Use of NRT2.1 gene in improving drought and / or high temperature resistance of crops
By overexpressing the OsNRT2.1 gene in rice, the problems of low crop yield and nitrogen use efficiency under drought and high temperature conditions were solved, and biomass and yield were improved under abiotic stress, which has significant potential for agricultural breeding applications.
Patent Information
- Application Number
- CN202211696643.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2042-12-28
AI Technical Summary
Existing technologies are insufficient to effectively improve crop yield, biomass, and nitrogen use efficiency under abiotic stresses such as drought and high temperatures, especially since research on rice NRT genes in this area has not been systematic and in-depth.
By cloning and overexpressing the rice OsNRT2.1 gene, and using transgenic technology to overexpress the NRT2.1 protein in rice, a recombinant expression vector was constructed and introduced into recipient rice materials to cultivate transgenic plants that are resistant to drought and high temperatures.
It significantly improved the biomass, yield, and nitrogen use efficiency of rice under drought and high temperature stress, providing potential application value in agricultural breeding.
Smart Images

Figure CN116121293B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to the application of NRT2.1 gene in improving the drought and / or high temperature resistance of crops. BACKGROUND
[0002] Rice is one of the main food crops in China, and rice production consumes a large amount of water resources. With the change of global climate, the shortage and uneven distribution of rainwater seriously affect the stable yield of rice. With the popularization of human industrialization process, carbon emissions continue to increase, and the continuous emission of greenhouse gases such as CO2 and methane accelerates the trend of global warming, and the high-temperature weather has an increasing trend every year. High temperature leads to the inactivation of plant chlorophyll and reduces the photosynthesis rate. High temperature during the day will inhibit plant photosynthesis and reduce the synthesis and accumulation of sugar; high temperature at night will accelerate plant respiration and consume more nutrients of plants, thereby reducing the yield and biomass of crops. High-temperature weather leads to drought, which causes great loss to crop growth and food safety.
[0003] Nitrogen is the most demanded nutrient element for plants and is one of the most important factors for promoting crop yield. However, in recent years, the application of a large amount of nitrogen fertilizer has led to soil acidification and water eutrophication. At the same time, the growing population has put forward more severe challenges to food production. Therefore, improving the nitrogen use efficiency of crops, especially the nitrogen use efficiency under drought and high temperature conditions, is an important measure to realize the stable yield of crops and the sustainable development of agriculture.
[0004] Scientists have been looking for genes responding to drought and high temperature in various crops, but these genes usually have no significant effect under natural conditions. In addition, some scientists have been looking for genes that can improve the nitrogen use efficiency of crops, such as the gene NRT1.1B encoding nitrate transporter and AMT1 encoding ammonium transporter in rice. The overexpression of these genes can improve the yield of crops and show high application value in agricultural production. However, previous studies have shown that drought can reduce the nitrogen use efficiency of plants (Robredo, A. et al. Elevated CO2 reduces the drought effect on nitrogen metabolism in barley plants during drought and subsequent recovery. Environ Exp Bot 71, 399-408 (2011)). How to improve the yield per plant, biomass and nitrogen use efficiency under abiotic stress such as high temperature and drought has not been reported so far.
[0005] Nitrate is the main form of nitrogen nutrient absorbed by plants from the soil, and nitrate transporter NRT2.1 is the executor and main limiting factor of the process. In addition, NRT proteins also play a key role in the transport of nitrate from the roots to the aboveground parts, indicating that the function of NRT proteins is directly related to the morphological development, dry matter accumulation and yield formation of crops.
[0006] NRT proteins from different species have significant differences in their ability to help plants absorb nitrate. In field trials, increasing the expression of OsNRT2.3b can increase grain yield and nitrogen use efficiency by 40%. This shows that nitrate transporters are key proteins for improving nitrogen use efficiency of crops using genetic improvement technology (XIAO R F, ZHONG T, YAWEN T, et al.. Overexpression of a pH-sensitive nitrate transporter in rice increases crop yields [J]. Proc. Natl. Acad. Sci. USA, 2016, 113 (26): 7118-7123.). Another study used a nitrate-inducible promoter to induce the expression of OsNRT2.1, which can increase the biomass of rice by 21% (J. Chen, Y. Zhang, Y. Tan, M. Zhang, L. Zhu, G. Xu, X. Fan, Agronomic nitrogen-use efficiency of rice can be increased by driving OsNRT2.1 expression with the OsNAR2.1 promoter. Plant Biotechnol. J. 14, 1705-1715 (2016)), indicating that the NRT gene encoding nitrate transporter may play an important role in crop genetic breeding.
[0007] Although there is extensive research on NRT genes in nitrogen absorption, whether rice NRT2.1 can improve the ability of crops to resist abiotic stress, especially drought and high temperature, or whether it can improve nitrogen use efficiency under drought or high temperature conditions, has not been systematically studied. Therefore, it is of great significance to further study the function of NRT2.1 gene in single plant yield, biomass and nitrogen use efficiency of rice under drought and high temperature conditions. SUMMARY
[0008] The application aims to provide a gene capable of regulating growth and development of crops under drought or high temperature stress conditions, and to improve biomass and yield of crops under drought or high temperature stress conditions through genetic engineering, so as to realize the purposes of stable yield and yield increase.
[0009] To achieve the above-mentioned purposes, the application adopts the following technical solutions.
[0010] The application clones and analyzes the rice OsNRT2.1 gene, and overexpresses the rice OsNRT2.1 gene by using a transgenic overexpression technology. Research shows that the OsNRT2.1 overexpression rice strain exhibits improved yield per plant, biomass and nitrogen use efficiency under natural growth conditions, and exhibits higher biomass and yield per plant under abiotic stress such as drought and high temperature stress conditions, which indicates that the overexpression of the OsNRT2.1 gene has certain application value in improving the biomass and yield of rice under abiotic stress such as drought and high temperature conditions.
[0011] The application performs homology analysis on the NRT2.1 protein, and the analysis shows that the NRT2.1 protein has high homology in plants. Therefore, the application provides an application of the NRT2.1 gene in improving drought resistance and / or high temperature resistance of crops, wherein the NRT2.1 gene CDS region nucleotide sequence is shown in SEQ ID NO. 1 or has at least 70% homology with the sequence shown in SEQ ID NO. 1 and the encoded protein is functionally equivalent.
[0012] The NRT2.1 gene is derived from rice or other plants with homology. Any nucleotide sequence with the same function obtained by deletion, insertion or replacement of the nucleotide sequence shown in SEQ ID NO. 1 also belongs to the protection scope of the application.
[0013] Further, the crops can be, but are not limited to, rice, corn, wheat, cotton, rapeseed, soybean.
[0014] Further, the application includes the following: overexpressing the protein encoded by the NRT2.1 gene in crops by using an overexpression technology, so as to obtain crops with improved biomass and yield under drought and / or high temperature stress conditions.
[0015] The drought stress refers to that the water content in soil is lower than the normal growth requirement of crops, and affects the growth and development of crops. The high temperature stress refers to that the temperature is higher than the natural growth temperature of crops, and affects the growth and development of crops.
[0016] Further, the crop is rice, and the natural growth condition of the rice is that the soil moisture content is greater than 40%, the temperature is 35 DEG C in the daytime and 25 DEG C at night; the drought stress condition is that the soil moisture content is less than 20%, and the high-temperature stress condition is that the temperature is 40-45 DEG C in the daytime and 30-35 DEG C at night.
[0017] Further, the application comprises that the nitrogen utilization efficiency of the crop plant with overexpression of the NRT2.1 gene is improved under the drought or high-temperature stress condition.
[0018] The application further provides a breeding method for improving the drought resistance or high-temperature resistance of rice, comprising the following steps: inserting a rice OsNRT2.1 gene fragment with the nucleotide sequence shown in SEQ ID NO. 1 into an overexpression vector to construct a recombinant expression vector; and using a transformation method to transform the target fragment into a receptor rice to cultivate a transgenic plant with improved drought resistance or high-temperature resistance.
[0019] The amino acid sequence of the protein encoded by the rice OsNRT2.1 gene is shown in SEQ ID NO. 2.
[0020] Further, the breeding method comprises the following steps:
[0021] (1) inserting a rice OsNRT2.1 gene fragment with the nucleotide sequence shown in SEQ ID NO. 1 into a pCAMBIA1300 expression vector to construct a recombinant expression vector;
[0022] (2) using an agrobacterium-mediated technology to introduce the target fragment into a receptor rice material to cultivate and screen to obtain an OsNRT2.1 gene function-enhanced rice transgenic plant.
[0023] Further, the receptor rice is a japonica rice variety ZH11 (Zhong Hua 11).
[0024] The application has the following beneficial effects:
[0025] The application provides a gene NRT2.1 capable of regulating the nitrogen utilization of crops, and the function of the gene is verified by obtaining a NRT2.1 gene overexpression plant through a transgenic technology; the overexpression of the NRT2.1 gene significantly improves the biomass, yield and nitrogen utilization efficiency of the plant under the drought or high-temperature stress condition. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1OsNRT2.1 and other homologous protein sequences in crops.
[0027] Figure 2 OsNRT2.1 overexpression vector schematic diagram.
[0028] Figure 3 OsNRT2.1 transgenic rice T0 representative expression level detection results schematic diagram.
[0029] Figure 4 OsNRT2.1 transgenic rice under normal growth conditions, wherein (A) is the plant photo, (B) is the single plant yield, (C) is the single plant biomass, (D) is the nitrogen use efficiency.
[0030] Figure 5 OsNRT2.1 transgenic rice under drought stress conditions, wherein (A) is the plant photo, (B) is the relative single plant yield, (C) is the relative single plant biomass.
[0031] Figure 6 OsNRT2.1 transgenic rice under high temperature stress conditions, wherein (A) is the plant photo, (B) is the relative single plant yield, (C) is the relative single plant biomass.
[0032] Figure 7 OsNRT2.1 transgenic rice under drought stress conditions (A) and high temperature stress conditions (B) nitrogen use efficiency. DETAILED DESCRIPTION
[0033] The application will be further described below in conjunction with specific examples. The following examples are only used to illustrate the application, and are not used to limit the application. Modifications or replacements of the method, steps or conditions of the application, without departing from the spirit and essence of the application, all belong to the scope of the application.
[0034] The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.
[0035] Example 1: Homologous protein homology analysis of rice OsNRT2.1 protein in major crops
[0036] By using the amino acid sequence corresponding to the rice OsNRT2.1 protein sequence No. NP_001388673.1, homology search was performed in NCBI (https: / / www.ncbi.nlm.nih.gov / protein / ).
[0037] The results are as follows: Figure 1As shown, according to sequence similarity analysis, the homology with the Arabidopsis AtNRT2:1 protein sequence (sequence number NP_172288.1) was 71.43%, the homology with the corn protein ZmNRT2 sequence (sequence number NP_001105195.2) was 87.71%, the homology with the wheat protein TaNRT2.1 sequence (sequence number XP_044405921.1) was 84.69%, the homology with the cotton protein GhNRT2.1 sequence (sequence number XP_016731295.1) was 75.80%, the homology with the rape BnNRT2.1 protein sequence (sequence number XP_013729508.1) was 72.59%, and the homology with the soybean GmNRT2 protein sequence (sequence number NP_001236444.1) was 76.56%.
[0038] The above results show that the OsNRT2.1 protein has high homology in plants.
[0039] Example 2: Obtaining rice OsNRT2.1 overexpression plants
[0040] In order to study the function of rice OsNRT2.1 gene, we constructed an OsNRT2.1 overexpression recombinant vector, and obtained overexpression plants by Agrobacterium-mediated genetic transformation method.
[0041] 1. Construction of OsNRT2.1 overexpression recombinant vector
[0042] 1.1 Obtain the CDS sequence in the NCBI genome database, and the CDS full length of OsNRT2.1 gene is 1602 bp (Os02g0112600), and the protein molecular weight is about 57.23 kD (NP_001388673.1).
[0043] According to the sequence design primer, F1: ATGGACTCGTCGACGGTGG; R1: TTAGGCGTGCTCCGGCGA, using rice cDNA as template, using high fidelity enzyme for amplification, after determining the correct band size, recovery and purification.
[0044] 1.2 Primers were designed based on the vector: F2: gttccagattacgctggatccATGGACTCGTCGACGGTGG; R2: atggtctttgtagtcggatccTTAGGCGTGCTCCGGCGA. Using the previously amplified fragment as a template, amplification was performed. Homologous arms were added to both ends of the OsNRT2.1 gene, and the gene was ligated into the pCAMBIA1301 vector via homologous recombination. After transformation, colony PCR analysis, and sequencing verification, the plasmid was extracted, yielding the recombinant plasmid pCAMBIA1301-35S-OsNRT2.1. A schematic diagram of the vector is shown below. Figure 2 As shown in the figure, the correctly sequenced plasmid was transferred into Agrobacterium EHA105 for the next step of transgenic rice creation.
[0045] 2. Creation of OsNRT2.1 overexpression rice
[0046] Transformation was performed using the japonica rice variety ZH11 as the recipient material. The transformation method involved Agrobacterium-mediated genetic transformation of rice callus tissue. After obtaining T0 generation transgenic plants, mRNA was extracted and analyzed by reverse transcription and qPCR. The qPCR primer sequences were F3: ATCATGATCATGGCGTGCAC; R3: TCCACTCGGAGCCGTAGTAGT. The results are as follows: Figure 3 As shown, the expression levels of the three independently transformed plants, designated OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, were all above 40-fold, and were used for subsequent abiotic stress phenotypic identification and nitrogen use efficiency analysis experiments. Example 3: Identification of drought resistance and high-temperature traits in rice with OsNRT2.1 overexpression.
[0047] 1. T1 generation plants from three families of OsNRT2.1 overexpressing rice (OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9) were taken and planted in a greenhouse at Zhejiang University's Zijingang Campus. 5 kg of paddy soil (containing 6.2 g of nitrogen) was placed in large rectangular containers (25 cm long × 18 cm wide × 32 cm high). Normal growing conditions were: soil moisture content greater than 40%, daytime temperature 35℃, and nighttime temperature 25℃. One transgenic rice plant and a wild-type control (WT) were planted in each container, with 8 plants per family. Aboveground biomass and yield per plant were measured under normal growing conditions at rice maturity.
[0048] Statistical analysis of the test results revealed that the aboveground yield per plant of three families of rice overexpressing OsNRT2.1—OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9—was significantly higher than that of other rice varieties. Figure 4 B), biomass per plant ( Figure 4 C) and nitrogen use efficiency (Figure 4 D) aspect is significantly higher than the wild type control.
[0049] 2, In order to study the ability of OsNRT2.1 overexpression rice to resist drought, a large barrel (25 cm long x 18 cm wide x 32 cm high) was used to contain 5 kg of rice field soil (containing 6.2 g of nitrogen), and three families of OsNRT2.1 overexpression rice, OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, were selected, with one barrel of each transgenic rice and wild type control, and 8 plants for each family. After growing for 35 days to the tillering stage, the soil moisture was measured by RIME-PICO TDR portable soil moisture measuring instrument, and the soil moisture was controlled in the range of 15%-20% through water management, until the grain filling stage at 70 days of growth, the water was restored to normal state (soil moisture content greater than 40%), and the aboveground biomass and single plant yield of rice were measured at the mature stage. Because OsNRT2.1 overexpression rice can increase the biomass and single plant yield of rice under normal growth conditions, we used the performance of each family under drought stress compared with the normal performance value to indicate the role of OsNRT2.1 overexpression rice under drought stress.
[0050] After statistical analysis of the test results, it was found that the three families of OsNRT2.1 overexpression rice, OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, had significantly higher relative single plant yield ( Figure 5 B) and relative single plant biomass ( Figure 5 C) than the wild type control, indicating that OsNRT2.1 overexpression rice significantly improved the ability of rice to resist drought.
[0051] 3、To study the ability of OsNRT2.1 overexpression rice to resist high temperature, 5 kg of paddy field soil was put in a large bucket (25 cm long * 18 cm wide * 32 cm high), and three families of OsNRT2.1 overexpression rice, OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, were selected. One of the above-mentioned transgenic rice and wild type control was planted in each bucket, and 8 plants were planted for each family. The plants were grown in a plant incubator under normal growth conditions, with a temperature of 35°C during light (from 7:00 am to 18:00 pm) and a temperature of 25°C during darkness (from 18:00 pm to 7:00 am the next day). After 60 days of normal growth, the plants entered the ear development stage, and high temperature stress treatment was started. The high temperature stress treatment conditions were set as a temperature of 45°C during light (from 7:00 am to 18:00 pm) and a temperature of 35°C during darkness (from 18:00 pm to 7:00 am the next day), and the treatment time was 5 days. The growth chamber was adjusted to the state before high temperature stress, with a temperature of 35°C during light (from 7:00 am to 18:00 pm) and a temperature of 25°C during darkness (from 18:00 pm to 7:00 am the next day). The plants were grown until they were completely mature, and the aboveground biomass and yield per plant of the rice were measured. Because the OsNRT2.1 overexpression rice can increase the biomass and yield per plant of the rice under normal growth conditions, the performance of each family under high temperature stress was compared with the normal performance value to indicate the role of OsNRT2.1 overexpression rice in high temperature stress.
[0052] After statistical analysis of the test results, it was found that the aboveground relative yield per plant ( Figure 6 B) and the relative biomass per plant ( Figure 6 C) of the three families of OsNRT2.1 overexpression rice, OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, were significantly higher than those of the wild type control after high temperature stress, indicating that the OsNRT2.1 overexpression rice significantly improved the ability of rice to resist high temperature.
[0053] 4、To explore the nitrogen utilization efficiency of OsNRT2.1 gene in rice under normal growth and drought stress, high temperature stress conditions, the seeds and aboveground parts of the rice in Examples 3 and 2, 3 were harvested at the mature stage, and the nitrogen content was measured by Shimadzu total nitrogen analyzer TOC / TN. The nitrogen utilization efficiency of rice was calculated by the formula = seed weight / total nitrogen content in soil + irrigation water.
[0054] The results showed that under normal growth conditions and drought, high temperature stress conditions, the three families of OsNRT2.1 overexpression rice, OsNRT2.1-OE2, OsNRT2.1-OE5, and OsNRT2.1-OE9, all showed higher nitrogen utilization efficiency.Figure 4 D, Figure 7 A, Figure 7 B).
[0055] These results show that overexpression of OsNRT2.1 gene in rice can significantly improve the nitrogen use efficiency of rice under drought and high temperature stress, and the gene has high utilization value in crop yield increase, drought resistance, high temperature resistance and nitrogen use efficiency.
Claims
1. NRT2.1 The use of genes in improving the high temperature tolerance of crops, characterized in that, The application comprises: using overexpression technology to make NRT2.1 The gene encodes a protein which is overexpressed in crops, thereby obtaining crop plants with improved biomass and yield under high temperature stress conditions, the crops being rice, the NRT2.1 The nucleotide sequence of the CDS region of the gene is shown as SEQ ID NO. 1, and the high temperature stress conditions are daytime temperature of 40-45℃ and nighttime temperature of 30-35℃.
2. Use according to claim 1, wherein The application comprises: NRT2.1 The crop plants with overexpression of the gene have an improved nitrogen use efficiency.
3. A breeding method for improving high temperature resistance in rice, characterized by, comprising: Rice plants having a nucleotide sequence as shown in SEQ ID NO. 1 OsNRT2.1 The gene fragment is inserted into an overexpression vector to construct a recombinant expression vector; the target fragment is transformed into a recipient rice plant by a transformation method, and a transgenic plant with improved high-temperature resistance is obtained by cultivation; the high-temperature stress condition is a daytime temperature of 40-45°C and a nighttime temperature of 30-35°C.
4. The breeding method for improving high temperature resistance of rice according to claim 3, wherein The rice OsNRT2.1 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.
2.
5. The breeding method for improving high temperature resistance of rice according to claim 3, wherein the nucleic acid molecule is a nucleic acid molecule having a nucleotide sequence encoding a polypeptide selected from the group consisting of SEQ ID NOs: 1 to 4. comprising the steps of: (1) The nucleotide sequence of the rice OsNRT2.1 The gene fragment is inserted into pCAMBIA1300 expression vector to construct a recombinant expression vector. (2) using Agrobacterium-mediated technology to introduce the target fragment into the recipient rice material, cultivate, and screen to obtain OsNRT2.1 Rice transgenic plants with enhanced gene function.
6. The breeding method for improving high temperature resistance of rice according to Claim 3, wherein the DNA fragment is a DNA fragment comprising a nucleotide sequence represented by any of SEQ ID NOs: 1 to 4. The recipient rice is japonica variety ZH11.
Citation Information
Patent Citations
Application of rice OsNRT2.1 gene for increasing manganese element content in rice grains
CN109971764A