PCR amplification system and PCR nucleic acid detection method

By optimizing the PCR amplification system using tetramethylene sulfoxide-modified gold nanoparticles and ATP catalytic reagent, and by moving the PCR system between high and low temperatures, the problem of excessively long PCR amplification time was solved, achieving rapid and efficient nucleic acid amplification.

CN116218962BActive Publication Date: 2026-06-26XIAMEN WIZ BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIAMEN WIZ BIOTECH CO LTD
Filing Date
2022-12-21
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing PCR amplification techniques are too time-consuming, resulting in low efficiency in scientific research experiments.

Method used

Tetramethylene sulfoxide-modified gold nanoparticles were used as PCR additives, and combined with ATP catalytic reagents and magnesium and potassium ions to optimize the PCR amplification system. At the same time, the PCR system was moved between high-temperature and low-temperature regions for rapid amplification.

Benefits of technology

It significantly shortens PCR amplification time, improves amplification rate and sensitivity, and ensures amplification effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004011262830000041
    Figure BDA0004011262830000041
  • Figure BDA0004011262830000051
    Figure BDA0004011262830000051
Patent Text Reader

Abstract

The application relates to the field of biology, and particularly discloses a PCR amplification system and a PCR nucleic acid detection method; the PCR amplification system comprises a PCR additive, the PCR additive comprises tetramethylene sulfoxide modified gold nanoparticles, and the particle size of the tetramethylene sulfoxide modified gold nanoparticles is 0.5-1.1 nm; and the amplification method comprises the following steps: S1, configuring a PCR reaction system, adding template DNA into the prepared reaction system to prepare a mixed solution; S2, placing the mixed solution in a high-temperature reaction zone and a low-temperature reaction zone to perform 30-45 amplification cycles, the temperature of the high-temperature reaction zone is one fixed temperature or a temperature interval in the range of 94 DEG C-100 DEG C, and the temperature of the low-temperature reaction zone is one fixed temperature or a temperature interval in the range of 50 DEG C-65 DEG C. The method has the advantages of shortening the time of the PCR amplification process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biology, and more specifically, to a PCR amplification system and a PCR nucleic acid detection method. Background Technology

[0002] Polymerase chain reaction (PCR) has become a routine technique for nucleic acid testing.

[0003] With the increasing application of PCR technology, the use of PCR for detecting different types of samples and the increasing sample volume have placed higher demands on analytical efficiency and cost. Therefore, for nucleic acid detection, further shortening PCR amplification time and developing rapid PCR technology is of great significance for the rapid detection of large sample volumes and the timeliness of special samples such as clinical samples.

[0004] Currently, a typical PCR procedure disclosed in related technologies usually consists of three basic reaction steps: repeated high-temperature denaturation, low-temperature annealing, and optimal-temperature extension. For short fragments, a two-step cycle amplification method can also be used, such as 94℃ for 30 seconds and 60℃ for 30 seconds. A complete PCR process usually takes more than an hour.

[0005] The aforementioned technologies require a significant amount of time to complete a full PCR amplification procedure, which slows down the progress of scientific research experiments. Summary of the Invention

[0006] To shorten the PCR amplification process and improve the efficiency of scientific research experiments, this application provides a PCR amplification system and a PCR nucleic acid detection method.

[0007] Firstly, this application provides a PCR amplification system, employing the following technical solution:

[0008] The PCR amplification system includes a PCR additive, which includes tetramethylene sulfoxide-modified gold nanoparticles with a particle size of 0.5-1.1 nm and a molar ratio of tetramethylene sulfoxide to gold nanoparticles of 1:(1-5).

[0009] By employing the above-mentioned technical solutions, gold nanoparticles can shorten the PCR reaction time and improve PCR sensitivity in the PCR reaction system. Tetramethylene sulfoxide (TMS) is the most effective sulfoxide compound for improving the specificity of PCR reactions and increasing the yield of the target product. Gold nanoparticles combined with TMS are a novel composite PCR additive that can significantly improve PCR reaction performance, thereby accelerating the PCR reaction time.

[0010] Preferably, the concentration of the tetramethylene sulfoxide-modified gold nanoparticles is 0.2-2.0 nmol / L.

[0011] By adopting the above technical solution, the concentration of tetramethylene sulfoxide-modified nanoparticles at 0.2-2.0 nmol / L has the best effect on accelerating the amplification of PCR system.

[0012] Preferably, the PCR amplification system further includes: Tris-HCl 20mM, K 2+ 70mM, Mg 2+ 50 mM, 0.3 mM each of dNTPs, 5 μM each of primers and probes, 3 mM ATP, ATP catalytic reagent and 25 U DNA polymerase.

[0013] By employing the above technical solution, magnesium and potassium ions bind to the enzyme-substrate complex during enzyme catalysis, thereby lowering the activation energy of the catalytic reaction and enabling the reaction to proceed. The role of ATP and ATP catalytic reagent is that ATP provides energy for the synthesis of daughter DNA strands from dNTPs, while the ATP catalytic reagent converts ADP into ATP to continue providing energy for the synthesis of daughter DNA strands. Adding magnesium chloride and potassium chloride to the system introduces magnesium and potassium ions to accelerate the reaction rate, and adding ATP and the ATP catalytic reagent also aims to accelerate the synthesis reaction, thereby speeding up PCR.

[0014] Preferably, the ATP catalytic reagent comprises 100 μg / μL creatine kinase and 20 mM phosphocreatine.

[0015] By adopting the above technical solution, after ATP provides energy for the synthesis of dNTP daughter chains, it is converted into ADP. Creatine kinase is used to promote the catalytic binding of phosphocreatine and ADP, so that ADP regains high-energy phosphate bonds and is restored to ATP, thus continuing to provide energy for the synthesis of dNTP daughter chains. This speeds up the synthesis of dNTP daughter chains, thereby increasing the amplification rate of PCR.

[0016] Preferably, the PCR additive consists of gold nanoparticles modified with tetramethylene sulfoxide.

[0017] Preferably, the method for preparing the tetramethylene sulfoxide-modified gold nanoparticles includes the following steps:

[0018] (1) Take 0.8-1.2% tetrachloroauric acid trihydrate and add it to water. After stirring, add 1% trisodium citrate aqueous solution to the solution and continue stirring. Then add 0.075% sodium borohydride solution prepared with 1% trisodium citrate aqueous solution as solvent to the solution to obtain a hydrosol of gold nanoparticles.

[0019] (2) The obtained gold nanoparticles hydrosol was mixed with anhydrous ethanol and heated and stirred. The molar ratio of tetramethylene sulfoxide solution to tetrachloroauric acid was 1:(1-5). After the solution boiled, tetramethylene sulfoxide solution was added to the solution and stirred continuously. After cooling, a black precipitate was collected, which is the tetramethylene sulfoxide-modified gold nanoparticles.

[0020] By employing the above technical solution, tetrachloroauric acid trihydrate and trisodium citrate are reacted first, with trisodium citrate acting as a reducing agent and sodium borohydride as a catalyst, to prepare a hydrosol of gold nanoparticles. Gold nanoparticles exhibit high specificity in PCR. Due to the presence of gold nanoparticles, the annealing temperature required for PCR is increased, and the transition time between high and low temperatures is shortened, thereby improving the PCR reaction speed. Tetramethylene sulfoxide can effectively remove the local secondary structure of the template strand, thereby increasing the specific binding of primers and probes to the template. Therefore, modifying gold nanoparticles with tetramethylene sulfoxide can achieve a better effect in improving the amplification rate.

[0021] Preferably, the PCR nucleic acid detection method includes the following steps:

[0022] S1: Prepare the PCR reaction system by adding template DNA to the prepared reaction system to obtain a mixture;

[0023] S2: Place the mixture in a high-temperature reaction zone and a low-temperature reaction zone for 30-45 amplification cycles. The temperature of the high-temperature reaction zone is a fixed temperature or temperature range of 94℃-100℃, and the temperature of the low-temperature reaction zone is a fixed temperature or temperature range of 50℃-65℃.

[0024] By adopting the above technical solution, in S1, the PCR amplification system is configured according to the standard, and then template DNA is added to the system to form a mixture. In S2, the prepared mixture is placed in high-temperature and low-temperature reaction zones to denature and open the DNA, followed by annealing and renaturation. The single-stranded template strand binds to the primers and probes, and dNTPs synthesize daughter strands under the principle of complementary base pairing. This process is repeated to allow the DNA template strand to replicate in large quantities. Finally, in S3, fluorescence detection is performed using the endpoint method to observe the amplification results.

[0025] Secondly, this application provides a PCR nucleic acid detection method, which adopts the following technical solution:

[0026] The extracted DNA template was added to the PCR amplification system for amplification.

[0027] Preferably, the amplification procedure is as follows: reacting in the high-temperature zone for 1-4 seconds, then reacting in the low-temperature zone for 2-5 seconds; performing 30-45 cycles.

[0028] Preferably, the amplification program is as follows: 96℃ hot start for 15s, 40 cycles, each cycle including 96℃ denaturation for 1s, 58℃ annealing extension for 2s, and a total amplification time of 4min15s.

[0029] By adopting the above technical solution, firstly, the mixture moves between the high-temperature zone and the low-temperature zone, and the residence time of the mixture in the high-temperature zone and the low-temperature zone is ensured by setting the width of the high-temperature zone and the low-temperature zone on the path; secondly, when the mixture moves at a constant speed along the set path, the process of high-temperature denaturation and low-temperature renaturation can be realized. Compared with the traditional method of changing the reaction temperature, the scheme of setting high-temperature zone and low-temperature zone makes the amplification time shorter and the efficiency higher.

[0030] Finally, after numerous trials, the optimal amplification program was designed: 2 seconds in the high-temperature zone, 4 seconds in the low-temperature zone, 40 cycles, plus a 15-second pre-denaturation time at 96℃, for a total amplification time of 4 minutes and 15 seconds. Following this pre-defined program for PCR amplification not only significantly shortens the amplification time but also ensures the best possible amplification results, achieving the optimal rapid amplification effect.

[0031] In summary, this application has the following beneficial effects:

[0032] 1. Since this application uses tetramethylene sulfoxide to modify gold nanoparticles, the annealing temperature of the template strand in the PCR reaction can be increased, thereby shortening the temperature rise and fall time of the system from high temperature to low temperature, thus accelerating the PCR amplification rate. Tetramethylene sulfoxide can effectively contact the local secondary structure in the template strand, thereby increasing the specific binding of primers and probes to the template strand. Therefore, the PCR additive prepared after modifying gold nanoparticles with tetramethylene sulfoxide can effectively accelerate the high-temperature denaturation and low-temperature annealing process in the PCR amplification process, thus shortening the PCR reaction time.

[0033] 2. In this application, ATP and ATP catalytic reagents are preferred. The ATP catalytic reagents include creatine kinase and phosphocreatine. ATP can provide energy for the process of dNTP synthesis of daughter chains, thereby accelerating its completion. After ATP releases energy, it generates ADP. Creatine kinase can promote the binding of phosphocreatine and ADP, so that ADP can regain energy and become ATP, thereby accelerating the process of dNTP synthesis of daughter chains.

[0034] 3. The method of this application replaces the traditional amplification method of fixing the PCR system and changing the ambient temperature with setting two different temperature zones of high and low temperature to move the PCR system. First, it directly saves the time wasted on heating and cooling. Second, due to the special amplification system of PCR, the time required for high-temperature denaturation in the high-temperature zone and low-temperature annealing in the low-temperature zone is greatly reduced, thereby achieving the purpose of rapid PCR amplification. Detailed Implementation

[0035] The present application will be further described in detail below with reference to the embodiments.

[0036] The sources of the raw materials used in this application are as follows:

[0037] Preparation example of tetramethylene sulfoxide-modified gold nanoparticles

[0038] Preparation Example 1

[0039] ① Preparation of gold nanoparticles:

[0040] Add 1 mL of 1% tetrachloroauric acid trihydrate to 97 mL of water and stir vigorously for 1 minute. Then, quickly add 1 mL of 1% trisodium citrate aqueous solution and stir for another minute. Next, add 1 mL of 0.075% sodium borohydride solution prepared using 1% trisodium citrate aqueous solution as a solvent and continue stirring for 5 minutes. The resulting wine-red solution is a hydrosol of gold nanoparticles.

[0041] ② Preparation of tetramethylene sulfoxide-modified gold nanoparticles:

[0042] The prepared gold sol (0.8 nM) was mixed with anhydrous ethanol in a 1:1 (volume ratio) mixture in a three-necked flask. The mixture was heated and stirred until boiling. Then, a tetramethylene sulfoxide solution with a molar ratio of 1:3 to tetrachloroauric acid was added, and the mixture was stirred continuously for one hour. After cooling, a black precipitate was observed at the bottom of the flask. The black precipitate was washed three times with anhydrous ethanol, dissolved in chloroform, and filtered to obtain a chloroform solution of tetramethylene sulfoxide-modified gold nanoparticles. The solution was pink in color. Evaporating the chloroform yielded the black tetramethylene sulfoxide-modified gold nanoparticles.

[0043] Example

[0044] Example 1

[0045] Table 1 PCR amplification system

[0046]

[0047]

[0048] Primers and probes include:

[0049] Upstream primer: 5'-CTCTCACTCAACATGGCAAGGAAGACCTTA-3';

[0050] Downstream primer: 5'-TTGTTAGCACCATAGGGAAGTCCAGCTTCT-3';

[0051] Fluorescent probe: 5'-FAM-CACCAATAGCAGTCCAGATGACCA-BHQ1-3';

[0052] Template DNA gene sequence:

[0053] TTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGT

[0054] TCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCA

[0055] GACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACT

[0056] ACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGG

[0057] This sequence was inserted into the pUC57 plasmid to synthesize a plasmid containing this sequence, named pUC57-a plasmid (0.1 ng / μL), which was synthesized by Shanghai Bailige Biotechnology Co., Ltd.

[0058] A novel method for rapid PCR nucleic acid detection and amplification:

[0059] S1: Mix 0.3 μL of pUC57-a plasmid, 0.3 μM upstream primer, 0.3 μM downstream primer, 0.5 μM fluorescent probe and PCR system, and add ultrapure water to make up to 10 μL to prepare a mixture.

[0060] S2: Set the PCR amplification program: 96℃ hot start for 10s, 40 cycles, each cycle includes 96℃ denaturation for 1s, 58℃ annealing extension for 2s, total amplification time is 4min 15s;

[0061] S3: Place the mixture from S1 into a 0.1 mL PCR tube. Place the PCR tube into a fixture consisting of a 96℃ metal bath module, a 58℃ metal bath module, a fluorescence detection module, and a robotic arm module. First, use an ELISA reader to detect the fluorescence value of the liquid before the reaction. Then, perform amplification according to the PCR amplification program. After amplification, use an ELISA reader to detect the endpoint fluorescence value. The PCR amplification effect can be judged by comparing the changes in fluorescence value.

[0062] Example 2

[0063] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that the concentration of the PCR additive in the PCR system is 0.2 nmol / L.

[0064] Example 3

[0065] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that the concentration of the PCR additive in the PCR system is 2.0 nmol / L.

[0066] Example 4

[0067] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that template DNA extraction: total DNA extraction from a single thrips was performed using a commercially available kit. The Takara Universal 9765 kit from Takara Bio was used.

[0068] Upstream primer: 5'-TGACCAAACTCAACGACCAGAC-3';

[0069] Downstream primer: 5'-ATCCAAGCGAACGAGACAAG-3';

[0070] Fluorescent probe: 5'-FAM-CGAACGCCGAGCCCACACT-BHQ1-3'.

[0071] Example 5

[0072] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that the concentration of the PCR additive in the PCR system is 0.2 nmol / L.

[0073] Example 6

[0074] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that the concentration of the PCR additive in the PCR system is 2.0 nmol / L.

[0075] Comparative Example

[0076] Comparative Example 1

[0077] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that no PCR additives are added to the PCR system used.

[0078] Comparative Example 2

[0079] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that the PCR system used does not contain creatine kinase and creatine phosphate.

[0080] Comparative Example 3

[0081] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that the concentration of the PCR additive in the PCR system is 0.1 nmol / L.

[0082] Comparative Example 4

[0083] A novel rapid PCR nucleic acid detection amplification method differs from Example 1 in that the concentration of the PCR additive in the PCR system is 2.2 nmol / L.

[0084] Comparative Example 5

[0085] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that no PCR additives are added to the PCR system used.

[0086] Comparative Example 6

[0087] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that the PCR system used does not contain creatine kinase and phosphocreatine.

[0088] Comparative Example 7

[0089] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that the concentration of the PCR additive in the PCR system is 0.1 nmol / L.

[0090] Comparative Example 8

[0091] A novel rapid PCR nucleic acid detection amplification method differs from Example 4 in that the concentration of the PCR additive in the PCR system is 2.2 nmol / L.

[0092] Table 2

[0093] Examples / Comparative Examples Initial fluorescence value endpoint fluorescence value Endpoint fluorescence value: Initial fluorescence value Example 1 811.5 3502.1 4.3 Example 2 825.2 3229.7 3.9 Example 3 798.1 3199.8 4.0 Comparative Example 1 832.7 2674.9 3.2 Comparative Example 2 797.5 2950.8 3.7 Comparative Example 3 817.7 2884.4 3.5 Comparative Example 4 762.3 2323.6 3.0 Example 4 796.1 2156.8 2.7 Example 5 799.3 2076.8 2.6 Example 6 775.2 1978.3 2.5 Comparative Example 5 808.8 1765.5 2.2 Comparative Example 6 792.3 1835.9 2.3 Comparative Example 7 747.9 1720.2 2.3 Comparative Example 8 773.9 1315.6 1.7

[0094] Combining Examples 1, 2, and 3 with Comparative Example 1, and referring to Table 2, it can be seen that the optimal concentration of the PCR additive is 1.0 nmol / L, and the addition of the PCR additive has a significant effect on accelerating PCR amplification. Calculations of fluorescence values ​​show that, within the same time frame, the system with the PCR additive amplified more progeny strands than the system without the additive, indicating that the tetramethylene sulfoxide-modified gold nanoparticles do have an effect on accelerating PCR. Furthermore, data from Examples 4, 5, and 6, as well as Comparative Example 3, also demonstrate that this system accelerates PCR amplification regardless of the template strand and amplification process.

[0095] Combining Examples 1, 5, 4, and 6, and referring to Table 2, it can be seen that when no ATP catalytic reagent is added, i.e., when there is no creatine kinase and phosphocreatine in the PCR system, after ATP is consumed, there is no replenished ATP to provide energy for the synthesis of daughter chains of dNTPs, thus slowing down the PCR amplification rate. Through the comparison of Examples 1 and 2, and Examples 4 and 6, combined with the results in Table 2, this system can achieve a significant speed-up effect in the amplification of two different template chains.

[0096] Based on Examples 1, 5, and 6, as well as Examples 4, 7, and 8, and referring to Table 2, it can be seen that the amplification efficiency of the PCR additive decreases when the concentration is greater than 2.0 nmol and less than 0.2 nmol. Since the catalytic efficiency of the PCR additive for PCR amplification is negligible when the concentration is less than 0.2 nmol, almost no amplification effect is observed in practical applications. When the concentration is in the range of 0.2-2.0 nmol, it promotes and accelerates PCR amplification. However, when the concentration is greater than 2.0 nmol, it inhibits PCR amplification. Therefore, 1.0 nmol is the concentration with the best amplification effect.

[0097] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A PCR amplification system, characterized in that, The PCR amplification system includes PCR additives, Tris-HCl 20mM, and K. + 70mM, Mg 2+ The PCR additives include 50 mM ATP, 0.3 mM dNTPs, 5 μM primers and probes, 3 mM ATP, ATP catalytic reagent, and 25 U DNA polymerase; the PCR additives include tetramethylene sulfoxide-modified gold nanoparticles with a particle size of 0.5-1.1 nm and a concentration of 0.2-2.0 nmol / L. The ATP catalytic reagent comprises 100 μg / μL creatine kinase and 20 mM phosphocreatine; The preparation method of the tetramethylene sulfoxide-modified gold nanoparticles includes the following steps: (1) Take 0.8-1.2% tetrachloroauric acid trihydrate and add it to water. After stirring, add 1% trisodium citrate aqueous solution to the solution and continue stirring. Then add 0.075% sodium borohydride solution prepared with 1% trisodium citrate aqueous solution as solvent to the solution to obtain a hydrosol of gold nanoparticles. (2) The obtained gold nanoparticles hydrosol was mixed with anhydrous ethanol and heated and stirred. The molar ratio of tetramethylene sulfoxide solution to tetrachloroauric acid was 1: (1-5). After the solution boiled, tetramethylene sulfoxide solution was added to the solution and stirred continuously. After cooling, a black precipitate was collected, which is the tetramethylene sulfoxide-modified gold nanoparticles.

2. The PCR amplification system according to claim 1, characterized in that, The PCR additive consists of gold nanoparticles modified with the tetramethylene sulfoxide.

3. A PCR nucleic acid detection method for non-disease diagnostic purposes, characterized in that, Includes the following steps: S1: Prepare a PCR amplification system as described in any one of claims 1-2, and add template DNA to the prepared amplification system to obtain a mixture; S2: Place the mixture in a high-temperature reaction zone and a low-temperature reaction zone for 30-45 amplification cycles. The temperature of the high-temperature reaction zone is a fixed temperature or temperature range of 94℃-100℃, and the temperature of the low-temperature reaction zone is a fixed temperature or temperature range of 50℃-65℃.

4. A PCR nucleic acid detection method for non-disease diagnostic purposes, characterized in that, The extracted DNA template is added to the PCR amplification system according to any one of claims 1-2 for amplification.

5. The PCR nucleic acid detection method according to claim 4, characterized in that: The amplification procedure is as follows: react in the high-temperature zone for 1-4 seconds, then react in the low-temperature zone for 2-5 seconds; repeat for 30-45 cycles.

6. The PCR nucleic acid detection method according to claim 4, characterized in that, The amplification program is as follows: 96℃ hot start for 15s, 40 cycles, each cycle including 96℃ denaturation for 1s and 58℃ annealing extension for 2s.