Application of SSR primers in Jingyan Dongmei 9 seed purity and authenticity identification
By using specific SSR primers for PCR amplification and electrophoresis detection in cucumber seeds, the problems of long cycle, high cost, and high environmental dependence in cucumber seed purity and authenticity identification have been solved, achieving efficient and accurate seed identification, saving resources, and improving identification efficiency.
Patent Information
- Application Number
- CN202310367718.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-07
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2043-04-07
AI Technical Summary
Existing technologies for identifying the purity and authenticity of cucumber seeds suffer from problems such as long processing time, high cost, and significant susceptibility to environmental factors, making it difficult to accurately identify the purity and authenticity of varieties.
PCR amplification of Jingyan Dongmei 9 cucumber seeds was performed using highly specific SSR primers, and the purity and authenticity were identified by electrophoresis. A dedicated kit and identification method are provided.
It enables efficient and accurate identification of seed purity and authenticity, saves resources, shortens identification time, avoids waste in field planting, and improves identification efficiency and accuracy.
Smart Images

Figure CN116334289B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of vegetable breeding, and particularly relates to application of SSR primers in seed purity and authenticity identification of a new cucumber variety, Beijingyan Dongmei No.9. BACKGROUND
[0002] Cucumber (Cucumis sativus L.) is also known as huogua, and is an annual climbing herbaceous plant in Cucumis sativus L. of Cucurbitaceae, with a chromosome number of 2n=2x=14, mostly monoecious, and a small amount of other sex types. Cucumber is rich in nutrients such as protein, vitamin C, niacin, carotene, iron, phosphorus, calcium and the like. Cucumber is usually eaten with tender cucumbers, and can be cooked, steamed, fried, stewed, cold or processed. The heat of cucumber is only 16 kcal / 100 g, which is the lowest among vegetables, and has a sweet, sweet, cool, bitter and non-toxic taste; has the effects of clearing heat and resolving toxins, promoting water and diuresis, and removing dampness and heat. Cucumber contains malonic acid, also known as hydroxypropanedioic acid, which can inhibit the conversion of sugar into fat in the human body without affecting the provision of heat and energy to the human body, so it has the effects of weight loss and fitness. Cucumber stems can be used as medicine, which can relieve convulsions, expel phlegm and reduce inflammation, and has the effect of reducing blood pressure and cholesterol. About 3000 years ago, India began to cultivate cucumbers, and later they were introduced to China through the Silk Road. Around 1500 AD, Spain and Canada had records of cucumber planting. Around 1600 AD, cucumbers were widely planted around the world. In the long-term cultivation selection and natural evolution process, a wide variety of cucumber varieties and cultivation types have been formed, and are now widely cultivated in temperate and tropical and subtropical regions, becoming one of the world's major vegetables. Because different varieties and types of cucumbers have different ecological adaptability and characteristics, there are great differences in characteristics, so there are varieties suitable for local climate and ecological conditions and consumer habits in different regions. With the improvement of people's living standards and the high efficiency in protected production, the protected cultivation of cucumbers has developed rapidly. Cucumbers can not only be produced in suitable cultivation seasons, but also can be cultivated in severe winters and hot summers, the growth period is extended, and the economic benefit is obviously improved, becoming one of the main vegetables supplied throughout the year in China.
[0003] With the rapid development of modern agriculture and biotechnology, breeding methods are constantly updated, and breeding levels are constantly improved. Variety purity is the prerequisite for the genetic characteristics of excellent varieties to be fully reflected and the genetic quality of seeds to be guaranteed, and is an important indicator for seed quality evaluation and seed grade evaluation, which has a great influence on the yield and quality of agricultural production, and has important significance and application value in the process of seed production, processing, storage and sales. Because biological contamination and mechanical contamination may occur during seed production, the purity and authenticity of the seeds are seriously affected. Therefore, it is necessary to sample and test the authenticity and variety purity of the seeds before sale and use.
[0004] Currently, the most widely used field plot planting identification method in production is simple, intuitive, and easy to observe. However, because many morphological traits of plants are often affected by environmental conditions, especially some quantitative traits which can vary greatly under different cultivation conditions, the technical requirements for identification personnel are very high. Purity identification of seeds used in production often requires off-site generation testing, which is time-consuming, inefficient, and costly. In recent years, biotechnology has developed rapidly, and DNA molecular markers have made good progress in the field of seed authenticity and purity identification. Their advantages are mainly reflected in: accurate and reliable variety identification; ability to identify varieties with difficult-to-identify phenotypes; short experimental cycle; low cost; and ease of automation; and the identification process is not affected by environmental factors. It has already achieved good results on some major vegetables and crops. Among them, SSR marker technology has simple operation steps and reliable experimental results, and is widely used in various crops such as corn, wheat, rice, cotton, cabbage, and Chinese cabbage.
[0005] Jingyan Dongmei No. 9 is a newly developed hybrid cucumber variety by the Cucumber Development Research Group of the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences. It has a high female node rate, is early-maturing, exhibits strong plant growth, is not prone to premature aging, and has a total growth period of approximately 120 days. It is a main vine-bearing variety with straight, rapidly expanding fruits, reaching about 35 cm in length, with a short stem, a dark green, glossy skin, moderately sized spines, light green flesh, a rich flavor, and crisp texture. It is suitable for winter and spring protected cultivation. Grafting onto high-quality cucumber rootstock can improve plant resistance, increase fruit gloss, and extend the harvest period. Summary of the Invention
[0006] To address the aforementioned problems in the existing technology, this invention provides the application of two pairs of SSR primers in the identification of the purity and authenticity of the new cucumber variety Jingyan Dongmei 9 seeds, or in assisting with the identification of authenticity.
[0007] In a first aspect, the present invention provides the application of SSR primers in the purity identification of the cucumber Jingyan Dongmei 9 hybrid, wherein the SSR primers include at least one of the following two pairs of primers:
[0008] SSR17922 primer pair:
[0009] Forward primer: 5′-CATTCTAGGTCAATGAATCGCA-3′;
[0010] Reverse primer: 5′-GCAAAGTTGCCACATTGAAG-3′;
[0011] SSR02118 primer pair:
[0012] Forward primer: 5′-GCAGGTCAGCACCTTCAACT-3′;
[0013] Forward primer: 5'-CATTCTAGGTCAATGAATCGCA-3';
[0014] In a second aspect, the present application provides a kit for identifying the purity of the hybrid of Cucumis sativus L. Jingyan Dongmei No.9, which contains at least one of the two pairs of primers described in the first aspect of the present application.
[0015] Preferably, the kit further contains at least one of PCR amplification buffer, dNTP, Taq enzyme and DNA color developing dye.
[0016] In a third aspect, the present application provides a method for identifying the purity of the hybrid of Cucumis sativus L. Jingyan Dongmei No.9, which comprises the following steps: taking the DNA of the seed to be detected as a template, using at least one of the two pairs of primers described in the first aspect of the present application to perform PCR amplification, and detecting the amplification product.
[0017] Preferably, the method comprises: when the SSR17922 primer pair is used, the hybrid of Cucumis sativus L. Jingyan Dongmei No.9 can be detected by two bands of 182bp and 195bp; and when the SSR02118 primer pair is used, the hybrid of Cucumis sativus L. Jingyan Dongmei No.9 can be detected by two bands of 178bp and 193bp.
[0018] In a fourth aspect, the present application provides the application of the SSR primer in the identification or auxiliary identification of the authenticity of the hybrid of Cucumis sativus L. Jingyan Dongmei No.9, which comprises at least one of the following two pairs of primers:
[0019] SSR17922 primer pair:
[0020] Forward primer: 5'-CATTCTAGGTCAATGAATCGCA-3';
[0021] Reverse primer: 5'-GCAAAGTTGCCACATTGAAG-3';
[0022] SSR02118 primer pair:
[0023] Forward primer: 5'-GCAGGTCAGCACCTTCAACT-3';
[0024] Reverse primer: 5'-TCAGGAGGCTTTTTAAGCGA-3'.
[0025] In a fifth aspect, the present application provides a kit for identifying or assisting in identifying the authenticity of the hybrid of Cucumis sativus L. Jingyan Dongmei No.9, which contains at least one of the two pairs of primers described in the fourth aspect of the present application.
[0026] Preferably, the kit further comprises at least one of PCR amplification buffer, dNTP, Taq enzyme and DNA color developing dye.
[0027] In a sixth aspect, the present application provides a method for identifying or assisting in identifying the authenticity of the cucumber Jingyan Dongmei No.9 hybrid variety, which comprises the following steps: taking the DNA of the seed to be detected as a template, performing PCR amplification by using at least one of the two primer pairs in the fourth aspect of the present application, and detecting the amplification product.
[0028] Preferably, the method comprises: when the SSR17922 primer pair is used, the cucumber Jingyan Dongmei No.9 hybrid variety can be detected by two bands of 182bp and 195bp; and when the SSR02118 primer pair is used, the cucumber Jingyan Dongmei No.9 hybrid variety can be detected by two bands of 178bp and 193bp.
[0029] The SSR primer provided by the present application has polymorphism among parents and exhibits co-dominance, and exhibits clear and stable parent complementary banding in hybrid offspring, has strong specificity, and can be used to distinguish the mixed maternal parent, paternal parent and other variety seeds; the present application provides a convenient, accurate and efficient identification method for the purity and authenticity identification (or assisted authenticity identification) of the Jingyan Dongmei No.9 variety, and can completely replace field planting identification to avoid resource waste, save land and manpower and material resources. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 The figure shows the electrophoresis detection results of the products amplified by using the SSR17922 and SSR02118 primer pairs in the parents and F1 generation in the embodiment 1 of the present application. Among them, the lanes numbered 7, 8, 19 and 20 are the electrophoresis results of the paternal parent, the lanes numbered 9, 10, 21 and 22 are the electrophoresis results of the maternal parent, and the lanes numbered 11, 12, 23 and 24 are the electrophoresis results of the F1 generation; the lane numbered "M" represents a DNA molecular weight standard product (DNA ladder) with an interval of 50bp; the lanes numbered 7-12 are the electrophoresis detection results of the SSR17922 primer pair; and the lanes numbered 19-24 are the electrophoresis detection results of the SSR02118 primer pair.
[0031] Figure 2 The figure shows the electrophoresis results of the detection of part of the F1 generation seedlings by using the SSR17922 primer pair in the embodiment 2 of the present application. Among them, the lane numbered 1 is the electrophoresis result of the paternal parent, the lane numbered 2 is the electrophoresis result of the maternal parent, and the remaining lanes are the electrophoresis results of the F1 generation; the lane numbered "M" represents a DNA molecular weight standard product (DNA ladder) with an interval of 50bp.
[0032] Figure 3 The following is an example of electrophoresis results from the detection of a portion of F1 generation seedlings using the SSR02118 primer pair in Example 2 of this invention. Lane 1 represents the electrophoresis results of the male parent, lane 2 represents the electrophoresis results of the female parent, and the remaining lanes represent the electrophoresis results of the F1 generation. Lanes marked "M" represent DNA molecular weight standards (DNAladders) spaced 50 bp apart.
[0033] Figure 4 The electrophoretic detection results of the products amplified from the parent and F1 generations using the three SSR primer pairs listed in Table 2 are shown in the comparative examples of this invention. Lanes 1-6 represent results using SSR20218 primers; lanes 7-12 represent results using SSR15955 primers; lanes 13-18 represent results using SSR10518 primers; lanes marked "M" represent DNA molecular weight standards (DNA ladder) spaced 50 bp apart; lanes 1, 2, 7, 8, 13, and 14 represent the electrophoresis results of the paternal parent; lanes 3, 4, 9, 10, 15, and 16 represent the electrophoresis results of the maternal parent; and lanes 5, 6, 11, 12, 17, and 18 represent the electrophoresis results of the F1 generation. Detailed Implementation
[0034] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0035] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.
[0036] The cucumber F1 hybrid Jingyan Dongmei 9 used in this invention, along with its male and female parents, as well as Green Elf 4 and Jingyan Chunqiu Lv 2, are all varieties bred by the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.
[0037] Example 1
[0038] This example illustrates the screening of specific primers.
[0039] According to GB / T 3543.5, 400 Jingyan Dongmei 9 cucumber F1 hybrid seeds were randomly selected from the net seeds, with 100 seeds per group and 4 replicates. They were placed in a paper bed for germination. When the seedlings grew to about 2.5 cm, the genomic DNA of the seedlings was extracted using the modified CTAB method.
[0040] Specific primer screening:
[0041] Seventy-two pairs of SSR primer sequences from Li Haimei (Li Haimei. Development and application of SSR molecular markers in cucumber mitochondria [M]. Nanjing Agricultural University, 2015.) and Huang (Huang SW, Li RQ, Zhang ZH, et al. The genome of the cucumber, Cucumis sativus L. [J]. Nat Genet, 2009, 41(12): 1275-1281.) were synthesized by Beijing Saibaisheng Gene Technology Co., Ltd., and then primer storage solutions with a final concentration of 100 μM were prepared using ultrapure water. Before use, the primers were further diluted with ultrapure water to a working solution of 10 μM.
[0042] Using the extracted genomic DNA from the male parent (Jingyan Dongmei 9), the female parent (Jingyan Dongmei 9), and 10 randomly selected F1 hybrid seedlings as templates, PCR amplification was performed using the aforementioned 72 pairs of SSR primers according to the following PCR reaction system and procedure:
[0043] The PCR reaction system consisted of a total reaction volume of 20 μL, including 0.4 μL of 10 mM dNTP, 2 μL of 10×PCR buffer, 0.2 μL of 5 U / μL Taq DNA polymerase, 2 μL of template DNA, 1 μL each of 10 pM forward and reverse primers, and ddH2O to bring the total volume to 20 μL.
[0044] The PCR reaction procedure was as follows: first, 94℃ for 5 min; then 94℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, for 35 cycles; then 72℃ for 4 min, and finally stored at 16℃.
[0045] After amplification, electrophoresis was performed using 2.5% high-resolution agarose gel. Following electrophoresis, the agarose gel was placed in the GBOX-CHEMIXRQ intelligent imaging analysis system to acquire images. Based on the differences in banding patterns of the PCR products, primer pairs in the F1 generation hybrids that could amplify both paternal and maternal banding patterns (i.e., complementary paternal and maternal primer pairs) were screened. Then, using the same PCR reaction system and procedure, and with genomic DNA from 100 F1 generation hybrid seedlings as templates, the specificity of the screened primer pairs was further tested and verified.
[0046] By screening and analyzing the SSR band patterns of the above PCR amplification results, two primer pairs were selected (see primer pairs numbered SSR17922 and SSR02118 in Table 1). Specifically, primer pair SSR17922 amplified a 182bp band in the male parent and a 195bp band in the female parent, and simultaneously amplified both 182bp and 195bp bands in the F1 generation; primer pair SSR02118 amplified a 193bp band in the male parent and a 178bp band in the female parent, and simultaneously amplified both 193bp and 178bp bands in the F1 generation (e.g., ...). Figure 1 (As shown).
[0047] Table 1. Composition of polymorphic SSR primer sequences
[0048] Primer No. Forward primer (5'→ 3') Reverse primer (5'→ 3') Size of amplified fragment (bp) SSR17922 CATTCTAGGTCAATGAATCGCA GCAAAGTTGCCACATTGAAG 182、195 SSR02118 GCAGGTCAGCACCTTCAACT TCAGGAGGCTTTTTAAGCGA 178、193
[0049] As can be seen, both primer pairs SSR17922 and SSR02118 can amplify polymorphic sites between the parents (including the paternal and maternal parents) and the F1 generation. Furthermore, the F1 hybrid offspring exhibit banding characteristics of both the paternal and maternal parents, demonstrating co-dominant segregation and complementarity. More importantly, the banding patterns amplified by these two primer pairs are clear and free from interference from other bands. The spacing between the two bands amplified by each primer pair in the F1 generation is appropriate, which is highly beneficial for experimental operation and observation of electrophoresis results (if the banding is blurry, has low brightness, or the molecular weight of the polymorphic fragments is too small (e.g., less than 10 bp), it is not conducive to the observation of electrophoresis results, and the identification of the electrophoretic pattern becomes difficult). Therefore, both primer pairs SSR17922 and SSR02118 can be used to identify the purity of F1 hybrids.
[0050] Example 2
[0051] This example illustrates the application of the selected specific primers in the purity identification of the F1 generation hybrid of cucumber Jingyan Dongmei 9.
[0052] 400 seeds of each of the F1 generation hybrids of cucumber Jingyan Dongmei 9 produced by 8 farmers from the seed production base were randomly selected and then divided into four equal parts. Two parts (one of which was used as a backup) were used to obtain seedlings according to the method in Example 1, and the genomic DNA of 100 seedlings from each farmer was extracted using the method in Example 1. The other two parts (one of which was used as a backup) were used for field plot planting identification.
[0053] Then, using the PCR reaction system and PCR reaction procedure in Example 1, the genomic DNA of the 100 seedlings extracted in this example was amplified using the two pairs of SSR primers SSR17922 and SSR02118 listed in Table 1 as templates, and the amplified products were analyzed by electrophoresis according to the method in Example 1.
[0054] The results showed that the purity of the F1 generation hybrids of Jingyan Dongmei 9 produced by 6 farmers was 100%. One farmer's F1 generation hybrid of Jingyan Dongmei 9 showed one DNA band that only amplified the corresponding maternal parent (indicating it was a self-pollinated female parent), therefore the seed purity was (100-1) / 100=99%. Finally, one farmer's F1 generation hybrid of Jingyan Dongmei 9 showed two DNA bands that only amplified the corresponding maternal parent (indicating it was a self-pollinated female parent), therefore the seed purity was (100-2) / 100=98%.
[0055] In summary, the purity of this batch of seeds tested in this embodiment is (800-3) / 800=99.625%. Figure 2 and Figure 3 Electrophoresis results of partial F1 generation seedlings were shown using primer pairs SSR17922 and SSR02118.
[0056] Field plot planting identification should be conducted as follows:
[0057] In accordance with the provisions of GB / T 3543.5, 100 seeds of each of the F1 generation hybrid cucumber variety Jingyan Dongmei 9 produced by the above 8 farmers were directly sown in the greenhouses of the 8 farmers at the seed production base, with protective rows set up around the perimeter and a row spacing of 40-50 cm. Field management was carried out in accordance with conventional methods.
[0058] Variety purity is expressed as a percentage. The percentages of identified plants representing the native variety, different varieties, different crops, and weeds are all expressed as a percentage of the identified plants. Variety purity can be calculated using the following formula:
[0059] Variety purity (%) = {Total number of plants of this crop - Number of variant plants (atypical plants) × 100} / Total number of plants of this crop.
[0060] Field trait identification results showed that only 3 out of the 800 plants had significant differences in traits from the other 797 plants, thus the seeds corresponding to these 3 plants were determined to be false hybrids. At the same time, it was found that the main agronomic traits of these three plants were consistent with those of the maternal parent, so they were determined to be self-crossed maternal parent plants.
[0061] In summary, the field identification results are consistent with the SSR molecular marker detection results, indicating that the primers in Table 1 used in this invention can be used to identify and detect the seed purity of the new cucumber variety Jingyan Dongmei 9.
[0062] Example 3
[0063] This example illustrates the application of the selected specific primers in the authenticity identification (or auxiliary authenticity identification) of the F1 generation hybrid of cucumber Jingyan Dongmei 9.
[0064] Two seeds of the F1 hybrid of cucumber Jingyan Dongmei 9 (identified as 'Jingyan Dongmei 9'), two seeds of the female parent self-cross, two seeds of Green Elf 4, and two seeds of Jingyan Chunqiu Lv 2 were selected, with all seeds being triple-reproduced. Seedlings were cultivated according to the method in Example 1, and genomic DNA was extracted from the seedlings.
[0065] Then, using the PCR reaction system and PCR reaction procedure in Example 1, and the two pairs of SSR primers listed in Table 1, the genomic DNA of the seedlings extracted in this example was amplified as a template, and the amplified products were subjected to electrophoresis according to the method in Example 1.
[0066] The results showed that both pairs of SSR primers listed in Table 1 could amplify the bands listed in Table 1 in the F1 generation hybrid of Jingyan Dongmei 9; a band from the maternal parent could be amplified in the self-pollinated varieties of the maternal parent of Jingyan Dongmei 9; and no bands listed in Table 1 could be amplified in Green Elf 4 and Jingyan Chunqiu Green 2. This indicates that the two pairs of SSR primers provided by this invention can be used for the authenticity identification (or auxiliary authenticity identification) of the F1 generation hybrid of cucumber Jingyan Dongmei 9.
[0067] Comparative Example
[0068] Using DNA extracted from the F1 hybrid of cucumber Jingyan Dongmei 9 (identified as strain 2) as a template, and employing the three pairs of SSR primers listed in Table 2, the PCR reaction system and procedure described in Example 1 were used for amplification. The amplified products were then analyzed by electrophoresis according to the method described in Example 1.
[0069] Table 2 Composition of the three pairs of SSR primer sequences
[0070] Primer No. Forward primer (5'→ 3') Reverse primer (5'→ 3') SSR20218 CTGGTGGGTTTTCTGAAACG TCGCCCACGTCCTCTATATC SSR15955 TTTGAGCCTTGAGGCAAAGT GCAATTCAACGTAATGGGCT SSR10518 TCTAATTCGCTCCGGATGAT TTGCAGCGAACAATCCTGTA
[0071] likeFigure 4 As shown, the results revealed:
[0072] The bands amplified by primer SSR20218 showed little difference between the male and female parents of Jingyan Dongmei 9. However, two bands were amplified in the F1 hybrids, but the difference between the two bands was too great, and the lower band was relatively weak. Therefore, it could not be used to distinguish the male and female parents of Jingyan Dongmei 9, and it was also easy to make misjudgments when using it to identify the F1 hybrids of Jingyan Dongmei 9. Therefore, it could not be used for purity identification and auxiliary authenticity identification (or auxiliary authenticity identification) of Jingyan Dongmei 9.
[0073] Although the bands amplified by primer SSR15955 can show the differences between the male and female parents of Jingyan Dongmei 9, and can also amplify the male and female parents' bands in the F1 generation hybrids, the size of these two bands is too similar, making it difficult to clearly distinguish between them. This can easily lead to errors when using them to identify the F1 generation hybrids of Jingyan Dongmei 9. Therefore, it is not suitable for using Jingyan Dongmei 9 for purity identification and auxiliary authenticity identification (or auxiliary authenticity identification).
[0074] Although the bands amplified by primer SSR10518 can also show the differences between the male and female parents of Jingyan Dongmei 9, the bands amplified in the F1 hybrid are too weak and blurry, making it difficult to distinguish the male and female parents. Furthermore, three very similar bands can be vaguely seen, making it impossible to accurately determine the molecular weight of the amplified bands. Therefore, it cannot be used for purity identification and auxiliary authenticity identification (or auxiliary authenticity identification) of Jingyan Dongmei 9.
[0075] In summary, the three pairs of SSR primers in Table 2 cannot accurately distinguish between the male and female parents of Jingyan Dongmei 9 and the F1 hybrids, and are not suitable for purity identification and auxiliary authenticity identification (or auxiliary authenticity identification) of Jingyan Dongmei 9.
[0076] In summary, the two pairs of SSR marker primers provided in this invention exhibit co-dominance in the PCR amplification patterns of the male, female, and F1 generations of Jingyan Dongmei 9, forming the fingerprint patterns of the parents and F1 generation of Jingyan Dongmei 9. The bands amplified by these two pairs of SSR primers show good stability and high clarity, with a molecular weight difference of more than 10 bp between polymorphic fragments, making them easy to distinguish and identify. The purity identification results of the SSR molecular markers are consistent with the field planting identification results, providing a convenient, accurate, and efficient identification method for the purity and authenticity of the Jingyan Dongmei 9 variety. This method can completely replace field planting identification to avoid resource waste and save land, manpower, and material resources. The SSR fingerprint of Jingyan Dongmei 9 can not only provide technical support for the approval, protection and parental purification of this variety, but also be used for rapid purity identification and authenticity testing of seed batches of this variety. It also provides basic information for gene localization and genetic mapping analysis of its related morphological traits and phenotypic characteristics, and provides alternative markers for purity identification and authenticity testing of similar cold-resistant cucumber varieties in North China.
[0077] By comparing indoor SSR molecular marker identification and field planting testing of Jingyan Dongmei 9 seeds, it was found that the results of field planting and molecular markers showed a high degree of agreement in seed purity identification, with no statistically significant difference. Using SSR molecular marker technology to replace field planting purity identification is not only unrestricted by environmental conditions such as climate, temperature, and soil, improving the efficiency and accuracy of variety identification, but also avoids the disadvantages of cumbersome, time-consuming, and demanding environmental requirements of field identification, greatly improving timeliness and ensuring that superior varieties can be launched into the market promptly. SSRs are distributed at different locations throughout the cucumber genome, and the number and sequence of repeating units at each locus may differ among different varieties, thus forming fragment length polymorphism. When using SSR molecular marker technology to identify the purity of cucumber hybrids, it reveals the polymorphism of the cucumber genomic DNA sequence. Therefore, the more SSR primers used, the higher the reliability of the identification results, but the corresponding cost is also higher. In actual seed production, the mixing of cucumber hybrids mainly originates from self-pollination of the maternal parent and hybridization of pollen from non-paternal parents during the seed production process. Therefore, the purity identification of cucumber hybrids mainly involves identifying whether they simultaneously contain parental bloodlines (bands). Thus, using a single pair of co-dominant SSR primers can achieve the purpose of identifying hybrids or parents, thereby saving manpower and resources, and achieving high efficiency. When used to identify the authenticity of the new cucumber variety Jingyan Dongmei 9, one or both pairs of primers provided in this invention can be selected for detection according to actual needs, thereby improving the reliability of the detection results.
[0078] In summary, using the two primer pairs provided by this invention to identify the authenticity and / or purity of the new cucumber variety Jingyan Dongmei 9 can greatly shorten the time from seed collection to sales, save resources, and improve efficiency.
[0079] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of SSR primers in purity identification of Jingyan Dongmei 9 hybrid cucumber, characterized in that, The SSR primers include at least one of the following two pairs of primers: SSR17922 primer pair: Forward primer: 5'-CATTCTAGGTCAATGAATCGCA-3'; Reverse primer: 5'-GCAAAGTTGCCACATTGAAG-3'; SSR02118 primer pair: Forward primer: 5'-GCAGGTCAGCACCTTCAACT-3'; Reverse primer: 5'-TCAGGAGGCTTTTTAAGCGA-3'.
2. A method for identifying the purity of the cucumber Jinyan Dongmei No. 9 hybrid, characterized in that: The method comprises the following steps: taking the DNA of the seed to be detected as a template, using at least one of the two pairs of primers in claim 1 to perform PCR amplification, and detecting the amplification product.
3. The method of claim 2, wherein, The method comprises the following steps: When the SSR17922 primer pair is used, the cucumber Jinyan Dongmei No. 9 hybrid can be detected by two bands of 182 bp and 195 bp; When the SSR02118 primer pair is used, the cucumber Jinyan Dongmei No. 9 hybrid can be detected by two bands of 178 bp and 193 bp.
4. Application of SSR primers in real or assisted authenticity identification of Jingyan Dongmei 9 hybrid cucumber variety, characterized in that, The SSR primers include at least one of the following two pairs of primers: SSR17922 primer pair: Forward primer: 5'-CATTCTAGGTCAATGAATCGCA-3'; Reverse primer: 5'-GCAAAGTTGCCACATTGAAG-3'; SSR02118 primer pair: Forward primer: 5'-GCAGGTCAGCACCTTCAACT-3'; Reverse primer: 5'-TCAGGAGGCTTTTTAAGCGA-3'.
5. A method for identifying or aiding in the identification of the authenticity of the cucumber hybrid variety Jingyan Dongmei No. 9, characterized by, The method comprises the following steps: taking the DNA of the seed to be detected as a template, using at least one of the two pairs of primers in claim 4 to perform PCR amplification, and detecting the amplification product.
6. The method of claim 5, wherein, The method comprises the following steps: When the SSR17922 primer pair is used, the cucumber Jinyan Dongmei No. 9 hybrid can be detected by two bands of 182 bp and 195 bp; When the SSR02118 primer pair is used, the cucumber Jinyan Dongmei No. 9 hybrid can be detected by two bands of 178 bp and 193 bp.
Citation Information
Patent Citations
SSR primer for identifying purity of seed of fruit CucumissativusL. Lvmei No.1 and method
CN111235306A