (SEQ ID NO: 4), and the nucleotide sequence of the EGFP gene-specific primers is shown in SEQ ID NO: 15 and SEQ ID NO: 16.

[0045] Synthesize the VV 7.5 promoter (SEQ ID NO: 34) based on the pSPV-EGFP vector sequence (No. GU062789) disclosed in GenBank, and design VV 7.5 promoter primers, and the nucleotide sequence of the VV 7.5 promoter primers is shown in SEQ ID NO: 35 and SEQ ID NO: 36.

[0046] The specific information of the primers is shown in Table 1.

[0047] Table 1 Specific information of primers

[0048] Primer Primer sequence (5'→ 3') 132LF-F (SEQ ID NO: 7) CCATCGAGAACCGCAAGATCTCGGG 132LF-R (SEQ ID NO: 8) TCCTCACCCTTAAAAGTTGGGCGTT 132RF-F (SEQ ID NO: 9) CAGCAGTTTTTGTAGCGGGACGTTT 132RF-R (SEQ ID NO: 10) TACGGTCACTTGTTTTCTCGTCTCT SP-F (SEQ ID NO: 11) ATGTCGAAGAACAAAATTCTGGT SP-R (SEQ ID NO: 12) CGCATCTGTGTATAATGTATAAG Cap-F (SEQ ID NO: 13) ATGCCTACCGCTGGAACCTACTACA Cap-R (SEQ ID NO: 14) TTACGCAGCACGCTCTTGTATCTGA EGFP-F (SEQ ID NO: 15) ATGGTGAGCAAGGGCGAGGAGCTG EGFP-R (SEQ ID NO: 16) TTACTTGTACAGCTCGTCCATGCCG VV 7.5-F (SEQ ID NO: 35) CTGCAGATATACTATATAGTAATAC VV 7.5-R (SEQ ID NO: 36) CGTCACTGTTCTTTATGATTCTACT

[0049] The ORFV GDZC full genome DNA obtained in step (1) was used as a template, and 132LF-F (SEQ ID NO: 7) and 132LF-R (SEQ ID NO: 8) were used as amplification primers to perform PCR amplification to obtain a 132LF fragment; 132RF-F (SEQ ID NO: 9) and 132RF-R (SEQ ID NO: 10) were used as amplification primers to perform PCR amplification to obtain a 132RF fragment; SP-F (SEQ ID NO: 11) and SP-R (SEQ ID NO: 12) were used as amplification primers to perform PCR amplification to obtain a SP fragment (ORFV 127 gene signal peptide fragment, SEQ ID NO: 39).

[0050] The truncated PCV3 Cap gene (SEQ ID NO: 3) was used as a template, and Cap-F (SEQ ID NO: 13) and Cap-R (SEQ ID NO: 14) were used as amplification primers to perform PCR amplification to obtain a truncated PCV3 Cap fragment.

[0051] The pEGFP-N1 vector sequence (SEQ ID NO: 4) was used as a template, and EGFP-F (SEQ ID NO: 15) and EGFP-R (SEQ ID NO: 16) were used as amplification primers to perform PCR amplification to obtain an EGFP fragment (SEQ ID NO: 40).

[0052] The VV 7.5 promoter (SEQ ID NO: 34) was used as a template, and VV 7.5-F (SEQ ID NO: 35) and VV 7.5-R (SEQ ID NO: 36) were used as amplification primers to perform PCR amplification to obtain a VV 7.5 promoter fragment.

[0053] Taking 132LF-F (SEQ ID NO: 7) and 132LF-R (SEQ ID NO: 8) as an example, PCR amplification was performed according to the PCR reaction system shown in Table 2, as follows:

[0054] Table 2 PCR reaction system

[0055]

[0056] PCR reaction program: 98℃, 5min; 98℃, 10s, 56℃, 15s, 72℃, 10s; 35 cycles; 72℃, 10min.

[0057] After the PCR reaction was completed, the PCR product was collected, which was the 132LF fragment, and agarose gel electrophoresis was performed.

[0058] The upper and lower primers shown in Table 2 were replaced with 132RF-F and 132RF-R, SP-F and SP-R, Cap-F and Cap-R, EGFP-F and EGFP-R, and VV 7.5-F and VV 7.5-R, respectively, and the corresponding template DNA was replaced, and PCR amplification was performed to obtain the 132RF fragment, the ORFV 127 gene signal peptide fragment (SP fragment), the EGFP fragment, the truncated PCV3 Cap fragment, and the VV 7.5 promoter fragment; and agarose gel electrophoresis was performed on the above fragments.

[0059] The results of agarose gel electrophoresis are shown in Figure 2 The results show that the size of the 132LF fragment is 984 bp, the size of the 132RF fragment is 1001 bp, the size of the ORFV 127 gene signal peptide fragment (SP fragment) is 66 bp, the size of the EGFP fragment is 720 bp, the size of the truncated PCV3 Cap fragment is 552 bp, and the size of the VV 7.5 promoter fragment is 269 bp. Each fragment was recovered using a DNA gel recovery kit from Bimake Biotech Co., Ltd., and each fragment was cloned into a different pMD18-T vector to obtain pMD18-T-132LF plasmid, pMD18-T-132RF plasmid, pMD18-T-VV 7.5 plasmid, pMD18-T-SP plasmid, pMD18-T-EGFP plasmid, and pMD18-T-Cap plasmid.

[0060] (3) Synthesis of 7E fragment

[0061] The pMD18-T-VV 7.5 plasmid obtained in step (2) was used as a template, and primers VV 7.5-1-F (SEQ ID NO: 17) and VV 7.5-1-R (SEQ ID NO: 18) were used for PCR amplification. The PCR reaction system is shown in Table 3.

[0062] Table 3 PCR reaction system

[0063] Reagents Volume (μL) Apex H F FS PCR Master Mix (2x) 25 VV 7.5-1-F (SEQ ID NO: 17) 2 VV 7.5-1-R (SEQ ID NO: 18) 2 Template (pMD18-T-VV 7.5 plasmid) 1 Sterilized ultra-pure water 20 Total volume 50

[0064] PCR program: 98°C, 5 min; 98°C, 10 s, 56°C, 15 s, 72°C, 5 s; 30 cycles; 72°C, 10 min.

[0065] After the PCR reaction was completed, a DNA gel recovery kit from Bimake Biotech Co., Ltd. was used for recovery to obtain the VV 7.5-1 fragment.

[0066] The primers VV 7.5-1-F (SEQ ID NO: 17) and VV 7.5-1-R (SEQ ID NO: 18) were replaced by EGFP-1-F (SEQ ID NO: 19) and EGFP-1-R (SEQ ID NO: 20), and the template was replaced by the pMD18-T-EGFP plasmid obtained in step (2) to obtain the EGFP-1 fragment by the same reaction.

[0067] The primer information is shown in Table 4.

[0068] Table 4 Primer information

[0069]

[0070] The Overlap PCR reaction was performed using the VV 7.5-1 fragment and the EGFP-1 fragment as templates, and the PCR reaction system is shown in Table 5.

[0071] Table 5 PCR reaction system

[0072] Reagents Volume (μL) Apex H F FS PCR Master Mix (2x) 25 VV 7.5-1-F (SEQ ID NO: 17) 2 EGFP-1-R (SEQ ID NO: 20) 2 VV 7.5-1 fragment 1 EGFP-1 fragment 1 Sterilized ultra-pure water 19 Total volume 50

[0073] PCR program: 98℃, 5min; 98℃, 10s, 56℃, 15s, 72℃, 5s; 35 cycles; 72℃, 10min.

[0074] The PCR product was recovered by using the DNA gel recovery kit of Polygen Biosciences Co., Ltd. to obtain the 7E fragment.

[0075] (4) Synthesis of 7SC-1 fragment and 7SC-2 fragment

[0076] The primers VV 7.5-1-F (SEQ ID NO: 17) and VV 7.5-1-R (SEQ ID NO: 18) in the PCR reaction system shown in Table 3 were replaced by VV 7.5-2-F (SEQ ID NO: 21) and VV 7.5-2-R (SEQ ID NO: 22) to obtain the VV 7.5-2 fragment by PCR reaction.

[0077] The primers VV 7.5-1-F (SEQ ID NO: 17) and VV 7.5-1-R (SEQ ID NO: 18) in the PCR reaction system shown in Table 3 were replaced by SP-1-F (SEQ ID NO: 23) and SP-1-R (SEQ ID NO: 24), and the template was replaced by the pMD18-T-SP plasmid prepared in step (1) to obtain the SP-1 fragment by PCR reaction.

[0078] The PCR reaction system shown in Table 3 was replaced with primers Cap-1-F (SEQ ID NO: 25) and Cap-1-R (SEQ ID NO: 26), and the template was replaced with the pMD18-T-Cap plasmid prepared in step (1) to perform PCR reaction to obtain Cap-1 fragment.

[0079] The PCR reaction system shown in Table 3 was replaced with primers Cap-1-F (SEQ ID NO: 25) and Cap-2-R (SEQ ID NO: 27), and the template was replaced with the pMD18-T-Cap plasmid prepared in step (1) to perform PCR reaction to obtain Cap-2 fragment.

[0080] The nucleotide information of each primer is shown in Table 6.

[0081] Table 6 Nucleotide information of each primer

[0082]

[0083]

[0084] The Overrlap PCR reaction was performed with the VV 7.5-2 fragment and the SP-1 fragment as templates; the PCR reaction system is shown in Table 7.

[0085] Table 7 PCR reaction system

[0086] Reagents Volume (μL) Apex H F FS PCR Master Mix (2x) 25 VV 7.5-2-F (SEQ ID NO: 21) 2 SP-1-R (SEQ ID NO: 24) 2 VV 7.5-2 fragment 1 SP-1 fragment 1 Sterilized ultra-pure water 19 Total volume 50

[0087] PCR program: 98℃, 5min; 98℃, 10s, 56℃, 15s, 72℃, 5s; 35 cycles; 72℃, 10min.

[0088] The PCR product was recovered by using the DNA gel recovery kit of Polygen Biosciences Co., Ltd. to obtain the 7S fragment.

[0089] The Overlap PCR reaction was performed with the Cap-1 fragment and the 7S fragment as templates; the reaction system is shown in Table 8.

[0090] Table 8 PCR reaction system

[0091] Reagents Volume (μL) Apex H F FS PCR Master Mix (2x) 25 VV 7.5-2-F (SEQ ID NO: 21) 2 Cap-1-R (SEQ ID NO: 26) 2 7S fragment 1 Cap-1 fragment 1 Sterilized ultra-pure water 19 Total volume 50

[0092] PCR procedure: 98℃, 5 min; 98℃, 10 s, 56℃, 15 s, 72℃, 5 s; 35 cycles; 72℃, 10 min.

[0093] The PCR product was recovered by using a DNA gel recovery kit from Promega Biotech Co., Ltd. to obtain the 7SC-1 fragment.

[0094] The PCR reaction was performed by replacing the VV 7.5-2-F (SEQ ID NO: 21) in the reaction system shown in Table 8 with VV 7.5-1-F (SEQ ID NO: 17), replacing Cap-1-R (SEQ ID NO: 26) with Cap-2-R (SEQ ID NO: 27), and replacing the Cap-1 fragment with the Cap-2 fragment to obtain the 7SC-2 fragment.

[0095] (5) Synthesis of 132LF-1 fragment and 132RF-1 fragment

[0096] The PCR amplification was performed by using the primer 132LF-1-F (SEQ ID NO: 28) and 132LF-1-R (SEQ ID NO: 29) and taking the pMD18-T-132LF plasmid obtained in step (1) as the template, and the PCR reaction system is shown in Table 9.

[0097] Table 9 PCR reaction system

[0098] Reagents Volume (μL) Apex HF FS PCR Master Mix (2x) 25 132LF-1-F (SEQ ID NO: 28) 2 132LF-1-R (SEQ ID NO: 29) 2 Template (pMD18-T-132LF plasmid) 1 Sterilized ultra-pure water 20 Total volume 50

[0099] PCR procedure: 98℃, 5 min; 98℃, 10 s, 56℃, 15 s, 72℃, 5 s; 30 cycles; 72℃, 10 min.

[0100] After the PCR reaction, the DNA gel recovery kit from Promega Biotech Co., Ltd. was used for recovery to obtain the 132LF-1 fragment.

[0101] The PCR reaction was performed by replacing the primers 132LF-1-F (SEQ ID NO: 28) and 132LF-1-R (SEQ ID NO: 29) in the reaction system shown in Table 9 with 132RF-1-F (SEQ ID NO: 30) and 132RF-1-R (SEQ ID NO: 31), and replacing the template with the pMD18-T-132RF plasmid prepared in step (1) to obtain the 132RF-1 fragment.

[0102] The nucleotide information of each primer is shown in Table 10.

[0103] Table 10 Nucleotide information of each primer

[0104]

[0105]

[0106] (6) Construction of recombinant plasmid pEGFP-132LF-7SC7E-132RF

[0107] The 7E fragment obtained in step (3) and the pEGFP-Nl vector were subjected to double enzyme digestion with EcoR I and Kpn I respectively, and the enzyme digestion products were recovered by using the DNA gel recovery kit of Bioasia Biotech Co., Ltd. to obtain the enzyme-digested 7E fragment and the linearized pEGFP-Nl vector. The enzyme digestion reaction system of the 7E fragment is shown in Table 11, and the enzyme digestion reaction system of the pEGFP-Nl vector is shown in Table 12.

[0108] Table 11 Enzyme digestion reaction system of 7E fragment

[0109] Reagent Volume (μL) EcoR I enzyme 1 Kpn I enzyme 1 10x M Buffer 2 7E fragment 10 Sterilized ultra-pure water 6 Total volume 20

[0110] Table 12 Enzyme digestion reaction system of pEGFP-Nl vector

[0111] Reagent Volume (μL) EcoR I enzyme 1 Kpn I enzyme 1 10x M Buffer 2 pEGFP-N1 vector 3 Sterilized ultra-pure water 13 Total volume 20

[0112] The enzyme digestion conditions were 37°C for 3h.

[0113] The enzyme-digested 7E fragment and the linearized pEGFP-Nl vector were subjected to ligation with DNA ligase, and the ligation reaction conditions were 16°C for 3h. The ligation reaction system is shown in Table 13.

[0114] Table 13 Ligation reaction system

[0115] Reagent Volume (μL) 7E fragment after enzyme digestion 3 Linearized pEGFP-N1 vector 2 DNA ligase 5 Total volume 10

[0116] After the ligation reaction, the ligation product was obtained, which was transformed into DH5a competent cells, and the cells were cultured in LB solid medium containing kanamycin for 14h. Positive clones were selected and inoculated in LB liquid medium containing kanamycin, and the culture was incubated at 37°C and 180r / min for 12-14h. Then, the plasmid was extracted and subjected to double enzyme digestion with EcoR I and Kpn I for identification. The identification results are shown in Table A. The plasmid was sent to Bioasia Biotech Co., Ltd. for sequencing, and the recombinant plasmid with correct sequencing (containing the 7E fragment) was pEGFP-7E plasmid. Figure 3

[0117] ​The pEGFP-7E plasmid and the 132LF-1 fragment obtained in step (5) were double-enzyme cut by Hind III and EcoR I respectively, and the enzyme cut products were recovered by the DNA gel recovery kit of Polygen Bio-technology Co. Ltd. to obtain the enzyme cut 132LF-1 fragment and the linearized pEGFP-7E plasmid. The enzyme cut reaction system of the 132LF-1 fragment is shown in Table 14, and the enzyme cut reaction system of the pEGFP-7E plasmid is shown in Table 15.

[0118] Table 14 Enzyme cut reaction system of 132LF-1 fragment

[0119] Reagent Volume (μL) Hind III enzyme 1 EcoR I enzyme 1 10x M Buffer 2 132LF-1 fragment 10 Sterilized ultra-pure water 6 Total volume 20

[0120] Table 15 Enzyme cut reaction system of pEGFP-7E plasmid

[0121] Reagent Volume (μL) Hind III enzyme 1 EcoR I enzyme 1 10x M Buffer 2 pEGFP-7E plasmid 3 Sterilized ultra-pure water 13 Total volume 20

[0122] The enzyme cut condition was 37℃ for 3h.

[0123] The enzyme cut 132LF-1 fragment and the linearized pEGFP-7E plasmid were connected by DNA ligase, and the connection reaction condition was 16℃ for 3h. The connection reaction system is shown in Table 16.

[0124] Table 16 Connection reaction system

[0125] Reagent Volume (μL) 132LF-1 fragment after enzyme digestion 3 Linearized pEGFP-7E vector 2 DNA ligase 5 Total volume 10

[0126] After the connection reaction, the connection product 1 was obtained, and the connection product 1 was transformed into the DH5α competent cell. The positive colonies were selected and inoculated in the LB liquid culture medium containing kanamycin, and cultured at 37℃ for 12-14h at 180r / min. Then the plasmid was extracted, and double-enzyme cut identification was carried out by Hind III and Kpn I. The identification result is shown in Table B. The plasmid was sent to Genesee Bio-technology Co. Ltd. for sequencing, and the recombinant plasmid with correct sequencing (containing 132LF-1 fragment) was pEGFP-132LF-7E plasmid. Figure 3 B.

[0127] The 132RF-1 fragment obtained in step (5) and the pEGFP-132LF-7E plasmid were double-enzyme cut by Kpn I and BamH I respectively, and the enzyme cut products were recovered by the DNA gel recovery kit of Polygen Bio-technology Co. Ltd. to obtain the enzyme cut 132RF-1 fragment and the linearized pEGFP-132LF-7E plasmid. The enzyme cut reaction system of the 132RF-1 fragment is shown in Table 17, and the enzyme cut reaction system of the pEGFP-132LF-7E plasmid is shown in Table 18.

[0128] Table 17 132RF-1 fragment enzyme digestion reaction system

[0129] Reagent Volume (μL) BamH I enzyme 1 Kpn I enzyme 1 10x M Buffer 1 132RF-1 fragment 10 Sterilized ultra-pure water 7 Total volume 20

[0130] Table 18 pEGFP-132LF-7E plasmid enzyme digestion reaction system

[0131] Reagent Volume (μL) BamH I enzyme 1 Kpn I enzyme 1 10x M Buffer 1 pEGFP-132LF-7E vector 3 Sterilized ultra-pure water 14 Total volume 20

[0132] The enzyme digestion conditions are: 37°C for 3h.

[0133] The enzyme-digested 132RF-1 fragment and the linearized pEGFP-132LF-7E plasmid are connected by DNA ligase, and the connection reaction conditions are: 16°C for 3h. The connection reaction system is shown in Table 19.

[0134] Table 19 Connection reaction system

[0135] Reagent Volume (μL) 132RF-1 fragment after enzyme digestion 3 Linearized pEGFP-132LF-7E vector 2 DNA ligase 5 Total volume 10

[0136] After the connection reaction, the connection product 2 is obtained, which is transformed into DH5α competent cells, and cultured in LB solid medium containing kanamycin for 14h. Positive colonies are selected and inoculated in LB liquid medium containing kanamycin, and cultured at 37°C, 180r / min for 12-14h. The plasmid is extracted, and double enzyme digestion is performed by using Hind III enzyme and BamH I enzyme. The identification results are shown in Table 20. Figure 3 C. The plasmid is sent to Genescript Biotech Co., Ltd. for sequencing, and the recombinant plasmid with 132RF-1 fragment is pEGFP-132LF-7E-132RF plasmid.

[0137] The pEGFP-132LF-7E-132RF plasmid is single enzyme-digested by using EcoR I enzyme, and the enzyme-digested product is recovered by using the DNA gel recovery kit of Polygen Biotech Co., Ltd. to obtain the linearized pEGFP-132LF-7E-132RF plasmid. The enzyme digestion conditions are: 37°C for 3h. The enzyme digestion reaction system is shown in Table 20.

[0138] Table 20 Enzyme digestion reaction system

[0139] Reagent Volume (μL) EcoR I enzyme 1 10x H Buffer 2 pEGFP-132LF-7E-132RF plasmid 3 Sterilized ultra-pure water 14 Total volume 20

[0140] The linearized pEGFP-132LF-7E-132RF plasmid and the 7SC-1 fragment obtained in step (4) are used for seamless cloning by using the OK clon DNA ligation kit of Aikewei Biotech Co., Ltd. The reaction conditions are: 50°C for 15min. The reaction system is shown in Table 21.

[0141] Table 21 Reaction system

[0142] Reagent Volume (μL) OK clon Master Mix (5x) 2 Linearized pEGFP-132LF-7E-132RF plasmid 3 7SC-1 fragment 1 Sterilized ultra-pure water 4 Total volume 10

[0143] After the reaction, the ligation product 3 was obtained, and the ligation product 3 was transformed into DH5a competent cells. The cells were cultured in LB solid medium containing kanamycin for 14 h, and positive colonies were selected and inoculated in LB liquid medium containing kanamycin. After being cultured at 37°C and 180 r / min for 12-14 h, plasmids were extracted and identified by double enzyme digestion with EcoR I and Kpn I. The identification results are shown in FIG. 2A. Figure 4 The plasmid was sent to Genescript Biotechnology Co., Ltd. for sequencing, and the recombinant plasmid pEGFP-132LF-7SC-132RF (SEQ ID NO: 1) containing the 7SC-1 fragment was obtained after sequencing.

[0144] (7) Construction of recombinant plasmid pEGFP-132LF-7SC-132RF

[0145] The pEGFP-132LF-7SC-132RF plasmid and the 7SC-2 fragment obtained in step (4) were subjected to double enzyme digestion with EcoR I and Kpn I, respectively. The enzyme digestion products were recovered by using the DNA gel recovery kit of Genescript Biotechnology Co., Ltd. to obtain the linearized pEGFP-132LF-7SC-132RF plasmid and the enzyme-digested 7SC-2 fragment. The enzyme digestion reaction system of the pEGFP-132LF-7SC-132RF plasmid is shown in Table 22, and the enzyme digestion reaction system of the 7SC-2 fragment is shown in Table 23.

[0146] Table 22 Enzyme digestion reaction system of pEGFP-132LF-7SC-132RF plasmid

[0147] Reagent Volume (μL) EcoR I enzyme 1 Kpn I enzyme 1 10x M Buffer 1 pEGFP-132LF-7SC7E-132RF plasmid 3 Sterilized ultra-pure water 14 Total volume 20

[0148] Table 23 Enzyme digestion reaction system of 7SC-2 fragment

[0149] Reagent Volume (μL) EcoR I enzyme 1 Kpn I enzyme 1 10x M Buffer 1 7SC-2 fragment 10 Sterilized ultra-pure water 7 Total volume 20

[0150] The enzyme digestion conditions were as follows: enzyme digestion at 37°C for 3 h.

[0151] The enzyme-digested 7SC-2 fragment and the linearized pEGFP-132LF-7SC-132RF plasmid were subjected to ligation with DNA ligase. The ligation reaction conditions were as follows: ligation at 16°C for 3 h. The ligation reaction system is shown in Table 24.

[0152] Table 24 Ligation reaction system

[0153] Reagent Volume (μL) 7SC-2 fragment after enzyme digestion 3 Linearized pEGFP-132LF-7SC7E-132RF plasmid 2 DNA ligase 5 Total volume 10

[0154] After the ligation reaction, the ligation product 4 was obtained, and the ligation product 4 was transformed into DH5a competent cells, which were cultured in LB solid medium containing kanamycin for 14 h, and positive colonies were selected and inoculated in LB liquid medium containing kanamycin, and cultured at 37°C, 180 r / min for 12-14 h, and then the plasmid was extracted and identified by double enzyme digestion with Hind III and BamH I enzymes, and the identification results are shown in Figure 4 B. The plasmid was sent to Genescript Biotech Co., Ltd. for sequencing, and the recombinant plasmid with correct sequencing was pEGFP-132LF-7SC-132RF plasmid (SEQ ID NO: 2).

[0155] Construction and screening of recombinant orfivirus in example 2

[0156] In the construction process of the recombinant orfivirus, the 132 gene (NO: AAR98227) of the orfivirus was replaced by the gene sequence 1 with the nucleotide sequence of SEQ ID NO: 5 to obtain the recombinant virus 1, and the gene sequence 1 with the nucleotide sequence of SEQ ID NO: 5 in the recombinant virus 1 was replaced by the gene sequence 2 with the nucleotide sequence of SEQ ID NO: 6 to obtain the recombinant orfivirus.

[0157] The gene sequence 1 (SEQ ID NO: 5) is located in the sequence of the pEGFP-132LF-7SC7E-132RF plasmid; and the gene sequence 2 (SEQ ID NO: 6) is located in the sequence of the pEGFP-132LF-7SC-132RF plasmid.

[0158] 1. Construction of recombinant virus rORFVΔ132-PCV3Cap-EGFP

[0159] S1. OFTu cells were infected with ORFV GDZC virus strain at MOI = 0.2, and the OFTu cells were incubated with the ORFV GDZC virus strain for 2 h to obtain OFTu cells carrying the ORFV virus, and the pEGFP-132LF-7SC7E-132RF plasmid prepared in example 1 was transfected into the OFTu cells carrying the ORFV virus according to the instructions for using Lipofectamine 2000 transfection reagent; wherein the homologous recombination diagram of the pEGFP-132LF-7SC7E-132RF plasmid and the ORFV GDZC virus strain of the OFTu cells carrying the ORFV virus is shown in Figure 5 .

[0160] When the cells appeared 80% lesions, the cells were collected and repeatedly frozen and thawed 3 times, and the supernatant was collected.

[0161] S2. Take 100 μL of the supernatant collected in step S1, dilute the supernatant with MEM, and take 100 μL of each dilution to add to a 96-well plate. Repeat 8 wells for each dilution. After 24 h, observe the fluorescence, collect the cells and cell liquid in the wells that emit fluorescence at each dilution, freeze-thaw 3 times, and collect the supernatant 1. -1 ~10 -11 dilutions, and add 2 mL of 1% (w / w) low-melting agarose to the 6-well plate. After 48 h, observe the fluorescence and pick single fluorescent virus plaques. (Consider this to be one round of fluorescent plaque screening) -1 ~10 -4 dilutions, and add 2 mL of 1% (w / w) low-melting agarose to the 6-well plate. After 48 h, observe the fluorescence and pick single fluorescent virus plaques. (Consider this to be one round of fluorescent plaque screening)

[0162] Dilute the collected supernatant 1 three times according to the method described in step S2, and freeze-thaw the selected cells to collect supernatant 2 (virus liquid).

[0163] S3. Dilute the collected supernatant 2 (virus liquid) in step S2 10 -1 ~10 -5 dilutions, and add 2 mL of 1% (w / w) low-melting agarose to the 6-well plate. After 48 h, observe the fluorescence and pick single fluorescent virus plaques. (Consider this to be one round of fluorescent plaque screening) Figure 6

[0164] Use a Pasteur pipette to pick single fluorescent virus plaques under an inverted fluorescence microscope, inoculate them into a new 6-well plate, and add 2 mL of 1% (w / w) low-melting agarose to the 6-well plate. After 48 h, observe the fluorescence and pick single fluorescent virus plaques. (Consider this to be one round of fluorescent plaque screening)

[0165] After 3 rounds of fluorescent plaque screening, expand the culture, collect the virus, and obtain the recombinant virus rORFVΔ132-PCV3Cap-EGFP.

[0166] 2. Construction of recombinant orfivirus

[0167] Infect OFTu cells with the recombinant virus rORFVΔ132-PCV3Cap-EGFP obtained in step 1 (MOI = 0.2), incubate the OFTu cells with rORFVΔ132-PCV3Cap-EGFP for 2 h to obtain virus-carrying OFTu cells, and transfect the virus-carrying OFTu cells with the pEGFP-132LF-7SC-132RF plasmid prepared in Example 1 according to the instructions for using Lipofectamine 2000 transfection reagent.

[0168] When the cells show 80% lesions, collect the cells, freeze-thaw 3 times, and collect the supernatant 3.

[0169] S2. Take 100 μL of the supernatant collected in step S1, dilute the supernatant with MEM, and take 100 μL of each dilution to add to a 96-well plate. Repeat 8 wells for each dilution. After 24 h, observe the fluorescence, collect the cells and cell liquid in the wells that emit fluorescence at each dilution, freeze-thaw 3 times, and collect the supernatant 1. -1 ~10​-11 Dilution, 100 μL of each dilution was added to a 96-well plate, and 8 wells were repeated for each dilution. After 24 h, fluorescence was observed, and 10 μL of the supernatant of the wells with fluorescent cells was collected. -1 ~10 -4 Dilution, 100 μL of each dilution was added to a 96-well plate, and 8 wells were repeated for each dilution. After 24 h, fluorescence was observed, and 10 μL of the supernatant of the wells with fluorescent cells was collected.

[0170] The collected supernatant 4 was diluted 3 times according to the method described in step S2, and the selected cells were frozen and thawed, and the supernatant 5 (virus liquid) was collected.

[0171] S3. The virus liquid collected in step S2 was diluted 10 -1 ~10 -5 Dilution, 100 μL of each dilution was added to a 96-well plate, and 8 wells were repeated for each dilution. After 24 h, fluorescence was observed, and 10 μL of the supernatant of the wells with fluorescent cells was collected.

[0172] After 3 rounds of plaque screening, the virus was expanded and collected, which was the recombinant orf virus (rORFVΔ132-PCV3Cap).

[0173] Example 3 Identification of recombinant orf virus

[0174] 1. Experimental method

[0175] (1) PCR identification

[0176] The DNA of the recombinant orf virus (rORFVΔ132-PCV3Cap) obtained in Example 2 was extracted, and the DNA of the recombinant orf virus was obtained, which was used as a template, and primers Cap-F (SEQ ID NO: 13) and Cap-R (SEQ ID NO: 14) were used for PCR amplification to detect the Cap gene; the reaction system is shown in Table 25.

[0177] Table 25 Reaction system

[0178]

[0179]

[0180] PCR reaction program: 98℃, 5min; 98℃, 10s, 56℃, 15s, 72℃, 5s; 35 cycles; 72℃, 10min.

[0181] After the PCR reaction, the product was collected and electrophoresis was performed, and the electrophoresis results were observed.

[0182] Cap-F (SEQ ID NO: 13) and Cap-R (SEQ ID NO: 14) in the reaction system shown in Table 25 were replaced by 132-F (SEQ ID NO: 32) and 132-R (SEQ ID NO: 33), PCR amplification was performed, and the PCR amplification product was electrophoresed to detect the 132 gene of the recombinant orf virus.

[0183] Specifically, the primer nucleotide sequence information is shown in Table 26.

[0184] Table 26 Primer nucleotide sequence

[0185] Primer Primer sequence (5'→3') Cap-F (SEQ ID NO: 13) ATGCCTACCGCTGGAACCTACTACA Cap-R (SEQ ID NO: 14) TTACGCAGCACGCTCTTGTATCTGA 132-L (SEQ ID NO: 32) AGGGTGAGGAGCCATGAAGTTGC 132-R (SEQ ID NO: 33) GGCGCCGTCTAGGTGGCGTCGGT

[0186] The control group was set to detect the Cap gene and the 132 gene of the DNA of the ORFV GDZC virus strain.

[0187] And the Cap gene and the 132 gene of the DNA of the recombinant virus rORFVΔ132-PCV3Cap-EGFP obtained in Example 2 were detected synchronously.

[0188] (2) Protein expression identification

[0189] Taking the recombinant orf virus (rORFVΔ132-PCV3Cap) obtained in Example 3 as an example, the recombinant orf virus was inoculated into OFTu cells, and after 48 h of culture, the cells were washed twice with phosphate buffered saline solution to obtain washed cells.

[0190] Based on the RIPA instructions, the pmsf and RIPA lysis solution were mixed to obtain a mixed solution, 150 μL of the mixed solution and the washed cells were mixed uniformly, the cells were blown for 3 min with a gun head, and after standing for 5 min, the cells were blown repeatedly for 3 times, then transferred to a 1.5 mL EP tube, centrifuged at 4°C, 12000 rpm for 10 min, the supernatant was collected and transferred to a new EP tube, 5×SDS-PAGE Loading Buffer buffer was added, and boiled in water bath for 6 min to obtain the treated protein sample.

[0191] The treated protein sample was subjected to polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins separated after electrophoresis were cut into gel blocks of corresponding sizes (containing polyacrylamide gel), to obtain PCV3Cap protein, EGFP protein and β-actin protein, and the three proteins were detected respectively; taking the PCV3Cap protein as an example:

[0192] The transfer membrane plate is composed of three layers of filter paper, polyacrylamide gel containing PCV3 Cap, PVDF membrane and three layers of filter paper in turn, wherein the protein gel is close to the negative electrode, and the transfer is carried out at a current of 150 mA for 1 h.

[0193] After the transfer membrane is taken out, the PVDF membrane is placed in the prepared 5% (w / w) skim milk, and is sealed at 50 rpm and 50°C for 2 h on a shaker. Then, the PVDF membrane is washed with TBST washing buffer for 3 times, each time for 5 min, and then 10 mL of rabbit anti-PCV3 Cap protein polyclonal antibody is added according to the ratio of polyclonal antibody: 5% (w / w) skim milk = 1:10000, and is incubated at 4°C for 16 h.

[0194] The rabbit anti-PCV3 Cap protein polyclonal antibody is obtained by connecting the Cap protein sequence in the PCV3 Cap protein polyclonal antibody with the nucleotide sequence as shown in SEQ ID NO: 38 to the pET-32a(+) vector for prokaryotic expression, and inoculating the inactivated protein into a New Zealand white rabbit to obtain the antibody.

[0195] After the incubation is completed, the PVDF membrane is washed with TBST washing buffer for 3 times, each time for 5 min, and then 10 mL of HRP-labeled goat anti-rabbit IgG (H+L) is added and incubated at room temperature for 2 h.

[0196] Then, the PVDF membrane is washed with TBS washing solution for 3 times, each time for 5 min, and the luminescent solution is prepared according to the ECL instruction, the PVDF membrane is placed in a chemiluminescence analyzer, 1 mL of ECL chemiluminescence developing solution is added for development, and the results are observed.

[0197] The difference between the detection of the EGFP protein and the detection of the PCV3 Cap protein is that 10 mL of rabbit anti-PCV3 Cap protein polyclonal antibody is replaced by 10 mL of rabbit anti-EGFP polyclonal antibody, and the remaining steps are the same.

[0198] The difference between the detection of the β-actin protein and the detection of the PCV3 Cap protein is that 10 mL of rabbit anti-PCV3 Cap protein polyclonal antibody is replaced by 10 mL of mouse anti-β-actin protein polyclonal antibody, and 10 mL of HRP-labeled goat anti-rabbit IgG (H+L) is replaced by HRP-labeled goat anti-mouse IgG (H+L), and the remaining steps are the same.

[0199] 2. Experimental results

[0200] The detection results of the 132 gene in the recombinant orf virus are shown in Figure 7 A, and the detection results of the Cap gene are shown in Figure 7B. The results show that the 132 gene cannot be detected in the recombinant virus rORFVΔ132-PCV3Cap-EGFP and the recombinant orf virus (rORFVΔ132-PCV3Cap), indicating that the 132 gene in the ORFV virus is successfully replaced; the Cap gene can be detected in the recombinant virus rORFVΔ132-PCV3Cap-EGFP and the recombinant orf virus (rORFVΔ132-PCV3Cap), indicating that the Cap gene is successfully transferred into the ORFV virus.

[0201] The protein expression identification results are shown in Figure 8 The results show that the recombinant virus rORFVΔ132-PCV3Cap-EGFP and the recombinant orf virus (rORFVΔ132-PCV3Cap) can express Cap protein; and the recombinant virus rORFVΔ132-PCV3Cap-EGFP can normally express EGFP protein in addition to Cap protein.

[0202] Example 4 Preparation of a porcine circovirus type 3 vaccine

[0203] The recombinant orf virus (rORFVΔ132-PCV3Cap) obtained in Example 2 is inoculated into OFTu cells at a dose of MOI = 1, and the recombinant orf virus (rORFVΔ132-PCV3Cap) supernatant is harvested after 48 h, and the recombinant orf virus (rORFVΔ132-PCV3Cap) supernatant is concentrated to a TCID 50 = 10 7 , and vacuum freeze-drying to obtain a recombinant orf virus (rORFVΔ132-PCV3Cap) vaccine, i.e., a porcine circovirus type 3 vaccine.

[0204] Comparative Example 1 Transfection of cells with recombinant plasmid pEGFP-132LF-7SC-132RF

[0205] 1. Experimental method

[0206] OFTu cells are infected with ORFV GDZC virus strain at MOI = 0.2, and the OFTu cells are incubated with the ORFV GDZC virus strain for 2 h to obtain OFTu cells carrying the ORFV virus. The pEGFP-132LF-7SC-132RF plasmid prepared in Example 1 is transfected into the OFTu cells carrying the ORFV virus according to the instructions for using Lipofectamine 2000 transfection reagent. When the cells show 80% lesions, the cells are collected and repeatedly frozen and thawed 3 times, and the supernatant is collected.

[0207] The collected supernatant was subjected to the method shown in steps S2 and S3 of step 2 of Example 2 to obtain a virus solution.

[0208] The virus solution was subjected to the method shown in PCR identification of step (1) of Example 3 for identification.

[0209] 2. Experimental results

[0210] PCR identification results showed that the PCV3 Cap gene was not detected in the virus solution, and the Cap protein could not be expressed.

[0211] Comparative Example 2: Transfection of cells with recombinant plasmid pEGFP-132LF-7SCE-132RF

[0212] 1. Experimental method

[0213] The pEGFP-132LF-7SC-132RF plasmid prepared in Example 1 was inserted with an EGFP gene after the Cap protein by seamless cloning technology to obtain a recombinant plasmid pEGFP-132LF-7SCE-132RF.

[0214] The ORFV GDZC strain virus was inoculated into cells at an MOI of 0.2 for 2 h, and then the cells were transfected with the recombinant plasmid pEGFP-132LF-7SCE-132RF expressing the fusion of the PCV3 GDHN strain Cap gene and the EGFP gene, and were further cultured at 37°C in a 5% CO2 incubator until 80% of the cells showed cytopathic effect. The cells were subjected to repeated freezing and thawing for 3 times, the cell debris was removed, and the supernatant was collected. The collected supernatant was subjected to limiting dilution, and a plaque assay was performed according to the fluorescence. After verification using specific primers, the inactivated virus was obtained. Then, the cell protein was collected, and Western blot was performed to determine the expression of the protein.

[0215] 2. Experimental results

[0216] It was found that the inactivated virus could be obtained by fluorescence screening, but no band appeared in the Western blot test, and the expression of the PCV3 Cap protein was not detected.

[0217] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not intended to limit the scope of protection of the present application. For those skilled in the art, based on the above description and ideas, other different forms of changes or modifications can also be made, and here it is not necessary or impossible to exhaust all the embodiments. Any modification, equivalent replacement and improvement made within the spirit and principles of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A recombinant orfivirus expressing porcine circovirus type 3 Cap protein, characterized in that, The recombinant orf virus is obtained by replacing the 132 gene of the orf virus with the nucleotide sequence of the gene sequence 1 of SEQ ID NO: 5 to obtain a recombinant virus 1, and then replacing the nucleotide sequence of the gene sequence 1 of SEQ ID NO: 5 in the recombinant virus 1 with the nucleotide sequence of the gene sequence 2 of SEQ ID NO: 6; and the orf virus is the orf virus GDZC strain.

2. The recombinant capripoxvirus according to claim 1, characterized in that, The recombinant orf virus is obtained by homologous recombination of the orf virus and the recombinant plasmid 1 in a host cell to obtain a recombinant virus 1, and then homologous recombination of the recombinant virus 1 and the recombinant plasmid 2 to obtain the recombinant orf virus. The nucleotide sequence of the recombinant plasmid 1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the recombinant plasmid 2 is shown in SEQ ID NO:

2.

3. The recombinant capripoxvirus according to claim 2, characterized in that, The host cell is an orf embryo nasal bone cell.

4. A method of producing a recombinant orf virus expressing porcine circovirus type 3 Cap protein, characterized by, The method comprises the following steps: S1. Infecting a host cell with an orf virus to obtain an infected cell 1, transfecting the recombinant plasmid 1 with the nucleotide sequence shown in SEQ ID NO: 1 into the infected cell 1, and performing homologous recombination to obtain a recombinant virus 1; S2. Infecting a host cell with the recombinant virus 1 obtained in step S1 to obtain an infected cell 2, transfecting the recombinant plasmid 2 with the nucleotide sequence shown in SEQ ID NO: 2 into the infected cell 2, and performing homologous recombination to obtain a virus, i.e. a recombinant orf virus.

5. The preparation method according to claim 4, characterized in that, The MOI value of the orf virus in step S1 is 0.1-1.

6. The preparation method according to claim 4, characterized in that, The MOI value of the recombinant virus 1 in step S2 is 0.1-1.

7. The preparation method according to claim 4, characterized in that, The host cell in steps S1 and S2 is an orf embryo nasal bone cell.

8. The recombinant orf virus obtained by the preparation method of any one of claims 4-7.

9. The recombinant orf virus of any one of claims 1-3 or the recombinant orf virus of claim 8 as a viral vector for preparing a porcine circovirus type 3 vaccine.

10. A porcine circovirus type 3 vaccine, characterized in that, The virus strain expressing an antigen in the porcine circovirus type 3 vaccine is the recombinant orf virus of any one of claims 1-3 or the recombinant orf virus of claim 8.

Images