Rpa-cas12a one-pot detection system and application thereof

By designing specific crRNAs to achieve one-pot detection of RPA-Cas12a, the inconvenience and contamination risk of the two-step RPA-CRISPR method in aquaculture are solved, providing a highly sensitive and low-cost on-site detection method for AHPND.

CN116144814BActive Publication Date: 2026-04-21NANJING NORMAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310288775.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-22
Publication Date
2026-04-21
Estimated Expiration
2043-03-22

AI Technical Summary

Technical Problem

The existing RPA-CRISPR two-step detection technology is not suitable for point-of-care testing (POCT), and is inconvenient to operate and has the risk of contamination. In addition, the detection cost is high, making it difficult to meet the real-time detection needs of AHPND in aquaculture.

Method used

We designed a special crRNA based on the suboptimal protospacer adjacent motif to achieve simultaneous RPA amplification and CRISPR-Cas12a cleavage in the same reaction tube, simplifying the operation steps, avoiding contamination problems during amplicon transfer, and improving detection sensitivity.

Benefits of technology

It achieves simple, rapid, and highly sensitive AHPND detection, suitable for on-site testing in aquaculture, reducing testing costs and operational complexity, and improving the accuracy and stability of the detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144814B_ABST
    Figure CN116144814B_ABST
Patent Text Reader

Abstract

The application discloses a kind of RPA-Cas12a one-pot rapid detection system and application thereof, the system includes RPA premix and CRISPR-Cas12a premix;CRISPR-Cas12a premix includes ssDNA, Cas12a and crRNA;crRNA is the specific guide RNA sequence based on suboptimal PAM sequence design can guide Cas12a target recognition AHPND RPA product.This application designs specific crRNA, reduces the cleavage efficiency of Cas12a, makes RPA amplification process and CRISPR-Cas12a specific cleavage process simultaneously in a tube reaction, avoids the potential pollution risk of RPA amplification product transfer in two-step method and cumbersome steps, high sensitivity, good stability, provides high sensitivity, high accuracy, good stability, simple and fast AHPND on-site detection method for aquaculture industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention pertains to rapid on-site detection of important aquatic diseases, specifically involving an RPA-Cas12a one-pot detection system and its application. Background Technology

[0002] Acute hepatopancreatic necrosis disease (AHPND) is one of the most serious infectious diseases in shrimp farming. It has a rapid onset, high infectivity, and high mortality rate, causing enormous economic losses to the industry. Since there is currently no effective treatment, early diagnosis is fundamental to minimizing these losses. Traditional diagnostic methods for AHPND include analysis of disease-related symptoms and histopathological features. These methods are typically laborious, time-consuming, and yield uncertain results, requiring specialized personnel. The application of modern molecular techniques has enabled AHPND diagnosis to be completed in just a few hours, greatly improving detection efficiency. These molecular diagnostic methods are all based on PCR, including PCR, qPCR, and nested PCR, with nested PCR being the gold standard for AHPND molecular diagnosis. However, these PCR-based analyses cannot meet the needs of point-of-care testing (POCT) because they rely on laboratory thermal cycling equipment, often failing to meet on-site testing requirements. With the continuous development of technology, isothermal amplification technology has emerged. Loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) have been successfully applied to the diagnosis of acute hypothermic neural tube defects (AHPND) and have point-of-care testing (POCT) applications. However, due to its relatively recent development, current isothermal amplification technologies are not as stable as PCR and are easily affected by various environmental factors. For example, LAMP has isothermal reaction conditions and high amplification efficiency, but a high probability of false positive signals. Compared to LAMP, RPA offers more convenient isothermal conditions (25-42°C) and can be easily applied to POCT when combined with fluorescent probes or lateral flow strips (LFD). However, RPA-based lateral flow strip methods and fluorescence methods require expensive specific probes, resulting in high detection costs. The reaction signal originates from probe cleavage, leading to complex and unstable systems. Combining isothermal amplification technology with the CRISPR system is a good way to overcome these difficulties. Adding a CRISPR-Cas protein recognition step to the isothermal amplification step can improve the accuracy and sensitivity of detection. Based on this principle, the DETECTR detection technology has been successfully developed by combining RPA technology with the CRISPR-Cas12a system, and this technology has been widely used in the development of various detection methods. While the DETECTR-based detection method is accurate and reliable, an RPA-Cas12a detection system (Chinese application number 2022108198227) has been disclosed in the prior art. However, this two-step method, which separates the RPA amplification and CRISPR cutting steps, requires an amplicon transfer step, which is inconvenient and carries a risk of contamination. Therefore, developing a more convenient one-pot RPA-CRISPR method for rapid detection of acute hepatopancreatic necrosis disease in shrimp is of great significance. Summary of the Invention

[0003] Objective: To address the limitations of existing two-step detection techniques combining RPA and CRISPR / Cas12a for AHPND diagnosis, which are unsuitable for point-of-care testing (POCT) and pose a risk of contamination, this invention provides a one-pot RPA-Cas12a detection system. This invention utilizes a special crRNA designed based on suboptimal protospacer adjacent motifs (sPAM) and applies it for the first time to the hepatopancreatic necrosis disease system, successfully developing an RPA-CRISPR one-pot detection system. This system integrates RPA amplification and CRISPR / Cas12a cleavage into a simultaneous reaction, overcoming the incompatibility issue of RPA amplification and Cas12a cleavage occurring in a single reaction tube. Figure 1 The entire detection process requires only one sample addition step, avoiding potential contamination issues during amplicon transfer, simplifying the operation, and significantly improving detection sensitivity. This invention provides a new option for AHPND diagnosis with POCT purposes and offers valuable insights for developing RPA-CRISPR one-pot molecular diagnostic methods.

[0004] This invention also provides the application of the RPA-Cas12a one-pot detection system in the rapid on-site detection of hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0005] Technical Solution: To achieve the above objectives, the present invention provides an RPA-Cas12a one-pot detection system, comprising an RPA premix and a CRISPR-Cas12a premix; the RPA premix includes a forward primer RPA-F and a reverse primer RPA-R for amplifying RPA products; the CRISPR-Cas12a premix includes ssDNA, Cas12a, and crRNA; the ssDNA is a single-stranded DNA with a fluorescent group FAM and a quenching group BHQ1 modified at both ends, respectively; the crRNA is a specific guide RNA sequence designed based on a suboptimal PAM sequence to guide Cas12a to target and recognize AHPND RPA products.

[0006] The RPA-F sequence is CATCTTTGACGGAATTTAACCCTAACAAT; the RPA-R sequence is TAACTAAACCAATGTAATCATCTTTTGC.

[0007] The ssDNA sequence is 5'FAM-TTATT-3'BHQ1.

[0008] The crRNA sequence is preferably UAAUUUCUACUAAGUGUAGAUAUUAAUGUCUUGAAUUUUAUC.

[0009] Preferably, the RPA premix also includes RPA Buffer A and DEPC water; the RPA-Cas12a one-pot detection system also includes RPA Buffer B. Both RPA buffer A and RPA Buffer B are components of the RPA kit. RPA buffer A provides buffering conditions for the RPA reaction; RPA buffer B is magnesium acetate, used to initiate the RPA reaction.

[0010] Preferably, the CRISPR-Cas12a premix comprises LbCas12a, 10X NEB Buffer 2.1, crRNA, and the fluorescent molecule ssDNA-FQ.

[0011] Furthermore, the CRISPR-Cas12a premix comprises 0.5 μl LbCas12a (1 μM), 0.5 μl 10X NEBBuffer 2.1, 0.5 μl crRNA (1.2 μM), and 0.4 μl of the fluorescent molecule ssDNA-FQ (10 μM).

[0012] The application of the RPA-Cas12a one-pot detection system described in this invention in the rapid on-site detection of hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0013] The rapid on-site detection method is as follows: RPA premix, Cas12a premix and template DNA are added to RPA Buffer B and mixed in a real-time quantitative PCR instrument for one-pot reaction. During the quantitative PCR reaction, FAM fluorescence signal is collected, the endpoint signal is visible under ultraviolet light, and an image is captured.

[0014] The template DNA is a template DNA that may or may not contain a conserved sequence on the AHPND virulence gene pirB that distinguishes it from other species.

[0015] When the test sample is positive, the RPA product is a conserved sequence on the AHPND virulence gene pirB that is distinct from other species. In this case, the RPA product sequence is SEQ ID NO.1.

[0016] SEQ ID NO.1

[0017] ATGAGCCAGATATTGAAAACATTTGGGAACAATTACGTGACAGAATCCAAGATTTAGTAGATGAATCGATTATAGATGCCATCAATGGAATATTGGATAGCAAAATCAAAGAGACACGCGATAAAATTCAAGACATTAATGAGACTATCGAAAACTTCGGTTATGCTGCGGCAAAAGATGATTACATTGGTTTAGTTA

[0018] The application of the RPA-Cas12a one-pot detection system described in this invention in the preparation of a rapid on-site detection kit for hepatopancreatic necrosis, an important infectious disease in aquaculture.

[0019] This invention proposes a highly sensitive, highly accurate, stable, simple, and rapid on-site detection method for AHPND.

[0020] The rapid on-site detection method is as follows: Prepare an RPA premix by adding 25 μl of buffer A (RPA buffer A), 2 μl of forward primer RPA-F (10 μM), 2 μl of reverse primer RPA-R (10 μM), and 17.5 μl of DEPC water to one tube of RAA (basic) nucleic acid amplification reagent lyophilized enzyme. Prepare a CRISPR-Cas12a premix by mixing 0.5 μl of LbCas12a (1 μM), 0.5 μl of 10X NEB Buffer 2.1, 0.5 μl of crRNA (1.2 μM), and 0.4 μl of the fluorescent molecule ssDNA-FQ (10 μM) (its sequence is FAM-TTATT-BHQ1). Then, 9 μl of RPA premix, 4 μl of CRISPR-Cas12a premix, and 1 μl of template DNA were added to 1 μl of RPA Buffer B (containing 280 mM magnesium acetate) to initiate a one-pot reaction. The reaction was performed at 37°C for 90 min using an AppliedBiosystems QuantStudio 3 real-time quantitative PCR instrument, with FAM fluorescence signals acquired every minute. The endpoint signal was visible under ultraviolet light, and images were captured using a smartphone camera. 37°C is closest to human body temperature and is suitable for developing on-site detection methods.

[0021] This invention, by selecting a suboptimal PAM sequence and designing specific crRNA, successfully achieves a one-pot RPA-Cas12a detection system that simultaneously performs RPA amplification and CRISPR-specific target recognition and ssDNA cleavage in a single reaction tube. The detection signal originates from the fluorescence signal generated by Cas12a's specific recognition of the RPA amplicon and subsequent cleavage of ssDNA in the system. This avoids the potential contamination risks and cumbersome steps associated with transferring RPA amplification products in two-step methods. It offers high sensitivity and good stability, providing a highly sensitive, accurate, and stable on-site detection method for AHPND in aquaculture industries such as shrimp and crab farming. By combining the high amplification performance of RPA technology with the specific recognition characteristics of CRISPR-Cas12a technology, the detection signal originates from the non-specific single-stranded DNA cleavage activity activated after Cas12a's specific recognition of the RPA amplicon. This avoids the cumbersome screening process for RPA-specific probes, and the system is simpler, more stable, and suitable for application to the detection of other target genes. This invention utilizes RPA amplification technology to amplify a conserved DNA sequence on the AHPND virulence gene, and uses CRISPR-Cas12a technology to target and cleave the RPA amplicon, while simultaneously activating the non-specific ssDNA activity of Cas12a, thereby cleaving 5'FAM-TTATT-3'BHQ1 in the reaction system and generating a fluorescent signal.

[0022] RPA amplification products are targets of the CRISPR reaction. Current two-step AHPND detection methods cannot achieve a one-pot assay because the crRNA used is incompatible with both RPA and CRISPR reactions, resulting in insufficient RPA amplicon accumulation and poor detection sensitivity. This invention is the first to utilize a suboptimal PAM sequence to achieve a one-pot AHPND detection application based on RPA-CRISPR. This invention uses a suboptimal PAM strategy to design specific crRNAs compatible with both the RPA amplification and CRISPR reaction systems, thus establishing a one-pot assay. This is the first time that a one-pot, on-site detection of AHPND has been achieved, avoiding potential contamination from RPA amplification product transfer while simultaneously obtaining a large number of RPA amplicons, effectively improving sensitivity.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0024] 1. This invention is an application development in the development of rapid detection methods for AHPND, a significant aquaculture disease, through the optimized one-pot reaction of RPA amplification and CRISPR-Cas12a. It provides a rapid on-site detection method for AHPND, which is simpler than the two-step RPA-CRISPR method, eliminating the need for prior RPA amplification and avoiding the risk of contamination during the transfer step. The specific crRNA sequence designed in this method is specifically designed for the suboptimal PAM sequence of AHPND, overcoming the incompatibility between RPA amplification and CRISPR-Cas12a, achieving a simple, rapid, and highly sensitive one-pot method. This invention is the first to achieve one-pot detection of AHPND.

[0025] 2. The system and detection method provided by this invention offer a highly sensitive, highly accurate, stable, rapid and convenient on-site detection method for AHPND in aquaculture industries such as shrimp farming and crab farming.

[0026] 3. The RPA-Cas12a detection method of this invention is inexpensive, simple, highly sensitive, and stable for detecting AHPND. It does not rely on instruments or equipment and is very suitable for on-site detection, which helps to reduce the economic losses caused by AHPND infection in aquaculture. Attached Figure Description

[0027] Figure 1 Schematic diagram of RPA-Cas12a one-pot method for detecting AHPND;

[0028] Figure 2 Fluorescence curves of Cas12a nonspecific cleavage of ssDNA in each reaction tube guided by different crRNAs.

[0029] Figure 3 For RPA-Cas12a detection of AHPND specificity test;

[0030] Figure 4 Sensitivity test for AHPND detection using RPA-Cas12a. Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments and accompanying drawings.

[0032] Unless otherwise specified, all materials and reagents used in the embodiments are commercially available.

[0033] The sample source was Vibrio parahaemolyticus, which caused AHPND in the examples. AHPND(Environmental isolates from Nantong, China, provided by Jiangsu Provincial Marine Fisheries Research Institute, Pei Wang; Chao Ma; Lei Liao; Junwei Yu; Longyu Yi; Yi Qiao; Xin Liu; Song Gao; Hui Shen; Qunwei Lu; Simultaneous visual diagnosis of acute hepatopancreatic necrosis disease and Enterocytozoon hepatopenaei infection in shrimp with duplex recombinase polymerase amplification, Journal of Fish Diseases, 2021. Summer, 44:1753-1763), as well as a series of pathogens commonly used in shrimp farming, including Enterocytozoon hepatopancreatic necrosis (EHP), white spot virus (WSSV), iridovirus (SHIV), non-VPAHPND, and V. vulnificus), and clinical samples were all from Jiangsu Provincial Marine Fisheries Research Institute (Nantong, China).

[0034] Reagents and instruments: RAA nucleic acid amplification reagent (basic type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd., catalog number: S001ZC (containing RPA Buffer A and RPA Buffer B, RPA Buffer B contains); T7 High YieldRNA Transcription kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. Lba Cas12a (Cpf1) was purchased from NEB (catalog number M0653S, concentration 1 μM, specification 70 pmol); TIANamp Bacteria DNA Kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; TIANamp Genomic DNA Kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; Applied Biosystems QuantStudio 3 real-time fluorescence quantitative PCR instrument was purchased from Thermo Fisher Scientific, USA.

[0035] Example 1

[0036] 1. Design and preparation of specific crRNA

[0037] Based on the published RPA-nfo-based lateral flow test strip method (Pei Wang; Chao Ma; Lei Liao; Junwei Yu; Longyu Yi; Yi Qiao; Xin Liu; Song Gao; Hui Shen; Qunwei Lu; Simultaneous visual diagnosis of acute hepatopancreatic necrosis disease and Enterocytozoon hepatopenaei infection in shrimp with duplex recombinase polymerase amplification, Journal of Fish Diseases, 2021. Summer, 44:1753-1763), the target gene of AHPND was identified as pirB (GeneBank: NC_025152.1); the amplified RPA primer sequences were RPA-F: ATGAGCCAGATATTGAAAACATTTGGGAAC (the sequence is shown in SEQ ID NO.2); RPA-R: TAACTAAACCAATGTAATCATCTTTTGC (the sequence is shown in SEQ ID NO.3). By analyzing the nucleic acid sequence of the RPA amplicon, the sPAM with the sequence "TCTC" was selected to design a specific crRNA, with the sequence: UAAUUUCUACUAAGUGUAGAUAUUAAUGUCUUGAAUUUUAUC. The primer sequences were synthesized by General Sangon Biotech (Shanghai) Co., Ltd.

[0038] 2. crRNA preparation and optimization

[0039] Based on the principle of in vitro transcription using T7 RNA polymerase, a T7 promoter-crRNA-transcription terminator sequence (TAATACGACTCACTATAGGG) was designed. TAATTTCTACTAAGTGTAGAT ATTAATGTCTTGAATTTTATC The protein (TTCCATCTGTTTTCTTATCTGTTCTTTCATCT GTTCTTTTATCTGTTTGTTT) was synthesized by Universal Biotechnology and inserted into the pUC57 vector (purchased from Universal Biosystems (Anhui) Co., Ltd.) to obtain pUC57-crRNA1 (inserted between the two restriction sites BamHI and XhoI in the multiple cloning site region of the pUC57 plasmid), which was used for in vitro transcription of crRNA1.

[0040] Subsequently, using this plasmid as a template, the plasmid pUC57-crRNA 2-9, which contains other crRNA sequences for in vitro transcription, was constructed using molecular cloning technology.

[0041] The sequences used for transcription in the plasmid are: TAATACGACTCACTATAGGG TAATTTCTACTAAGTGTAGAT- N 21 - ATTCCATCT GTTTCTTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT

[0042] pUC57-crRNA 1 corresponds to the crRNA used in this invention.

[0043] Subsequently, linearized crRNA plasmids were prepared using the restriction endonuclease Xho I (all procedures were performed according to the reagent manufacturer's instructions). In vitro transcription was performed using the purified linearized pUC57-crRNA plasmid as a template. The reaction system was prepared according to the recommended system of the T7 High Yield RNA Transcription kit, and the reaction was carried out in a PCR instrument at 37°C for 16 hours. The crRNA was purified by phenol / chloroform extraction, and its concentration was determined using qubit 4. Finally, the crRNA was aliquoted and stored at -80°C.

[0044] 3. AHPND plasmid extraction and bacterial genomic DNA preparation

[0045] The AHPND standard plasmid was extracted from the bacterial suspension of Vibrio parahaemolyticus, which causes AHPND, and its name is pVPA3-1. The specific steps are as follows: Take 10 μl of glycerol bacterial suspension stored at -80℃ (Vibrio parahaemolyticus, which causes AHPND). AHPND The plating was streaked onto a solid medium containing alkaline peptone (1L deionized water containing 20g peptone, 20g sodium chloride, and 10g agar powder, pH 8.6±0.2), and then inverted in a 30°C incubator overnight. The next day, one single colony was picked and inoculated into 5mL of liquid alkaline peptone medium (1L deionized water containing 20g peptone and 20g sodium chloride, pH 8.6±0.2), and cultured at 200 rpm for 12 hours in a 30°C shaker. The pVPA3-1 plasmid was then extracted from the bacterial culture using a TIANprep Mini Plasmid kit, and finally eluted with 50μl of elution buffer to obtain the AHPND standard plasmid. The concentration was determined using a Nanodrop micro spectrophotometer, and used in subsequent Examples 2-4.

[0046] The bacterial genomic DNA used for specific experiments was prepared by boiling. The specific procedure is as follows: Take 1 ml of the logarithmic phase culture medium of each of the above bacteria (Vibrio parahaemolyticus (ATCC 17802) and Vibrio vulnificus (ATCC 27562), centrifuge at 8000 rpm for 5 min, add 200 μl of sterile water to resuspend, boil at 100℃ for 10 min, centrifuge at 13000g for 5 min, and take 1 μl of the supernatant as a template for subsequent use in Example 3.

[0047] The viral genome used for specific experiments was extracted from shrimp infected with the corresponding pathogen. The specific procedure was as follows: After sterilizing shrimp tissue with ethanol, 1g was added to 9mL of PBS and homogenized using a handheld third-generation tissue homogenizer. 10-50mg of genomic DNA was extracted from the shrimp tissue according to the instructions of the Magnetic Universal Genomic DNA Kit. The concentration of the purified genomic DNA was determined using a Nanodrop micro-spectrophotometer, and used in subsequent Example 3.

[0048] 4. Clinical Sample Preparation

[0049] Shrimp tissue for clinical samples was sterilized with ethanol, and 1g was added to 9mL of PBS and homogenized using a handheld third-generation tissue homogenizer. Genomic DNA was extracted from the shrimp tissue using 10-50mg of the Magnetic Universal Genomic DNA Kit according to the instructions. The concentration of the purified genomic DNA was determined using a Nanodrop micro-spectrophotometer, which was used in Example 5.

[0050] Example 2

[0051] Construction of a one-pot RPA-Cas12a detection system and its fluorescence detection method based on the CRISPR-Cas12a system.

[0052] 1. RPA premix preparation: The RPA amplification system should be prepared according to the instructions of the RAA nucleic acid amplification reagent (basic type). Add 400 nM forward primer (RPA-F) and reverse primer (RPA-R), 25 μl of RPA Buffer A, and 17.5 μl of DEPC water to each 50 μl of RPA enzyme powder in the kit. Cap the tube, invert it to mix thoroughly, and centrifuge at low speed for 10 seconds.

[0053] 2. Construction of the RPA-Cas12a detection system: First, a CRISPR-Cas12a premix was prepared, consisting of 0.5 μl LbCas12a (1 μM), 0.5 μl 10X NEB Buffer 2.1, 0.5 μl crRNA (1.2 μM), and 0.4 μl of the fluorescent molecule ssDNA-FQ (10 μM) (its sequence is FAM-TTATT-BHQ1). Then, 9 μl of the RPA premix, 4 μl of the CRISPR-Cas12a premix, and 1 μl of template DNA (AHPND standard plasmid) were reacted in a one-pot reaction, and 1 μl of RPA Buffer B was added to initiate the reaction.

[0054] 3. CRISPR-Cas12a-based fluorescence detection method: A one-pot reaction was performed at 37°C for 90 minutes using an Applied Biosystems QuantStudio3 real-time quantitative PCR instrument, with FAM fluorescence signals acquired every minute. The endpoint signal was visible under ultraviolet light, and images were captured using a smartphone. 37°C is closest to human body temperature, making it suitable for developing on-site detection methods. The entire RPA-Cas12a detection principle for AHPND is as follows: Figure 1 As shown.

[0055] 4. Different crRNAs screen for Cas12a nonspecific ssDNA cleavage activity

[0056] Using the AHPND RPA product as a template, nine designed crRNAs were tested to screen for the crRNAs with the highest Cas12a nonspecific ssDNA cleavage activity. The specific steps are as follows: 9 μl of RPA premix, 4 μl of CRISPR-Cas12a premix (containing nine different crRNAs), and 1 μl of template DNA were reacted in a one-pot reaction. 1 μl of RPABuffer B (containing 280 mM magnesium acetate) was added to initiate the reaction (prepared in step 2 of Example 2). The reaction solution was placed in a 37°C qPCR instrument for 60 min, with FAM fluorescence signals read once per minute. The Cas12a nonspecific ssDNA cleavage activity was determined based on the endpoint fluorescence values ​​of different reaction tubes. Subsequently, the reaction tubes were placed under UV light, and the fluorescence intensity of each reaction tube was observed visually. The fluorescence values ​​of each reaction tube and the endpoint fluorescence results are shown below. Figure 2The results showed that, compared with other crRNAs (see Table 1), Cas12a nonspecific ssDNA cleavage activity was the highest under the guidance of crRNA 1. Other crRNAs could not achieve one-pot cleavage, only crRNA 1 could achieve one-pot cleavage and produce a visible fluorescent signal. This crRNA 1 (UAAUUUCUACUAAGUGUAGAUAUUAAUGUCUUGAAUUUUAUC) was used as the crRNA in subsequent examples for subsequent detection. At the same time, the crRNA in Chinese application number 2022108198227 (UAAUUUCUACUAAGUGUAGAUAUUUUGCUAUCCAAUAUUCCA) was tested according to the above method, and the results were similar. Figure 2 crRNA2-9,

[0057] Example 3

[0058] Specificity testing of the RPA-Cas12a one-pot detection system and method

[0059] The method established in steps (2) and (3) of Example 2 was applied to evaluate the specificity of the method by detecting several common Vibrio species in shrimp farming.

[0060] AHPND plasmids and bacterial genomic DNA prepared according to step (3) of Example 1 were used to evaluate the specificity of the method established in this study.

[0061] RPA-CRISPR one-pot fluorescence detection was performed according to Example 2. The primers and reagents used for RPA amplification with genomic DNA as templates for each bacterium were the same as those in Example 2.

[0062] The results are as follows Figure 3 , Figure 3 Several common Vibrio species in shrimp farming, including Vibrio parahaemolyticus (ATCC 17802) and Vibrio vulnificus (ATCC 27562), were used to prepare corresponding genomic DNA according to step (3) of Example 1. The DNA was then detected using the RPA-Cas12a one-pot method established in this invention. The fluorescence curves corresponding to different templates are shown in the left figure, and the endpoint fluorescence of each reaction tube under blue light is shown in the right figure. The established RPA-Cas12a one-pot method can only detect AHPND; other similar pathogens cannot be detected, indicating that the method has good specificity.

[0063] Example 4

[0064] Sensitivity Testing of RPA-Cas12a Detection System and Method

[0065] The need for early detection of AHPND in aquaculture has driven the demand for highly sensitive detection technologies. The method established in step (3) of Example 2 was applied by detecting AHPND through 10-fold serial dilutions. 1 -10 5 The sensitivity of this method was evaluated by using copies / μl of AHPND standard plasmid.

[0066] Specifically, the AHPND standard plasmid was extracted according to step (3) of Example 1, and its concentration was determined using Nanodrop. Then, the copy number was calculated based on the plasmid size of 69168 bp. The plasmid was then serially diluted 10-fold to prepare 10 5 10 4 10 3 10 2 10 1 AHPND standard plasmid copies / μl were prepared. Fluorescence detection was performed according to steps (1)(2)(3) of Example 2.

[0067] The results are as follows Figure 4 , Figure 4 The AHPND standard plasmid was serially diluted 10-fold to prepare 10 5 10 4 10 3 10 2 10 1 Copies / μl were tested using the RPA-Cas12a one-pot method established in this invention. Fluorescence curves corresponding to different templates are shown in the left figure, and the endpoint fluorescence of each reaction tube under blue light is shown in the right figure. The detection limit of the established RPA-Cas12a method is 10. 2 The number of copies / μl has already met the testing requirements of current industry standard testing methods.

[0068] Example 5

[0069] Comparison of RPA-Cas12a one-pot detection system and method with industry standard detection method nested PCR (AP4)

[0070] 1. The specific process of the RPA-Cas12a one-pot method is as follows: 18 clinical samples are processed according to the method of step (4) in Example 1 above to prepare shrimp genomic DNA as DNA template samples for clinical tissues.

[0071] Using 1 μl of clinical sample DNA prepared according to the above steps as a template, the method established in steps (1), (2), and (3) of Example 2 was applied to perform one-pot testing on 18 clinical samples.

[0072] 2. AP4 method: Take 1 μl of the clinical sample DNA prepared according to the above steps as a template and perform PCR amplification using the AP4-1F and AP4-1R primer pairs in Table 1 (94℃, 3 min; [94℃, 30 s; 55℃, 30 s; 72℃, 90 s] 30 cycles; 72℃, 2 min). Then take 1 μl of the previous round PCR product as a template for the second round of PCR amplification (94℃, 3 min; [94℃, 30 s; 55℃, 30 s; 72℃, 30 s] 25 cycles; 72℃, 2 min). Perform agarose gel electrophoresis on the PCR product. If a 230 bp fragment (its sequence is as shown in SEQ ID NO.4) is present, it is positive.

[0073] Table 1 Primer sequences

[0074]

[0075] SEQ ID NO.4

[0076] TTGAGAATACGGGACGTGGGGAGCTTACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGCGGCTGGAAAGTGGCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCTGATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGTCGTGGTTTCTGTACAATCTATTACCACTAAGAAGGTGCTCACATGACTAAC

[0077] Using the method established in steps (1), (2), and (3) of Example 2 above, 18 clinical samples were tested and compared with the industry standard detection method nested PCR (AP4). Three independent replicate experiments were also performed.

[0078] The results, shown in Table 2, indicate that the actual detection results of the two methods are completely consistent.

[0079] Table 2. Clinical Sample Testing

[0080]

[0081]

Claims

1. The application of an RPA-Cas12a one-pot detection system in the preparation of a rapid on-site detection reagent for hepatopancreatic necrosis, an important infectious disease in aquaculture; the method of application is as follows: RPA premix, Cas12a premix and template DNA are added to RPA Buffer B and mixed in a real-time quantitative PCR instrument for one-pot reaction, and quantitative PCR is performed. During the reaction, FAM fluorescence signal is collected, the endpoint signal is visible under ultraviolet light, and an image is captured; The RPA premix includes a forward primer RPA-F, a reverse primer RPA-R, RPA Buffer A, and DEPC water for amplifying the RPA product; the Cas12a premix includes LbCas12a, 10x NEB Buffer 2.1, crRNA, and ssDNA; the ssDNA is a single-stranded DNA with a fluorescent group FAM and a quenching group BHQ1 modified at both ends; the crRNA is a specific guide RNA sequence designed based on a suboptimal PAM sequence to guide Cas12a to target and recognize the AHPND RPA product. The sequence of RPA-F is ATGAGCCAGATATTGAAAACATTTGGGAAC; the sequence of RPA-R is TAACTAAACCAATGTAATCATCTTTTGC; The sequence of the ssDNA is 5'FAM-TTATT-3'BHQ1; The crRNA sequence is UAAUUUCUACUAAGUGUAGAUAUUAAUGUCUUGAAUUUUAUC.

2. Use according to claim 1, characterized in that, The template DNA is with or without AHPND virulence genes pirB The template DNA of the last paragraph is distinguished from the conserved sequences of other species.

Citation Information

Patent Citations

  • Rapid detection kit and detection method for prawn acute hepatopancreatic necrosis disease based on CRISPR / Cas12a

    CN114350759A