A strain of Lactobacillus plantarum E2 and its application in preventing and treating white spot disease in the internal organs of large yellow croaker

Abstract

The present invention provides a strain of Lactobacillus plantarum E2 and its application in preventing and treating white spot disease of large yellow croaker viscera. The strain is classified and named as Lactobacillus plantarum ( Lactobacillus plantarum ) E2 was deposited with the China Center for Type Culture Collection on December 29, 2022, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the accession number CCTCC NO: M 20222097. Antibacterial tests have shown that Lactobacillus plantarum E2 has a broad antibacterial spectrum and excellent biocontrol efficacy. Its fermentation broth effectively inhibits Pseudomonas aeruginosa, Vibrio harveyi, Vibrio alginolyticus, Vibrio Campbellii, and Aeromonas hydrophila. Using the bacteria or fermentation broth as a feed additive can prevent and treat visceral white spot disease and vibriosis.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control, and in particular relates to a Lactobacillus plantarum E2 and an application thereof in preventing and treating large yellow croaker visceral white spot disease. Background Art

[0002] Large yellow croaker, commonly known as yellow croaker, belongs to the order Perciformes, family Sciaenidae, and genus Pseudocrocea. It is a uniquely Chinese marine economic fish and the most cultivated marine fish species in my country. During cage aquaculture of large yellow croaker, bacterial outbreaks have caused significant losses. Bacterial diseases can occur year-round, but are most common from April to November. They are typically caused by mixed infections with one or more pathogens. Vibrio, Pseudomonas, and Aeromonas are the most common bacterial species causing diseases during aquaculture. The main pathogens of the Vibrio genus include Vibrio harveyi, Vibrio alginolyticus, and Vibrio Campbellii. Pseudomonas includes Pseudomonas proteus, while Aeromonas includes Aeromonas hydrophila. Bacterial diseases caused by these species have caused significant economic losses to the large yellow croaker aquaculture industry.

[0003] The three main mechanisms of action of probiotics are pathogen inhibition, barrier enhancement, and immune interaction. Currently, many different species and genera of probiotics are widely used in human and veterinary medicine.

[0004] Lactobacillus plantarum is a widely distributed member of the genus Lactobacillus, found extensively in nature. It possesses the largest genome of any lactic acid bacterium and possesses strong adaptability. It is recognized as a relatively safe probiotic and has extensive applications across various industries, including the food industry, feed additives, and aquaculture. Lactobacillus plantarum has a safety rating of Generally Recognized as Safe (GRAS) and is included in the European Food Safety Authority's (EFSA) Qualified Presumption of Safety (QPS) list. Summary of the Invention

[0005] The present invention aims to provide a Lactobacillus plantarum E2 and its application in preventing and treating large yellow croaker visceral white spot disease.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention first provides a strain of Lactobacillus plantarum E2, which is classified and named Lactobacillus plantarum E2, which is isolated from the intestine of large yellow croaker, which is caught in the waters of Ningde, Fujian. The Lactobacillus plantarum E2 has been deposited in the China Center for Type Culture Collection on December 29, 2022, with a preservation address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and a preservation number of CCTCCNO: M20222097.

[0008] The 16S rDNA sequence of the Lactobacillus plantarum E2 was amplified by polymerase chain reaction (PCR) and compared with the corresponding sequence in the GenBank database of the National Center for Biotechnology Information (NCBI) of the United States. It was found that the sequence similarity between the E2 and the genus Lactobacillus was 99.93%.

[0009] In vitro antibacterial experiments showed that the above-mentioned Lactobacillus plantarum E2 had inhibitory effects on Pseudomonas aeruginosa, Vibrio harveyi, Vibrio alginolyticus, Vibrio Campbellii, and Aeromonas hydrophila.

[0010] The present invention also provides the use of the above-mentioned Lactobacillus plantarum E2 in the preparation of biocontrol agents or feeds for preventing and controlling aquatic diseases;

[0011] Wherein, the biocontrol agent or feed contains fermentation supernatant or bacteria of Lactobacillus plantarum E2;

[0012] Wherein, the aquatic disease is white spot disease of large yellow croaker viscera caused by Pseudomonas aeruginosa;

[0013] The steps for preparing the Lactobacillus plantarum E2 fermentation supernatant and the bacterial cells are as follows:

[0014] 1) Activation: A single colony of Lactobacillus plantarum E2 was inoculated into 5 mL of MRS liquid medium for activation culture to obtain a seed solution;

[0015] 2) Expansion: Transfer the seed solution to MRS liquid medium at an inoculum volume of 1 vol% for fermentation to obtain a pure culture;

[0016] 3) Centrifugation: Centrifuge the pure culture solution, collect the supernatant to obtain the Lactobacillus plantarum E2 fermentation supernatant, and collect the precipitate to obtain the Lactobacillus plantarum E2 bacteria;

[0017] The formula of the MRS liquid culture medium is as follows: peptone 10g, yeast extract 5g, beef extract 10g, glucose 20g, dipotassium hydrogen phosphate 2g, ammonium citrate 2g, sodium acetate 5g, magnesium sulfate 0.58g, manganese sulfate 0.25g, Tween 80 1mL, distilled water 1.0L, pH 6.5; high pressure sterilization at 115°C for 15min;

[0018] The activation culture conditions are as follows: temperature 37°C, shaker speed 200 rpm, time 12 h;

[0019] The fermentation conditions are as follows: temperature 37°C, shaker speed 200 rpm, and time 24 h.

[0020] The centrifugal conditions are as follows: rotation speed 10000 rpm, time 15 min.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The plant lactobacillus E2 of the present invention has a broad antibacterial spectrum and a good biocontrol effect. The fermentation liquid thereof can effectively inhibit Pseudomonas aeruginosa, Vibrio harveyi, Vibrio alginolyticus, Vibrio Campbellii, and Aeromonas hydrophila. The plant lactobacillus E2 bacterial bodies or fermentation liquid thereof can be used as a feed additive to prevent and treat visceral white spot disease and vibriosis. When plant lactobacillus E2 is used as an additive to feed large yellow croaker, the survival rate of large yellow croaker in response to visceral white spot disease caused by Pseudomonas aeruginosa can be increased by 29.7%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the colony morphology of Lactobacillus plantarum E2.

[0024] Figure 2 The antibacterial effect of the fermentation supernatant of Lactobacillus plantarum E2 on different plant pathogenic fungi: A: Pseudomonas aeruginosa; B: Vibrio harveyi; C: Vibrio alginolyticus; D: Vibrio campbellii; E: Aeromonas hydrophila. DETAILED DESCRIPTION

[0025] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0026] The MRS agar medium involved in the following examples has a formula: 10 g of peptone, 5 g of yeast extract, 10 g of beef extract, 20 g of glucose, 2 g of dipotassium hydrogen phosphate, 2 g of ammonium citrate, 5 g of sodium acetate, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 80 1 mL of Tween, 15 g of agar, and 1.0 L of distilled water; the pH value is 6.5.

[0027] The MRS liquid culture medium involved in the following examples has a formula of: 10 g of peptone, 5 g of yeast extract, 10 g of beef extract, 20 g of glucose, 2 g of dipotassium hydrogen phosphate, 2 g of ammonium citrate, 5 g of sodium acetate, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 801 mL of Tween, and 1.0 L of distilled water; the pH value is 6.5.

[0028] Example 1 Isolation and Screening of Lactobacillus plantarum E2

[0029] Lactobacillus plantarum E2 was isolated from the intestinal samples of large yellow croaker, which was caught in Ningde, Fujian. First, the sediment sample collected from the intestinal tract of large yellow croaker was diluted with 1× PBS to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 100 μL of each dilution gradient was evenly spread on MRS agar plates, with three replicates per gradient. The plates were then incubated at 37°C for 48 hours. Based on the morphology and color of the colonies, individual colonies were streaked onto MRS agar plates until the morphology and color of the colonies in the culture medium were essentially identical. This indicated that the strain had been isolated and purified, and was designated E2.

[0030] The E2 strain was inoculated into MRS agar medium and cultured at 37℃ for 24h. Its colonies were milky white, opaque, round, smooth, and without wrinkles or protrusions. Figure 1 ).

[0031] Example 2 Identification of Lactobacillus plantarum E2

[0032] The 16S rDNA sequence of Lactobacillus plantarum E2 was amplified using universal 16S rDNA primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT). PCR reactions were performed using E2 genomic DNA as the template. Reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; and extension at 72°C for 1.5 min for 30 cycles. The amplified sequence was sequenced by a sequencing company to obtain the 16S rDNA sequence of this strain (SEQ ID NO. 1). This sequence was then compared with the nucleic acid database in GenBank at the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of strain E2 shared 99.93% similarity with strains such as Lactiplantibacillus plantarum (NR_115605.1) and Lactiplantibacillus plantarum (NR_112690.1), indicating that strain E2 is homologous to Lactobacillus plantarum. Therefore, strain E2 was confirmed to be Lactobacillus plantarum. On August 25, 2022, in accordance with the Food Safety Law of the People's Republic of China and its implementing regulations, Lactobacillus plantarum was renamed Lactiplantibacillus plantarum.

[0033] Example 3 Determination of the antimicrobial spectrum of aquatic pathogens

[0034] Preparation of the fermentation supernatant of Lactobacillus plantarum E2: First, a single colony of Lactobacillus plantarum E2 was inoculated into 5 mL of MRS liquid culture medium and activated and cultured at 37°C and a shaker speed of 200 rpm for 12 hours to obtain a seed solution. The seed solution was then transferred to a new MRS liquid culture medium at an inoculum rate of 1 vol%, and fermented and cultured at 37°C and a shaker speed of 200 rpm for 24 hours to obtain a pure culture. After the fermentation, the pure culture was centrifuged at 10,000 rpm for 15 minutes to remove the bacteria, and the supernatant was collected to obtain the fermentation supernatant of Lactobacillus plantarum E2. The formula of the MRS liquid culture medium is: 10g peptone, 5g yeast extract, 10g beef extract, 20g glucose, 2g dipotassium hydrogen phosphate, 2g ammonium citrate, 5g sodium acetate, 0.58g magnesium sulfate, 0.25g manganese sulfate, 1mL Tween 80, 1.0L distilled water, pH 6.5; high pressure sterilization at 115°C for 15min.

[0035] The inhibitory activity of Lactobacillus plantarum E2 fermentation supernatant against five aquatic pathogens was determined by plate agar diffusion method. The indicator culture medium containing 1.5% agar was cooled to about 50°C, and the indicator culture medium (OD 600 =0.6), shake thoroughly and pour 20mL per plate into a sterile culture dish, and cool in a clean bench. Use a sterile hole puncher to punch a hole in the center of the agar plate, inoculate 100μL of the supernatant of Lactobacillus plantarum E2 cell-free fermentation in each well, diffuse on the clean bench for 1 hour, place at a suitable temperature of 37°C and incubate for 24 hours. Observe and count the size of the inhibition zone. If the test pathogen is inhibited, a transparent inhibition zone will appear on the plate. The results are shown in Table 1 and Figure 2 As shown in the results, the fermentation supernatant of Lactobacillus plantarum E2 had inhibitory activity against five tested aquatic pathogens: Pseudomonas aeruginosa, Vibrio harveyi, Vibrio alginolyticus, Vibrio campbellii, and Aeromonas hydrophila.

[0036] Table 1E2 inhibition diameter of aquatic pathogens

[0037] Test pathogens serial number Diameter of inhibition zone (mm) Pseudomonas aeruginosa PQLYC4* 20.6±0.6 Vibrio harveyi MCCC1A03220 22.7±0.6 Vibrio alginolyticus MCCC1A03227 28.7±2.4 Vibrio Campbellii MCCC1A08161 28.7±1.6 Aeromonas hydrophila MCCC1A00007 21.2±0.4

[0038] *The strain was isolated from diseased large yellow croaker in Xiapu, Ningde City, Fujian Province (2018).

[0039] All results (Table 1) are presented as mean ± standard deviation (SD).

[0040] Example 4 Experiment on feeding large yellow croaker with plant lactobacillus E2

[0041] 1,200 healthy large yellow croaker were randomly assigned to two 8m × 2m × 1m aquaculture ponds, each divided into three sections with fishing nets. The ponds contained approximately 8 tons of fresh seawater. The aquaculture ponds were designated NC (control group) and E2 (experimental group with Lactobacillus plantarum), and the cages were designated NC-1, NC-2, NC-3, E2-1, E2-2, and E2-3. The NC group was fed a standard large yellow croaker feed, while the E2 group was fed a feed supplemented with Lactobacillus plantarum. The fish were fed 100-200g twice daily at designated locations, morning and evening, until visually full, and any remaining food was removed. Fresh seawater was replaced daily in the aquaculture ponds for a total of 7 weeks.

[0042] Feed preparation: Lactobacillus plantarum E2 was cultured in MRS liquid medium until OD600=1, and the bacterial solution was added to the normal feed (NC). The bacterial content of the feed was about 1.35×10 10 CFU / g.

[0043] 33 large yellow croakers were randomly selected from each aquaculture cage and 10 5 Fish were challenged with Pseudomonas aeruginosa at 100 CFU / mL at 24°C for 1.5 hours. After challenge, the fish were quickly removed and soaked in fresh seawater to remove as much residual Pseudomonas aeruginosa as possible. The fish were then placed in a culture tank containing approximately 150 L of fresh seawater. The tank number corresponded to the cage number. Fresh seawater was replaced daily in the culture tank, and feed was provided every two days during the culture period.

[0044] The growth index and survival rate of large yellow croaker were calculated according to the following formula:

[0045] Weight gain rate = 100 × (Wt-W0) / W0;

[0046] Specific growth rate = 100 × (Ln Wt - Ln W0) / t;

[0047] Survival rate = 100 × (S0-St) / S0

[0048] Wherein, Wt represents the final body weight, W0 represents the initial body weight, t represents the breeding period, S0 represents the number of fish at the beginning of the experiment, and St represents the number of fish at the end of the experiment.

[0049] All results (Table 2) are presented as mean ± standard error of the mean (SEM) and were statistically analyzed using SPSS (SPSS, Chicago, IL, USA). The differences between the two experimental groups were analyzed using t-test, and p < 0.05 was considered significant, *p < 0.05, **p < 0.01, ***p < 0.001.

[0050] Table 2 Growth indexes and survival rates of large yellow croaker

[0051] index NC E2 Starting weight (g) 3.15±0.87 3.2±0.89 Final body weight (g) 6.20±2.22 7.03±2.15* Starting body length (cm) 7.59±0.65 7.71±0.69 Final body length (cm) 8.53±1.05 9.58±1.18** Weight gain rate (%) 93.79±18.77 117.86±20.49*** Specific growth rate (%) 1.56±0.23 1.84±0.24*** Survival rate (%) 49.00 78.70

[0052] The calculation results show that feeding feed containing Lactobacillus plantarum E2 can reduce the mortality rate of large yellow croaker infected with Pseudomonas aeruginosa and improve the growth indicators of large yellow croaker.

[0053] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A strain of Lactobacillus plantarum E2, characterized by: The strain is classified and named as Lactobacillus plantarum ( Lactobacillus plantarum ) E2, was deposited in the China Center for Type Culture Collection on December 29, 2022, with the deposit address at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M 20222097.

2. The Lactobacillus plantarum E2 according to claim 1, wherein: The plant lactobacillus E2 has an effect on Pseudomonas aeruginosa ( Pseudomonas plecoglossicida harveyi ( Vibrio harveyi )、Vibrio alginolyticus( Vibrio alginolyticus ), Vibrio Campbellii ( Vibrio campbellii ), Aeromonas hydrophila ( Aeromonas hydrophila ) has an inhibitory effect.

3. Use of the plant lactobacillus E2 according to claim 1 in preparing a biocontrol agent or feed for preventing and treating aquatic diseases, characterized in that: The aquatic disease is white spot disease of large yellow croaker viscera caused by Pseudomonas aeruginosa.

4. Use of the Lactobacillus plantarum E2 according to claim 3 in preparing a biocontrol agent or feed for preventing and treating aquatic diseases, characterized in that: The biocontrol preparation or feed contains Lactobacillus plantarum E2.

Images