Tobacco nicotine accumulation-related gene NtBGLU1, protein and its application

By cloning the tobacco nicotine accumulation-related gene NtBGLU1 and its protein and constructing a recombinant vector to regulate its expression, the problem of unclear regulation of nicotine synthesis was solved, effective regulation of tobacco nicotine content was achieved, and technical support for tobacco quality improvement was provided.

CN116334044BActive Publication Date: 2025-09-23CHINA TOBACCO HUNAN IND CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111583093.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-22
Publication Date
2025-09-23
Estimated Expiration
2041-12-22

AI Technical Summary

Technical Problem

The existing technology has unclear mechanisms for nicotine synthesis and regulation, and lacks effective means for regulating nicotine accumulation in tobacco. In particular, there are no reports on the research of the BGLU gene family in nicotine accumulation.

Method used

The tobacco nicotine accumulation-related gene NtBGLU1 and its encoding protein were cloned. By constructing the recombinant pBWA(V)KS-RNAi-BGLU1 expression vector, the expression level of the NtBGLU1 gene was regulated to achieve the regulation of tobacco nicotine content.

Benefits of technology

By reducing or overexpressing the NtBGLU1 gene, the nicotine content in tobacco roots can be effectively regulated, reducing or increasing the nicotine content, providing technical means and theoretical basis for regulating the nicotine content in tobacco.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334044B_ABST
    Figure CN116334044B_ABST
Patent Text Reader

Abstract

The present invention provides a tobacco nicotine accumulation-related gene NtBGLU1, a protein, and applications thereof. The present invention constructs a pBWA(V)KS-RNAi-BGLU1 recombinant expression vector. After transforming the vector into tobacco plants, genetic material with reduced NtBGLU1 gene expression is constructed. Analysis and detection show that the nicotine content in the roots of strains with reduced NtBGLU1 gene expression is reduced. Therefore, the NtBGLU1 gene (NtBGLU1 protein) has the function of regulating the nicotine content of tobacco. By reducing or knocking out the NtBGLU1 gene expression, the nicotine content in the tobacco roots is reduced; conversely, by overexpressing the NtBGLU1 gene, the nicotine content in the roots is increased. In short, regulating the NtBGLU1 gene (NtBGLU1 protein) is of great significance for regulating the nicotine content of tobacco.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a tobacco nicotine accumulation-related gene NtBGLU1, a protein and an application thereof. Background Art

[0002] Nicotine is the primary alkaloid in tobacco, accounting for over 95% of the total alkaloid content. When insects or herbivores infest tobacco leaves, nicotine synthesis and metabolism, mediated by jasmonic acid damage-induced signals, immediately initiate in the roots. The synthesized nicotine is then transported to the leaves, providing protection against various infestations. Nicotine synthesis and metabolism are regulated by multiple factors, including insect feeding, jasmonic acid, abscisic acid, ethylene, and auxin.

[0003] Key genes and transcription factors in the nicotine biosynthesis pathway have been cloned. Studies have shown that ornithine undergoes decarboxylation under the catalysis of ornithine decarboxylase (ODC), or arginine is converted to putrescine under the catalysis of arginine decarboxylase (ADC). S-adenosylmethionine and putrescine are converted to N-methylputrescine and S-adenosylhomocysteine ​​under the catalysis of putrescine N-methyltransferase (PMT), which is a key rate-limiting enzyme in nicotine biosynthesis. Quinolinate phosphoribosyltransferase (QPT) plays a crucial regulatory role in the biosynthesis of pyridine alkaloids. QPT activity in tobacco roots is positively correlated with the rate and content of nicotine biosynthesis. Furthermore, BBLs and A622 are considered the final two key enzymes in nicotine biosynthesis. Regarding transcription factors, MYC2 and ERF189 are known to regulate nicotine biosynthesis. MYC2 and ERF189 regulate genes in the nicotine biosynthesis pathway through the transcription factor binding sites GCC and G-box in the gene promoter regions.

[0004] Nicotine synthesis and its regulatory mechanisms are relatively complex, and the molecular mechanisms underlying the nicotine biosynthesis pathway are not well understood. BGLU belongs to the β-glucosidase gene family, and there are currently no reports of its role in nicotine accumulation. This present invention is the first to clone a BGLU family gene involved in nicotine accumulation from tobacco, providing a new technical approach for regulating tobacco nicotine content and its application. Summary of the Invention

[0005] This application aims to provide a tobacco nicotine accumulation-related protein encoding gene, NtBGLU1, and the encoded tobacco nicotine accumulation-related NtBGLU1 protein, as well as applications of the NtBGLU1 gene and the encoded protein. NtBGLU1 and its encoded protein are associated with nicotine accumulation in tobacco and have important applications in tobacco nicotine regulation.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] A tobacco nicotine accumulation-related gene NtBGLU1, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] The tobacco nicotine accumulation-related gene NtBGLU1 also includes: a nucleotide sequence shown in SEQ ID NO. 1 which is replaced, deleted or added with at least one nucleotide and can express a nucleotide sequence having the function of a nicotine accumulation-related protein.

[0009] The tobacco nicotine accumulation-related gene NtBGLU1 and the nicotine accumulation-related protein can participate in tobacco nicotine accumulation and have the function of regulating nicotine content.

[0010] Furthermore, the expression level of the NtBGLU1 gene is reduced or knocked out, thereby reducing the nicotine content of tobacco; the NtBGLU1 gene is overexpressed, thereby increasing the nicotine content of tobacco.

[0011] A tobacco nicotine accumulation-related protein NtBGLU1, whose amino acid sequence is shown in SEQ ID NO.2.

[0012] The tobacco nicotine accumulation-related protein NtBGLU1 further comprises: an amino acid sequence in which the amino acid sequence shown in SEQ ID NO. 2 is replaced, deleted or added with at least one amino acid, and has the function of a nicotine accumulation-related protein.

[0013] The tobacco nicotine accumulation-related protein NtBGLU1 and the nicotine accumulation-related protein can participate in tobacco nicotine accumulation and have the function of regulating nicotine content.

[0014] Furthermore, the expression level of NtBGLU1 protein is reduced, thereby reducing the nicotine content of tobacco; and the nicotine content of tobacco is increased by overexpressing NtBGLU1 protein.

[0015] The application of the tobacco nicotine accumulation-related gene NtBGLU1 is used to regulate nicotine content.

[0016] The application reduces or knocks out the expression level of the NtBGLU1 gene, thereby reducing the nicotine content of tobacco; and overexpresses the NtBGLU1 gene, thereby increasing the nicotine content of tobacco.

[0017] The application of the tobacco nicotine accumulation-related protein NtBGLU1 is used to regulate nicotine content.

[0018] The application reduces the expression of NtBGLU1 protein, thereby reducing the nicotine content of tobacco; overexpresses NtBGLU1 protein, thereby increasing the nicotine content of tobacco.

[0019] After silencing the NtBGLU1 gene, which encodes the NtBGLU1 protein, the nicotine content in the roots of the silenced plants decreased. Tobacco NtBGLU1 and its encoding gene have important application significance for regulating nicotine content in tobacco.

[0020] The recombinant pBWA(V)KS-RNAi-BGLU1 expression vector for knocking down NtBGLU1 gene expression was constructed by the following steps:

[0021] The primer sequences BGLU1-F and BGLU1-R of the recombinant expression vector were designed as follows:

[0022] BGLU1-F(+):cagtggtctcacaacctaacagaccaagtttcatt, as shown in SEQ ID NO.3;

[0023] BGLU1-F(-):cgatggtctcacaggttgatgtcctccaaataacg, as shown in SEQ ID NO.4;

[0024] loop(+):cgatggtctcacctgcaggtctagtttttct, as shown in SEQ ID NO.5;

[0025] loop(-):cgatggtctcagcccgggctctgtaactatc, as shown in SEQ ID NO.6;

[0026] BGLU1-R(+):cagtggtctcagggcttgatgtcctccaaataacg, as shown in SEQ ID NO.7;

[0027] BGLU1-R(-):cagtggtctcatacactaacagaccaagtttcatt, as shown in SEQ ID NO.8.

[0028] Perform three 50-μl PCR reactions to amplify the target fragment and obtain the target sequence for constructing the interference vector. The target fragment and the vector sequence are digested with BsaI / Eco31I and ligated using T4 ligase. The ligation product is transformed into competent E. coli, and positive clones are screened to obtain the recombinant pBWA(V)KS-RNAi-BGLU1 expression vector for knocking down the BGLU1 gene in tobacco.

[0029] The recombinant pBWA(V)KS-RNAi-BGLU1 expression vector is used in tobacco. After the vector is transformed into tobacco, the expression level of the NtBGLU1 gene in tobacco can be reduced, so that the expression amount of the NtBGLU1 gene and protein in the transformed plants is significantly reduced.

[0030] The method for constructing transgenic plants using the pBWA(V)KS-RNAi-BGLU1 expression vector comprises the following steps: using an Agrobacterium-mediated gene transformation method to transform the pBWA(V)KS-RNAi-BGLU1 expression vector into Agrobacterium, screening to obtain engineered bacteria for transformation, using the engineered bacteria to infect plant tissue culture tissues, and obtaining tobacco genetic material with reduced tobacco NtBGLU1 gene expression through tissue culture and identification.

[0031] By designing specific primers, the present invention cloned the NtBGLU1 gene, encoding the tobacco NtBGLU1 protein. Real-time quantitative PCR analysis showed that the gene's expression was upregulated by jasmonic acid signals. Therefore, the present invention also aims to provide the use of MeJA in inducing the expression of the tobacco nicotine accumulation-related gene NtBGLU1 and nicotine biosynthesis.

[0032] To further investigate the role of the tobacco NtBGLU1 gene in tobacco accumulation, the present invention constructed the pBWA(V)KS-RNAi-BGLU1 recombinant expression vector. After transforming tobacco plants with this vector, genetic material with reduced NtBGLU1 gene expression was obtained. Analysis and testing showed that strains with reduced NtBGLU1 gene expression had reduced nicotine content in their roots. Therefore, the NtBGLU1 gene (NtBGLU1 protein) has the function of regulating tobacco nicotine content. By reducing or knocking out NtBGLU1 gene expression, nicotine content in tobacco roots is reduced; conversely, by overexpressing the NtBGLU1 gene, nicotine content in roots is increased. In summary, regulating the NtBGLU1 gene (NtBGLU1 protein) is of great significance for regulating tobacco nicotine content. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the electrophoresis picture of PCR amplification of NtBGLU1 gene;

[0034] Figure 2 The expression characteristics of NtBGLU1 gene under exogenous methyl jasmonate treatment (50 μmol / L and 100 μmol / L);

[0035] Figure 3 To analyze the expression of NtBGLU1 gene in interference plants;

[0036] Figure 4 These are the results of nicotine content analysis in NtBGLU1-interfered plants.

[0037] Figure 3 RNAi15, RNAi30, RNAi32, RNAi33, Figure 4 R15, R30, and R32 represent different tobacco strains. DETAILED DESCRIPTION

[0038] The present application will be further explained below in conjunction with the embodiments. Before introducing the specific embodiments, some of the biological materials, experimental reagents, experimental equipment, etc. involved in the following embodiments are briefly introduced as follows.

[0039] Biomaterials:

[0040] Tobacco variety: Honghua Dajinyuan, a commercial tobacco. The seeds used in the examples were provided by the National Tobacco Gene Research Center.

[0041] Vector: pEASY-T1 Simple vector, purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0042] pBWA(V)KS-RNAi vector was purchased from Boyuan Biotechnology Co., Ltd.;

[0043] Strains:

[0044] Trans1-T1 chemically competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.;

[0045] Agrobacterium strain LBA4404, a commonly used strain in biological experiments and publicly available;

[0046] Primer synthesis and DNA sequencing were provided by Beijing Liuhe BGI Genomics Co., Ltd.;

[0047] Experimental reagents:

[0048] RNA extraction kit, SuperPure Plant polyRNA Kit;

[0049] Fluorescent quantitative PCR enzyme (qPCR Mix) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0050] Reverse transcription kit and T4 ligase were purchased from Promega (Beijing) Biotechnology Co., Ltd. and NEB, UK, respectively;

[0051] DNA amplification enzyme was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0052] Plant genome extraction kit and DNA purification kit were purchased from QIAGEN.

[0053] Example 1

[0054] This example briefly introduces the cloning process of the NtBGLU1 gene as follows.

[0055] (1) Preparation of cDNA as cloning template

[0056] 100 mg of roots of tobacco (Honghua Dajinyuan) in vigorous growth period were taken as samples, and they were thoroughly ground in liquid nitrogen. Total RNA was extracted according to the instructions of the RNA extraction kit, and then reverse transcribed into cDNA for later use;

[0057] (2) Design primers and perform PCR amplification

[0058] The primer sequences designed for amplifying tobacco NtBGLU1 are as follows:

[0059] NtBGLU1-F: 5'-atggtgtcatgtcatctaacagacc-3'; as shown in SEQ ID NO.9;

[0060] NtBGLU11-R: 5'-ctatttctgggcagtatgtgcttca-3'; as shown in SEQ ID NO.10.

[0061] The cDNA prepared in step (1) was used as a template and PCR amplification was performed using the above primers. The PCR amplification conditions were as follows: 94°C pre-denaturation for 4 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 1 min, for a total of 30 cycles; and 72°C final extension for 10 min. The PCR amplification was then stored at 4°C for future use. Electrophoresis detection of PCR amplification of the NtBGLU11 gene was as follows. Figure 1 shown.

[0062] Purify the PCR amplification product according to the instructions of the gel recovery kit, and then ligate the purified product into the pEASY-T1 vector. The ligation system is as follows:

[0063] DNA amplification product, 6 μL;

[0064] pEASY-T1 vector, 1 μL;

[0065] After mixing, connect at 25°C for 25 min.

[0066] The ligation product was transformed into E. coli competent cells. The specific transformation process is briefly described as follows:

[0067] Take out the Trans-T1 competent medium from the -80℃ refrigerator and thaw it on ice; quickly add the ligation product to the thawed competent medium, mix gently, and incubate on ice for 20 to 30 minutes to allow the ligation product to adhere to the cell wall;

[0068] Heat shock at 42°C for 30 seconds to allow the ligation product to enter the competent cells. Place on ice for 2 minutes to allow the cell wall to recover. Do not shake the centrifuge tube during this process. Add 250 μL of antibiotic-free LB liquid medium and incubate at 37°C with a shaker at 200 rpm for 1 hour.

[0069] Take 8 μL of 500 mM IPTG and 40 μL of 20 mg / mL X-gal, mix them, and evenly spread them on a LB solid plate (containing 60 μg / μL ampicillin), invert the culture dish, and culture at 37°C overnight.

[0070] After white spots were picked and amplified and cultured, the plasmid DNA was extracted, the recombinant plasmid was identified by plasmid PCR amplification, and the corresponding positive clones were sent for sequencing to obtain the NtBGLU1 gene sequence.

[0071] Sequencing analysis results showed that the coding region of the NtBGLU1 gene was 1470 bp in length (specifically shown in SEQ ID NO.1). Analysis of the gene revealed that the amino acid sequence of the NtBGLU1 protein it encoded was shown in SEQ ID NO.2.

[0072] Example 2

[0073] In this example, the inventors treated tobacco seedlings with methyl jasmonate, extracted RNA and performed reverse transcription, and analyzed the expression pattern of the NtBGLU1 gene using fluorescent quantitative PCR. The relevant experiments are briefly described below.

[0074] Tobacco seeds were placed in a culture dish and cultured with Hoagland solution (light / dark = 18 / 6h, 23℃~28℃). After germination for 2 weeks, the seedlings were transplanted and immersed in a solution containing methyl jasmonate, and the corresponding concentration of methyl jasmonate was sprayed on the leaves for 5 hours. The samples were collected, quickly frozen with liquid nitrogen, and placed in a -80℃ refrigerator. After quick freezing with liquid nitrogen, they were placed in a -80℃ refrigerator and stored for future use.

[0075] The specific treatment methods of the experimental group are as follows:

[0076] 50 μmol / L and 100 μmol / L methyl jasmonate (MeJA);

[0077] At the same time, a control group was set up, and the tobacco seedlings in the control group were treated with 1% (v / v) DMSO solution.

[0078] The treated tobacco seedling materials were placed in 1.5 mL centrifuge tubes, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0079] RNA was extracted from the preserved materials and cDNA was synthesized using a reverse transcription kit (refer to the kit instructions for operation). Fluorescence quantitative PCR was performed using the tobacco NtBGLU1 gene as an internal reference. The primer sequences for the detection were designed as follows:

[0080] Fluorescent quantitative primers for detecting the NtBGLU1 gene, the primer sequences are:

[0081] NtBGLU1-qF: 5′-actgaaagggatccaaccgt-3′, as shown in SEQ ID NO. 11;

[0082] NtBGLU1-qR: 5'-ctaatggccacgaagctagc-3'; as shown in SEQ ID NO.12;

[0083] The NtL25 gene was used as the internal reference gene for quantitative PCR, and the specific primers were:

[0084] NtL25-F: 5′-caaaagttacattccaccg-3′, as shown in SEQ ID NO. 13;

[0085] NtL25-R: 5'-tttcttcgtcccatcaggc-3'; as shown in SEQ ID NO.14;

[0086] The conditions of fluorescence quantitative PCR were as follows: first step pre-denaturation, 95°C for 10 s; second step PCR reaction, 95°C for 5 s, 60°C for 30 s, 39 cycles; third step melting curve.

[0087] Each sample was biologically replicated three times. -△△CT The relative gene expression differences were analyzed by the method. Figure 1 As shown, compared with the control group, the relative expression level of NtBGLU1 gene was upregulated by jasmonic acid.

[0088] Fluorescence quantitative analysis results showed that both 50uM MeJA and 100MeJA could significantly induce the up-regulation of tobacco NtBGLU1 gene ( Figure 2 ).

[0089] Example 3

[0090] To further verify the function of tobacco NtBGLU1 gene in tobacco nicotine accumulation, the inventors constructed the pBWA(V)KS-RNAi-NtBGLU1 expression vector for knocking down the NtBGLU1 gene. The construction process is briefly described below.

[0091] First, based on the NtBGLU1 gene coding sequence known from Example 1 and according to the principle of RNA interference, a 200 bp target site was selected in the coding region of the NtBGLU1 gene, and the primer sequences of the recombinant expression vector were designed as follows:

[0092] BGLU1-F(+):cagtGGTCTCacaacCTAACAGACCAAGTTTCATT

[0093] BGLU1-F(-):cgatGGTCTCacaggTTGATGTCCTCCAAATAACG

[0094] loop(+):cgatGGTCTCacctgcaggtctagtttttct

[0095] loop(-):cgatGGTCTCagcccgggctctgtaactatc

[0096] BGLU1-R(+):cagtGGTCTCagggcTTGATGTCCTCCAAATAACG

[0097] BGLU1-R(-):cagtGGTCTCatacaCTAACAGACCAAGTTTCATT

[0098] Using the above three pairs of primers, three 50ul PCR reactions were performed to amplify the target fragment and obtain the target sequence fragment for constructing the interference vector. The obtained target fragment and the vector sequence were digested by BsaI / Eco31I and ligated using T4_ligase. The ligation product was transformed into Escherichia coli competent cells. After PCR confirmation of successful vector construction, the plasmid was extracted to obtain the recombinant pBWA(V)KS-RNAi-BGLU1 expression vector for knocking down the tobacco transport protein gene NtNTP1.

[0099] Example 4

[0100] The pBWA(V)KS-RNAi-BGLU1 expression vector constructed in Example 3 was transformed into Agrobacterium, and then into tobacco plants to construct transgenic plants with NtBGLU1 gene knockout. The specific experimental process is briefly described as follows.

[0101] (1) Transformation of Agrobacterium

[0102] Remove the competent Agrobacterium from -80°C and thaw on ice; add 100-200ng pBWA(V)KS-RNAi-BGLU11 plasmid to the competent culture, mix well, and place on ice for 30 minutes; immerse in liquid nitrogen for 1 minute, and heat shock at 37°C for 5 minutes; add 800μL YEB and culture at 28°C 200rpm for 4 to 6 hours; centrifuge to remove 800μL supernatant, suspend and evenly spread on YEB solid plate (containing Kana, Rif, Str), and culture in the dark at 28°C for 36 to 48 hours; then centrifuge the bacterial solution at 4500rpm for 1 minute, discard half of the supernatant, resuspend and evenly spread on YEB solid medium containing Rif (100μg / mL), Str (50μg / mL) and Kan (50μg / mL), and culture inverted at 28°C for about 2-3 days until single colonies are formed;

[0103] Pick a single colony, expand it, and perform PCR identification on the bacterial solution. The correct positive clone strain is the correctly transformed engineered bacteria.

[0104] (2) Transformation of tobacco plants

[0105] Take the leaves of the sterile tobacco seedlings that have grown for about one month, use a hole punch to process the leaves into leaf discs with a diameter of 0.5 cm, and pre-culture the processed leaf discs on MS solid medium for 3 days;

[0106] The transformed Agrobacterium engineered bacteria prepared above were cultured to an OD600 of about 0.6, centrifuged at 4000 rpm for 5 min to collect the bacteria, and then suspended in 20 mL of MS liquid medium;

[0107] Then the leaf disc after pre-culture was placed in the bacterial solution and infected for 10 minutes;

[0108] Use sterile filter paper to absorb the excess bacterial liquid around the infected leaf disc, and culture it in the dark on a solid medium containing MS+6-BA (2 mg / L)+NAA (0.5 mg / L) for 3 days;

[0109] The leaf discs were washed with sterile water containing Cef (400 mg / L), and the excess liquid was removed with sterile filter paper. The leaf discs were transferred to MS solid screening medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L), and Kan (50 mg / L) and cultured at 28°C in the light.

[0110] When the adventitious buds grew to 0.5 cm, they were transferred to MS solid medium containing Cef (200 mg / L) and Kan (50 mg / L) for rooting.

[0111] After about one month of growth, take a small amount of leaves and extract DNA according to the instructions of the plant genome extraction kit. Then use PCR amplification, cloning, and sequencing to detect positive transgenic lines. The specific identification method is as follows:

[0112] Design a pair of detection primers, which are located in the positive transformed plants for identification:

[0113] NtBGLU1-JF: 5'GACGCACAATCCCACTATCC-3' is shown in SEQ ID NO. 15;

[0114] NtBGLU1-JR: 5'TTGATGTCCTCCAAATAACGATGGT-3'; as shown in SEQ ID NO. 16

[0115] PCR amplification was performed using DNA templates from the T0 transgenic lines. The PCR conditions were as follows: pre-denaturation at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 min.

[0116] The PCR amplification was detected by agarose gel electrophoresis to identify the positive transformed plants.

[0117] The target fragment of the recombinant pBWA(V)KS-RNAi-BGLU1 vector was detected in the T0 generation plants, but not in the wild-type plant Hong Da. This indicates that the pBWA(V)KS-RNAi-BGLU1 recombinant vector has been successfully transformed into the T0 generation plants tested, confirming them as positive genetically transformed plants.

[0118] Phenotypic changes of transgenic lines:

[0119] RNA was extracted from positive plants and reverse transcribed into cDNA. Real-time quantitative PCR was then used to analyze the expression level of tobacco NtBGLU1 gene in positive plants. The results showed that compared with wild-type Hongda, the expression level of tobacco NtBGLU1 gene in RNAi plants was significantly reduced ( Figure 3 The wild-type and transgenic T0 plants were transplanted into pots and cultured in a greenhouse for about 12 weeks. The roots and leaves were collected and analyzed for nicotine content using ultra-high performance liquid chromatography. The results showed that the nicotine content in the roots of RNAi plants was lower than that of the wild-type plants. Figure 4 The results indicate that reducing the expression level of tobacco NtBGLU1 gene can reduce the nicotine content of tobacco.

[0120] In summary, the nicotine content of tobacco can be regulated by regulating the expression level of the NtBGLU1 gene, providing technical means and theoretical basis for the regulation of tobacco nicotine content and quality improvement. Sequence Listing <110> Hunan China Tobacco Industrial Co., Ltd. <120> Tobacco nicotine accumulation-related gene NtBGLU1, protein and its application <160> 16 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1470 <212> DNA <213> Tobacco (Nicotiana tabacum L.) <400> 1 atggtgtcat gtcatctaac agaccaagtt tcattgtcga gcaatttctt gtttggaacg 60 gcctcttcat cttaccagta tgaaggagct ttcctcagtg atgggaaagg cctcagcaac 120 tgggactttt ttacccatga agctggtcat gttaaggatg gaagcaatgg agatgttgct 180 gttgatcact accatcgtta tttggaggac atcaaactca tggcagatat gggtgtgaat 240 agctttcgtt tctctatctc atgggcaaga attctaccta agggcagatt tggaaaagtt 300 aatatggccg gaattgagta ctacagtaag ctcattgatg cactcctact gaaagggatc 360 caaccgtttg tcacattaac acattatgac ataccacaag aacttgagga cagatatggt 420 ggttggctaa attcacagat acagtatgat tttagctatt ttgcaaacat atgcttcaaa 480 tacttcggag atagagttaa atattggata acgatgaatg aggctagctt cgtggccatt 540 agtggctata gagatgggag ttaccctcca gctcgatgct ctggtatatt tgggaattgt 600 agtgctggcg gggattcaga aagggagccc ttcattgcag ctcacaatat gatcctatct 660 catgcagctg ctgtccgcat ttaccgcacc agatatcaga aatgtcaagg aggcatgatt 720 ggcattacta tgggtgtcga atggtatgaa ccgtttagca actcctcaga agacatagct 780 gcaactcaaa gagctcgatc attctatacc aattggtttt tagaccctat tatattagga 840 agatatcctg aagaaatggt acaaatttg ggatctaatc ttccagaatt ttcagtgagt 900 gatttgagaa tgttgagtta tggcctagat ttcattggca tcaatcatta ttcagctgtt 960 tatatcaaag attgcttata ttctgcctgt gaacatggaa actcttggtc agagggttct 1020 tatttaacga ctacacaaag agacggtgtc tacatcgggg aacctgggga agtggactgg 1080 caatttgtgt atccacaagg gattgaaaaa gttgtgatgt atataaagga cagattcaac 1140 aatactccta tgttatcac tgaaaatggc tttgctggga acagttcttc tatagaggat 1200 gccttgaacg atgttcatag agtgaaatac atgcatagct acttaaattc attggcaaat 1260 gcaatcagga aaggtgcaga tgtaaggggg tactttgctt ggtcccttct tgataacttt 1320 gagtggctag atggatatac cataagattt ggactttact atgtcaacta cacaaatctc 1380 cagagaactc caaaactatc agccactaag tatccagagc tcatgtgtaa ctttcacata 1440 gagcttgaag cacatactgc ccagaaatag 1470 <210> 2 <211> 489 <212> PRT <213> Tobacco (Nicotiana tabacum L.) <400> 2 Met Val Ser Cys His Leu Thr Asp Gln Val Ser Leu Ser Ser Asn Phe 1 5 10 15 Leu Phe Gly Thr Ala Ser Ser Ser Tyr Gln Tyr Glu Gly Ala Phe Leu 20 25 30 Ser Asp Gly Lys Gly Leu Ser Asn Trp Asp Phe Phe Thr His Glu Ala 35 40 45 Gly His Val Lys Asp Gly Ser Asn Gly Asp Val Ala Val Asp His Tyr 50 55 60 His Arg Tyr Leu Glu Asp Ile Lys Leu Met Ala Asp Met Gly Val Asn 65 70 75 80 Ser Phe Arg Phe Ser Ile Ser Trp Ala Arg Ile Leu Pro Lys Gly Arg 85 90 95 Phe Gly Lys Val Asn Met Ala Gly Ile Glu Tyr Tyr Ser Lys Leu Ile 100 105 110 Asp Ala Leu Leu Leu Lys Gly Ile Gln Pro Phe Val Thr Leu Thr His 115 120 125 Tyr Asp Ile Pro Gln Glu Leu Glu Asp Arg Tyr Gly Gly Trp Leu Asn 130 135 140 Ser Gln Ile Gln Tyr Asp Phe Ser Tyr Phe Ala Asn Ile Cys Phe Lys 145 150 155 160 Tyr Phe Gly Asp Arg Val Lys Tyr Trp Ile Thr Met Asn Glu Ala Ser 165 170 175 Phe Val Ala Ile Ser Gly Tyr Arg Asp Gly Ser Tyr Pro Pro Ala Arg 180 185 190 Cys Ser Gly Ile Phe Gly Asn Cys Ser Ala Gly Gly Asp Ser Glu Arg 195 200 205 Glu Pro Phe Ile Ala Ala His Asn Met Ile Leu Ser His Ala Ala Ala 210 215 220 Val Arg Ile Tyr Arg Thr Arg Tyr Gln Lys Cys Gln Gly Gly Met Ile 225 230 235 240 Gly Ile Thr Met Gly Val Glu Trp Tyr Glu Pro Phe Ser Asn Ser Ser 245 250 255 Glu Asp Ile Ala Ala Thr Gln Arg Ala Arg Ser Phe Tyr Thr Asn Trp 260 265 270 Phe Leu Asp Pro Ile Ile Leu Gly Arg Tyr Pro Glu Glu Met Val Gln 275 280 285 Ile Leu Gly Ser Asn Leu Pro Glu Phe Ser Val Ser Asp Leu Arg Met 290 295 300 Leu Ser Tyr Gly Leu Asp Phe Ile Gly Ile Asn His Tyr Ser Ala Val 305 310 315 320 Tyr Ile Lys Asp Cys Leu Tyr Ser Ala Cys Glu His Gly Asn Ser Trp 325 330 335 Ser Glu Gly Ser Tyr Leu Thr Thr Thr Gln Arg Asp Gly Val Tyr Ile 340 345 350 Gly Glu Pro Gly Glu Val Asp Trp Gln Phe Val Tyr Pro Gln Gly Ile 355 360 365 Glu Lys Val Val Met Tyr Ile Lys Asp Arg Phe Asn Asn Thr Pro Met 370 375 380 Phe Ile Thr Glu Asn Gly Phe Ala Gly Asn Ser Ser Ser Ile Glu Asp 385 390 395 400 Ala Leu Asn Asp Val His Arg Val Lys Tyr Met His Ser Tyr Leu Asn 405 410 415 Ser Leu Ala Asn Ala Ile Arg Lys Gly Ala Asp Val Arg Gly Tyr Phe 420 425 430 Ala Trp Ser Leu Leu Asp Asn Phe Glu Trp Leu Asp Gly Tyr Thr Ile 435 440 445 Arg Phe Gly Leu Tyr Tyr Val Asn Tyr Thr Asn Leu Gln Arg Thr Pro 450 455 460 Lys Leu Ser Ala Thr Lys Tyr Pro Glu Leu Met Cys Asn Phe His Ile 465 470 475 480<000035​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​<212> DNA <213> Artificial Sequence <400> 5 cgatggtctc acctgcaggt ctagtttttc t 31 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <400> 6 cgatggtctc agcccgggct ctgtaactat c 31 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <400> 7 cagtggtctc agggcttgat gtcctccaaa taacg 35 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <400> 8 cagtggtctc atacactaac agaccaagtt tcatt 35 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 atggtgtcat gtcatctaac agacc 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <400> 10 ctatttctgg gcagtatgtg cttca 25 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 actgaaaggg atccaaccgt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ctaatggcca cgaagctagc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 caaaagttac attccaccg 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 tttcttcgtc ccatcaggc 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 gacgcacaat cccactatcc 20 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <400> 16 ttgatgtcct ccaaataacg atggt 25

Claims

1. A tobacco nicotine accumulation-related gene NtBGLU1 , whose nucleotide sequence is shown in SEQ ID NO.

1.

2. A tobacco nicotine accumulation-related protein NtBGLU1, whose amino acid sequence is shown in SEQ ID NO.

2.

3. The tobacco nicotine accumulation-related gene according to claim 1 NtBGLU1 The application is characterized in that reduce NtBGLU1 gene expression, thereby reducing the nicotine content in tobacco.

4. The use of the tobacco nicotine accumulation-related protein NtBGLU1 according to claim 2, characterized in that: Reduce the expression of NtBGLU1 protein, thereby reducing the nicotine content in tobacco.

5. Methyl jasmonate induces the tobacco nicotine accumulation-related gene according to claim 1 NtBGLU1 Application in expression.

Citation Information

Patent Citations

  • Genes capable of regulating and controlling nicotine content of tobacco and application of genes

    CN104388431A

  • Cloning and application of tobacco nornicotine compound regulatory gene NtERF91

    CN110643616A