Land cotton ghisr43 gene, its coding protein and application thereof in regulating plant salt stress tolerance
By isolating and regulating the GhISR43 gene, the problem of insufficient utilization of cotton salt tolerance genes in existing technologies has been solved, thereby improving the plant's resistance to salt stress and promoting the development of agriculture in saline-alkali land and agricultural security.
Patent Information
- Application Number
- CN202310426124.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-20
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2043-04-20
AI Technical Summary
Existing technologies make it difficult to effectively discover and utilize the salt-tolerant genes in cotton, resulting in slow progress in agricultural production on saline-alkali land and an inability to meet the demand for salt-tolerant crops in agricultural production.
The GhISR43 gene and its encoded protein were isolated and identified. Through gene editing and RNA interference technology, the salt stress tolerance of plants was regulated. Recombinant expression vectors were constructed and transformed into target plants to achieve overexpression or deletion of the GhISR43 gene, thereby improving or reducing the salt stress resistance of plants.
It improved the salt stress resistance of plants, promoted the agricultural development of saline-alkali land and the improvement of crop salt tolerance, solved the problem of effective utilization of saline-alkali land resources, and ensured the safety of agricultural production.
Smart Images

Figure CN116376931B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to genes isolated from cotton and their applications, particularly to the GhISR43 gene and its encoded protein isolated from upland cotton that regulates salt stress performance. This invention further relates to the application of the upland cotton GhISR43 gene and its encoded protein in regulating plant salt stress performance, and belongs to the field of genes regulating plant salt stress and their applications. Background Technology
[0002] Soil salinization is one of the global abiotic stresses limiting agricultural production, directly affecting normal crop growth, leading to reduced yields, and seriously threatening agricultural production. Statistics show that approximately 800 million hectares of land worldwide (equivalent to 6.5% of the world's total land area) are currently affected by high salt concentrations. Among them, the total area of saline soil in China reaches 99.13 × 10⁻⁶. 4 hm 2 Saline-alkali land accounts for approximately 10% of China's land area, mainly distributed in the Northwest, North China, Northeast, and coastal regions. The vast majority of China's saline-alkali land remains undeveloped, representing a huge reserve of land resources for agricultural production. However, effective development and utilization of saline-alkali land and progress in agricultural production have been slow.
[0003] Cotton (salt tolerance threshold 7.7 dS m) -1 It is an important economic crop and a "pioneer crop" for planting in saline-alkali land. Major food crops include corn (1.7dS m). -1 ), rice (3.0 dS m -1 ) and wheat (6.0 dS m -1 Cotton varieties exhibit higher salt tolerance. Discovering salt-tolerant genes and elucidating salt-tolerant mechanisms in cotton is of great significance for improving crop salt tolerance, developing agricultural production on saline-alkali land, and ensuring agricultural security. Cotton's salt tolerance varies significantly at different growth and development stages. Studies show that seed germination and seedling stages are the most sensitive periods for cotton to salt stress. Under salt stress, seedling cotton growth is inhibited, and the above-ground parts typically exhibit phenotypes such as thinning and softening of the stem and wrinkling of the leaves. Long-term, high-salt stress can also severely affect plant respiration and photosynthesis, hindering the absorption of nutrients and reducing nitrogen content in leaves. However, compared to salt-sensitive varieties, salt-tolerant varieties are less affected during the seedling stage. Therefore, discovering salt-tolerant genes in the seedling stage of salt-tolerant cotton varieties and elucidating their salt-tolerant functions has greater theoretical and applied value in improving crop salt tolerance. Furthermore, it is also of great significance for the efficient utilization of saline-alkali land for agricultural production, resolving the conflict between grain and cotton for land, and ensuring China's agricultural security.
[0004] Salt tolerance in crops is a highly complex trait. Conventional breeding methods, such as hybridization, have made slow progress in improving crop salt tolerance and cannot meet the urgent needs of production. However, using biotechnology to discover salt-tolerant genes in salt-tolerant cotton and to explore and analyze its salt tolerance mechanisms has extremely important theoretical value and application prospects for breeding new salt-tolerant crop varieties and scientifically utilizing saline-alkali land for agricultural production.
[0005] The GhISR43 gene (Gh_D11G0177) is a novel gene for which no function has been reported in the plant kingdom. It is 480 bp in length and encodes 159 amino acids. Currently, neither this gene nor its homologs have any functional descriptions in the plant kingdom, and no structural information, such as conserved domains, is available on NCBI (https: / / www.ncbi.nlm.nih.gov / ). Summary of the Invention
[0006] One objective of this invention is to provide the GhISR43 gene, isolated from cotton, that regulates plant salt stress tolerance.
[0007] A second objective of this invention is to provide an expression cassette or recombinant expression vector containing the GhISR43 gene that regulates salt stress tolerance in plants.
[0008] The third objective of this invention is to apply the GhISR43 gene, which regulates plant salt stress tolerance, to improve crop salt stress resistance or to cultivate salt-tolerant plant varieties.
[0009] The above-mentioned objective of the present invention is achieved through the following technical solution:
[0010] One aspect of the present invention provides a GhISR43 gene isolated from cotton that regulates plant salt stress, wherein the polynucleotide sequence of the GhISR43 gene is selected from any one of (a)-(e):
[0011] (a) The polynucleotide sequence shown in SEQ ID No. 1;
[0012] (b) A polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2;
[0013] (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and that polynucleotide sequence still has the function of regulating plant salt stress tolerance;
[0014] (d) A polynucleotide sequence having at least 80% or more similarity to any of the polynucleotide sequences shown in (a)-(c), wherein the polynucleotide sequence still has the function of regulating plant salt stress tolerance; preferably, a polynucleotide sequence having at least 85% or more similarity to any of the polynucleotide sequences shown in (a)-(c), wherein the polynucleotide sequence still has the function of plant salt stress tolerance; more preferably, a polynucleotide sequence having at least 90% or more similarity to any of the polynucleotide sequences shown in (a)-(c), wherein the polynucleotide sequence still has the function of plant salt stress tolerance; most preferably, a polynucleotide sequence having at least 95% or more similarity to any of the polynucleotide sequences shown in (a)-(c), wherein the polynucleotide sequence still has the function of plant salt stress tolerance;
[0015] (e) and any of the polynucleotide sequences described in (a)-(d) are complementary polynucleotide sequences.
[0016] The percentage of sequence similarity described in this application can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.
[0017] The present invention also provides the protein encoded by the GhISR43 gene that regulates the salt stress tolerance of plants, the amino acid sequence of which is shown in SEQ ID No. 2.
[0018] Another aspect of the present invention further provides an expression cassette, recombinant vector, or recombinant host cell containing the GhISR43 gene; preferably, the expression cassette, recombinant vector, or recombinant host cell is a recombinant eukaryotic expression cassette, recombinant eukaryotic expression vector, or recombinant plant cell; more preferably, the recombinant eukaryotic expression cassette or recombinant eukaryotic expression vector is a recombinant plant expression cassette or recombinant plant expression vector.
[0019] Another aspect of the present invention provides a method for improving the salt stress tolerance of cotton, comprising: causing a mutation in the GhISR43 gene in cotton to impair the normal function of the GhISR43 gene; or interfering with the normal expression or normal function of the GhISR43 gene.
[0020] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the nucleotide sequence of the GhISR43 gene or its promoter. Specifically, the mutations can be obtained through physical mutagenesis, chemical mutagenesis, or gene editing. Physical mutagenesis includes, but is not limited to, radiation mutagenesis and space breeding; chemical mutagenesis methods include mutagenesis induced by treatment with mutagens such as EMS; and gene editing methods include, but are not limited to, ZFN, TALEN, and / or CRISPR / Cas.
[0021] Those skilled in the art will understand that the main principle of the CRISPR / Cas gene editing system or method is to use a nucleic acid fragment called guide RNA (gRNA) to locate the site for gene editing in the host genome, i.e., the target DNA sequence, and then use Cas proteins to cut the DNA. In this application, the Cas proteins include, but are not limited to, Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13, and / or Cas14 proteins.
[0022] The interference with the normal expression or function of the GhISR43 gene or its promoter can be achieved using RNA interference (RNAi) technology. RNA interference is a conventional technique in this field. It involves the specific binding of 21-23 bp short double-stranded RNA (siRNA; small interfering RNA) or long double-stranded RNA (dsRNA; double-strand RNA) to the homologous region of the mRNA expressing the target gene, thereby degrading the mRNA and inhibiting gene expression.
[0023] This invention further provides a method for reducing salt stress tolerance in plants, comprising: overexpressing the GhISR43 gene in plants to obtain transgenic plants; the obtained transgenic plants exhibit reduced resistance to salt stress; for example: operably linking the GhISR43 gene to an expression regulatory element to obtain a recombinant plant expression vector expressing the coding gene in plants; the recombinant plant expression vector may consist of a 5′ untranslated region, the GhISR43 gene, and a 3′ untranslated region; wherein, the 5′ untranslated region may include a promoter sequence, an enhancer sequence, and / or a translational enhancement sequence; the promoter may be a constitutive promoter, an inducible promoter, or a tissue or organ-specific promoter; the 3′ untranslated region may include a terminator sequence, an mRNA cleavage sequence, etc. A suitable terminator sequence may be obtained from the Ti-plasmid of Agrobacterium tumefaciens, such as the terminator regions of octopine synthase and carmine synthase.
[0024] The recombinant plant expression vector was transformed into the target plant to overexpress the GhISR43 gene in the plant.
[0025] The target plants include, but are not limited to, monocotyledonous or dicotyledonous plants; more preferably, the target plants include crops, vegetables or ornamental plants, fruit trees, etc., such as cotton, Arabidopsis thaliana, corn, rice, sorghum, wheat, soybean, potato, barley, tomato, green bean, peanut or sugarcane, etc., with cotton or Arabidopsis thaliana being the most preferred.
[0026] The transformation protocol and the protocol for introducing the gene (or polynucleotide) into the plant can vary depending on the type of plant (monocot or dicot) or plant cell used for transformation. Suitable methods for introducing the gene (or polynucleotide) into plant cells include: using conventional biotechnological methods such as Ti plasmids, plant viral vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2). nd Edition).
[0027] The present invention also provides a plant cell, tissue, organ or product not used as propagation material, wherein the plant cell, tissue, organ or product contains the GhISR43 gene or its mutant sequence described in this application for regulating plant salt tolerance.
[0028] The GhISR43 gene or its mutants provided by this invention can regulate the salt stress tolerance of crops without adversely affecting other agronomic traits, and have application prospects in improving the salt stress tolerance of plants or breeding salt stress tolerant cotton varieties.
[0029] Definitions of terms involved in this invention
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0031] The terms "polynucleotide" or "nucleotide" refer to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers, either in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs (phosphate thioesters, phosphoramidites, etc.) used in antisense techniques. Unless otherwise specified, specific nucleic acid sequences implicitly encompass variants of their conserved modifications (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as explicitly specified sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue.
[0032] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. That is, the description of a polypeptide is equally applicable to the description of a peptide and the description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms cover amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.
[0033] The terms "recombinant host cell line" or "host cell" refer to a cell containing the polynucleotides of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotides may be maintained as, for example, a non-integrating vector of a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic or eukaryotic cell, and may also be a monocotyledonous or dicotyledonous plant cell.
[0034] The term "operable connection" refers to a functional connection between two or more elements, which can be adjacent or non-adjacent.
[0035] The term "recombinant plant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, an engineered selection marker for expression in plant cells, and the heterologous DNA sequence to be transcribed.
[0036] The term "transformation" refers to the method of introducing a heterologous DNA sequence into a host cell or organism. The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in plant cells. Attached Figure Description
[0037] Figure 1 Subcellular localization results for GhISR43; Note: Bars = 20 μm.
[0038] Figure 2 Results of obtaining and identifying the GhISR43 gene silencing recombinant plasmid; A: amplification of the target gene, where M: DL2000 DNA marker; lines 1-7: amplification of GhISR43 in Nongda Mian 13; B: PCR detection of GhISR43-pTRV2 recombinant plasmid in bacterial culture, where M: DL2000 DNA marker; lines 1-11: PCR of recombinant plasmid in bacterial culture.
[0039] Figure 3 The results show the silencing efficiency of the GhISR43 gene; A: Leaf whitening occurred after silencing the CLA1 gene; B: Real-time quantitative PCR detection of GhISR43 silencing efficiency.
[0040] Figure 4 The results of the verification of the salt tolerance function of the GhISR43 gene in cotton seedlings are as follows: A: Albino plants after silencing the CLA1 gene; B: Phenotype of VIGS after silencing the GhISR43 gene at 0 h of salt stress; C: Phenotype of VIGS after silencing the GhISR43 gene at 5 h of salt stress; Note: CK is the control group, and Gh_D11G0177(GhISR43) is the silenced group.
[0041] Figure 5 The results of identification of positive Arabidopsis seedlings transgenic with the GhISR43 gene;
[0042] A represents the screening results of positive Arabidopsis thaliana seedlings transgenic with GhISR43, where: M: DNA marker DL2000; lanes 1-6: screening of positive Arabidopsis thaliana seedlings transgenic with GhISR43; lane 7: positive control of 35s-pGreen-GhISR43-6HA plasmid.
[0043] B represents the results of real-time fluorescence quantitative analysis; * indicates that the difference is statistically significant at the P<0.05 level.
[0044] C represents the Western blot results of Arabidopsis thaliana transgenic with the GhISR43 gene, where: M: 180kD protein marker; lane 1: wild type; lanes 2-7: Western blot results of Arabidopsis thaliana transgenic with the GhISR43 gene.
[0045] Figure 6 The results show the salt tolerance of Arabidopsis thaliana seedlings transgenic with the GhISR43 gene; A: Growth of different lines after 7 days of non-salt stress; B: Salt tolerance of different lines after 7 days of 150mM NaCl stress; WT: Wild type; OX: Overexpression line; C: Germination rate statistics of different lines after 7 days of non-salt stress; D: Germination rate statistics of different lines after 7 days of 150mM NaCl stress. Detailed Implementation
[0046] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0047] Example 1: Discovery of the GhISR43 gene in upland cotton and its differential expression in different salt-tolerant cotton varieties.
[0048] Under 150 mM NaCl stress, iTRAQ technology was used to perform root tissue proteome sequencing on three-leaf stage seedlings of three salt-tolerant varieties (Nongda Mian 13, E Mian 9, and E Kang Mian 3, with relative survival rates of 56.7%, 73.3%, and 50.9%, respectively) and three salt-sensitive varieties (Jin Mian 12, Lu Mian 14, and Zhong 078, with relative survival rates of 34.04%, 32.95%, and 33.30%, respectively) after 0 h, 0.5 h, and 5 h of stress treatment. The results showed that Gh_D11G0177 (GhISR43) was differentially expressed after 0.5 h and 5 h of stress treatment (Table 1).
[0049] Table 1. Expression levels of GhISR43 in different salt-tolerant varieties under salt stress.
[0050]
[0051] Note: Salt-tolerant variety group: A: Nongda Cotton 13, B: E Cotton 9, C: Ekang Cotton 3; Salt-sensitive variety group: D: Jin Cotton 12, E: Lu Cotton 14, F: Zhong 078.
[0052] Example 2: Subcellular localization of GhISR43 in upland cotton
[0053] 1 Experimental Methods
[0054] 1.1 Sample Preparation
[0055] Cotton seedlings of Nongda Cotton No. 13 were cultured, and root tissue was collected when the seedlings reached the three-leaf stage. All root tissue was thoroughly ground into powder in a mortar with liquid nitrogen, then packaged and stored in an ultra-low temperature freezer at -80℃ for later use.
[0056] 1.2 RNA Extraction
[0057] Follow the instructions for the Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (catalog number DP441) from Tiangen Biotech (Beijing) Co., Ltd.
[0058] 1.3 cDNA Synthesis
[0059] The specific steps for reverse transcription of RNA into cDNA using a reverse transcription kit are as follows:
[0060] RNA 1μg
[0061] 4x gDNA wiper mix 4μL
[0062] RNase-free ddH2O to 16μL
[0063] After mixing, react at 42°C for 2 min; then add 4 μL of 5xHiScriptⅢqRT SuperMix to the above reaction tube, mix well, react at 37°C for 15 min, and react at 85°C for 5 s.
[0064] 1.4 Obtaining the full-length ORF of the GhISR43 gene
[0065] Primers for the full-length specific amplification of the GhISR43 gene were designed based on the GhISR43 gene sequence obtained from the upland cotton genome database, as shown in Table 2.
[0066] Table 2 Primers for GhISR43 gene cloning PCR
[0067]
[0068] The GhISR43 gene was amplified using cDNA obtained from reverse transcription of RNA from the root tissue of Cotton 13 from Nongda. The PCR amplification system (20 μL) consisted of: 1 μL cDNA, 1 μL GhISR43-F, and 1 μL GhISR43-R. Max DNA Polymerase 10 μL, sterile distilled water 7 μL. Amplification steps: pre-denaturation 95℃ 5 min; 95℃ 10 s, 58℃ 15 s, 72℃ 10 s, 34 cycles; extension 72℃ 7 min. Amplification results were detected by 1.2% agarose gel electrophoresis. The target fragment with the correct band size was recovered by agarose gel electrophoresis according to the instructions of the column DNA gel recovery kit (Shanghai Sangon Biotech Co., Ltd.). The recovered band was ligated to the pMD18-T vector, and the ligation product was then transformed into E. coli competent cells using a heat shock method.
[0069] Construction of the 1.5GhISR43-35s-pGreen-GFP recombinant vector
[0070] An overexpression vector, 35s-pGreen-GFP, containing a strong 35S promoter and a green fluorescent protein tag for the GhISR43 gene, was constructed and transformed into Agrobacterium. Subcellular localization was performed when tobacco plants had 4–5 true leaves. A 50 mL tobacco medium buffer was prepared including 0.097 g MES, 0.1016 g MgCl2·H2O, and 50 μL AS (100 μM), with the remainder made up with distilled water. The specific operating steps are as follows:
[0071] (1) Incubate Agrobacterium at 28℃ and 180 rpm until OD. 600 Remove at approximately 1.2 rpm and centrifuge at 5000 rpm for 10 minutes;
[0072] (2) Discard the supernatant and resuspend the bacterial precipitate in sterile distilled water 2-3 times;
[0073] (3) Resuspend the bacterial cells in buffer solution and adjust to OD. 600 ≈1.0, let stand at room temperature for 3 hours.
[0074] (4) Using a 1mL syringe, gently inject the liquid from (3) into the underside of the tobacco leaf until the liquid fills the underside of the leaf, and incubate in semi-darkness;
[0075] (5) After culturing for at least 48 hours, cut off the lower epidermis of the injected tobacco leaves, observe and photograph the results using a confocal fluorescence microscope (OLYMPUS, FV10i), and save the results. The excitation wavelength of green fluorescence is 489 nm and the emission wavelength is 510 nm.
[0076] 2. Experimental Results
[0077] Subcellular localization results showed that GhISR43 was localized in the cell membrane and cytoplasm. Figure 1 ).
[0078] Experiment Example 1: Silencing GhISR43 to improve the salt tolerance of cotton seedlings
[0079] 1 Experimental Methods
[0080] 1.1 Construction of VIGS vector and transformation with Agrobacterium
[0081] 1.1.1 Obtaining the full-length ORF of the GhISR43 gene
[0082] The amplification of the GhISR43 gene is the same as step 1.4 in Example 2.
[0083] 1.1.2 Construction of VIGS Carriers for Upland Cotton
[0084] Using the constructed GhISR43-pMD18-T vector as a template, the GhISR43 gene was amplified using GhISR43 gene-specific primers containing EcoRI and BamHI restriction sites (Table 3):
[0085] Table 3. VIGS primers for GhISR43 gene
[0086]
[0087] After agarose gel electrophoresis and gel recovery, the target fragment was obtained. After correct sequencing, the pTRV2 empty vector and GhISR43-pMD18-T vector were simultaneously double-digested with enzymes. The target gene was then ligated into the pTRV2 vector. The constructed recombinant vector was then transformed into Agrobacterium competent cells GV3101 using the freeze-thaw method.
[0088] 1.1.3 Cotton Seedling Cultivation
[0089] (1) Remove the fluff from the Nongda Cotton No. 13 seeds with concentrated sulfuric acid, rinse them with clean water and dry them. Place them evenly in a germination box containing 800g of dry quartz sand, cover the seed surface with 250g of dry quartz sand, and then pour in 250ml of distilled water evenly. Cover and keep moist, and place them in a constant temperature and humidity culture room at 28℃ with 12h light / 12h darkness. Do not treat them again during this period.
[0090] (2) After sand culture for 6-7 days, select seedlings with cotton bolls fallen off, cotyledons flat and spread out and with the same growth, and use 1 / 2 Hoagland nutrient solution for water culture. Place them in a constant temperature and humidity culture room with 28℃, 12h light and 12h darkness.
[0091] (3) After hydroponics for 1-2 days, when the two cotyledons of the cotton seedlings have fully unfolded but the first true leaf has not yet grown, start injecting Agrobacterium tumefaciens solution.
[0092] 1.1.4 VIGS bacterial suspension injection
[0093] VIGS bacterial culture method and cotton seedling injection method: Agrobacterium tumefaciens bacterial cultures containing GhISR43-pTRV2, pTRV192, pTRV2, and CLA1-pTRV2 plasmids were activated, respectively. Then, 5 ml of the bacterial culture was added to 100 ml of LB liquid medium containing Kan (100 mg / L), Rif (50 mg / L), and 2-morpholinoethanesulfonic acid (2-4-Morpholinoethanesulfonic acid). Incubate overnight at 28°C with 10 mmol / L of MgCl2 (MES), 20 μmol / L of acetosyringone (AS), and shake at 180 rpm. When the OD600 value reaches 0.8-1.2, centrifuge at 5000 rpm for 10 min, discard the supernatant, and wash twice with sterile distilled water. Centrifuge again at 5000 rpm for 10 min, discard the supernatant, and resuspend the cells in buffer (MgCl2, 10 mmol / L; MEs, 10 mmol / L; AS, 200 μmol / L) to achieve an OD600 value between 1.2 and 1.5. Incubate at room temperature for 3 h. Mix GhISR43-pTRV2, pTRV2 empty vector, and CLA1-pTRV2 buffer with pTRV192 at a 1:1 volume ratio and inject into cotton seedlings.
[0094] When the cotton seedlings reached the three-leaf stage (about 16 days), they were subjected to salt stress treatment with a 150 mmol / L NaCl solution. Samples of cotton roots, stems and leaves were taken at three time points: 0 h, 0.5 h and 5 h after stress. The samples were frozen in liquid nitrogen and then stored at -80℃.
[0095] 1.1.5 RNA extraction from test samples
[0096] RNA extraction is performed in step 1.2 of Example 2.
[0097] 1.1.6 cDNA Synthesis
[0098] cDNA was synthesized using the PrimeScript™ 1st strand cDNA Synthesis Kit (6110A) DNA reverse transcription kit from Dalian Bao Biotechnology Co., Ltd.
[0099] 1.1.7 Quantitative Real-Time PCR
[0100] Primers were designed for real-time quantitative PCR of the differentially expressed GhISR43 gene, with the GhHis3 gene used as an internal control (Table 4). Quantitative PCR was performed using a Roche LightCycler 96 real-time fluorescence quantitative PCR instrument. The reaction mixture consisted of 1 μL cDNA template, 0.6 μL each of forward and reverse primers (10 μmol / L), 10 μL 2×SYBR mix, and 7.8 μL sterile distilled water. The reaction program was 95℃ for 30 s; 95℃ for 5 s, 56℃ for 20 s, 72℃ for 30 s, for 40 cycles; and 95℃ for 5 s, 60℃ for 60 s, 95℃ for 1 s, 37℃ for 30 s. Five biological assays were performed to replicate the silencing efficiency.
[0101] Table 4 Primers for Real-Time Quantitative PCR
[0102]
[0103] 2 Experimental Results
[0104] 2.1 Construction of VIGS Recombinant Vector
[0105] After 5 hours of salt stress, GhISR43 with EcoRI and BamHI restriction sites was amplified in the cDNA of Nongda Cotton 13. Figure 2 A). The amplified target fragment was sequenced and compared with the target gene CDS library. The gene sequence was consistent with the target sequence and was used for the construction of the VIGS vector. The target gene GhISR43 and the VIGS vector pTRV2 were simultaneously digested and ligated with EcoRI and BamHI enzymes to obtain the recombinant vector GhISR43-pTRV2. After the recombinant plasmid was transformed into E. coli, it was identified by bacterial PCR. Figure 2 B) The size of the VIGS recombinant plasmid was consistent with the expected gene fragment size, confirming the successful construction of the plasmid. Further transformation of Agrobacterium competent cells GV3101 was performed to conduct a cotton VIGS gene silencing experiment.
[0106] 2.2 Detection of GhISR43 gene silencing efficiency
[0107] One week after the bacterial injection, the true leaves of the CLAI control plants showed leukoplakia. Figure 3 A) Five silenced and five control plants were selected, and RNA was extracted from their leaves for Real-time quantitative PCR to detect the silencing efficiency of the GhISR43 gene. Figure 3 B) The results showed that the GhISR43 gene was silenced with an efficiency of 82.208%, which allows for the study of the salt tolerance function of the GhISR43 gene in seedlings.
[0108] 2.3 Silencing GhISR43 improves the salt tolerance of cotton seedlings.
[0109] When the third true leaf of the cotton seedlings injected with VIGS bacterial solution had fully expanded, both GhISR43-VIGS and control cotton seedlings were simultaneously subjected to 150 mmol / L NaCl stress treatment. Phenotypic changes in the silent group and the control group were recorded at 0 h of stress. Figure 4 B). At 5 hours of salt stress, cotton seedlings in the control group showed significantly greater lodging than those with the silenced GhISR43 gene. Figure 4 C) Obvious symptoms of salt stress response in cotton seedlings were observed. This indicates that GhISR43 plays a role in the salt stress response of cotton seedlings, and silencing the GhISR43 gene improves the tolerance of cotton seedlings to salt stress.
[0110] Experiment Example 2: Overexpression of GhISR43 reduces salt tolerance in Arabidopsis seedlings
[0111] 1 Experimental Methods
[0112] 1.1 Genetic transformation of Arabidopsis thaliana using the 35S-pGreen-6HA-GhISR43 recombinant vector
[0113] 1.1.1 Experimental Materials and Culture
[0114] Plant material: Wild-type Arabidopsis thaliana was sown in 32-cell seedling trays and grown at 23°C (16 hours of light, 8 hours of darkness).
[0115] 1.1.2 Arabidopsis genetic transformation
[0116] The expression vector 35S-pGreen-6HA-GhISR43 was constructed, and Arabidopsis thaliana genetic transformation was performed after the Arabidopsis thaliana bolted and flowered. The transformation of Arabidopsis thaliana was carried out using the flower-drop method.
[0117] (1) Resuscitation of Agrobacterium tumefaciens
[0118] Take the Agrobacterium tumefaciens culture stored at -80℃ into a 50ml centrifuge tube, add 10ml LB medium + 10μL kanamycin + 5μL rifampin, and incubate overnight at 28℃ and 180rpm.
[0119] (2) Expand cultivation
[0120] Add 50 ml of LB containing antibiotics to a 150 ml Erlenmeyer flask, add 500 μL of activated bacterial culture, and incubate in a shaker at 28 °C and 180 rpm.
[0121] (3) Determination of bacterial concentration
[0122] Shake Agrobacterium to OD 600 Centrifuge at approximately 1.2 μL and wash twice with sterile water. Add 50 ml of sucrose buffer and 7 μL of surfactant.
[0123] (4) Sticky flowers
[0124] The infection time is 30 seconds, followed by 24 hours of dark incubation. A second infection is performed one week later. Nutrient solution is applied regularly, and mature pods are harvested in multiple batches; these are the T0 generation seeds.
[0125] 1.1.3 Screening of positive Arabidopsis plants
[0126] T0 generation transgenic Arabidopsis seeds were harvested and sown. After approximately one week, the seeds were sprayed with the herbicide Basta (0.15% concentration). After culturing for 3 days, normally growing plants were identified as positive plants. A thumb-sized leaf sample was taken from each positive seedling for DNA extraction, and PCR was used for further identification of the positive seedlings. Figure 5 A) The sequencing results are correct. Positive plants were harvested individually (T1 generation). Seeds of the positive line progeny were sown in 32-well seedling trays. After about one week of cultivation, herbicides were sprayed, and T2 generation seeds were harvested individually. Eight individual plants from each line (OX) were selected for sowing, with 16 seeds sown in each well of a seedling tray (4 wells). After about one week of cultivation, herbicides were sprayed, and the survival rate of Arabidopsis thaliana after herbicide spraying was observed. Individual plants that did not die (without isolating a) were sampled, RNA was extracted, and gene expression levels were detected. Seeds from T3 generation pure lines were harvested.
[0127] 1.1.4 Identification of Arabidopsis thaliana with 35S-pGreen-6HA-GhISR43
[0128] (1) DNA extraction using the CTAB method.
[0129] (2) Detection primers:
[0130] Primer sequence
[0131] GhISR43-F:GAATTCATGGCTACCCACAATAACAACA
[0132] GhISR43-R:GGATCCTCAATCATCACTTTTTTTGTCC
[0133] Mix: 2xEs Taq MasterMix (Dye)
[0134] Marker: DL2000 DNA Marker
[0135] (3) PCR amplification system:
[0136]
[0137] PCR program
[0138]
[0139] Electrophoretic detection
[0140] Gel preparation:
[0141] 0.48g agarose
[0142] 1xTAE 40ml
[0143] Electrophoresis for 15 minutes.
[0144] 1.1.5 RT-PCR and Western blot detection of Arabidopsis thaliana transformed with 35S-pGreen-6HA-GhISR43
[0145] (1) RNA extraction was performed as in step 1.2 of Example 2, and RT-PCR detection was performed as in step 1.1.7 of Experiment 1. Primer sequences are shown in Table 5:
[0146] Table 5. Primers for real-time quantitative conversion of Arabidopsis thaliana using 35S-pGreen-6HA-GhISR43.
[0147]
[0148] (2) Western blot detection method:
[0149] 1) Preparation of 12% separating gel
[0150] Set up the gel plate (using a 1mm glass plate) and prepare 12% separating gel (Table 6): use 4mL to prepare 6mL of gel.
[0151] Table 6 Separating Gel Preparation
[0152]
[0153] Use a pipette to inject the prepared separating gel into the gaps in the glass plate, and finally seal the top layer with ddH2O to allow the separating gel to dry.
[0154] 2) Preparation of 5% stacked gel
[0155] After waiting 40 minutes until the separating gel and water show obvious separation, pour the water out of the gaps and use absorbent paper to dry the moisture in the gaps to prepare a 5% stacking gel. Use 2 mL to prepare 3 mL of the gel.
[0156] Table 7. Preparation of Concentrated Gel
[0157]
[0158] Slowly add the stacking gel into the gaps of the glass plate using a pipette, being careful not to create air bubbles. After adding the separating gel, immediately insert a comb and wait 40 minutes for the separating gel to solidify.
[0159] 3) Sample preparation and electrophoresis
[0160] Samples of Arabidopsis thaliana transgenic 43 and wild-type Arabidopsis thaliana were ground into powder using liquid nitrogen. An appropriate amount of plant protein extract (Kangwei Century Biotechnology Co., Ltd.; catalog number: CW0885) was added, and the mixture was vortexed and placed on ice for 30 min. After the vortexing, the mixture was centrifuged at 12,000 rpm and 4°C for 10 min. A suitable amount of the supernatant was added to SDS-PAGE loading buffer (Kangwei Century Biotechnology Co., Ltd.; catalog number: CW0027) and incubated in boiling water at 100°C for 20 min to denature the proteins. After the gel solidified, samples were loaded. Electrophoresis was performed at 80V until the bromophenol blue strip was passed through the stacking gel. Electrophoresis was then performed at 120V until the gel was completely cleared (the bromophenol blue indicator band reached the bottom of the gel or just emerged from the gel).
[0161] 4) Western blot
[0162] (a) Place the gel after electrophoresis on a nitrocellulose membrane of the same size and fix it in the electrophoresis tank with a transfer clamp. Electrophore at a constant voltage of 30V for 2 hours.
[0163] (b) Place the nitrocellulose membrane after the transfer in 5% milk (2.5g skim milk powder + 50ml water; product number: LP0031B) and seal it at 37°C and 50rpm for 1 hour.
[0164] (c) Place the sealed nitrocellulose membrane in a primary antibody solution (10 ml skim milk powder + 5 μl primary antibody (Boaolong; item number B1023) at 37°C and shake at 50 rpm for 2 h to bind.
[0165] (d) Place the bound nitrocellulose membrane in washing buffer (100 ml PBS (Solepro; catalog number: P1020) + 500 μl Tween-20 (Solepro; catalog number: T8220) and wash 3 times at room temperature for 15 min each time.
[0166] (e) Place the washed nitrocellulose membrane in a secondary antibody solution (10 ml PBS + 2 μl secondary antibody (Boaolong; catalog number: BF03001x) at 37°C and shake at 50 rpm for 2 h to bind.
[0167] (f) Wash the membrane as in step (4).
[0168] (g) Irradiation
[0169] The luminescence detection was performed and photographed using the Omni-ECL™ Basic Chemiluminescence Detection Kit (product number: SQ202) from Shanghai Yamei Biomedical Technology Co., Ltd.
[0170] (3) Detection results of GhISR43 gene expression products
[0171] RNA and protein were further extracted from the T3 generation Arabidopsis thaliana line transgenic with the GhISR43 gene, and qRT-PCR was performed. Figure 5 B) and Western blot ( Figure 5 C) The results showed that the GhISR43 gene had been successfully transferred into Arabidopsis thaliana and was stably expressed. Based on the results of qRT-PCR and Western blot, three positive Arabidopsis thaliana lines with the GhISR43 gene were further screened for subsequent salt stress experiments: OX1, OX2 and OX4.
[0172] 1.2 Planting of transgenic Arabidopsis seeds and determination of seedling survival rate
[0173] 1.2.1 Materials
[0174] Transgenic Arabidopsis thaliana T3 seeds, wild-type Arabidopsis thaliana seeds, MS medium powder, agar powder, sodium chloride, disposable petri dishes, 70% alcohol, 30% sodium hypochlorite, 2.0ml centrifuge tubes, centrifuge, and clean bench.
[0175] 1.2.2 Planting Methods
[0176] Three transgenic Arabidopsis thaliana T3 lines (OX1, OX2, and OX4) overexpressing the GhISR43 gene were randomly selected. Seeds from the positive lines and wild-type Arabidopsis thaliana were surface-sterilized (70% ethanol, 30 seconds; rinsed 4 times with sterile water) and submerged (30% sodium hypochlorite, 10 minutes; rinsed 3 times with sterile water). The seeds were then sown on 1 / 2 MS solid medium containing 150 mM NaCl and NaCl-free medium, with 37 seeds per region. After sowing, the seeds were placed at 4°C for 72 hours and then transferred to 22°C for further culture. Seed germination and seedling emergence rates of different lines were recorded, and data were analyzed one week later, with 5 replicates.
[0177] 1.2.3 Analysis and Graphing Methods
[0178] Origin 2021 software was used for data analysis and graphing, and one-way ANOVA was used for significance analysis.
[0179] 2 Experimental Results
[0180] Experimental results showed that there was no significant difference in germination and seedling rate between transgenic Arabidopsis lines and wild-type Arabidopsis lines on culture media without sodium chloride, Pr(>F) = 0.55 ( Figure 6 A, Figure 6 C). However, in a culture medium containing 150 mM NaCl, the germination rate of transgenic Arabidopsis lines was significantly lower than that of wild-type Arabidopsis lines. Figure 6 B, Figure 6D), the significance analysis of the differences between groups yielded Pr(>F) = 7.06 * 10^- ... -8 This indicates that overexpression of the GhISR43 gene under salt stress can reduce the salt tolerance of Arabidopsis thaliana.
Claims
1. GhISR43 The application of genes in regulating the salt stress tolerance performance of cotton, characterized in that, The aforementioned GhISR43 The polynucleotide sequence of the gene is shown in SEQ ID No.
1. The regulation of cotton salt stress tolerance involves improving cotton's resistance to salt stress, including: RNA interference in cotton... GhISR43 Normal expression or normal function of genes.
Citation Information
Patent Citations
Cotton stress response associated protein GhGeBP and coding gene and application thereof
CN104610438A