Methods for enriching functional microbial communities in pit mud

By using enhanced Daqu (a type of starter culture) to inoculate and expand the cellar mud under anaerobic conditions through multiple rounds of inoculation, the problem of cultivating functional microbial communities in the cellar mud was solved, the quality of the cellar mud was improved, and the brewing effect of Baijiu (Chinese liquor) was enhanced.

CN116286452BActive Publication Date: 2026-05-26LUZHOU LAOJIAO CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LUZHOU LAOJIAO CO LTD
Filing Date
2022-11-10
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The isolation and cultivation of functional microorganisms in cellar mud are difficult, which limits the improvement of cellar mud and the development of strong-aroma baijiu industry. Existing pure cultivation techniques are cumbersome and inefficient.

Method used

Under anaerobic conditions, the pit mud suspension was inoculated into yellow water culture medium, and enhanced Daqu (a type of starter culture) was added. Through multiple rounds of inoculation and expansion culture, the functional microbial community of pit mud was directionally cultured using a synthetic microbial community composed of Bacillus subtilis and Bacillus velezensis, thus achieving batch expansion culture.

Benefits of technology

It increases the number of methanogenic bacteria and Clostridium species in the cellar mud, enhances the metabolic capacity of caproic acid bacteria, promotes the synthesis of butyric acid and caproic acid, improves the quality of cellar mud, and is beneficial to the brewing of baijiu.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116286452B_ABST
    Figure CN116286452B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial fermentation technology, specifically relating to a method for enriching functional microbial communities in fermentation pit mud. Given that most functional microbial communities in fermentation pit mud are anaerobic fermenting bacteria, their isolation and cultivation are difficult, limiting the improvement of pit mud. This invention provides a method for enriching functional microbial communities in fermentation pit mud, comprising the following steps: inoculating a pit mud suspension into a yellow water culture medium, then adding fortified Daqu (a type of starter culture), and culturing under anaerobic conditions to obtain a pit mud culture solution. Then, the pit mud culture solution is subjected to multiple rounds of inoculation and expansion. The pit mud culture solution obtained by this method shows a significant increase in the number of functional microbial communities *Methanococcus sanguinalis* and *Clostridium*, and an increased abundance of *Caproiciproducens*, which metabolizes characteristic products of baijiu (Chinese liquor), promoting the synthesis of butyric acid and caproic acid, improving the quality of the pit mud, and benefiting subsequent brewing production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a method for enriching functional microbial communities in pit mud. Background Technology

[0002] The phrase "Old cellars produce fine wine" emphasizes the decisive role of fermentation pits in the fermentation process of strong-aroma baijiu. Using mud pits as fermentation containers, the functional bacteria residing in the pit mud significantly impact the quality and yield of the base liquor. High-quality pit mud is a necessary foundation for superior old cellars, the result of decades or even centuries of targeted domestication, and has become a valuable resource in the development of strong-aroma baijiu. Its scarcity and difficulty in replication have become one of the main obstacles to the sustainable development of strong-aroma baijiu. In the past half-century, the development of microbial culture technology has promoted the widespread application of technologies for improving pit quality based on pure culture, driving the rapid development of the industry. These technologies mainly involve exploring the unique microbial resources in old pit mud, such as isolating functional bacteria like acetic acid bacteria, butyric acid bacteria, and caproic acid bacteria, and developing their cultivation and application technologies. In recent years, research and application of perturbation technology based on enhanced koji (fermentation starter) to create a favorable environment for baijiu brewing have attracted widespread attention for their effects on the targeted domestication of pit mud community structure, base liquor yield, and quality improvement. The development and application of cultivation technology for producing caproic acid bacteria by using high-quality cellar mud as a source of functional microorganisms has opened up new avenues for the development of high-quality cellar mud resources and for solving key technical problems in the strong-aroma baijiu industry. Summary of the Invention

[0003] To address the shortcomings of existing technologies, this invention provides a method for enriching functional microbial communities in pit mud, comprising the following steps:

[0004] The pit mud suspension is inoculated into yellow water culture medium, and then enhanced Daqu (a type of starter culture) is added. Under anaerobic conditions, the pit mud culture solution is obtained. Then, the pit mud culture solution is inoculated and expanded multiple times.

[0005] The volume ratio of the pit mud suspension inoculated into the yellow water culture medium is 5-15v / v%. That is, the volume ratio of the pit mud suspension to the total volume of the pit mud suspension and the culture medium.

[0006] The pit mud suspension is obtained by dispersing and mixing pit mud in sterile physiological saline, with an inoculum amount of pit mud of 5-20 w / v%. Inoculum amount refers to the mass-to-volume ratio of pit mud to sterile physiological saline.

[0007] The pit mud is pit mud with an age of 10 years or more, preferably pit mud with an age of 30-200 years; more preferably pit mud with an age of 100 years.

[0008] The yellow water culture medium is formulated as follows: per liter, it contains 5g NaHCO3, 1g yeast extract, 1g peptone, 3g glucose, 0.2g cysteine ​​hydrochloride, 0.001g resazurin, 170mL salt solution A, 170mL salt solution B, and 5-25v / v% yellow water; wherein salt solution A includes per liter 3g KH2PO4, 6g NaCl, 3g (NH4)2SO4, 0.3g CaCl2, and 0.3g MgSO4; and salt solution B includes per liter 3g K2HPO4.

[0009] The yellow water culture medium has a natural pH and is sterilized at 121°C for 20 minutes.

[0010] The yellow liquid is a brownish-yellow liquid that gradually seeps into the bottom of the cellar during fermentation.

[0011] The inoculum amount for strengthening Daqu (a type of starter culture) was 0.2-0.5 w / v%.

[0012] The enhanced Daqu is a synthetic microbial community-enhanced Daqu composed of Bacillus subtilis and Bacillus velezensis; the Bacillus subtilis has the accession number CGMC NO.10830; and the Bacillus velezensis has the accession number CGMC NO.7044.

[0013] Under anaerobic conditions, the culture temperature is 30℃-40℃, and the culture time is 5-20 days.

[0014] The multiple inoculation process involves inoculating the first-round produced pit mud culture solution into freshly prepared yellow water culture medium at a ratio of 5-15 w / v%, adding 0.2-0.5 w / v% of Daqu (a type of starter culture), and culturing at 30℃-40℃ for 5-20 days to obtain the second-round pit mud culture solution. This step constitutes one round, and the process is repeated to achieve multiple inoculation.

[0015] Beneficial effects:

[0016] This invention addresses the challenge of isolating and culturing anaerobic fermenting bacteria, which are predominantly anaerobic and difficult to isolate, thus limiting the improvement of fermentation mud. It addresses this issue by directionally culturing microorganisms from fermentation mud of different ages and positively disturbing them using enhanced Daqu (a type of starter culture). Through multiple rounds of inoculation, the functional microbial community of the fermentation mud is expanded in large quantities. Experimental tests show a significant increase in the number of *Methanococcus sanguinis* and *Clostridium* species in the second round of 100-year-old fermentation mud culture solution, along with an increased abundance of *Caproiciproducens*, a metabolic byproduct of baijiu (Chinese liquor), promoting the synthesis of butyric and caproic acids, improving the quality of the fermentation mud, and benefiting subsequent brewing production. Furthermore, the method provided by this invention omits the cumbersome process of pure microbial culture and can be implemented in multiple rounds, opening up new avenues for the development of high-quality fermentation mud resources and solving key technical challenges in the strong-aroma baijiu industry. Attached Figure Description

[0017] Figure 1 This is a graph showing the differences in microbial community diversity at different ages and locations in Experiment Example 1.

[0018] Figure 2 This is a schematic diagram of the anaerobic culture device in an embodiment of the present invention.

[0019] Figure 3 The changes in organic acid content after each round of culture in the embodiments of the present invention are shown in A: first round, B: second round, C: third round (1 is the control sample without koji, 2 is the test sample with koji).

[0020] Figure 4 This is a heatmap of the dominant microbial community composition in the third round of pit mud culture solution in this embodiment of the invention.

[0021] The Bacillus subtilis described herein has the accession number CGMCC NO.10830. The deposit date was May 20, 2015. The deposit center is the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0022] The Bacillus velezensis described herein has the accession number CGMCC NO.7044. The deposit date was December 26, 2012. The deposit center is the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. Detailed Implementation

[0023] Currently, inoculated functional microorganisms promote the growth and reproduction of dominant microorganisms in cellar mud, thereby shortening the natural aging time of the mud and improving the quality of baijiu (Chinese liquor). However, most of the functional microbial communities in cellar mud, such as Caproiciproducens, are anaerobic fermentation bacteria, making their isolation and cultivation difficult and limiting the development of this technology. This invention breaks through the limitations of pure culture technology, and multiple rounds of implementation have shown good results, indicating broad application prospects.

[0024] This invention involves the directional cultivation of microorganisms in fermentation pit mud of different ages under anaerobic conditions, with enhanced Daqu (a type of starter culture) used for positive disturbance. Multiple rounds of inoculation were then used to achieve mass propagation of functional microbial communities in the pit mud. The resulting pit mud culture solution showed a significant increase in the abundance of functional microorganisms *Methanococcus sanguinalis* and *Clostridium*, as well as an increase in the abundance of *Caproiciproducens*, which metabolizes characteristic products of baijiu (Chinese liquor). This promoted the synthesis of butyric and caproic acids, improved the quality of the pit mud, and benefited subsequent brewing production.

[0025] The method for enriching functional microbial communities in pit mud provided by this invention includes the following steps: High-quality pit mud is weighed and added to sterile physiological saline. After thorough dispersion and mixing, the pit mud suspension is inoculated into a yellow water culture medium. Fortified Daqu powder is added, and the mixture is sealed after introducing air through a sterile N2 replacement device. The medium is then placed in a constant temperature incubator for a period of time to obtain the first round of pit mud culture solution. A portion of this solution is inoculated into freshly prepared yellow water culture medium, and cultured using the same steps to obtain a new round of pit mud culture solution, i.e., the second round of pit mud culture solution. A portion of the second round of pit mud culture solution is then inoculated into freshly prepared yellow water culture medium again, and cultured to obtain the third round of pit mud culture solution.

[0026] The inoculation amount of the first round of pit mud is 5-20 w / v%. The inoculation amount refers to the mass and volume ratio of pit mud to sterile saline.

[0027] The volume ratio of the pit mud suspension inoculated into the yellow water culture medium in each round was 5-15 v / v%. That is, the volume ratio of the pit mud suspension to the total volume of the pit mud suspension and the culture medium.

[0028] In each round, the inoculation ratio of Luzhou Laojiao's fortified koji powder added was 0.2-0.5 w / v. The fortified koji is a synthetic microbial community composed of Bacillus subtilis and Bacillus velezensis.

[0029] The specific steps for synthesizing enhanced Daqu (a type of starter culture) include: adjusting the cell concentration of the seed culture medium of the two strains to 3 × 10⁻⁶. 8 Mix the cells / mL in equal proportions, transfer to the grain soaking water, mix the grain soaking water with the crushed wheat, and control the moisture content at 38%.

[0030] The Bacillus subtilis specimen, with accession number CGMCC NO.10830, was deposited on May 20, 2015, at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0031] The Bacillus velezensis mentioned above has the accession number CGMCC NO.7044. The accession date was December 26, 2012. The accession center was the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, 100101, China.

[0032] The cultivation temperature is 30℃-40℃, and the time is 5-20 days.

[0033] The yellow liquid refers to the brownish-yellow liquid that gradually seeps to the bottom of the cellar during fermentation.

[0034] This invention utilizes the targeted cultivation of functional microorganisms in fermentation pit mud using enhanced Daqu (a type of starter culture), resulting in a significant increase in the abundance of functional microorganisms such as *Methanococcus sanguinalis* and *Clostridium* in the pit mud culture solution. It also increases the abundance of *Caproiciproducens*, which metabolizes characteristic products of baijiu (Chinese liquor), promoting the synthesis of butyric and caproic acids, thus improving the quality of the pit mud and benefiting subsequent brewing processes. The effect is particularly pronounced with the second batch of pit mud culture solution from a 100-year-old fermentation process.

[0035] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0036] Experimental Example 1: Detection of Organic Acids

[0037] Accurately weigh 5.00 g of pit mud (30 years, 100 years, and 200 years old), add 20 mL of 9 mM H2SO4 solution, sonicate for 60 min, vortex for 5 min every 15 min, centrifuge (12000 r / min, 4℃) for 10 min, collect the supernatant, purify the supernatant using an activated C18 SPE column, filter through a 0.22 μm filter membrane, and then perform HPLC. The chromatographic column was an Alltech OA-1000 (300 × 7.8 mm) organic acid column, the mobile phase was 9 mM H2SO4 solution, the flow rate was 0.6 mL / min, the UV detector was used, the detection wavelength was 210 nm, the column temperature was 75℃, and the injection volume was 10 μL. The types of organic acids in the samples were determined by the retention times of standards lactic acid, acetic acid, propionic acid, butyric acid, and hexanoic acid, and their contents were calculated using the external standard method, as shown in Table 1.

[0038] Table 1. Differences in organic acid content among different cellar ages and locations.

[0039]

[0040] JB represents the mud on the cellar wall, and JD represents the mud on the cellar bottom; 30, 100, and 200 represent the duration of continuous use of the cellar (in years); a to e indicate differences between samples, with the same letter indicating no significant difference and different letters indicating significant differences; ND indicates not detected.

[0041] Experimental Example 2: Detection of Community Composition Profile via Fluorescence In Situ Hybridization

[0042] Accurately weigh 1.00g of high-quality pit mud, add 25mL of 10mM PBS (pH 7.2) buffer, vortex for 5min, centrifuge (800r / min, 4℃) for 10min to collect the supernatant, centrifuge the supernatant (12000r / min, 4℃) for 10min to collect the precipitate, repeat the process three times with the same buffer, and the obtained bacterial precipitate is the FISH detection sample. The target probe is shown in Table 2.

[0043] Table 2 Fluorescent in situ hybridization targeting probes

[0044] probe Sequence (5'-3') Targeted microbiota EUB338 (SEQ ID NO.1) GCTGCCTCCCGTAGGAGT Total bacteria ARCH915 (SEQ ID NO.2) GTGCTCCCCCGCCAATTCCT Total Archaea CLZ (SEQ ID NO.3) GGCTACCTTGTTACGACTTCACCCCA Clostridium MB311 (SEQ ID NO.4) ACCTTGTCTCAGGTTCCATCTCC Methanobacterales MG1200b (SEQ ID NO.5) CRGATAATTCGGGGCATGCTG Methanomicrobiales MSMX860 (SEQ ID NO.6) GGCTCGCTTCACGGCTTCCCT Methanocytococcidales

[0045] Experiment 3: High-throughput sequencing to detect microbial community composition

[0046] DNA was extracted from pit mud or pit mud culture samples according to the Fast DNA SPIN kit (MP Biomedicals, Santa Ana, CA, USA). The content, purity, and integrity of the extracted DNA were detected using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 1% agarose gel electrophoresis. 338F / 806R and ARC787F / ARC1059R were used for amplification of the V3-V4 hypervariable region and ARC region of the 16S rDNA gene in bacteria and archaea, respectively, while ITS5 / ITS1 amplified the ITS1 region of fungi. The PCR products were excised from the gel to obtain the target fragments, purified, and recovered. After spectrophotometric determination, the fragments were mixed at equal molecular weights. Libraries were constructed using the MiSeq Reagent Kit v3 and then sent to the Illumina MiSeq platform of Shanghai Paisennuo Biotechnology Co., Ltd. for sequencing.

[0047] Sequencing data were processed by removing sequences with an average base quality ≤ Q20 and ambiguous sequences. The FLASH software (V1.2.7, http: / / ccb.jbu.edu / software / FLASH) was used to assemble the initially screened paired-end sequences (base overlap length > 10 bp and no base mismatches). The assembled sequences were then assigned to the appropriate samples to obtain valid sequences. The QIIME software (QuantitativeInsights Into Microbial Ecology, v1.8.0, http: / / qiime.org / ) was used to remove low-quality sequences (length ≤ 150 bp, 5' end base mismatch > 1, and sequences with > 8 identical bases) to obtain high-quality sequences. UCLUST was used to cluster the high-quality sequences into different operational taxonomic units (OTUs) based on 97% sequence similarity. The Greengenes database (Releasese 13.8, http: / / greengenessecondgenome.com / ) and the UNIT database (Release 5.0, http: / / unite.ut.ee / ) were used as template sequences for OTU classification and identification to obtain microbial classification information for each OTU. An OTU matrix was constructed based on the number of sequences of each OTU in each sample to determine the relative abundance of microorganisms in each sample. The results are shown below. Figure 1 As shown.

[0048] In the following examples, the anaerobic culture apparatus used in the experiments is as follows: Figure 2 As shown.

[0049] Example 1

[0050] Weigh 10g of 30-year-old pit mud and add it to 90mL of sterile physiological saline. After thorough dispersion and mixing, take 50mL of the pit mud suspension and inoculate it into 500mL of 15% yellow water culture medium. Then add 0.2w / v% fortified Daqu powder. After introducing air through a sterile N2 replacement device, seal the container and incubate it in a 37℃ constant temperature incubator for 10 days to obtain the first round of 30-year-old pit mud culture medium.

[0051] Weigh 50 mL of the first-round culture solution of 30-year-old pit mud and inoculate it into 500 mL of culture medium containing 15% yellow water. Then add 0.2 w / v% fortified Daqu powder, introduce air through a sterile N2 replacement device, seal, and incubate at 37℃ for 10 days to obtain the second-round culture solution of 30-year-old pit mud. Repeat this step to obtain the third-round culture solution of 30-year-old pit mud.

[0052] The organic acid content and microbial community number in the culture solution of the three rounds of pit mud were determined respectively, and the results are shown in the figure. Figure 3 Table 3. The results show that lactic acid content decreased significantly, while caproic acid increased. Among the functional flora, Methanobacteria remained stable, the Methanococcales order slightly increased or decreased, the Methanocytococci order increased, and the Clostridium genus increased in the first and second rounds but decreased in the third round. The abundance of caproic acid-producing bacteria (Caproiciproducens) increased.

[0053] Example 2

[0054] Weigh 10g of 100-year-old pit mud and add it to 90mL of sterile physiological saline. After fully dispersing and mixing, take 50mL of the pit mud suspension and inoculate it into 500mL of culture medium containing 15% yellow water. Then add 0.2w / v% fortified Daqu powder, introduce air into a sterile N2 replacement device, seal, and place in a 37℃ constant temperature incubator for 10 days to obtain the first round of 100-year-old pit mud culture medium.

[0055] Weigh 50 mL of the first-round culture solution of 100-year-old pit mud and inoculate it into 500 mL of 15% yellow water culture medium. Then add 0.2 w / v% fortified Daqu powder, introduce air through a sterile N2 replacement device, seal, and incubate at 37℃ for 10 days to obtain the second-round culture solution of 100-year-old pit mud. Repeat this step to obtain the third-round culture solution of 100-year-old pit mud.

[0056] The organic acid content and microbial community number in the culture solution of the three rounds of pit mud were determined respectively, and the results are shown in the figure. Figure 3Table 3. The results show a significant decrease in lactic acid and an increase in hexanoic acid. In the first round of functional bacterial communities, the orders Methanobacteria, Methanocycocales, Methanosarcoptes, and Clostridium all decreased. In the second round, only the orders Methanobacteria decreased, while the orders Methanocycocales, Methanosarcoptes, and Clostridium increased. In the third round, only the order Methanosarcoptes increased. The abundance of Candida, Hyphopichia, and Pichia increased.

[0057] Example 3

[0058] Weigh 10g of 200-year-old pit mud and add it to 90mL of sterile physiological saline. After fully dispersing and mixing, take 50mL of the pit mud suspension and inoculate it into 500mL of culture medium containing 15% yellow water. Then add 0.2w / v% fortified Daqu powder, introduce air into a sterile N2 replacement device, seal it, and place it in a 37℃ constant temperature incubator for 10 days to obtain the first round of 200-year-old pit mud culture medium.

[0059] Weigh 50 mL of the first-round culture solution of 200-year-old pit mud and inoculate it into 500 mL of 15% yellow water culture medium. Then add 0.2 w / v% fortified Daqu powder, introduce air through a sterile N2 replacement device, seal, and incubate at 37℃ for 10 days to obtain the second-round culture solution of 200-year-old pit mud. Repeat this step to obtain the third-round culture solution of 200-year-old pit mud.

[0060] The organic acid content and microbial community number in the culture solution of the three rounds of pit mud were determined respectively, and the results are shown in the figure. Figure 3 Table 3. The results show that lactic acid content decreased significantly, while hexanoic acid increased. Among the functional flora, only the orders Methanobacteriae II and Methanocytococci increased in number.

[0061] Table 3. Changes in the incremental value of characteristic microbial communities in liquid pit mud based on different FISH cycles.

[0062]

[0063]

[0064] Note: 1: No yeast added, 2: Yeast added; Δ: Difference in species relative to the corresponding pit mud; ARCH: Archaea; EUB: Eubacteria; MB: Methanobacteria; MG: Methanobacteria; MS: Methanocytococcidales; CLZ: Clostridium.

[0065] In summary, the second round of fermentation liquid containing fortified Daqu (a type of starter culture) showed the best increase in characteristic microorganisms of the fermentation mud. Compared with fermentation liquids from fermentation muds of other ages, the second round of fermentation liquid containing 100-year-old fermentation mud showed an increase in the number of Methanococci, Methanocytococci, and Clostridium species. Therefore, this invention, by adding fortified Daqu to positively disturb the fermentation mud and through multiple rounds of cultivation, achieved a significant increase in the number of functional microorganisms Methanocytococci and Clostridium, an increase in the abundance of Caproiciproducens (a type of bacteria that metabolizes characteristic products of baijiu), promoted the synthesis of butyric acid and caproic acid, improved the quality of the fermentation mud, and benefited subsequent production and brewing.

Claims

1. A method for enriching functional microbial communities in pit mud, characterized by: Includes the following steps: A suspension of 100-year-old pit mud was inoculated into a yellow water culture medium, then a fortified Daqu (a type of starter culture) was added. Under anaerobic conditions, the mixture was cultured to obtain a pit mud culture solution. This culture solution was then subjected to multiple rounds of inoculation and expansion. The fortified Daqu was Bacillus subtilis. Bacillus subtilis and Bacillus velezensis The synthetic microbial community-enhanced Daqu; the Bacillus subtilis Bacillus subtilis The accession number is CGMC NO.10830; Bacillus velezensis The preservation number is CGMC NO.7044; the multi-round fermentation is a two-round fermentation; the yellow water culture medium formula is: per liter containing 5g NaHCO3, 1g yeast extract, 1g peptone, 3g glucose, 0.2g cysteine ​​hydrochloride, 0.001g resazurin, 170 mL salt solution A, 170 mL salt solution B, and 5~25 v / v% yellow water; wherein, salt solution A includes per liter 3g KH2PO4, 6g NaCl, 3g (NH4)2SO4, 0.3g CaCl2, and 0.3g MgSO4; salt solution B includes per liter 3g K2HPO4.

2. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: The volume ratio of the pit mud suspension inoculated into the yellow water culture medium is 5-15 v / v.

3. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: The pit mud suspension is obtained by dispersing and mixing pit mud in sterile physiological saline, with an inoculation amount of pit mud of 5-20 w / v.

4. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: The yellow water culture medium has a natural pH and is sterilized at 121°C for 20 minutes.

5. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: The inoculum size for strengthening Daqu (a type of starter culture) is 0.2-0.5 w / v.

6. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: Under anaerobic conditions, the culture temperature is 30℃-40℃, and the culture time is 5-20 days.

7. The method for enriching functional microbial communities in pit mud according to claim 1, characterized in that: The multiple inoculation process involves inoculating the first-round produced pit mud culture solution into freshly prepared yellow water culture medium at a ratio of 5-15 v / v%, adding 0.2-0.5 w / v % of Daqu (a type of starter culture), and culturing at 30℃-40℃ for 5-20 days to obtain the second-round pit mud culture solution. This step constitutes one round, and the process is repeated to achieve multiple inoculation.

Citation Information

Patent Citations

  • CN109536331A

  • CN111088189A

  • CN115747128A

  • CN120718729A