An anti-apoptotic baculovirus expression vector
By introducing small RNA expression cassettes targeting Sf-caspase-1 and Tn-caspase-1 into baculovirus vectors, the problem of low recombinant protein yield caused by insect cell apoptosis was solved, enabling efficient expression of exogenous genes in Sf and Tn cell lines and advancing the industrial application of anti-apoptotic vectors.
Patent Information
- Application Number
- CN202211099000.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2018-06-21
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2038-06-21
AI Technical Summary
In existing baculovirus expression systems, insect cells undergo apoptosis shortly after infection, resulting in limited recombinant protein production. In particular, the lack of simultaneously effective anti-apoptotic vectors in Sf and Tn cell lines limits their industrial application.
We designed and cloned a small RNA expression cassette targeting the shared sequences of Sf-caspase-1 and Tn-caspase-1 into the genome of a baculovirus vector. The cassette contained the human U6 promoter, a 21nt guide strand complement sequence, a 9nt loop sequence, and a transcription termination signal, which reduced the tendency of the DNA strand to form hairpin structures and constructed an anti-apoptotic recombinant baculovirus vector.
It significantly improved the expression level of exogenous genes and protein production in Sf9 and High Five cells, increased luciferase activity by about 1 time, and prolonged the survival time of infected cells, making it suitable for the industrial production of protein drugs and vaccines.
Smart Images

Figure CN116144653B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of recombinant protein expression technology, and particularly relates to an anti-apoptotic baculovirus expression vector. This application is a divisional application, with parent application number CN201810640684.X. Background Technology
[0002] Baculoviruses are double-stranded DNA viruses that specifically infect arthropods. *Autographa californica* nucleopolyhedrovirus (AcMNPV) is the type species of baculovirus. Since Smith GE et al. first expressed the human β-interferon gene in insect cells using baculoviruses in 1983, baculovirus expression vector systems have been widely used in research and production due to their advantages such as low cost, high yield, and availability of various post-translational modification systems.
[0003] Baculovirus expression systems are transient; insect cells undergo apoptosis 3-4 days after viral infection. The expression duration of late-promoter-based baculovirus expression systems extends from 20 hours post-infection until host cell death. Extending the survival time of infected cells can increase the production of exogenous recombinant proteins.
[0004] Apoptosis is one of the host's strategies to defend against viral infection, and the activity of cell-encoded caspases is very important for apoptosis. The most studied caspase in Spodoptera frugiperda (Sf) cells is caspase Sf-caspase-1. In 2007, a research group in Taiwan, China, used an RNA interference vector to express the dsRNA of Sf-caspase-1 in Sf9 cells, successfully silencing Sf-caspase-1 in the cells, and screened out a cell line that inhibited Sf9 cell apoptosis (Lin CC, Hsu JTA, Huang KL, et al. Sf-Caspase-1-repressed stable cells: resistance to apoptosis and augmentation of recombinant protein production. Biotechnology and applied biochemistry. 2007, 48(1):11-19.).
[0005] Apoptosis is an active way for organisms to clear degenerated cells. If the anti-apoptotic pathway of insect cell lines is blocked, the cell lines will inevitably degenerate. To solve this problem, Zhang Xiaoyue et al. directly cloned the coding sequence of a double-stranded small RNA targeting Sf-caspase-1 into the baculovirus genome, which increased the activity of expressed luciferase by 10 times, but the protein expression level did not increase much. It is speculated that the anti-apoptosis may have affected the activity of the host protein quality control system more (Zhang X, Xu K, Ou Y, Xu X, Chen H. Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production. BMC Biotechnol. 2018, 18(1):24.).
[0006] The commercially available cell line High Five, derived from the white armyworm (Trichoplusia ni, Tn), has achieved great industrial success due to its higher yield compared to the Sf cell line. Studies have shown that artificially synthesized Tn-caspase-1 dsRNA can inhibit apoptosis in High Five cells (Hebert CG, Valdes JJ, Bentley WE. Investigating apoptosis: characterization and analysis of Trichoplusia ni-caspase-1 through overexpression and RNAi mediated silencing. Insect Biochem Mol Biol. 2009, 39(2):113-24.). Further cloning of Tn-caspase-1 dsRNA into High Five cells resulted in an anti-apoptotic cell line that significantly enhanced the expression of the exogenous gene (Hebert CG, Valdes JJ, Bentley WE. In vitro and invivo RNA interference mediated suppression of Tn-caspase-1 for improved recombinant protein production in High Five cell culture with the baculovirus expression vector system. Biotechnol Bioeng. 2009, 104(2):390-9.). Although the expression level in High Five cells was higher than that in Sf cells, it was not suitable for baculovirus transfection. In industrial production, the two cell lines are usually used interchangeably, but unfortunately, there is currently no baculovirus expression vector that can simultaneously inhibit apoptosis in both Sf and Tn cells. If a baculovirus expression vector could simultaneously exhibit anti-apoptotic properties in both Sf and Tn cell lines, it would greatly advance the industrial application of anti-apoptotic baculovirus expression vectors. Summary of the Invention
[0007] The purpose of this application is to provide a recombinant baculovirus vector with broad-spectrum anti-host apoptosis capabilities, aiming to solve the problems mentioned in the background art.
[0008] This application obtained a unique shared sequence (SEQ ID NO:1) longer than 21 nt by comparing the coding sequences of Sf-caspase-1 and Tn-caspase-1. Based on this sequence, this application designed two RNAi target sites:
[0009] gccgcactgagacagatggct (complementary sequence is SEQ ID NO:2)
[0010] gcactgagacagatggctcac (complementary sequence is SEQ ID NO:3)
[0011] This application is achieved by cloning a small RNA expression cassette targeting the above sequence into the genome of a baculovirus vector.
[0012] Furthermore, the expression cassette sequence includes a human U6 promoter sequence, a 21nt guide strand complement sequence, a 9nt loop sequence, a 21nt guide strand coding sequence, and a TTTTT sequence as a transcription termination signal;
[0013] The complementary sequences of the 21nt guide chain are SEQ ID NO:4 or SEQ ID NO:5, respectively;
[0014] The 21nt bootstrap coding sequences are SEQ ID NO:2 or SEQ ID NO:3, respectively.
[0015] Furthermore, based on the GU pairing phenomenon in RNA, several C-to-T point mutations are introduced into the complementary sequence to the guide strand to reduce the tendency of the DNA strand to form hairpin structures without affecting siRNA processing.
[0016] Another objective of this application is to prepare protein products using the aforementioned anti-apoptotic recombinant baculovirus vector.
[0017] Another objective of this application is to prepare a vaccine using the aforementioned anti-apoptotic recombinant baculovirus vector.
[0018] This application clones the siRNA sequences and regulatory sequences of two commonly used industrial insect cells, Sf-caspase-1 and Tn-caspase-1, into the baculovirus genome, constructing a baculovirus expression vector that can prolong the survival of infected cells. This vector can be used to construct recombinant baculoviruses expressing exogenous genes. Because the viral vector carries siRNA sequences that inhibit insect cell apoptosis, the protein expression level of the obtained recombinant baculovirus is significantly increased after infecting insect cells. Tests showed that, using luciferase as a reporter gene, the luciferase activity and protein content of the anti-apoptotic vector in this application were approximately doubled in Sf9 cells and High Five cells (see appendix). Figure 3 , Figure 4 This demonstrates that the present application can indeed play its intended role in both cell lines. The baculovirus vector obtained in this application can be used for the industrial production of protein drugs and vaccines. Attached Figure Description
[0019] Figure 1 This application provides a schematic diagram of the anti-apoptotic mechanism of the recombinant baculovirus vector.
[0020] Figure 2 Comparison of GFP fluorescence intensity expressed using different embodiments of this application. Ctrl is the control that does not encode siRNA; 563-4T, 563-5T, 566, and 566-4T are examples of four anti-apoptotic vectors; the exogenous gene GFP is transcribed from the p10 promoter.
[0021] Figure 3 SDS-PAGE analysis results of luciferase expression prepared using the recombinant baculovirus vector provided in this application.
[0022] Figure 4 Enzyme activity detection results of luciferase expressed using the recombinant baculovirus vector provided in this application. Detailed Implementation
[0023] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0024] The application principle of the present invention will be described in detail below with reference to the accompanying drawings.
[0025] This application designs two RNAi target sites based on the shared sequence SEQ ID NO:1 of Sf-caspase-1 and Tn-caspase-1:
[0026] gccgcactgagacagatggct(563-583)
[0027] gcactgagacagatggctcac(566-586)
[0028] Four siRNA coding sequences were designed based on these two target sites (DNA sequences are: SEQ ID NO:4+loop+SEQ ID NO:2+TTTTT and SEQ ID NO:5+loop+SEQ ID NO:3+TTTTT):
[0029] 563-4T:gctgtattgagatagatggctgcttattaaagccatctgtctcagtgcggcttttt
[0030] 563-5T:gctgtattgagatagatggttgcttattaaagccatctgtctcagtgcggcttttt
[0031] 566:gcactgagacagatggctcacgcttattaagtgagccatctgtctcagtgcttttt
[0032] 566-4T:gcattgagatagatggtttacgcttattaagtgagccatctgtctcagtgcttttt
[0033] Furthermore, by overlapping PCR, the above sequences were ligated downstream of the human U6 promoter, so that transcription would begin from the first base "G" of the above sequences;
[0034] Furthermore, the siRNA sequence carrying the U6 promoter was knocked into a baculovirus expression vector (e.g., Figure 1 As shown, the knock-in method is described in Zhang X, Xu K, Ou Y, Xu X, Chen H. Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production. BMC Biotechnol. 2018, 18(1):24.), to obtain the anti-apoptotic baculovirus expression vector.
[0035] The application effects of this application will be further explained below with reference to the embodiments.
[0036] (1) Evaluation of the above four anti-apoptotic baculovirus expression vectors by expressing GFP
[0037] Five recombinant baculoviruses expressing GFP were obtained through homologous recombination, one of which served as a control (Ctrl) lacking an siRNA sequence. (See attached image.) Figure 2 As shown, the intensity of green fluorescence in Sf9 cells was detected by flow cytometry 4 days after infection. Except for 566-4T, the intensity of green fluorescence in the cells infected with the other three recombinant viruses was significantly higher than that in the control. This indicates that the shRNA of this application can indeed increase the expression level of exogenous genes. Among them, 563-5T was used as a candidate anti-apoptotic vector, and its expression effect in different cell lines was further investigated.
[0038] (2) Electrophoretic detection of luciferase expression level
[0039] Recombinant baculovirus carrying the luciferase gene was obtained through homologous recombination. Sf9 and High Five cells were infected with MOI 4, and cells were collected 2-5 days post-infection. After SDS-PAGE, Coomassie Brilliant Blue staining was performed for analysis. (See attached image) Figure 3 As shown, regardless of the cell type, the expression level of the anti-apoptotic vector was significantly higher than that of the control at any time.
[0040] (3) Enzyme activity detection of luciferase expression level
[0041] like Figure 4 As shown: After infecting Sf9 cells and High Five cells with the above-mentioned virus for 2-5 days, the expression level of luciferase was directly quantitatively detected using luciferase substrate. The results showed that the expression level of luciferase in the recombinant virus with siRNA was increased in both cell types, and the expression level reached twice that of the control on days 4-5 post-infection.
[0042] The above description is merely an embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. An shRNA, characterized in that, The shRNA is 563-4T, wherein the guide strand complementary sequence of 563-4T is gctgtattgagatagatggct, and the guide strand coding sequence of 563-4T is agccatctgtctcagtgcggc.
2. The shRNA as described in claim 1, characterized in that, The nucleotide sequence of the 563-4T is: gctgtattgagatagatggctgcttattaaagccatctgtctcagtgcggcttttt.
3. An expression carrier, characterized in that, It contains the shRNA as described in claim 1 or 2.
4. The expression vector as described in claim 3, characterized in that, The expression vector is a baculovirus.
5. The use of an expression vector as described in claim 3 or 4 in the preparation of recombinant proteins.
6. The use of an expression vector as described in claim 3 or 4 in the preparation of a vaccine.
Citation Information
Patent Citations
Recombinant baculovirus vector resistant to host apoptosis
CN106636207A