Construction method of a mouse model with increased copy number of transcription factor FOXG1 and application thereof
By constructing a mouse model with increased FOXG1 copy number, conditional overexpression of FOXG1 is achieved, solving the problem of the lack of accurate models simulating FOXG1 mutation autism in existing technologies. This provides a more controllable research tool and supports drug development and diagnosis of autism.
Patent Information
- Application Number
- CN202310568822.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-19
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-05-19
AI Technical Summary
Current technologies lack accurate mouse models of autism, cannot effectively simulate the clinical symptoms caused by different forms of FOXG1 mutations, and lack targeted diagnostic and treatment methods.
A mouse model with increased FOXG1 copy number was constructed. A specific plasmid was introduced into the mouse genome via microinjection to achieve conditional overexpression of FOXG1. The Cre tool was then used to achieve spatiotemporally specific expression in mice, thus establishing a conditional overexpression model.
It provides a more controllable FOXG1 expression model that can simulate the pathological state of autistic patients, providing support for drug development and diagnosis.
Smart Images
Figure CN116548387B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of animal models, and particularly relates to a construction method of a mouse model with increased copy number of transcription factor FOXG1 and application thereof. BACKGROUND
[0002] FOXG1 belongs to the forkhead box transcription factor family, is also known as brain factor, is a core transcription factor for regulating brain development, and is involved in many processes of brain development, including regulation of proliferation of neural stem cells, determination of fates of different types of neural cells, mature differentiation, and migration of neurons. Mutation thereof leads to FOXG1 syndrome, and patients show core symptoms of autism, such as mental retardation, language disorder, stereotyped behavior, and low social interaction ability. Patients carrying different site and different form mutations of FOXG1 also have different clinical manifestations, and the increase in copy number is one of the mutation forms. In addition, it has been reported that the expression level of FOXG1 is up-regulated in patients with autism. The mechanisms of diseases caused by different forms of mutations of FOXG1 are also different, and there is a lack of precise diagnosis and treatment methods for patients carrying different mutations. Therefore, establishing a disease mouse model that is true and close to the clinical symptoms of patients for different forms of mutations, revealing different pathogenesis, and developing effective treatment drugs and precise intervention methods for diseases are urgent problems to be solved in the current research on FOXG1 syndrome. SUMMARY
[0003] In view of the deficiencies in the prior art, the purpose of the present application is to provide a construction method of a mouse model with increased copy number of transcription factor FOXG1 and application thereof. The expression level of FOXG1 is found to be up-regulated in patients with autism, so the mutant mouse model can be used not only for research on the biological function of FOXG1, but also for research on autism-related diseases, and can be used for developing precise diagnosis and intervention methods for FOXG1 syndrome and autism-related diseases.
[0004] The purpose of the present application can be achieved by the following technical solutions.
[0005] The construction method of the mouse model with increased copy number of FOXG1 syndrome comprises the following steps:
[0006] Step 1: Constructing a CAG-loxp-stop-loxp-Foxg1-IRES-EGFP plasmid;
[0007] The Foxg1-cDNA fragment is obtained from the pCAGEN-Foxg1 plasmid and inserted into the IRES2-EGFP plasmid, the Foxg1-cDNA fragment is cut by EcoR I and Nde I, and the IRES2-EGFP plasmid is cut by EcoR I and Sma I, wherein Nde I and Sma I are blunt-end restriction enzymes; the Foxg1-cDNA fragment and the IRES2-EGFP plasmid are connected by using T4 ligase;
[0008] The connected Foxg1-IRES2-EGFP plasmid is subjected to gel electrophoresis identification, and the full length is 7.8 kb after being cut by EcoR I, and can be cut into two segments of 2 kb and 5.8 kb after being cut by Kpn I;
[0009] The CAG-loxp-stop-loxp in the Ai9 vector is connected into the Foxg1-IRES2-EGFP plasmid, the Ai9 vector is cut by EcoR I and recovered by gel cutting, and the self-connection is performed by using T4 ligase; the self-connection plasmid and the Foxg1-IRES2-EGFP plasmid are double-cut by Sac I and EcoR I; the CAG-loxp-stop-loxp fragment is connected into the Foxg1-IRES2-EGFP plasmid by using T4 ligase;
[0010] The connected CAG-loxp-stop-loxp-FOXG1-IRES-EGFP plasmid is subjected to gel electrophoresis identification, wherein two segments of 2.6 kb and 9 kb are obtained after being cut by BamH I, five segments of 1.4, 0.9, 3.5, 0.1 and 5.7 are obtained after being cut by Apa I, two segments of 3.5 kb and 8.1 kb are obtained after being cut by Hind III, and one segment of 11.6 kb is obtained after being cut by Sal I;
[0011] Step two: the constructed plasmid is transformed, expanded, purified and linearized, and the transgenic mouse is prepared by using the microinjection method.
[0012] The constructed plasmid is transformed, expanded and purified;
[0013] The purified plasmid is cut by Sac I and Afl II into two segments of 7.9 kb and 3.7 kb, and the 7.9 kb band is selected for gel cutting and purification;
[0014] The 7.9 kb segment purified by gel cutting is microinjected to prepare a transgenic mouse;
[0015] Step three: the positive transgenic mouse is identified by PCR.
[0016] Transgenic mice were marked by toe clipping at 7-14 days after birth, and the clipped tissues were collected, genomic DNA was extracted by alkaline lysis, and detected by PCR using specific primers;
[0017] The positive mice identified by PCR were used as the experimental group, and the negative mice were used as wild-type controls. The transgenic mice expressing the 378 bp target fragment were obtained as Cre / Loxp system-dependent overexpression of FOXG1.
[0018] The above-mentioned positive Founder mice were selected and mated with wild-type mice to obtain the F1 generation.
[0019] Step 4: Select F1 generation positive mice and mate them with Cre tool mice to detect whether the FOXG1 expression level can be increased.
[0020] Sexually mature PCR-positive mice were mated with Cre-positive mice, and the expression level of FOXG1 in Cre-positive cells was detected by immunofluorescence assay;
[0021] Furthermore, the PCR amplification primers in step 3 are used to identify founder mice and stably inherited F1 generation mice, and the sequences are as follows:
[0022] The upstream primer is: 5'AAG GAC GAC GGCAAC TACAAG 3'
[0023] Downstream primer: 5'GGC GGT CAC GAA CTC CA 3'
[0024] Beneficial effects of the present invention:
[0025] The FOXG1 copy number increase mouse model constructed by the present invention is a conditional overexpression model. By mating Cre-expressing mice with different brain regions and cell types, spatiotemporal-specific overexpression of FOXG1 can be achieved, providing greater controllability than conventional transgenic mouse models. Furthermore, studies have reported that FOXG1 expression levels are upregulated in patients with autism. This model, based on which autism models can be established at the holistic animal level, provides support for the screening of drugs targeting autism. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.
[0027] Figure 1FOXG1 overexpression plasmid map of the FOXG1 copy number increase mouse model provided by the application;
[0028] Figure 2 Gel electrophoresis result of the FOXG1 overexpression plasmid of the FOXG1 copy number increase mouse model provided by the application;
[0029] Figure 3 PCR identification result of the FOXG1 copy number increase mouse model provided by the application;
[0030] Figure 4 The FOXG1 is overexpressed in the dorsal telencephalic neurons of the FOXG1 copy number increase mouse mated with the Nex-Cre mouse. DETAILED DESCRIPTION
[0031] The technical solutions in the embodiments of the application will be clearly and completely described below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the application.
[0032] A method for constructing a transcription factor FOXG1 copy number increase mouse model and application thereof
[0033] Embodiment 1
[0034] The method for constructing a FOXG1 syndrome copy number increase mutant mouse model comprises the following steps:
[0035] Step 1: Constructing a CAG-loxp-stop-loxp-FOXG1-IRES-EGFP overexpression plasmid
[0036] (1) Obtain a Foxg1-cDNA fragment from a pCAGEN-Foxg1 plasmid, and insert the Foxg1-cDNA fragment into an IRES2-EGFP plasmid. The Foxg1-cDNA fragment is cut by EcoR I and Nde I, and the IRES2-EGFP plasmid is cut by EcoR I and Sma I, wherein Nde I and Sma I are blunt-end restriction enzymes. The Foxg1-cDNA fragment and the IRES2-EGFP plasmid are connected by using a T4 ligase.
[0037] (2) Perform gel electrophoresis identification on the connected Foxg1-IRES2-EGFP plasmid. After being cut by EcoR I, the full length is 7.8 kb, and after being cut by Kpn I, the full length can be cut into two segments of 2 kb and 5.8 kb.
[0038] (3) The CAG-loxp-stop-loxp in the Ai9 vector is connected into the Foxg1-IRES2-EGFP plasmid. The Ai9 vector is cut by EcoR I enzyme and recovered by cutting the gel, and self-ligation is performed by using T4 ligase. The self-ligation plasmid and the Foxg1-IRES2-EGFP plasmid are double-cut by Sac I and EcoR I. The CAG-loxp-stop-loxp fragment is connected into the Foxg1-IRES2-EGFP plasmid by using T4 ligase, as shown in FIG. 3. Figure 1
[0039] (4) The connected CAG-loxp-stop-loxp-FOXG1-IRES-EGFP overexpression plasmid is identified by gel electrophoresis, which has two fragments of 2.6 kb+9 kb after being cut by BamH I, five fragments of 1.4+0.9+3.5+0.1+5.7 after being cut by Apa I, two fragments of 3.5+8.1 kb after being cut by Hind III, and one fragment of 11.6 kb after being cut by Sal I, as shown in FIG. 4. Figure 2
[0040] Step two: the constructed plasmid is transformed, expanded, purified, and linearized for microinjection.
[0041] (1) The constructed plasmid is transformed, expanded, and purified.
[0042] (2) The purified plasmid is cut by Sac I and Afl II to be two fragments of 7.9 kb and 3.7 kb, and the 7.9 kb band is selected for gel purification, and the DNA is recovered by using TE solution.
[0043] (3) The 7.9 kb fragment purified by cutting the gel is microinjected to make transgenic mice.
[0044] (4) Superovulation of embryonic donor mice (C57BL / 6)
[0045] The donor female mice are treated with PMSG (pregnant mare serum gonadotropin), and hCG (human chorionic gonadotropin) is injected 48 hours later. The male mice are mated in a cage, and the next day, the fertilized eggs are microinjected.
[0046] Step three: PCR method is used to identify positive transgenic mice.
[0047] (1) The transgenic mice are marked by cutting the toes at 7-14 days after birth, and the cut tissues are collected. The genomic DNA is extracted by alkaline lysis, and detected by PCR using specific primers.
[0048] (2) PCR positive mice were used as the experimental group, and negative mice were used as the wild-type control. The mice expressing the 378bp target fragment were Cre / Loxp system-dependent overexpression FOXG1 transgenic mice, as shown in Figure 3 .
[0049] (3) The positive founder mice were mated with wild-type mice to obtain F1 generation.
[0050] Step four: The positive F1 mice were mated with Cre tool mice to detect whether they could increase the expression level of FOXG1.
[0051] The sexually mature PCR positive mice were mated with Cre tool mice, and the expression level of FOXG1 in Cre positive cells was detected by immunofluorescence experiment.
[0052] PCR amplification primers were used to identify founder mice and stably inherited F1 generation mice, and the sequences are as follows:
[0053] The upstream primer is: 5 'AAG GAC GAC GGC AAC TACAAG 3 '
[0054] The downstream primer is: 5 'GGC GGT CAC GAA CTC CA 3 '.
[0055] Example 2:
[0056] The application of the FOXG1 syndrome copy number increase mutant mouse model, after sequencing, the sexually mature mice were mated with different brain regions or different types of neuron-specific Cre tool mice in the nervous system. With the help of the mouse, the influence of overexpression of FOXG1 in different brain regions or different types of neurons on the development and behavior of mice can be explored, and the molecular mechanism of its regulation can be analyzed, which provides a theoretical basis for the research and development of drugs related to neural development diseases.
[0057] Example 3:
[0058] The application of the FOXG1 syndrome copy number increase mutant mouse model, after sequencing, the sexually mature mice were mated with endocrine system-specific Cre tool mice. With the help of the mouse, the regulatory role of endogenous FOXG1 on the development and function of the endocrine system can be explored.
[0059] In the description of the specification, the description of the terms "one embodiment", "an example", "a specific example" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate way in one or more embodiments or examples.
[0060] The basic principles, main features and advantages of the present application are shown and described above. Those skilled in the art should understand that the present application is not limited by the above embodiments, and the above embodiments and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.
Claims
1. A method for constructing a mouse model with increased copy number of the transcription factor FOXG1, wherein the model is used to prepare FOXG1 syndrome and screen drugs for autism, characterized in that: The following steps are involved: Obtain Foxg1-cDNA fragment, insert into IRES2-EGFP plasmid to obtain Foxg1-IRES2-EGFP plasmid, obtain CAG-loxp-stop-loxp and ligate into Foxg1-IRES2-EGFP plasmid to obtain CAG-loxp-stop-loxp-FOXG1-IRES-EGFP plasmid; The constructed CAG-loxp-stop-loxp-FOXG1-IRES-EGFP plasmid was transformed, amplified, purified, and linearized, and transgenic mice were generated by microinjection. Positive transgenic mice were identified by PCR as the experimental group, and the positive transgenic mice were selected to mate with wild-type mice to obtain F1 generation mice; F1 generation positive mice were selected to mate with Cre tool mice, and the expression level of FOXG1 in Cre-positive cells was detected.
2. The method for constructing a mouse model with increased copy number of transcription factor FOXG1 according to claim 1, characterized in that: The Foxg1-cDNA fragment was obtained from the pCAGEN-Foxg1 plasmid and inserted into the IRES2-EGFP plasmid. The Foxg1-cDNA fragment was digested with EcoRI and NdeI, and the IRES2-EGFP plasmid was digested with EcoRI and SmaI (NdeI and SmaI are blunt-end restriction endonucleases). The Foxg1-cDNA fragment and the IRES2-EGFP plasmid were ligated using T4 ligase. Gel electrophoresis was performed on the ligated Foxg1-IRES2-EGFP plasmid to identify that the full length was 7.8 kb after EcoRI cleavage and could be cut into two fragments of 2 kb and 5.8 kb after KpnⅠ cleavage. The CAG-loxp-stop-loxp fragment in the Ai9 vector was ligated into the Foxg1-IRES2-EGFP plasmid. The Ai9 vector was digested with EcoRI and recovered by tapping. It was then self-ligated with T4 ligase. The self-ligated plasmid and the Foxg1-IRES2-EGFP plasmid were double-digested with SacI and EcoRI. The CAG-loxp-stop-loxp fragment was then ligated into the Foxg1-IRES2-EGFP plasmid using T4 ligase. The ligated CAG-loxp-stop-loxp-FOXG1-IRES-EGFP plasmid was identified by gel electrophoresis. After digestion with BamHⅠ, two fragments of 2.6kb+9kb were obtained; after digestion with ApaⅠ, five fragments of 1.4+0.9+3.5+0.1+5.7 were obtained; after digestion with HindⅢ, two fragments of 3.5+8.1kb were obtained; and after digestion with SalⅠ, one fragment of 11.6kb was obtained.
3. The method for constructing a mouse model with increased copy number of transcription factor FOXG1 according to claim 1, characterized in that: After the constructed plasmid was transformed, expanded and purified, the purified plasmid was double-digested with SacⅠ and AflⅡ and cut into two fragments of 7.9kb and 3.7kb. The 7.9kb band was selected for gelatin tapping and purification, and the 7.9kb fragment after gelatin tapping and purification was microinjected to produce transgenic mice.
4. The method for constructing a mouse model with increased copy number of transcription factor FOXG1 according to claim 1, characterized in that: Transgenic mice were marked by toe clipping at 7-14 days after birth, and the clipped tissues were collected. Genomic DNA was extracted by alkaline lysis and detected by PCR using specific primers. Those with positive PCR identification were used as the experimental group, and those with negative PCR identification were used as wild-type controls of the same littermate. The transgenic founder mice expressing the 378bp target fragment were obtained, which were Cre / Loxp system-dependent overexpression of FOXG1.
5. The method for constructing a mouse model with increased copy number of transcription factor FOXG1 according to claim 1, characterized in that: Sexually mature PCR-positive mice were mated with Cre-expressing mice, and the expression level of FOXG1 in Cre-positive cells was detected by immunofluorescence assay.
6. The method for constructing a mouse model with increased copy number of transcription factor FOXG1 according to claim 1, characterized in that: Among those that were positive in PCR identification, PCR amplification primers were used to identify founder mice and stably inherited F1 generation mice. The sequences are as follows: The upstream primer was: 5′AAGGACGACGGCAACTACAAG3′; The downstream primer is: 5'GGCGGTCACGAACTCCA3'.
7. Application of the method for constructing a mouse model according to any one of claims 1 to 6 in studying autism.