A detection reagent, kit and method for Vibrio cholerae O139 biotype double virulence gene by loop-mediated isothermal amplification

By designing a dual-virulence gene loop-mediated isothermal amplification detection reagent targeting Vibrio cholerae group O139, and using tcpA and hlyA genes as detection targets, the problem of long detection time, expensive equipment, and low sensitivity in existing technologies has been solved, achieving rapid and accurate detection of Vibrio cholerae.

CN116397036BActive Publication Date: 2026-05-01ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211085596.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-06
Publication Date
2026-05-01
Estimated Expiration
2042-09-06

AI Technical Summary

Technical Problem

Existing technologies for detecting Vibrio cholerae O139 have problems such as long detection time, complex operation, expensive equipment, low sensitivity, and difficulty in distinguishing Vibrio cholerae groups, especially the lack of targeted detection of O1 and O139 groups.

Method used

A dual-virulence gene loop-mediated isothermal amplification (LAMP) detection reagent for Vibrio cholerae group O139 was designed. The reagent uses the tcpA and hlyA genes as detection targets and employs eight amplification primers for LAMP detection. The kit and detection method are provided in conjunction with specific amplification reaction temperatures and times.

Benefits of technology

It achieves rapid, accurate, and highly specific detection of Vibrio cholerae group O139, which can be completed within 30 minutes. It has high sensitivity and broad application prospects, avoiding false negatives and missed detections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116397036B_ABST
    Figure CN116397036B_ABST
Patent Text Reader

Abstract

This invention relates to the field of biomedical detection technology, providing a reagent, kit, and detection method for detecting *Vibrio cholerae* serogroup O139 using loop-mediated isothermal amplification (LAMP). This invention targets the synergistic regulation of the tcpA and hlyA genes in *Vibrio cholerae* serogroup O139, designing LAMP detection primers and establishing a LAMP detection method based on isothermal amplification. These LAMP detection primers or loop primers show promising applications not only against *Vibrio cholerae* serogroup O139 but also against other nosocomial infection bacteria. The LAMP primers for detecting *Vibrio cholerae* serogroup O139 can be used to detect *Vibrio cholerae* serogroup O139 in clinical patients or for outpatient screening. The kit of this invention can effectively and specifically detect single-reaction, single-copy, or higher copies of *Vibrio cholerae* serogroup O139. Compared to the "gold standard" real-time quantitative PCR, the kit of this invention offers higher accuracy and sensitivity, completing the detection within 30 minutes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a detection reagent and technology for loop-mediated isothermal amplification of the O139 group Vibrio cholerae dual virulence gene. Background Technology

[0002] Vibrio cholerae (group O139) is an intestinal infectious disease pathogen that can cause cholera in humans. O139 cholera produces the same toxin as group O1 Vibrio cholerae, has the potential to cause epidemics, and can spread rapidly with a high mortality rate. Due to antigenic variation, the population lacks immunity to this bacterium. Cholera is classified as a Class A infectious disease under prevention and control management. It has a rapid onset, is highly contagious, and without timely treatment, can lead to electrolyte imbalances and hypokalemia.

[0003] Currently, there are various methods for detecting Vibrio cholerae group O139. The traditional method for identifying Vibrio cholerae group O139, based on the "National Clinical Laboratory Operation Procedures," involves routine bacterial isolation and culture, microscopic observation, and biochemical indicator identification. This is considered the "gold standard" for detecting Vibrio cholerae group O139. However, these methods require specialized technicians and complex equipment, and the identification process is time-consuming (48 hours), complex, and has low sensitivity. Clinically, there is an urgent need to develop a rapid and effective method for detecting Vibrio cholerae group O139.

[0004] Enzyme-linked immunosorbent assay (ELISA) and electrochemical techniques are also used for the rapid detection of Vibrio cholerae serogroup O139. However, these methods are relatively complex, time-consuming, and have poor accuracy. Currently, polymerase chain reaction (PCR) is also used for the rapid detection of Vibrio cholerae serogroup O139. However, PCR technology requires expensive PCR instruments, complete laboratory facilities, and professional operators, thus limiting its application in grassroots laboratories and field settings. As an isothermal nucleic acid amplification technique, the LAMP method has significant advantages in terms of ease of operation and equipment requirements; however, existing detection sensitivity is not high, and most LAMP detection techniques cannot effectively distinguish between different Vibrio cholerae groups, especially for the targeted detection of O1 and O139 groups. Furthermore, existing LAMP amplification detection of Vibrio cholerae only targets single genes, which significantly affects the positive detection rate for Vibrio cholerae with partial gene deletions or mutations. Summary of the Invention

[0005] The technical problem to be solved by this invention is to address the problems existing in the background art by proposing a detection reagent, kit and detection method for O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification. Eight amplification primers are designed based on the characteristics of synergistic regulation of virulence production in the O139 group. This method has high accuracy, fast detection speed and can specifically detect O139 group Vibrio cholerae.

[0006] To achieve the above-mentioned objectives of the present invention, the present invention employs the following technical solutions or combinations:

[0007] First, the present invention provides a detection reagent for loop-mediated isothermal amplification of dual virulence genes of Vibrio cholerae serogroup O139. The reagent includes a primer set for detecting Vibrio cholerae serogroup O139. The primer set includes dual virulence gene amplification primers. The dual virulence genes include virulence gene tcpA and virulence gene hlyA. Each virulence gene includes amplification primers for multiple sites.

[0008] The primers used to amplify the virulence gene tcpA include four primers: HL-TcpA-F3, HL-TcpA-B3, HL-TcpA-FIP, and HL-TcpA-BIP; their nucleotide sequences are shown in SEQ ID Nos. 1-4 of the sequence listing, respectively.

[0009] SEQ ID No.1:ATGGTTTGGTCAGCCTTG,

[0010] SEQ ID No.2: GATAAATGGAAACATATCCCCT,

[0011] SEQ ID No.3: GTGGAAATGAGAAAATCCCCATAGC GTAAGGTTTCAG CTGATGAG,

[0012] SEQ ID No. 4: GAAACTCTGCAGCGAATAAAGCA ACGCTTGTAACCAA AGTCT.

[0013] The primers used to amplify the virulence gene hlyA include four primers: HL-hlyA-F3, HL-hlyA-B3, HL-hlyA-FIP, and HL-hlyA-BIP; their nucleotide sequences are shown in SEQ ID Nos. 5-8 of the sequence listing, respectively.

[0014] SEQ ID No.5:TCGATTGGGATCACCCTGTA,

[0015] SEQ ID No.6:GCACCATCAAGACAGAGCT,

[0016] SEQ ID No.7: GCGACCTTGAGCATCGACTTGA GCCCGGTCAATCTAC AACTT,

[0017] SEQ ID No. 8: GGCCAATACGTGCGATAGCCA ACTCGCACTCACATAAC GAC.

[0018] In this invention, the use of the above-described reagents in the detection of Vibrio cholerae group O139 is provided.

[0019] Based on this, the present invention provides a detection kit for the O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification, the kit comprising a turbidimetric reagent, a DNA extraction kit, and a LAMP amplification reaction system.

[0020] The LAMP amplification system, in 50 μL increments, includes:

[0021] Template DNA 1.0–10 μL;

[0022] 1.0–5.0 μL of each amplification primer;

[0023] 20 μL of a mixture of betaine, large fragment polymerase buffer, and other buffers;

[0024] Add RNase-free sterilized deionized water to a final volume of 50 μL;

[0025] The amplification primers are those described in any one of claims 1-3, and the initial concentration of each amplification primer is 1-10 mmol / L.

[0026] The kit of this invention can specifically detect Vibrio cholerae group O139, offering advantages in accuracy and speed compared to existing quantitative real-time PCR methods. Furthermore, the kit provided by this invention can be widely used in clinical detection of Vibrio cholerae group O139.

[0027] Furthermore, the LAMP amplification reaction is carried out at a temperature of 58-65°C and for a duration of 1-60 min. Preferably, the amplification temperature is 63°C and the amplification time is 30-40 min.

[0028] This invention also provides a method for detecting the O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification, wherein the detection method uses the above-mentioned kit and includes the following steps:

[0029] (1) DNA template extraction: DNA was extracted from the sample to be tested, with RNase-free deionized water as a negative control.

[0030] (2) LAMP amplification reaction: Using the DNA extracted in step (1) as a template, and using the LAMP primers in the kit, LAMP amplification reaction was carried out in the LAMP reaction tube.

[0031] (3) Fluorescence analysis of LAMP amplification products.

[0032] Furthermore, the sample to be tested includes at least one of the following: bacterial nucleic acid template, bacterial monoclonal culture colony, bacterial culture medium, water source containing Vibrio cholerae O139, and intestinal secretions.

[0033] Furthermore, in the loop-mediated isothermal amplification reaction system, the amplification system is 10-100 μL, the amplification temperature is 58-65℃, and the reaction time is 15-45 minutes.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] (1) This invention uses the synergistic regulation of the tcpA and hlyA genes of Vibrio cholerae serogroup O139 as detection targets, designs LAMP detection primers, and establishes a LAMP detection method based on isothermal amplification. These LAMP detection primers or loop primers show promising application prospects not only for Vibrio cholerae serogroup O139 but also for other nosocomial infection bacteria.

[0036] (2) The LAMP primers for detecting Vibrio cholerae O139 of the present invention can be used to detect Vibrio cholerae O139 in clinical patients or outpatient screening. The kit of the present invention is characterized by specificity, low cost, sensitivity, and portability. The kit of the present invention can effectively and specifically detect single-reaction single-copy or higher copies of Vibrio cholerae O139.

[0037] (3) Using the LAMP primers of the present invention for detection, one or more different fluorescence signals can be detected in one reaction, and multiple samples can be detected simultaneously, which effectively simplifies the system design and avoids inaccuracies caused by different optical inspection times of samples.

[0038] (4) Compared with the "gold standard" real-time fluorescence quantitative PCR, the kit of the present invention has higher accuracy and sensitivity, and the detection can be completed within 30 minutes.

[0039] (5) The present invention uses LAMP detection primers for the TcpA and hlyA genes of Vibrio cholerae group O139 for detection, which has high accuracy and can avoid false negatives and missed detections caused by single gene detection.

[0040] (6) The LAMP primers of this invention have been verified by multiple O139 group Vibrio cholerae nucleic acid samples, with a positive concordance rate of 100%, and have very high accuracy and specificity, which is more convincing for clinical application trial results. Attached Figure Description

[0041] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0042] Figure 1 This is a fluorescence signal diagram for sensitivity detection provided in Embodiment 3 of the present invention.

[0043] Figure 2 This is a visual turbidity diagram provided in Embodiment 3 of the present invention. Specific implementation methods

[0044] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0045] The technical solution of the present invention will be further described below with reference to the embodiments.

[0046] Note: In this invention, unless otherwise specified, the terms "TcpA gene" and "hlyA" of Vibrio cholerae serogroup O139 should be understood as whole-genome fragments. The TcpA gene and hlyA gene of Vibrio cholerae serogroup O139 are not limited to the fragments involved in the disclosed primers, but can also be other regions of the gene that can be designed with primers.

[0047] In this invention, the colorimetric fluorescence is not limited to FAM, but can also be other fluorescent excitation groups such as GFP, Texas Red, DAPI, Alexa Fluor@488, FITC, Cy3, Cy5, Cy7, ROX, JOE and Alexa Fluor@750;

[0048] In this invention, the test sample may be at least one of the following: bacterial nucleic acid template, bacterial monoclonal culture colony, bacterial culture medium, water source containing Vibrio cholerae group O139, and intestinal secretions. Those skilled in the art or relevant testing personnel can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0049] In this invention, the Bst DNA polymerase, etc., are commercially available finished products, and the reagents and instruments used can all be purchased through commercial channels.

[0050] Example 1 Primer Design

[0051] Based on the genome base sequence of Vibrio cholerae O139 published by NCBI, the TcpA gene base sequence of Vibrio cholerae O139 was searched and compared. Primers were artificially and creatively designed according to primer design principles, and the parameters such as GC content of the designed primers were verified to ensure that they reached the optimal range.

[0052] Meanwhile, corresponding primers were designed according to the design principles of LAMP primers (including but not limited to GC content analysis, hairpin structure exclusion, etc.). The designed primer sets were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. After obtaining the primers, they were diluted with RNase-free water to 10 mmol / μL for later use.

[0053] Specifically, the primers for the TcpA gene of Vibrio cholerae group O139 are as follows:

[0054]

[0055]

[0056] The primers described above can be used to detect the TcpA and hlyA genes of Vibrio cholerae group O139.

[0057] Example 2 LAMP amplification system

[0058] A kit for detecting the O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification, the kit comprising the primers of Example 1;

[0059] The kit also includes strand displacement large fragment BST polymerase, betaine and amplification buffer containing dNTPs and magnesium sulfate, RNase-free water, sterile deionized water, turbidimetric reagent, and DNA extraction kit (QIAGEN's QIAamp DNA Mini Kit Qiagen).

[0060] It should be noted that the DNA extraction kit is used to extract DNA from the sample to be tested as a template; the DNA extraction kit can be a conventional commercially available DNA extraction kit. In this embodiment, the DNA extraction kit used is the QIAGEN QIAamp Viral DNA mini KIT.

[0061] The kit in this embodiment includes the following LAMP amplification reaction system:

[0062] The LAMP amplification reaction system for detecting Vibrio cholerae group O139 contains the tcpA primer set for detecting Vibrio cholerae group O139 in Example 1.

[0063] The LAMP amplification system for detecting Vibrio cholerae group O139 comprises, in 50 μL increments:

[0064] Template DNA 1.0–10 μL;

[0065] 1.0–5.0 μL of each amplification primer;

[0066] 20 μL of a mixture of betaine, large fragment polymerase buffer, and other buffers;

[0067] Add RNase-free sterilized deionized water to a final volume of 50 μL;

[0068] The initial concentrations of the amplification primers were all 1–10 mmol / L.

[0069] Furthermore, the LAMP amplification reaction is carried out at a temperature of 58-65℃ for 1-60 min, preferably at 63℃ for 30-40 min.

[0070] The method of using the reagent kit includes the following steps:

[0071] (1) DNA template extraction: DNA was extracted from the sample to be tested, with RNase-free deionized water as a negative control.

[0072] (2) LAMP amplification reaction: Using the DNA extracted in step (1) as a template, and using the LAMP primers in the kit, LAMP amplification reaction was carried out in the LAMP reaction tube.

[0073] Example 3: Sensitivity detection of LAMP primers

[0074] (1) The kit of Example 2 is provided, and the reagents are added according to the following reaction system, specifically including:

[0075] Add amplification primers, amplification buffer, and turbidimetric reagent (μL), RNase-free sterile deionized water, and BST enzyme to the LAMP amplification tube, respectively.

[0076] (2) Immediately place the reaction tube into the instrument that is set up in advance to collect fluorescence signals. The LAMP reaction conditions are 63°C, reaction time is 40 minutes, and fluorescence signals are collected every 30 seconds.

[0077] Sensitivity detection fluorescence signal graph as shown Figure 1 As shown, the detection sensitivity for Vibrio cholerae group O139 is 1 copy / μL.

[0078] Eye color, for example Figure 2 As shown in the figure, from left to right, the numbers are 10. 4 copies / μL(-4), 10 3 copies / μL(-5), 10 2 copies / μL(-6), 10 1 copies / μL (-7), 1 copy / μL (-8), and negative control (-9). As can be seen from the figure, only the negative control is light orange (negative), while the rest are light green (positive).

[0079] Example 4 Specific detection of LAMP primers

[0080] LAMP primer specificity was validated using *Vibrio cholerae* serogroup O139 and PBS buffer as templates. DNA template from *Vibrio cholerae* serogroup O139 was extracted directly using a purchased kit, its concentration was measured and converted to copy number, and then serially diluted 10-fold to create a concentration gradient, including 10-10... 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 1 copy / μL.

[0081] The kit of Example 2 is provided. The reagents for the sample are added according to the following reaction system, wherein the gene detection primers and loop primers are not added together and are amplified separately. Specifically, the amount of each component added is the same as in Example 2.

[0082] The reaction tube was placed in a pre-set instrument for collecting fluorescence signals. The LAMP reaction conditions were 63°C for 10 minutes, and the fluorescence signal was collected every 30 seconds.

[0083] The specific results of the tests are shown in Table 1. Common bacteria isolated from oral sputum and the respiratory tract that have already been identified, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus (see Appendix Table 1 for details), were selected for routine bacterial culture. Finally, the bacterial concentration was determined using a bacterial turbidimeter, and the nucleic acid DNA was extracted and converted into copy number to achieve a concentration of 10. 6The bacterial nucleic acid template was extracted using a Qiagen bacterial genome extraction kit at a concentration of copies / μL. After extraction, the concentration was measured using Nanodrop and adjusted to a uniform concentration of 10. 6 Copies / μL were used for non-specific amplification detection using the kit and LAMP amplification method described in Example 2. As shown in Table 1, the primer amplification detection of Vibrio cholerae group O139 only detected Vibrio cholerae group O139; all others were negative, and no non-specific amplification occurred.

[0084] Table 1:

[0085]

[0086] In the table above, "+" indicates amplification, and "-" indicates no amplification.

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A reagent for detecting the double virulence gene loop-mediated isothermal amplification of Vibrio cholerae group O139, characterized in that, The reagent includes a primer set for detecting Vibrio cholerae group O139, the primer set including primers for amplifying dual virulence genes, the dual virulence genes being virulence gene tcpA and virulence gene hlyA; The primers used to amplify the virulence gene tcpA are primers HL-TcpA-F3, HL-TcpA-B3, HL-TcpA-FIP, and HL-TcpA-BIP; their nucleotide sequences are shown in SEQ ID Nos. 1-4 of the sequence listing, respectively. SEQ ID No.1:ATGGTTTGGTCAGCCTTG, SEQ ID No.2: GATAAATGGAAACATATCCCCT, SEQ ID No.3: GTGGAAATGAGAAAATCCCCATAGCGTAAGGTTTCAGCTGATGAG, SEQ ID No.4: GAAACTCTGCAGCGAATAAAGCAACGCTTGTAACCAAAGTCT; The primers used to amplify the virulence gene hlyA are primers HL-hlyA-F3, HL-hlyA-B3, HL-hlyA-FIP, and HL-hlyA-BIP; their nucleotide sequences are shown in SEQ ID No. 5-8 of the sequence listing, respectively. SEQ ID No.5:TCGATTGGGATCACCCTGTA, SEQ ID No.6:GCACCATCAAGACAGAGCT, SEQ ID No.7: GCGACCTTGAGCATCGACTTGA GCCCGGTCAATCTACAACTT, SEQ ID No. 8: GGCCAATACGTGCGATAGCCA ACTCGCACTCACATAACGAC.

2. A kit for detecting the O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification, characterized in that, The kit includes a turbidimetric reagent, a DNA extraction kit, and a LAMP amplification reaction system. The nucleotide sequences of the amplification primers in the LAMP amplification reaction system are as shown in SEQ ID NO.1-8 of claim 1, and the initial concentration of the amplification primers is 1-10 mmol / L.

3. The O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification detection kit according to claim 2, characterized in that, The amplification temperature of the LAMP amplification reaction system is 58-65℃, and the amplification time is 15-45 min.

4. The O139 group Vibrio cholerae dual virulence gene loop-mediated isothermal amplification detection kit according to claim 3, characterized in that, The amplification temperature was 63℃, and the amplification time was 30-40 min.

Citation Information

Patent Citations

  • LAMP fast detection reagent kit for vibrio cholerae in aquatic products

    CN105400892A

  • Detection method and application of auxiliary toxin protein coding gene of vibrio cholerae

    CN108950032A