Construction method of a pseudomonas putida suicide vector and application thereof
By using a suicide vector of *Pseudomonas putida* that enhances the expression of the sacB gene, combined with the strong promoter Prib and screening methods, the problems of low gene knockout efficiency and accuracy in existing technologies have been solved, and efficient screening of *Pseudomonas putida* gene knockout has been achieved.
Patent Information
- Application Number
- CN202310156721.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-23
- Publication Date
- 2026-05-29
- Estimated Expiration
- 2043-02-23
AI Technical Summary
In the existing technology, the sucrose lethal effect of the *Pseudomonas putida* gene knockout vector pK18mobsacB is relatively weak, resulting in low accuracy and efficiency of gene knockout.
By enhancing the expression level of the sacB gene and using the strong promoter Prib, a suicide vector for *Pseudomonas putida* was constructed. Combined with kanamycin positive selection and sucrose negative selection, the accuracy and efficiency of gene knockout were improved.
This method enables efficient and accurate screening of Pseudomonas putida gene knockout, improving the screening efficiency and accuracy of gene knockout strains.
Smart Images

Figure CN116355942B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing a suicide vector of *Pseudomonas putida* and its application. Background Technology
[0002] Pseudomonas putida KT2440 ( Pseudomonas putida KT2440 is an important model environmental microbial strain. Its genome was deciphered in 2002, and it was the first Gram-negative strain recognized as environmentally safe by the U.S. Department of Health's Recombinant DNA Committee. *Pseudomonas putida* KT2440 exhibits broad metabolic diversity and strong adaptability to various environments. Since its isolation and discovery, *Pseudomonas putida* KT2440 has been frequently used as a model strain for research on general basic metabolic pathways. In addition, *Pseudomonas putida* KT2440 and its derivatives have been widely applied in various biotechnological applications, such as bioremediation of pollutants and the production of specific chemical compounds. Gene knockout is a primary method of genetic manipulation of strains and a major approach for studying gene and protein function, elucidating biodegradation pathways, and regulating them. Therefore, developing efficient, rapid, and accurate gene knockout techniques is a crucial prerequisite for fully utilizing *Pseudomonas putida*.
[0003] Suicide plasmids are plasmids that replicate autonomously in certain bacteria but not in others. They are usually derived from R plasmids. Since most bacteria lack the replication proteins required for gene initiation, they cannot replicate. Therefore, when a suicide plasmid enters a host cell, it either fails to replicate and is eliminated, or it integrates into the host chromosome under selective pressure and replicates along with the chromosome. Based on this characteristic of suicide plasmids, a mutant DNA fragment constructed using genetic engineering techniques is cloned into the suicide plasmid. Homologous exchanges between the homologous fragments at both ends of the mutant gene and the genome are then performed to construct a precise gene deletion mutant. Due to its suicide nature, the plasmid itself, along with the original wild-type gene on the chromosome, disappears from the bacterial cell with each generation.
[0004] Currently, the main vector used for gene knockout in *Pseudomonas putida* is pK18mobsacB. However, the traditional suicide vector pK18mobsacB has significant drawbacks when used for gene knockout. The main issue is that the expression level of sacB in *Pseudomonas putida* is low, resulting in a weak sucrose lethal effect. Therefore, the proportion of correctly deleted mutant strains screened is very low, leading to low accuracy.
[0005] Therefore, our research team intends to find a method to enhance the sucrose lethal effect of the pK18mobsacB vector and construct a suicide vector that can efficiently and accurately knock out genes in *Pseudomonas putida*. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a method for constructing a *Pseudomonas putida* suicide vector and its application. The suicide vector constructed using the method provided by this invention enhances the sucrose lethal effect induced by the sacB gene, exhibiting high efficiency and accuracy in screening *Pseudomonas putida* gene knockout strains.
[0007] The specific technical solution of this invention is as follows:
[0008] On the one hand, the present invention provides a method for constructing a suicide vector of *Pseudomonas putida*, the method comprising the following steps:
[0009] (1) Using pK18mobsacB vector as template, the vector backbone pK18 was amplified, and its nucleotide sequence is shown in SEQ ID No. 1;
[0010] (2) Using Pseudomonas putida KT2440 bacterial culture as a template, the promoter Prib was amplified, and its nucleotide sequence is shown in SEQ ID No.2;
[0011] (3) Connect the vector backbone pK18 described in step (1) with the promoter Prib fragment described in step (2), and then digest with enzymes to obtain the linearized vector pk18-Prib;
[0012] (4) Using the bacterial culture of Pseudomonas putida KT2440 as a template, the upstream and downstream homologous arms of the gene to be knocked out x are amplified and then linked to the vector pk18-Prib described in step (3) to obtain the Pseudomonas putida suicide vector.
[0013] The method for constructing the *Pseudomonas putida* suicide vector provided by this invention uses the pK18mobsacB vector as a template to amplify the vector backbone, the nucleotide sequence of which is shown in SEQ ID No. 1. Then, using *P. putida* KT2440 bacterial culture as a template, the promoter Prib and the upstream and downstream homologous arms of the gene to be knocked out, x, are amplified and linked to the vector backbone to obtain the *P. putida* suicide vector of this invention. The nucleotide sequence of the promoter Prib is shown in SEQ ID No. 2. The promoter Prib with this nucleotide sequence is a strong promoter, which can increase the expression level of sacB sucrase in *P. putida*, enhancing the sucrose lethal effect. After introducing the obtained *P. putida* suicide vector into *P. putida*, strains with the deletion of the target gene to be knocked out can be obtained efficiently and accurately through kanamycin positive selection and sucrose negative selection.
[0014] As a preferred embodiment of the present invention, in step (4), the upstream and downstream homologous arms of the gene to be knocked out x are 1000~2000bp in length.
[0015] Inserting upstream and downstream homologous arms of the gene to be knocked out, with a length of 1000-2000 bp, into the suicide vector of *Pseudomonas putida* can enable homologous exchange between the suicide vector and the recipient strain with high efficiency.
[0016] As a preferred embodiment of the present invention, in step (3), the enzyme used for enzymatic digestion is selected from restriction endonucleases. Hin dIII and restriction endonucleases Eco RI.
[0017] As a preferred embodiment of the present invention, in step (1), the amplification method is PCR amplification.
[0018] As a preferred embodiment of the present invention, in step (2), the amplification method is PCR amplification.
[0019] On the other hand, the present invention provides a method for constructing a *Pseudomonas putida* strain with the KT2440 gene deletion using the suicide vector provided by the present invention.
[0020] The method for constructing gene-deleted strains includes the following steps: introducing the *Pseudomonas putida* suicide vector into *Pseudomonas putida* for homologous recombination, and then screening with kanamycin and sucrose to obtain strains with the target gene to be knocked out.
[0021] Using the aforementioned *Pseudomonas putida* suicide vector, *Pseudomonas putida* gene-deleted strains can be constructed. After introducing the obtained *Pseudomonas putida* suicide vector into *Pseudomonas putida*, strains with the target gene deletion can be obtained efficiently and accurately through kanamycin positive selection and sucrose negative selection.
[0022] As a preferred embodiment of the present invention, the number of homologous recombinations is 2.
[0023] During the first homologous recombination, kanamycin was used for positive selection, and during the second homologous recombination, sucrose was used for negative selection. After positive and negative selection, strains with the target gene deletion to be knocked out were accurately obtained.
[0024] As a preferred embodiment of the present invention, the above-mentioned method of introduction is an electro-switching method. Preferably, the voltage for electro-switching introduction is 1.2~1.5 kV.
[0025] Compared with existing technologies, the method for constructing and applying the *Pseudomonas putida* suicide vector of this invention has the following technical advantages:
[0026] (1) pK18mobsacB can exist stably in a variety of bacteria. It contains the sacB gene, which encodes a sucrase that catalyzes the hydrolysis of sucrose into glucose and fructose. The fructose further polymerizes into high-molecular-weight fructans. The accumulation of fructans has a potential toxic effect on cells and can cause bacterial death. The construction method of this invention uses the pK18mobsacB vector as the basic framework and enhances the expression level of the sacB gene in the vector, which can improve the efficiency and accuracy of the resulting suicide vector in screening gene knockout strains.
[0027] (2) The suicide vector of Pseudomonas putida provided by the present invention is introduced into Pseudomonas putida for gene knockout strain screening. The operation is simple, efficient and accurate.
[0028] (3) By using the strong promoter Prib nucleotide sequence provided by this invention and adopting the same strategy as this invention, the expression of other genes can be enhanced, thereby enabling other molecular biological research. Attached Figure Description
[0029] Figure 1 This is a schematic diagram of the structure of the constructed vector pPribmobsacB and the original vector pK18mobsacB in Embodiment 1 of the present invention;
[0030] Figure 2 This is a schematic diagram of the fluorescence intensity detection of the Prib promoter and the sacB promoter itself in Embodiment 1 of the present invention;
[0031] Figure 3 This is a schematic diagram of the structures of the carriers pK18-ΔphaG and pPrib-ΔphaG constructed in Embodiment 2 of the present invention;
[0032] Figure 4 This is a gel image of PCR amplification of P9 / P10 using external primers for the phaG gene in Example 2 of this invention;
[0033] Figure 5 This is a schematic diagram of the structure of the carrier pK18-Δflag1 and pPrib-Δflag1 constructed in Embodiment 3 of the present invention;
[0034] Figure 6 This is a gel image of PCR amplification of P15 / P16 using external primers of the flag1 gene cluster in Example 3 of the present invention.
[0035] Figure 7 This is a schematic diagram of the carriers pK18-ΔPHA and pPrib-ΔPHA constructed in Embodiment 4 of the present invention;
[0036] Figure 8This is a gel image of PCR amplification of P21 / P22 using external primers of the PHA gene cluster in Example 4 of the present invention. Detailed Implementation
[0037] The technical solutions in the embodiments of the present invention will be described in a comprehensive and clear manner below with reference to specific examples.
[0038] The primer sequences used in this invention are shown in Table 1.
[0039] Table 1
[0040] Primer Name DNA Sequence (5’-3’) Restriction Site P1 ATGAACATCAAAAAGTTTGC P2 ATGGGTTAAAAAGGATCGAT P3 atcgatcctttttaacccatCCGGTAGCAAATGGGGGCC P4 gcaaactttttgatgttcatTAGAAAACCTCCTTAGATTCAATCC P5 acgacggccagtgccAAGCTTGCCAACCTGCCCAGCTACAA dIII P6 tacaaggcgccgagccgctTGTCATCGACTCCTGGCGCA P7 tgcgccaggagtcgatgacaAGCGGCTCGGCGCCTTGTA P8 ctatgaccatgattacGAATTCAGCCAGATGAGCAGGCCCAG RI P9 TGCGCAACAAGGCCTGTCTG P10 TTCCGCCAGGTTGCTGTGTG P11 acgacggccagtgccAAGCTTAACAGCAGGATGAGCATGGA dIII P12 tgcatcaagaggactcgcggGATTGTATACAACCTGTCGAGCC P13 ggctcgacaggttgtatacaatcCCGCGAGTCCTCTTGATGCA P14 ctatgaccatgattacGAATTCGATCGGTCGGCTCCGTTGAT RI P15 ACACCGACAATCGCAAGCACC P16 TCAAGGAGAGCCGTGCCAGT P17 acgacggccagtgccAAGCTTCCAGGTCAACGAGAAGACCGA dIII P18 ctcatgagcatgaggtacacagcTCTACGACGCTCCGTTGTCCT P19 aggacaacggagcgtcgtagaGCTGTGTACCTCATGCTCATGAG P20 ctatgaccatgattacGAATTCGACAACGCCTCGAAGCGATA RI P21 TGAAGCACAGCTTCCAGCTTAT P22 ATGTGTTTCAAATTCAGGAGC
[0041] Example 1: Construction of vector pPribmobsacB
[0042] Using primer pair P1 / P2 and pK18mobsacB vector as template, the vector backbone pK18 was amplified by PCR. Using primer pair P3 / P4 and KT2440 bacterial culture as template, the promoter Prib fragment was amplified. Then, pK18 and Prib were ligated separately using Vazyme's C112 ligase, and sequenced to obtain the vector pPribmobsacB. The nucleotide sequence of pK18 is shown in SEQ ID No. 1 of the sequence listing, and the nucleotide sequence of Prib is shown in SEQ ID No. 2 of the sequence listing.
[0043] The construction diagram of the vector pPribmobsacB is shown below. Figure 1 As shown, KanR is the kanamycin gene, used for screening the first homologous recombination; sacB is the sucrose lethal gene, used for screening the second homologous recombination; Prib is a stronger promoter than sacB, which can increase the expression level of sacB; the mob gene allows the plasmid to be transferred between different strains through the conjugation of the two parents.
[0044] Figure 2 This is a schematic diagram illustrating the fluorescence intensity detection of the Prib promoter and the sacB promoter itself. The promoter intensity is characterized by the fluorescence intensity of green fluorescent protein GFP in KT2440. Figure 2 It can be seen that the strength of the promoter Prib is much greater than that of the sacB promoter itself.
[0045] Example 2: Knocking out the phaG gene from *Pseudomonas putida* KT2440
[0046] Construction of S1, suicide vectors pK18-ΔphaG and pPrib-ΔphaG
[0047] The phaG gene is located at PP_1408 in the genome of *Pseudomonas putida* KT2440 and is 900 bp in length. This invention uses the phaG gene as a target gene to test the feasibility of the invention.
[0048] First, using *Pseudomonas putida* KT2440 as a template, the upstream and downstream homologous arms (~1000 bp) of the phaG gene were amplified using primer pairs P5 / P6 and P7 / P8, respectively. The pK18mobsacB and pPribmobsacB vectors were then used... Hin dIII、 Eco RI was double-digested, then ligated using C112 ligase, and transformed into DH5α competent cells. Sequencing confirmed the results, yielding the new vectors pK18-ΔphaG and pPrib-ΔphaG. The vector maps are shown below. Figure 3 As shown.
[0049] S2. Introducing the suicide vector into *Pseudomonas putida* KT2440.
[0050] Two suicide vectors correctly sequenced in step S1 were electroporated into competent *Pseudomonas putida* KT2440 cells at 1.2–1.5 kV. 1–2 ml of LB medium was added, and the cells were incubated for 1.5 h at 30 °C and 200 rpm in a shaker. The bacterial culture was then plated onto LB agar plates containing kanamycin (25 mg / L) and ampicillin (100 mg / L) and cultured until single colonies appeared. Single colonies were picked and cultured in LB liquid medium containing ampicillin (100 mg / L) at 30 °C and 200 rpm for 24 h, then streaked onto LBS (LB + 10% sucrose) plates.
[0051] Screening and validation of S3 and phaG gene knockout strains
[0052] ① Antibiotics were used to screen transformants. If a single crossover occurred, the suicide vector was integrated into the genome, and the strain exhibited resistance to both kanamycin and ampicillin. If a double crossover occurred, the upstream and downstream homologous arms of the phaG gene completely replaced PP_1408, and the strain only exhibited resistance to ampicillin. If the wild-type was restored, the strain only exhibited resistance to ampicillin. Single colonies were picked from LBS plates and streaked simultaneously onto Amp-resistant plates and Kan / Amp-resistant plates. After incubation at 30 °C for 24 h, the transformants were observed. Transformants that grew only on Amp-resistant plates and not on Kan / Amp-resistant plates were the correct knockout strains or wild-type strains. The results are shown in Table 2.
[0053] Table 2
[0054] ;
[0055] As shown in Table 2, when the vector pK18-ΔphaG with sacB as the promoter is knocked out, the probability of it not growing on the dual antibody plate is 3 / 8; when the vector pPrib-ΔphaG is knocked out, the probability of it not growing on the dual antibody plate is 8 / 8, which is higher than that of the vector pK18-ΔphaG with sacB as the promoter.
[0056] ② Colony PCR and sequencing verified the correct mutant strain. Using the screened transformants as templates, if wild-type recovery was achieved, PCR amplification was performed on P9 / P10 using external primers with up-down homologous arms of the phaG gene. The band length was 3162 bp (900 bp of phaG gene length + 1000 bp of up-arm + 1000 bp of down-arm + 262 bp of external genome length). If double crossover occurred, PCR amplification was performed on P9 / P10 using primers. The band length was 2262 bp (1000 bp of up-arm + 1000 bp of down-arm + 262 bp of external genome length). Further verification by sequencing confirmed the correct phaG gene knockout strain.
[0057] Figure 4 This is a gel image of PCR amplification of P9 / P10 using external primers for the phaG gene. Lane WT is the KT2440 negative control, and lanes 1-8 are the correctly screened mutant strains.
[0058] Example 3: Knocking out the flag1 gene cluster of *Pseudomonas putida* KT2440
[0059] Construction of S1, suicide vectors pK18-Δflag1, and pPrib-Δflag1
[0060] The flag1 gene cluster is located at PP_4328—PP_4344 in the genome of *Pseudomonas putida* KT2440, with a length of 18987 bp. To further demonstrate the advantages of the pPribmobsacB vector in knocking out long genes, this invention uses the flag1 gene cluster as a target gene to test the feasibility of the invention. First, using *Pseudomonas putida* KT2440 as a template, the upstream and downstream homologous arms of the flag1 gene cluster (2000 bp each) were amplified using primer pairs P11 / P12 and P13 / P14. The pK18mobsacB and pPribmobsacB vectors were then used... Hin dIII、 Eco The RI was double-digested, and then ligated using C112 ligase to obtain the new vectors pK18-Δflag1 and pPrib-Δflag1, respectively. The vector maps are shown below. Figure 5 As shown, sequencing verification.
[0061] S2. Introducing the suicide vector into *Pseudomonas putida* KT2440
[0062] Two suicide vectors correctly sequenced in step S1 were electroporated into competent *Pseudomonas putida* KT2440 cells at 1.2–1.5 kV. 1–2 ml of LB medium was added, and the cells were incubated for 1.5 h at 30 °C and 200 rpm in a shaker. The bacterial culture was then plated onto LB agar plates containing kanamycin (25 mg / L) and ampicillin (100 mg / L) and cultured until single colonies appeared. Single colonies were picked and cultured in LB liquid medium containing ampicillin (100 mg / L) at 30 °C and 200 rpm for 24 h, then streaked onto LBS (LB + 10% sucrose) plates.
[0063] Screening and validation of S3 and flag1 gene cluster knockout strains
[0064] ① Antibiotics were used to screen transformants. If a single crossover occurred, the suicide vector was integrated into the genome, and the strain exhibited resistance to both kanamycin and ampicillin. If a double crossover occurred, the upstream and downstream homologous arms of the flag1 gene completely replaced PP_4328—PP_4344, and the strain only exhibited ampicillin resistance. If the wild-type was restored, the strain only exhibited ampicillin resistance. Single colonies were picked from LBS plates and streaked simultaneously onto both Amp-resistant and Kan / Amp-resistant plates. After incubation at 30 °C for 24 h, the transformants were observed. Transformants that grew only on Amp-resistant plates and not on Kan / Amp-resistant plates were the correct knockout strains or wild-type strains. The results are shown in Table 2.
[0065] As shown in Table 2, when the vector pK18-Δflag1 with sacB as the promoter is knocked out, the probability of it not growing on the dual antibody plate is 0 / 30; when the vector pPrib-Δflag1 is knocked out, the probability of it not growing on the dual antibody plate is 15 / 30, which is much higher than the probability of knocking out with sacB as the promoter.
[0066] ② Colony PCR and sequencing verified the correct mutant strain. Using the screened transformants as templates, if wild-type recovery was achieved, PCR amplification was performed on P15 / P16 using external primers with up-down homologous arms of the flag1 gene cluster. The band length was 23300 bp (19000 bp of the flag gene cluster + 2000 bp of the up arm + 2000 bp of the down arm + 300 bp of the external genome). If double crossover occurred, PCR amplification was performed on P15 / P16 using primers. The band length was 4300 bp (2000 bp of the up arm + 2000 bp of the down arm + 300 bp of the external genome). The strain with the correct band was sent for testing, and the correct flag1 gene cluster knockout strain was finally obtained.
[0067] Figure 6This is a gel image of PCR amplification of P15 / P16 using external primers for the flag1 gene cluster. Lane WT is the KT2440 negative control, and lanes 3, 6, 9, and 14 are the correctly selected mutant strains.
[0068] Example 4: Based on the *Pseudomonas putida* deletion strain (ΔphaG) with the phaG gene knocked out, the PHA gene cluster was iteratively knocked out.
[0069] Construction of S1, suicide vectors pK18-ΔPHA and pPrib-ΔPHA
[0070] The PHA gene cluster is located at PP_5003–PP_5008 in the genome of *Pseudomonas putida* KT2440, and is 6280 bp in length. The feasibility of this invention was tested by using the PHA gene cluster as a target gene. First, using *Pseudomonas putida* KT2440 as a template, the upstream and downstream homologous arms (~1000 bp) of the PHA gene cluster were amplified using primer pairs P17 / P18 and P19 / P20, respectively. The pK18mobsacB and pPribmobsacB vectors were used… [[ID= dIII、 RI was double-digested, then ligated using C112 ligase, and transformed into DH5α competent cells. Sequencing confirmed the results, yielding the new vectors pK18-ΔPHA and pPrib-ΔPHA. The vector maps are shown below. As shown.
[0071] S2. Introducing the suicide vector into *Pseudomonas putida* ΔphaG
[0072] Two suicide vectors correctly sequenced in step S1 were electroporated into *Pseudomonas putida* ΔphaG competent cells at 1.2–1.5 kV. 1–2 ml of LB medium was added, and the cells were incubated for 1.5 h at 30 °C and 200 rpm in a shaker. The bacterial culture was then plated onto LB agar plates containing kanamycin (25 mg / L) and ampicillin (100 mg / L) and cultured until single colonies appeared. Single colonies were picked and cultured in LB liquid medium containing ampicillin (100 mg / L) at 30 °C and 200 rpm for 24 h, then streaked onto LBS (LB + 10% sucrose) plates.
[0073] Screening and validation of S3 and PHA gene cluster knockout strains
[0074] ① Transformants were screened using antibiotics. If a single crossover occurred, the suicide vector was integrated into the genome, and the strain exhibited resistance to both kanamycin and ampicillin. If a double crossover occurred, the upstream and downstream homologous arms of the PHA gene completely replaced PP_5003—PP_5008, and the strain only exhibited ampicillin resistance. If the wild-type was restored, the strain only exhibited ampicillin resistance. Single colonies were picked from LBS plates and streaked simultaneously onto both Amp-resistant and Kan / Amp-resistant plates. After incubation at 30 °C for 24 h, the transformants were observed. Transformants that grew only on Amp-resistant plates and not on Kan / Amp-resistant plates were the correct knockout strains or wild-type strains. The results are shown in Table 2.
[0075] As shown in Table 2, when the vector pK18-ΔPHA with sacB as the promoter is knocked out, the probability of it not growing on the dual antibody plate is 2 / 20; when the vector pPrib-ΔPHA is knocked out, the probability of it not growing on the dual antibody plate is 10 / 40, which is much higher than the probability of knocking out with sacB as the promoter.
[0076] ② Colony PCR and sequencing verified the correct mutant strain. Using the screened transformants as templates, if wild-type recovery was achieved, PCR amplification was performed on P21 / P22 using external primers with up-down homologous arms of the PHA gene cluster. The band length was 8580 bp (6280 bp of PHA gene cluster length + 1000 bp of up + 1000 bp of down + 300 bp of external genome). If double crossover occurred, PCR amplification was performed on P21 / P22 using primers. The band length was 2300 bp (1000 bp of up + 1000 bp of down + 300 bp of external genome). Further verification by sequencing confirmed the correct PHA gene cluster knockout strain.
[0077] Five of the ten transformants screened from pPrib-ΔPHA were selected for colony PCR verification. This is a gel image of PCR amplification of P21 / P22 using external primers of the PHA gene cluster. Lane WT is the KT2440 negative control, and lanes 3, 4, and 5 are the correctly screened mutant strains.
[0078] The cloning host DH5α used in this invention was purchased from Beijing Qingke Biotechnology Co., Ltd., and grown on standard LB medium. The chassis host *Pseudomonas putida* KT2440 used in the experiment was purchased from Hangzhou Baosai Biotechnology Co., Ltd., and grown on standard LB medium. The antibiotic concentrations used for growth were 100 mg / L ampicillin (Amp) or 50 mg / L kanamycin (Kan). The original vector pK18mobsacB used in the experiment was purchased from a biotechnology company and is commercially available.
[0079] For detailed steps of vector cloning, competent cell preparation, and electroporation in this invention, please refer to Molecular Cloning: A Laboratory Manual (4th Edition), translated by He Fuchu, Chen Wei, Yang Xiaoming, et al.
[0080] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.
[0081] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A method for constructing a suicide vector of *Pseudomonas putida*, characterized in that: Includes the following steps: (1) Using pK18mobsacB vector as template, the vector backbone pK18 was amplified, and its nucleotide sequence is shown in SEQ ID No.1; (2) Using the bacterial culture of Pseudomonas putida KT2440 as a template, the promoter Prib was amplified, and its nucleotide sequence is shown in SEQ ID No.2; (3) Connect the vector backbone pK18 described in step (1) with the promoter Prib described in step (2), and then digest with enzymes to obtain the linearized vector pk18-Prib; (4) Using the bacterial culture of Pseudomonas putida KT2440 as a template, the upstream and downstream homologous arms of the gene to be knocked out x are amplified and then linked to the vector pk18-Prib described in step (3) to obtain the Pseudomonas putida suicide vector.
2. The method for constructing a *Pseudomonas putida* suicide vector as described in claim 1, characterized in that: In step (4), the upstream and downstream homologous arms of the gene to be knocked out x are 1000~2000 bp in length.
3. The method for constructing a *Pseudomonas putida* suicide vector as described in claim 1, characterized in that: In step (3), the enzymes used for digestion are selected from restriction endonuclease HindIII and restriction endonuclease EcoRI.
4. The method for constructing a *Pseudomonas putida* suicide vector as described in claim 1, characterized in that: In step (1), the amplification method is PCR amplification.
5. The method for constructing a *Pseudomonas putida* suicide vector as described in claim 1, characterized in that: In step (2), the amplification method is PCR amplification.
6. The application of the *Pseudomonas putida* suicide vector constructed by the method described in any one of claims 1-5 in gene knockout of *Pseudomonas putida* KT2440.
7. The application as described in claim 6, characterized in that: The application includes the following steps: introducing the *Pseudomonas putida* suicide vector into *Pseudomonas putida* for homologous recombination, and then screening with kanamycin and sucrose to obtain strains with the target gene deletion to be knocked out.
8. The application as described in claim 7, characterized in that: The number of homologous recombinations is 2.
9. The application as described in claim 7, characterized in that: The import method is electroporation.
10. The application as described in claim 7 or 9, characterized in that: The induction is performed at a voltage of 1.2~1.5 kV.
Citation Information
Patent Citations
Pseudomonas putida gene knockout and genome simplification system
CN106086056A