A multiplex qPCR kit for simultaneous detection of six respiratory pathogens

By designing qPCR primers and probes with high specificity and sensitivity, a multiplex qPCR kit was constructed, which solved the problem of low specificity and sensitivity in the existing multiplex fluorescent PCR method. This enabled rapid and accurate detection of six respiratory pathogens, supporting rapid clinical diagnosis.

CN116121414BActive Publication Date: 2025-11-11DAAN GENE CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211573467.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-08
Publication Date
2025-11-11
Estimated Expiration
2042-12-08

AI Technical Summary

Technical Problem

Existing multiplex fluorescent PCR methods suffer from problems such as low specificity, low sensitivity, and poor repeatability when detecting multiple respiratory pathogens, making it difficult to achieve rapid and accurate detection of multiple pathogens.

Method used

Multiple sets of different qPCR primers and probes were designed. By analyzing the genomic sequences of adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, and chlamydia pneumoniae, a multiplex qPCR kit was constructed. These pathogens were detected separately using a two-tube reaction system. Probes labeled with specific fluorescent groups were used to improve detection accuracy and sensitivity.

Benefits of technology

It achieves high specificity, sensitivity and repeatability in the detection of six respiratory pathogens, enabling rapid and accurate identification of these pathogens. It is suitable for rapid clinical detection of respiratory pathogens and supports timely and appropriate treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116121414B_ABST
    Figure CN116121414B_ABST
Patent Text Reader

Abstract

This invention discloses a multiplex qPCR kit for the simultaneous detection of six respiratory pathogens. The multiplex qPCR kit of this invention can simultaneously detect six common respiratory pathogens: adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, and chlamydia pneumoniae. It has the advantages of high specificity, high sensitivity, good repeatability, and is unaffected by interfering substances. Furthermore, the kit is simple to operate and quick to use for detecting adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, or chlamydia pneumoniae. It can simultaneously detect these six different common respiratory pathogens using a two-tube reaction system, and the detection results are accurate. It is suitable for rapid clinical detection of respiratory pathogens, which helps in timely and accurate treatment of the infecting pathogens.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pathogen detection technology. More specifically, it relates to a multiplex qPCR kit for the simultaneous detection of six respiratory pathogens. Background Technology

[0002] Respiratory tract infection is a common clinical disease caused by pathogens such as fungi, bacteria, viruses, or atypical pathogens invading and multiplying in the respiratory tract. Depending on the site of infection, respiratory tract infections are divided into upper respiratory tract infections and lower respiratory tract infections. If upper respiratory tract infections are not treated promptly, or due to factors such as a weakened immune system or mixed infections, they can progress to lower respiratory tract infections, leading to diseases such as tracheitis, bronchitis, and pneumonia, seriously affecting health.

[0003] Common pathogens causing respiratory infections include adenoviruses (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), human rhinovirus (HRV), and chlamydia pneumoniae (CP). If not detected and treated promptly, these pathogens can easily affect other organs. Although the pathogens are different, the symptoms caused by respiratory pathogens are similar, and mixed infections are common. Furthermore, different pathogens exhibit significant differences in their susceptibility to the same drug. Therefore, identifying the specific respiratory pathogen and using targeted medication is crucial for timely and accurate treatment of respiratory infections.

[0004] Currently, laboratory testing for respiratory pathogens includes virus isolation and identification, immunofluorescence assays, serological detection, and multiplex fluorescent PCR. Among these, virus culture is cumbersome and has a low positive rate; immunological methods have poor sensitivity and specificity; serological identification is limited in scope, time-consuming, and has a high false-positive rate, making them unsuitable for large-scale, rapid, and accurate detection of multiple pathogens. Multiplex fluorescent PCR can simultaneously detect multiple pathogens in a single reaction tube, reflecting changes in multiple pathogens. However, due to interference between different primers or probes in the multiplex fluorescent PCR reaction system, existing products for the simultaneous detection of multiple respiratory pathogens often suffer from low specificity, low sensitivity, or poor repeatability. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the existing technologies and provide a multiplex qPCR kit for the simultaneous detection of six common respiratory pathogens, namely adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), rhinovirus (HRV) and chlamydia pneumoniae (CP).

[0006] The above-mentioned objective of this invention is achieved through the following technical solution:

[0007] This invention analyzes the genomic sequences of adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), rhinovirus (HRV), and chlamydia pneumoniae (CP), selects suitable target gene fragments, and designs multiple sets of different qPCR primers and probes, aiming to construct a multiplex qPCR kit for the simultaneous detection of these pathogens. However, when testing the detection performance of the primers and probes, it was found that the primers or probes themselves, as well as factors such as primer / probe dimers and cross-interference, can affect the accuracy and sensitivity of the multiplex qPCR detection system. For example, some primers and probes have poor detection specificity; combining different primers and probes significantly reduces their detection performance compared to using them individually. Furthermore, pathogens such as adenovirus have multiple serotypes, and introducing degenerate bases when designing corresponding multiplex qPCR primers and probes can also affect their detection performance. After continuous design and adjustments, this invention has successfully constructed a multiplex qPCR kit with good detection specificity, high sensitivity, good repeatability and high detection accuracy, which can be used to simultaneously detect adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), rhinovirus (HRV) and chlamydia pneumoniae (CP).

[0008] This invention provides a multiplex qPCR kit for the simultaneous detection of six respiratory pathogens. The kit contains qPCR reaction solution A1 and qPCR reaction solution A2. qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting adenovirus, human bocavirus, and respiratory syncytial virus; qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting Mycoplasma pneumoniae, rhinovirus, and Chlamydia pneumoniae.

[0009] The sequences of the multiplex qPCR primers and probes used for detecting adenovirus in qPCR reaction solution A1 are shown in SEQ ID NO. 1-3, the sequences of the multiplex qPCR primers and probes used for detecting human bocavirus are shown in SEQ ID NO. 4-6, and the sequences of the multiplex qPCR primers and probes used for detecting respiratory syncytial virus are shown in SEQ ID NO. 7-10. The sequences of the multiplex qPCR primers and probes used for detecting Mycoplasma pneumoniae in qPCR reaction solution A2 are shown in SEQ ID NO. 11-13, the sequences of the multiplex qPCR primers and probes used for detecting rhinovirus are shown in SEQ ID NO. 14-16, and the sequences of the multiplex qPCR primers and probes used for detecting Chlamydia pneumoniae are shown in SEQ ID NO. 17-19. The 5' ends of the different probes in the same qPCR reaction solution are labeled with different fluorescent emitting groups.

[0010] Specifically, the probe for detecting adenovirus has a 5' end labeled with the fluorescent group FAM and a 3' end labeled with the quenching group BHQ1; the probe for detecting human bocavirus has a 5' end labeled with the fluorescent group VIC and a 3' end labeled with the quenching group BHQ1; the probe for detecting respiratory syncytial virus has a 5' end labeled with the fluorescent group Texas red and a 3' end labeled with the quenching group BHQ2; the probe for detecting mycoplasma pneumoniae has a 5' end labeled with the fluorescent group FAM and a 3' end labeled with the quenching group BHQ1; the probe for detecting rhinovirus has a 5' end labeled with the fluorescent group VIC and a 3' end labeled with the quenching group BHQ1; and the probe for detecting chlamydia pneumoniae has a 5' end labeled with the fluorescent group Texas red and a 3' end labeled with the quenching group BHQ2.

[0011] In addition to the qPCR primers and probes for detecting respiratory pathogens, the qPCR reaction solutions A1 and A2 also contain internal standard primers and probes for detecting the internal standard RNase P. The sequences of the internal standard primers and probes are shown in SEQ ID NO. 20-22, respectively. The 5' end of the internal standard probe is labeled with a fluorescent group that is different from that of the other probes.

[0012] Specifically, the internal standard probe is labeled with the fluorescent group Cy5 at its 5' end and with the quenching group BHQ2 at its 3' end.

[0013] As an alternative implementation method, the present invention obtains the corresponding qPCR reaction solution by adding qPCR primers and probes for detecting respiratory pathogens to the qPCR reaction buffer.

[0014] Specifically, the concentration of MgCl2 in the qPCR reaction buffer is 2–5 mM, the concentration of KCl is 20–50 mM, and the concentration of Tris-HCl is 20–50 mM. That is, the concentrations of MgCl2, KCl, and Tris-HCl in qPCR reaction solutions A1 and A2 are 2–5 mM, 20–50 mM, and 20–50 mM, respectively.

[0015] Specifically, the concentrations of primers and probes contained in qPCR reaction solution A1 and qPCR reaction solution A2 are both 0.1–1 μM.

[0016] In addition to the qPCR reaction solution, the kit of the present invention also contains an enzyme mixture containing dNTPs, Taq enzyme and MMLV enzyme.

[0017] Specifically, the concentration of the dNTPs is 0.2–0.4 mM; the concentration of the Taq enzyme is 2.5–10 U; and the concentration of the MMLV enzyme is 2.5–10 U.

[0018] Specifically, the concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP in the dNTPs is 2:3:2:2:1.

[0019] In addition, the kit of the present invention also contains a positive control and a negative control; the positive control is a pseudovirus containing the target gene amplification fragment of the adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae and an internal standard amplification fragment; the negative control is a pseudovirus containing an internal standard amplification fragment.

[0020] When using the kit described in this invention for detection, the reaction system is as follows: 17 μL of qPCR reaction solution A1 or A2, 3 μL of enzyme mixture, and 10 μL of nucleic acid from the sample to be tested.

[0021] The reaction conditions were: 50℃, 2 min, 95℃, 5 min, 1 cycle; 95℃, 5 sec, 60℃, 35 sec, 45 cycles.

[0022] The present invention has the following beneficial effects:

[0023] This invention provides a multiplex qPCR kit for the simultaneous detection of adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, and chlamydia pneumoniae. It offers advantages such as high specificity, high sensitivity, good repeatability, and immunity to interference. The kit is simple to use and quick to detect adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, or chlamydia pneumoniae. It allows for the simultaneous detection of these six common respiratory pathogens using a two-tube reaction system, providing accurate results. This kit is suitable for rapid clinical detection of respiratory pathogens, facilitating timely and appropriate treatment. Attached Figure Description

[0024] Figure 1 This represents the specificity test results of the kit described in this invention.

[0025] Figure 2 This refers to the detection result of the internal standard during the specificity testing process of the kit described in this invention.

[0026] Figure 3 This is the detection result of adenovirus in actual clinical samples using the kit described in this invention.

[0027] Figure 4 The results of the kit described in this invention for detecting human bocavirus in actual clinical samples are shown.

[0028] Figure 5 The results of the kit described in this invention for detecting respiratory syncytial virus in actual clinical samples are shown.

[0029] Figure 6 The results of the kit described in this invention for detecting Chlamydia pneumoniae in actual clinical samples are shown.

[0030] Figure 7 The results of the kit described in this invention for detecting rhinovirus in actual clinical samples are shown.

[0031] Figure 8 The results of the kit described in this invention for detecting Mycoplasma pneumoniae in actual clinical samples are shown.

[0032] Figure 9 The results show the detection of primers MP-F2 / MP-R2 and probe MP-P2 on physiological saline.

[0033] Figure 10 The results show the singlet and multiplex qPCR detection of Mycoplasma pneumoniae using primers MP-F3 / MP-R3 and probe MP-P3.

[0034] Figure 11This is a comparison of the detection results of Chlamydia pneumoniae by the multiplex qPCR reaction system (comparative multiplex detection system) used in Comparative Example 2 and the multiplex qPCR reaction system (combined detection system) described in Example 2.

[0035] Figure 12 This is a comparison of the rhinovirus detection results between the multiplex qPCR reaction system (comparative multiplex detection system) used in Comparative Example 2 and the multiplex qPCR reaction system (combined detection system) described in Example 2. Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0037] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0038] Example 1: Design of multiplex qPCR primers and probes and establishment of detection methods

[0039] 1. Design and determination of multiplex qPCR primers and probes

[0040] This invention, through sequence comparison of adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), rhinovirus (HRV), and chlamydia pneumoniae (CP), and through primer design, experimental verification, screening, adjustment, and re-verification, obtained a set of multiplex qPCR primers and probes for the simultaneous detection of adenovirus, human bocavirus, respiratory syncytial virus, mycoplasma pneumoniae, rhinovirus, and chlamydia pneumoniae. The primer and probe sequences are shown in Table 1, and corresponding detection methods were established. Furthermore, this invention selected the human gene RNase P (ribonuclease P, Genebank number: AK296196.1) as an internal standard. Based on this gene, corresponding qPCR primers and probes were designed to monitor the sample collection and extraction process, preventing false negatives due to failed nucleic acid extraction.

[0041] Table 1. Primer and probe sequences for multiplex qPCR

[0042]

[0043]

[0044] Primer and probe sequences used to detect adenovirus, respiratory syncytial virus, and rhinovirus contain degenerate bases; where S represents base G or C, R represents base A or G, K represents base G or T, V represents base G, A, or C, M represents base A or C, and Y represents base C or T.

[0045] This invention achieves the detection of different types of adenoviruses (adenovirus types 1, 2, 3, 4, 5, 7, and 55), respiratory syncytial virus (RSV types A and B), and rhinoviruses (rhinovirus types A, B, and C) by introducing degenerate bases at specific positions on primers and probes, or by designing an additional primer while introducing degenerate bases. At the same time, it ensures the detection specificity and sensitivity of primers and probes, thus guaranteeing the accuracy of detection.

[0046] In this embodiment, the probe for detecting adenovirus is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end; the probe for detecting human bocavirus is labeled with the fluorescent group VIC at its 5' end and the quenching group BHQ1 at its 3' end; the probe for detecting respiratory syncytial virus is labeled with the fluorescent group Texas red at its 5' end and the quenching group BHQ2 at its 3' end; the probe for detecting mycoplasma pneumoniae is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end; the probe for detecting rhinovirus is labeled with the fluorescent group VIC at its 5' end and the quenching group BHQ1 at its 3' end; the probe for detecting chlamydia pneumoniae is labeled with the fluorescent group Texas red at its 5' end and the quenching group BHQ2 at its 3' end; and the internal standard probe is labeled with the fluorescent group Cy5 at its 5' end and the quenching group BHQ2 at its 3' end.

[0047] 2. Establishment of detection methods

[0048] Based on the multiplex qPCR primers and probes shown in Table 1, this invention utilizes pseudoviruses containing the target genes of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae, as well as internal standard fragments, to construct corresponding detection methods for the simultaneous detection of adenovirus, human bocavirus, respiratory syncytial virus, Mycoplasma pneumoniae, rhinovirus, and Chlamydia pneumoniae. The primers and probes shown in Table 1 are divided into two groups, and the above six different common respiratory pathogens are detected simultaneously using a two-tube reaction system.

[0049] The reaction system comprises: 17 μL of qPCR reaction solution A1 or qPCR reaction solution A2, 3 μL of enzyme mixture, and 10 μL of nucleic acid from the sample to be tested. Specifically, qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting adenovirus, human bocavirus, and respiratory syncytial virus, as well as qPCR reaction buffer; qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting Mycoplasma pneumoniae, rhinovirus, and Chlamydia pneumoniae, as well as qPCR reaction buffer; qPCR reaction solutions A1 and A2 also contain internal standard primers and probes; and the enzyme mixture contains dNTPs, Taq enzyme, and MMLV enzyme.

[0050] The qPCR reaction buffer contains MgCl2, KCl and Tris-HCl.

[0051] The reaction procedure was as follows: 50°C, 2 min, 95°C, 5 min, 1 cycle; 95°C, 5 sec, 60°C, 35 sec (fluorescence collection), 45 cycles.

[0052] This invention also optimized the concentrations of each component in qPCR reaction solution A1, qPCR reaction solution A2, and the enzyme mixture. With other component concentrations remaining constant, the concentrations of qPCR primers and probes in qPCR reaction solution A1 and qPCR reaction solution A2 were diluted to 0.1 μM, 0.5 μM, and 1 μM for qPCR detection, respectively; the concentration of MgCl2 in the qPCR reaction buffer was diluted to 2 mM, 3.5 mM, and 5 mM for qPCR detection; the concentration of KCl in the qPCR reaction buffer was diluted to 20 mM, 35 mM, and 50 mM for qPCR detection; and the concentration of Tris-HCl in the qPCR reaction buffer was diluted to 20 mM. qPCR was performed at concentrations of 35 mM and 50 mM. The concentrations of dNTPs in the enzyme mixture (with a dATP:dUTP:dCTP:dGTP:dTTP concentration ratio of 2:3:2:2:1) were diluted to 0.2 mM, 0.3 mM, and 0.4 mM for qPCR. The concentrations of Taq enzyme were diluted to 2.5 U, 6 U, and 10 U for qPCR. The concentrations of MMLV enzyme were diluted to 2.5 U, 6 U, and 10 U for qPCR to determine the appropriate concentrations for each component for qPCR detection.

[0053] The results showed that, in the constructed reaction system, the applicable concentration ranges for the multiplex qPCR primers and probes were 0.1–1 μM, for MgCl2 2–5 mM, for KCl and Tris-HCl 20–50 mM, for dNTPs 0.2–0.4 mM, for Taq enzyme 2.5 U–10 U, and for MMLV enzyme 2.5 U–10 U. All components were suitable within the above concentration ranges, and the detection efficiencies were not significantly different.

[0054] Example 2: Multiplex qPCR kit for detecting six respiratory pathogens

[0055] Based on the multiplex qPCR primers, probes, and detection methods described in Example 1, this invention also provides a multiplex qPCR kit for the simultaneous detection of adenovirus (ADV), human bocavirus (HBoV), respiratory syncytial virus (RSV), mycoplasma pneumoniae (MP), rhinovirus (HRV), and chlamydia pneumoniae (CP).

[0056] 1. Components of the reagent kit

[0057] The multiplex qPCR kit for detecting various respiratory pathogens includes qPCR reaction solution A1, qPCR reaction solution A2, enzyme mixture, positive control, and negative control.

[0058] The qPCR reaction solution A1 contains multiplex qPCR primers and probes (shown in Table 1) and qPCR reaction buffer for detecting adenovirus, human bocavirus and respiratory syncytial virus. The concentrations of the multiplex qPCR primers and probes in reaction solution A1 are 0.1–1 μM, the concentration of MgCl2 is 2–5 mM, the concentration of KCl is 20–50 mM, and the concentration of Tris-HCl is 20–50 mM.

[0059] The qPCR reaction solution A2 contains multiplex qPCR primers and probes (shown in Table 1) and qPCR reaction buffer for detecting Mycoplasma pneumoniae, rhinovirus and Chlamydia pneumoniae. The concentrations of the multiplex qPCR primers and probes are 0.1–1 μM, the concentrations of MgCl2 and KCl are 2–5 mM, the concentrations of KCl and Tris-HCl are 20–50 mM.

[0060] The qPCR reaction solutions A1 and A2 also contain internal standard primers and probes (as shown in Table 1), with concentrations of 0.1–1 μM.

[0061] The enzyme mixture contains dNTPs, Taq enzyme, and MMLV enzyme. The concentration of the dNTPs is 0.2–0.4 mM, and the concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP in the dNTPs is 2:3:2:2:1. The concentration of Taq enzyme is 2.5–10 U, and the concentration of MMLV enzyme is 2.5–10 U.

[0062] The positive control sample is a pseudovirus containing the target genes and internal standard fragments of the tested adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae.

[0063] The negative control was a pseudovirus containing an internal standard fragment.

[0064] 2. Instructions for using the reagent kit

[0065] The present invention also provides a method for using the kit, comprising the following steps:

[0066] S1. Extract nucleic acid from the sample to be tested; In this embodiment of the invention, the reagent used to extract nucleic acid from the sample is a nucleic acid extraction or purification reagent (Guangdong-Guangzhou Medical Device Registration No. 20170583) produced by Guangzhou Da'an Gene Co., Ltd., and positive and negative quality control products are extracted simultaneously;

[0067] S2. Perform qPCR reaction; take 10 μL of the extracted sample nucleic acid, add qPCR reaction solution A1 or qPCR reaction solution A2 (17 μL) and enzyme mixture (3 μL), and perform amplification reaction in a real-time fluorescence PCR instrument; the reaction program is: 50℃, 2 min, 95℃, 5 min, 1 cycle; 95℃, 5 sec, 60℃, 35 sec (collect fluorescence), 45 cycles;

[0068] S3. Result determination: The fluorescence channels were selected sequentially as FAM, VIC, Texas red, and Cy5. After qPCR, the negative and positive results of the corresponding pathogen nucleic acid were determined by the different fluorescence channel curves and Ct values.

[0069] When the Ct value corresponding to each channel is ≤ the positive cutoff value of 40 and the amplification curve shows a significant exponential increase, the test result of the corresponding channel is interpreted as positive; when the Ct value is > the positive cutoff value of 40 or there is no Ct value, the corresponding channel is interpreted as negative; as detailed below:

[0070]

[0071] Note:

[0072] 1. RP6 PCR reaction tube 1 is for detecting adenovirus (ADV), human bocavirus (HBoV), and respiratory syncytial virus (RSV); RP6 PCR reaction tube 2 is for detecting mycoplasma pneumoniae (MP), rhinovirus (HRV), and chlamydia pneumoniae (CP).

[0073] 2. When the FAM, VIC, and TEXAS RED detection channels are positive, the Cy5 channel (internal standard channel) result may be negative due to the competition among the systems.

[0074] 3. If the internal standard result is negative, and the FAM, VIC, and TEXAS RED detection channels in the same test tube are also negative, the test is invalid and the sample needs to be retested.

[0075] Example 3 Sensitivity Test

[0076] This embodiment tested the detection sensitivity of the kit described in Example 2. Inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae with pre-determined values ​​were used as initial samples and diluted to a concentration of 10. 5 10 410 3 200 and 100 copies / mL were added to the samples obtained from dilution to a final concentration of 10. 4 Plasmid bacteria containing internal standard amplification fragments (copies / mL) were used as test samples. Nucleic acid was extracted from the samples. Using the extracted nucleic acid as a template, three different batches of kits were used for detection, with each batch repeated 20 times. Sensitivity testing was performed. The reaction system and reaction procedure were as described in Example 2. The negative and positive results of the corresponding pathogen nucleic acid were determined by different fluorescence channel curves and Ct values.

[0077] The sensitivity test results of the kit described in Example 2 of this invention for adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae show that when the sample concentration is 200 copies / mL or higher, the Ct values ​​of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae samples are all ≤40, and the amplification curves show obvious exponential growth. At the same time, the detection results of the internal standard are all positive, and the detection results are reliable, indicating that the detection sensitivity of the kit described in Example 2 of this invention is 200 copies / mL (it can also be detected at 100 copies / mL, but the detection rate is slightly lower than 95%).

[0078] Example 3 Specificity Test

[0079] To test the detection specificity of the kit described in Example 2 of this invention, other common pathogens and physiological saline were selected for specificity testing. Physiological saline, influenza A virus, influenza B virus, cytomegalovirus, Klebsiella pneumoniae, Legionella pneumophila, Streptococcus pneumoniae, Bordetella pertussis, parainfluenza virus type I, and Epstein-Barr virus were used as specificity references to test the detection specificity of the kit constructed in Example 2 of this invention.

[0080] The detection results of other common pathogens and physiological saline, i.e., the specific detection results of the kit described in this invention, are as follows: Figure 1 As shown, in the specificity test, the detection results of the internal standard are as follows: Figure 2 As shown. By Figure 1 and Figure 2 It is known that the kit described in this invention does not produce an amplification curve when detecting other common pathogens, indicating that the kit has good detection specificity and can specifically detect adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae.

[0081] Example 4 Precision Test

[0082] This embodiment tested the detection precision of the kit described in Example 2. Inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae with pre-determined values ​​were mixed and used as a precision reference. The final concentration of each pathogen in the precision reference was 10. 4 Each of the 500 copies / mL kits was tested 10 times according to the method of use described in Example 2, and the coefficient of variation of each concentration of precision reference material was calculated.

[0083] The coefficients of variation of the kit described in Example 2 of this invention for different concentrations of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus and Mycoplasma pneumoniae precision references are shown in Table 2.

[0084] Table 2. Coefficients of variation for precision reference materials at different concentrations

[0085]

[0086]

[0087] As shown in Table 2, the kit described in Example 2 of this invention has good detection precision, that is, good detection repeatability. Its coefficient of variation for different concentrations of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus and Mycoplasma pneumoniae precision reference materials is less than 2%.

[0088] Example 5 Accuracy Test

[0089] This invention prepared 5 samples of medium and low concentrations (specifically, each concentration was 10). 4 10 3 Inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae (200 copies / mL) were used as positive references. After extracting nucleic acid from the samples, they were detected using the method described in Example 2.

[0090] The test results show that the kit described in Example 2 of this invention has positive results for the corresponding positive reference samples of each pathogen, and the test results are accurate. The primers and probes in the reaction system do not cross-react with other pathogens. For example, when the sample tested is adenovirus, the primers and probes used to detect human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae did not show amplification curves.

[0091] Example 6 Interference Substance Test

[0092] This embodiment tested the ability of the kit described in Example 2 to resist interference substances. 5% whole blood, 5% mucus, spectinomycin (100 mg / L), penicillin (0.5 mg / mL), tetracycline (5 mg / L), ofloxacin (3.06 mg / L), and azithromycin (0.45 mg / L) were added to inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae at a concentration of 500 copies / mL, respectively, as test samples for interference substances. Inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae at a concentration of 500 copies / mL without the above interference substances were used as controls to test the effect of interference substances on primer and probe amplification.

[0093] The detection results of the kit described in Example 2 of this invention on adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae with added interfering substances show that the addition of interfering substances does not affect the detection effect of the kit described in this invention on human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae.

[0094] Example 7: Actual Detection of Clinical Samples

[0095] This invention collected clinical samples from suspected cases of upper respiratory tract infection and performed actual testing on the clinical samples using the kit described in Example 2.

[0096] 1. Extraction of nucleic acid from clinical test samples

[0097] Oropharyngeal swab clinical samples were collected from 30 suspected cases of upper respiratory tract infection, and nasopharyngeal swab clinical samples were collected from 30 suspected cases of upper respiratory tract infection, for a total of 60 clinical samples. Nucleic acid was extracted from the clinical samples using nucleic acid extraction or purification reagent (Guangdong-Guangzhou Medical Device Registration No. 20170583) produced by Guangzhou Da An Gene Co., Ltd. Positive and negative control samples in the kit were used simultaneously in the extraction. 10 μL of the extracted nucleic acid sample was taken and amplified according to the kit usage method described in Example 2. After qPCR, the negative and positive results of the corresponding pathogen nucleic acid were determined by different fluorescence channel curves and Ct values, using the same method as in Example 2.

[0098] Of the 60 suspected respiratory infection clinical samples tested, 11 were positive for adenovirus (including 2 samples with mixed adenovirus and rhinovirus infection), 4 were positive for human bocavirus, 10 were positive for respiratory syncytial virus (RSV), 3 were positive for Mycoplasma pneumoniae, 6 were positive for rhinovirus, and 1 was positive for Chlamydia pneumoniae. The detection results of adenovirus, human bocavirus, RSV, Mycoplasma pneumoniae, rhinovirus, and Chlamydia pneumoniae in actual clinical samples using the kit described in this invention are as follows: Figures 3-8 As shown. This invention also sequenced the amplification results of the aforementioned positive clinical samples. The sequencing alignment results were identical to the kit's detection results, indicating that the kit's detection accuracy reached 100%, further demonstrating the clinical detection accuracy of the detection system and method for simultaneously detecting six respiratory pathogens constructed in this invention.

[0099] Comparative Example 1

[0100] This invention utilizes primer design software to design dozens of sets of qPCR primers and probes targeting the nucleic acid sequences of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae. However, single-channel experiments revealed that the specificity of some primer pairs did not meet the requirements. For example, the sequences of the primers MP-F2 / MP-R2 and probe MP-P2 designed in this invention for detecting Mycoplasma pneumoniae are shown below:

[0101] Mycoplasma pneumoniae upstream primer MP-F2: CAACGCACCCTACTACTTCCAC

[0102] Mycoplasma pneumoniae downstream primer MP-R2: GTTCTTGTCCTCTCAGGGCTT

[0103] Mycoplasma pneumoniae detection probe MP-P2: 5'-FAM-TCCAATCCAAAGTGTGGTTGATGC CT BHQ1-3'

[0104] This invention utilizes the aforementioned primers MP-F2 / MP-R2 and probe MP-P2 to perform blank detection using physiological saline as a sample. The detection results are as follows: Figure 9 As shown, by Figure 9 It can be seen that nonspecific amplification occurred in the detection of primers MP-F2 / MP-R2 and probe MP-P2.

[0105] Some primers and probes (such as the upstream primer MP-F3 / MP-R3 for Mycoplasma pneumoniae and the probe MP-P3) have good detection results when used alone, but when combined with primers and probes for the detection of other pathogens for multiplex qPCR reactions, their detection results are found to decrease, making them unsuitable for multiplex qPCR systems.

[0106] The sequences of the primers MP-F3 / MP-R3 and the probe MP-P3 designed in this invention for detecting Mycoplasma pneumoniae are shown below:

[0107] Mycoplasma pneumoniae upstream primer MP-F3: GTACAGACCATTCCACCCAGC

[0108] Mycoplasma pneumoniae downstream primer MP-R3: GTTACCACTACTCGTCCCAAATAC

[0109] Mycoplasma pneumoniae detection probe MP-P3: 5'-FAM-CAGCCCCAATCGCTCAAAACAAC BHQ1-3'

[0110] Specifically, the primers MP-F3 / MP-R3 and probe MP-P3 used for detecting Mycoplasma pneumoniae in the qPCR reaction solution A2 of this invention were replaced with the primers MP-F3 / MP-R3 and probe MP-P3. The nucleic acid from a positive Mycoplasma pneumoniae sample was used for detection, and the reaction system and conditions were the same as in Example 2. The detection results using MP-F3, MP-R3, and MP-P3 are as follows: Figure 10 As shown, by Figure 10 It can be seen that the primer pair has good specificity and sensitivity for the target nucleic acid of Mycoplasma pneumoniae in a single detection system, but the amplification of low concentration nucleic acid of Mycoplasma pneumoniae target gene is significantly inhibited in a multiplex detection system. Primers MP-F3, MP-R3 and MP-P3 cannot be used in a multiplex detection system.

[0111] Comparative Example 2

[0112] Furthermore, this invention has found that even with primers and probes selected for high specificity and sensitivity, combining primers and probes from different pathogens to construct a multiplex qPCR system does not necessarily guarantee good detection results. For example, this invention combined primers and probes used in Example 1 for detecting adenovirus, Chlamydia pneumoniae, and respiratory syncytial virus into a multiplex qPCR reaction system, and also combined primers and probes used in Example 1 for detecting Mycoplasma pneumoniae, human bocavirus, and rhinovirus into a multiplex qPCR reaction system. The detection method described in Example 1 was used to detect inactivated cultures of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae. The results of comparing the detection of Chlamydia pneumoniae using the multiplex qPCR reaction system (comparative multiplex detection system) in this comparative example with the multiplex qPCR reaction system (combined detection system) described in Example 2 of this invention are as follows: Figure 11As shown, the comparison results of the rhinovirus detection by the multiplex qPCR reaction system (comparative multiplex detection system) used in this comparative example and the multiplex qPCR reaction system (combined detection system) described in Example 2 of this invention are as follows. Figure 12 As shown. By Figure 11 and 12 It can be seen that, compared with the detection results of the multiplex qPCR detection system determined in this invention, in this comparative example, the primer and probe combination used to detect Chlamydia pneumoniae was inhibited by the multiplex system, the peak fluorescence height was reduced and the CT value was placed later. Figure 11 The primer and probe combinations used to detect rhinovirus showed decreased amplification efficiency in multiplex systems, with reduced peak curves at low concentrations. Figure 12 This indicates that the multiple detection combination method of this comparison ratio is not suitable for the combined detection of adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, and Mycoplasma pneumoniae.

[0113] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A multiplex qPCR kit for simultaneous detection of six respiratory pathogens, characterized in that, The kit contains qPCR reaction solution A1 and qPCR reaction solution A2; wherein, qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting adenovirus, human bocavirus and respiratory syncytial virus; qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting mycoplasma pneumoniae, rhinovirus and chlamydia pneumoniae. The sequences of the multiplex qPCR primers and probes used for detecting adenovirus in qPCR reaction solution A1 are shown in SEQ ID NO. 1-3, the sequences of the multiplex qPCR primers and probes used for detecting human bocavirus are shown in SEQ ID NO. 4-6, and the sequences of the multiplex qPCR primers and probes used for detecting respiratory syncytial virus are shown in SEQ ID NO. 7-10; the sequences of the multiplex qPCR primers and probes used for detecting Mycoplasma pneumoniae in qPCR reaction solution A2 are shown in SEQ ID NO. 11-13, the sequences of the multiplex qPCR primers and probes used for detecting rhinovirus are shown in SEQ ID NO. 14-16, and the sequences of the multiplex qPCR primers and probes used for detecting Chlamydia pneumoniae are shown in SEQ ID NO. 17-19; the 5' ends of the different probes in the same qPCR reaction solution are labeled with different fluorescent emitting groups. The qPCR reaction solutions A1 and A2 also contain internal standard primers and probes for detecting the internal standard RNase P, and the sequences of the internal standard primers and probes are shown in SEQ ID NO. 20-22, respectively; the 5' end of the internal standard probe is labeled with a fluorescent group different from that of other probes.

2. The kit according to claim 1, characterized in that, The probes used for detecting adenovirus are labeled with the fluorescent group FAM at the 5' end and the quenching group BHQ1 at the 3' end; the probes used for detecting human bocavirus are labeled with the fluorescent group VIC at the 5' end and the quenching group BHQ1 at the 3' end; the probes used for detecting respiratory syncytial virus are labeled with the fluorescent group Texas red at the 5' end and the quenching group BHQ2 at the 3' end; the probes used for detecting mycoplasma pneumoniae are labeled with the fluorescent group FAM at the 5' end and the quenching group BHQ1 at the 3' end; the probes used for detecting rhinovirus are labeled with the fluorescent group VIC at the 5' end and the quenching group BHQ1 at the 3' end; and the probes used for detecting chlamydia pneumoniae are labeled with the fluorescent group Texas red at the 5' end and the quenching group BHQ2 at the 3' end.

3. The reagent kit according to claim 1, characterized in that, The internal standard probe is labeled with the fluorescent group Cy5 at its 5' end and the quenching group BHQ2 at its 3' end.

4. The kit according to any one of claims 1 to 3, characterized in that, The primers and probes contained in the qPCR reaction solutions A1 and A2 are both 0.1–1 μM.

5. The kit according to any one of claims 1 to 3, characterized in that, The qPCR reaction solutions A1 and A2 also contain qPCR reaction buffer, wherein the concentration of MgCl2 in the qPCR reaction buffer is 2-5 mM, the concentration of KCl is 20-50 mM, and the concentration of Tris-HCl is 20-50 mM.

6. The kit according to any one of claims 1 to 3, characterized in that, The kit also contains an enzyme mixture containing dNTPs, Taq enzyme, and MMLV enzyme.

7. The reagent kit according to claim 6, characterized in that, The concentration of the dNTPs is 0.2–0.4 mM; the concentration of the Taq enzyme is 2.5–10 U; and the concentration of the MMLV enzyme is 2.5–10 U.

8. The reagent kit according to claim 6, characterized in that, The concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP in the dNTPs is 2:3:2:2:

1.

9. The kit according to any one of claims 1 to 3, characterized in that, The kit also contains positive and negative controls; the positive control is a pseudovirus containing amplified fragments of the target gene of the adenovirus, human bocavirus, respiratory syncytial virus, Chlamydia pneumoniae, rhinovirus, or Mycoplasma pneumoniae and an internal standard amplified fragment; the negative control is a pseudovirus containing an internal standard amplified fragment.

Citation Information

Patent Citations

  • Primer group, kit and method for detecting respiratory pathogens

    CN109457053A

  • Multiplex fluorescence quantitative PCR kit for detecting 19 human respiratory viruses

    CN110468234A

  • Collaborative multiplex PCR detection method for nucleic acids of nine respiratory tract pathogens

    CN111074001A