Circular RNA circTP63-N and its applications

By overexpressing circTP63-N in nasopharyngeal carcinoma and binding to HSP90AB1 protein, the Hippo-YAP1 signaling pathway was activated, resolving the unknown function of circTP63-N in nasopharyngeal carcinoma. This resulted in the inhibition of nasopharyngeal carcinoma cell proliferation, invasion, and migration, providing a new diagnostic and therapeutic approach.

CN116716300BActive Publication Date: 2025-10-28CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310576197.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-22
Publication Date
2025-10-28
Estimated Expiration
2043-05-22

AI Technical Summary

Technical Problem

Existing research has not explored the role of circRNAs in nasopharyngeal carcinoma in depth, especially the function of circular RNAs with different exon circular forms of TP63 pre-mRNA in nasopharyngeal carcinoma. Furthermore, the low expression abundance of circTP63-N in nasopharyngeal carcinoma may have an important impact on tumor proliferation, invasion, and migration.

Method used

We discovered and verified that circTP63-N, formed from exons 2-4 of TP63 pre-mRNA, is lowly expressed in nasopharyngeal carcinoma. By overexpressing the circTP63-N vector, binding to HSP90AB1 protein, we activated the Hippo-YAP1 signaling pathway and inhibited the proliferation, invasion, and migration of nasopharyngeal carcinoma cells.

Benefits of technology

circTP63-N, by binding to HSP90AB1, promotes the upregulation of LATS1/2 and the phosphorylation and degradation of YAP1, thereby inhibiting the proliferation, invasion, and migration of nasopharyngeal carcinoma cells, providing a new diagnostic and therapeutic strategy for nasopharyngeal carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116716300B_ABST
    Figure CN116716300B_ABST
Patent Text Reader

Abstract

This invention discloses a circular RNA, circTP63-N, and its applications. This invention discovers a novel circular RNA, circTP63-N, expressed at low levels in nasopharyngeal carcinoma. By directly binding to the HSP90AB1 protein, it promotes the binding of LATS1 / 2 and YAP1 proteins, causing YAP1 phosphorylation and ubiquitination degradation, leading to reduced YAP1 nuclear translocation. This further inhibits the expression of downstream extracellular matrix-related genes INHBA and MMP3, as well as the cell cycle-related gene CCNE2, ultimately suppressing the proliferation, invasion, and migration of nasopharyngeal carcinoma. The discovery of this circular RNA provides a new approach for the diagnosis and treatment of nasopharyngeal carcinoma and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tumor molecular biology preparation technology, specifically relating to a novel circular RNA circTP63-N and its applications. Background Technology

[0002] In nasopharyngeal carcinoma (NPC), numerous altered circular RNAs (circRNAs) have been identified. These circRNAs can regulate various malignant phenotypes of NPC, including tumor cell proliferation, invasion, migration, radioresistance, drug resistance, and tumor immunity. For example, circCAMSAP1 can regulate c-Myc through SERPINH1, thereby promoting NPC proliferation, invasion, and migration. circRNF13 can promote the degradation of GLUT1 by binding to SUMO2. Inhibition of GLUT1's function as a glucose transporter inhibits glycolysis, affecting the AMPK-mTOR pathway and ultimately suppressing NPC proliferation and metastasis. Overexpression of exosome-derived circMYC can reduce radiosensitivity and promote cell proliferation, while knockdown of circMYC can enhance radiosensitivity and inhibit cell proliferation. circIPO7 promotes the phosphorylation of YBX1 by binding to it, further activating the transcription of downstream target genes of YBX1, thereby promoting NPC metastasis and cisplatin resistance. Although several studies have shown that circRNAs can influence the development and progression of nasopharyngeal carcinoma, current research is not yet in-depth enough, and further exploration of the role of more circRNAs in nasopharyngeal carcinoma is needed.

[0003] TP63 is a transcription factor belonging to the p53 family. Several isoforms of TP63 have been identified, falling into two categories: TAp63, which possesses a transactivation domain homologous to p53, and ΔNp63, which lacks an N-terminal deletion. These isoforms have diverse functions and are widely involved in biological processes such as proliferation, differentiation, cell death and survival, DNA damage repair, and metabolism. Furthermore, TP63 is closely related to human diseases, including cancer.

[0004] Overexpression of TP63 has been observed in various cancers, including nasopharyngeal carcinoma, and TP63 is closely related to the differentiation stage of nasopharyngeal carcinoma. Furthermore, TP63 can interact with EBV nuclear antigen 5 (EBNA5) in vivo, playing an important role in EBV infection and the development of nasopharyngeal carcinoma.

[0005] TP63 can also function in tumors by encoding circRNA. It has been reported that circTP63, a pre-mRNA containing exons 10 and 11, promotes the development and progression of various tumors. In lung squamous cell carcinoma and breast cancer, circTP63 has been shown to act as a ceRNA, competitively binding to miR-873-3p and ultimately upregulating FOXM1 to promote tumor progression. In liver cancer, circTP63 promotes liver cancer cell growth by binding to miR-155-5p and upregulating ZBTB18; it can also promote the proliferation and invasion of biliary cancer cells by binding to miR-217 and upregulating EZH2.

[0006] The pre-mRNA of TP63 contains 15 exons. Besides circTP63, which is circularized in exons 10 and 11, there may be other circular forms of circRNA, which may also play an important role in nasopharyngeal carcinoma. This invention discovered that circTP63, a circular form of TP63 pre-mRNA formed in exons 10 and 11, is expressed at very low levels in both nasopharyngeal epithelium and nasopharyngeal carcinoma. In contrast, the circular RNA formed by exons 2-4 of TP63 pre-mRNA is highly expressed in normal nasopharyngeal epithelium and significantly underexpressed in nasopharyngeal carcinoma. We named this novel circular RNA circTP63-N. Further research confirmed that circTP63-N can inhibit the proliferation, invasion, and migration of nasopharyngeal carcinoma cells, thus playing an important tumor suppressor gene role in the malignant progression of nasopharyngeal carcinoma. Summary of the Invention

[0007] The primary objective of this invention is to provide a novel circular RNA circTP63-N, with the sequence: Tttcgtagaaaccccagctcatttctcttggaaagaaagttattaccgatccaccatgtcccagagcacacagacaaatgaattcctcagtccagaggttttccagcatatctgggattttctggaacagcctatatgttcagttcagcccattgacttgaactttgtggatgaaccatcagaagatggtgcgacaaacaagattgagattagcatggactgtatccgcatgcaggactcggacctgagtgac cccatgtggccacagtacacgaacctggggctcctgaacagcatggaccagcagattcagaacggctcctcgtccaccagtccctataacacagaccacgcgcagaacagcgtcacggcgccctcgccctacgc acagcccagctccaccttcgatgctctctctccatcacccgccatcccctccaacaccgactacccaggcccgcacagtttcgacgtgtccttccagcagtcgagcaccgccaagtcggccacctggacg, see SEQ ID NO.1.

[0008] A second objective of this invention is to provide the use of a reagent for detecting the circular RNA circTP63-N in the preparation of diagnostic or prognostic agents for nasopharyngeal carcinoma.

[0009] Furthermore, the reagents for detecting circular RNA circTP63-N include PCR detection reagents or in situ hybridization detection reagents.

[0010] Furthermore, the primer sequences of the PCR detection reagent are as follows:

[0011] Upstream primer: 5'-TCCACCTTCGATGCTCTCTC-3'

[0012] Downstream primer: 5'-TTTGTCTGTGTGCTCTGGGA-3'.

[0013] A third object of the present invention is to provide a diagnostic or prognostic agent for nasopharyngeal carcinoma, including a reagent for detecting the circular RNA circTP63-N.

[0014] A fourth objective of this invention is to provide the use of the reagent that overexpresses the circular RNA circTP63-N in the preparation of nasopharyngeal carcinoma therapeutic agents.

[0015] Furthermore, the reagent for overexpressing the circular RNA circTP63-N includes a vector that overexpresses the circular RNA circTP63-N.

[0016] A fifth object of the present invention is to provide a nasopharyngeal carcinoma treatment agent comprising a reagent that overexpresses the circular RNA circTP63-N.

[0017] Furthermore, the reagent for overexpressing the circular RNA circTP63-N includes a vector that overexpresses the circular RNA circTP63-N.

[0018] The present invention also provides the use of circTP63-N in the preparation of any of the formulations that bind to HSP90AB1 protein to promote the binding of LATS1 / 2 and YAP1 proteins, induce YAP1 phosphorylation and ubiquitination degradation, reduce YAP1 nuclear translocation, and inhibit the expression of downstream extracellular matrix-related genes INHBA, MMP3 and cell cycle-related gene CCNE2.

[0019] In this invention, circTP63-N is a circular RNA formed by TP63 (NM_003722) in a novel exon 2-4 circular form. This is the first report of circTP63-N in nasopharyngeal carcinoma, and also the first report of circTP63-N in a novel exon circular form. Previously, four papers reported that circTP63, with exons 11 and 12 circularized from TP63 pre-mRNA, promotes the development and progression of various tumors. However, we found that circTP63-N, with exons 2-4 circularized from TP63 pre-mRNA, can inhibit the proliferation, invasion, and migration of nasopharyngeal carcinoma. This indicates that the same gene may have different biological functions in different tumor types or with different exon circularizations. This may be related to their different downstream target genes and signaling pathways, and their regulation by different mechanisms, thus exhibiting tissue specificity and spatiotemporal specificity.

[0020] Because the expression level of circTP63-N in nasopharyngeal carcinoma is very low, we only preliminarily revealed its biological function in nasopharyngeal carcinoma cells by overexpressing circTP63-N in vitro and in vivo. Through cell experiments and animal experiments, we demonstrated that circTP63-N can inhibit the proliferation, invasion and migration of nasopharyngeal carcinoma.

[0021] Since this is the first time we have discovered that circTP63-N is downregulated in nasopharyngeal carcinoma (NPC), identifying its functional mechanism is crucial for elucidating the molecular mechanism by which circTP63-N inhibits NPC proliferation and invasion. We identified 170 potential binding proteins for circTP63-N using RNA pull-down assays combined with LC / MS. After ranking the proteins by their scores, we validated the top 5 proteins using RNA pull-down and RIP assays, demonstrating that circTP63-N can directly bind to the HSP90AB1 protein. We hypothesize that HSP90AB1 is most likely the downstream molecule through which circTP63-N directly binds to and inhibits NPC proliferation and invasion.

[0022] HSP90, as a novel cancer target, possesses unique biological functions, helping to stabilize many proteins required for tumor growth, including protein kinases, receptor tyrosine kinases, transcription factors, and chromatin remodeling proteins. HSP90 mainly exists in two isoforms: inducibly expressed HSP90AA1 (HSP90α) and constitutively expressed HSP90AB1 (HSP90β). Currently, the mechanism of action of HSP90AB1 in nasopharyngeal carcinoma has not been reported. We found that circTP63-N can bind to HSP90AB1 and promote the binding of HSP90AB1, LATS1 / 2, and YAP1. Specifically, HSP90AB1 binds to and promotes the upregulation of total LATS1 / 2 protein levels, activating the phosphorylation of downstream YAP1, leading to the ubiquitination and degradation of large amounts of YAP1 in the cytoplasm, ultimately inhibiting the malignant phenotype of nasopharyngeal carcinoma.

[0023] In summary, this invention found that circTP63-N, formed by the reverse splicing of exons 2-4 of TP63, is expressed at low levels in nasopharyngeal carcinoma. Furthermore, circTP63-N can directly bind to the HSP90AB1 protein, thereby promoting the interaction between HSP90AB1, LATS1 / 2, and YAP1, further regulating the Hippo-YAP1 signaling pathway, inhibiting the transcriptional activation of three downstream oncogenes INHBA, MMP3, and CCNE2, and ultimately suppressing the proliferation, invasion, and migration abilities of nasopharyngeal carcinoma. Attached Figure Description

[0024] Figure 1 circTP63-N is expressed at low levels in nasopharyngeal carcinoma;

[0025] A. qRT-PCR detection of circTP63-N and circTP63 expression in nasopharyngeal carcinoma tissues, N: chronic inflammatory nasopharyngeal epithelial tissue; T: nasopharyngeal carcinoma tissue, β-actin as internal control; *, p<0.05; B. qRT-PCR detection of circTP63-N and circTP63 expression in nasopharyngeal carcinoma cell lines and NP69, ***, p<0.001.

[0026] Figure 2 The ring structure of circTP63 and circTP63-N;

[0027] Sanger sequencing confirmed that circTP63-N is formed by reverse splicing of exons 2-4 of TP63 mRNA.

[0028] Figure 3 Detect the tolerance of circTP63-N to RNase R;

[0029] After treatment with RNase R, the relative RNA levels of circTP63-N and TP63 in nasopharyngeal carcinoma cells were detected by qRT-PCR.

[0030] Figure 4 Detect the stability of circTP63-N;

[0031] After treatment with actinomycin D, the relative RNA levels of circTP63-N and TP63 in nasopharyngeal carcinoma cells at different time points were detected by qRT-PCR.

[0032] Figure 5 Localization of circTP63-N in nasopharyngeal carcinoma cells;

[0033] FISH assay was used to detect the localization of circTP63-N in nasopharyngeal carcinoma cells CNE2 and HONE1; digoxigenin-labeled probe (red); DAPI (blue) labeled cell nuclei; scale bar = 20 μm.

[0034] Figure 6 .circTP63-N overexpression vector map and overexpression efficiency identification.

[0035] Figure 7 circTP63-N inhibits the proliferation of nasopharyngeal carcinoma cells;

[0036] A. MTT assay to detect the inhibition of nasopharyngeal carcinoma cell proliferation by circTP63-N; *, p<0.05; ***, p<0.001; ****, p<0.0001; B. Colony formation assay to detect the colony formation ability of nasopharyngeal carcinoma cells CNE2 and HONE1 after overexpression of circTP63-N; ***, p<0.001; ****, p<0.0001.

[0037] Figure 8 Transwell assays showed that circTP63-N inhibited the invasion of nasopharyngeal carcinoma cells;

[0038] Scale bar = 200 μm, **, p < 0.01; ****, p < 0.0001.

[0039] Figure 9 The scratch healing assay showed that circTP63-N inhibited the migration of nasopharyngeal carcinoma cells;

[0040] Scale bar = 200μm, *p<0.05, **p<0.01, ***p<0.001.

[0041] Figure 10 circTP63-N inhibits the proliferation, invasion, and migration of nasopharyngeal carcinoma by binding to HSP90AB1; A. RNA pulldown and LC-MS / MS screening of the top 10 proteins that may bind to circTP63-N; B. RNA pulldown... Down and Western blotting assays detected the binding of HSP90AB1 to circTP63-N; C. RIP assay detected the binding of HSP90AB1 to circTP63-N; D. FISH and IF assays detected the co-localization of circTP63-N (red) and HSP90AB1 (green) in nasopharyngeal carcinoma cells CNE2 and HONE1, scale bar = 20 μm; E. MTT assay detected that circTP63-N inhibits the proliferation of nasopharyngeal carcinoma cells through HSP90AB1; F. Colony formation assay detected that circTP63-N inhibits the colony formation of nasopharyngeal carcinoma cells through HSP90AB1; G. Transwell assay detected that circTP63-N inhibits the invasion of nasopharyngeal carcinoma cells through HSP90AB1; H. Scratch healing assay detected that circTP63-N inhibits the migration of nasopharyngeal carcinoma cells through HSP90AB1; *p<0.05, **p<0.01,

[0042] ***p<0.001,****p<0.0001.

[0043] Figure 11 .circTP63-N activates the Hippo pathway via HSP90AB1;

[0044] A. Co-IP assay to detect the effect of circTP63-N overexpression on the binding of HSP90AB1, YAP1, and LATS1 / 2 in nasopharyngeal carcinoma cells; B. Western blotting assay to detect the effect of simultaneous overexpression of circTP63-N and knockdown of HSP90AB1 on the total protein content and phosphorylation modification level of LATS1 / 2 and YAP1 in nasopharyngeal carcinoma cells; C. Western blotting assay to detect the effect of simultaneous overexpression of circTP63-N and knockdown of HSP90AB1 on the expression of YAP1 in the nucleus and cytoplasm in nasopharyngeal carcinoma cells CNE2 and HONE1; β-tubulin and C23 were used as positive controls for cytoplasmic and nuclear proteins, respectively; D. Western blotting assay to detect the effect of simultaneous overexpression of circTP63-N and knockdown of HSP90AB1 on the expression of YAP1 in the nucleus and cytoplasm in nasopharyngeal carcinoma cells CNE2 and HONE1; Blotting assays were used to detect the effects of simultaneous overexpression of circTP63-N and knockdown of HSP90AB1 on the ubiquitination level of YAP1 in nasopharyngeal carcinoma cells CNE2 and HONE1; E. Dual-luciferase reporter gene assays were used to detect the effects of simultaneous overexpression of circTP63-N and knockdown of HSP90AB1 on the transcriptional activity of YAP1 in nasopharyngeal carcinoma cells CNE2 and HONE1; *p<0.05,**p<0.01,***p<0.001,****p<0.0001.

[0045] Figure 12 circTP63-N inhibits the proliferation and metastasis of nasopharyngeal carcinoma through the LATS / YAP1 axis;

[0046] A. MTT assay to detect the effect of simultaneous overexpression of circTP63-N and YAP1 in CNE2 and HONE1 on the proliferation of nasopharyngeal carcinoma cells; B. Colony formation assay to detect the effect of simultaneous overexpression of circTP63-N and YAP1 in CNE2 and HONE1 on the colony formation ability of nasopharyngeal carcinoma cells; C. Transwell assay to detect the effect of simultaneous overexpression of circTP63-N and YAP1 in CNE2 and HONE1 on the invasive ability of nasopharyngeal carcinoma cells; D. Scratch healing assay to detect the effect of simultaneous overexpression of circTP63-N and YAP1 in CNE2 and HONE1 on the migration ability of nasopharyngeal carcinoma cells; *p<0.05,**p<0.01,***p<0.001,****p<0.0001.

[0047] Figure 13 The circTP63-N / YAP1 axis inhibits the expression of INHBA, MMP3, and CCNE2;

[0048] A. Venn diagram analysis was performed using the CistromeDB database to identify the intersection of YAP1 downstream target genes predicted from the YAP1 gene expression microarrays GSE12452 and GSE53819 with genes upregulated (LogFC>1); B. Metascape was used to perform pathway enrichment analysis on the 223 predicted genes; C. qRT-PCR was used to detect the effect of YAP1 on the mRNA expression of INHBA, MMP3, and CCNE2 in nasopharyngeal carcinoma cells CNE2 and HONE1; D. RT-PCR was used to detect the effect of circTP63-N on the mRNA expression of INHBA, MMP3, and CCNE2 in nasopharyngeal carcinoma cells CNE2 and HONE1; E. Western blotting was used to detect the effect of YAP1 on the protein expression of INHBA, MMP3, and CCNE2 in nasopharyngeal carcinoma cells CNE2 and HONE1; F. Western blotting was used to detect the effect of YAP1 on the protein expression of INHBA, MMP3, and CCNE2 in nasopharyngeal carcinoma cells CNE2 and HONE1; Blending assays were used to detect the effect of circTP63-N overexpression on the expression of INHBA, MMP3, and CCNE2 proteins in nasopharyngeal carcinoma cells CNE2 and HONE1; G. qRT-PCR assays were used to detect the effect of circTP63-N and YAP1 overexpression on the expression of INHBA, MMP3, and CCNE2 mRNA in CNE2 and HONE1; H. Western blotting assays were used to detect the effect of circTP63-N and YAP1 overexpression on the expression of INHBA, MMP3, and CCNE2 proteins in CNE2 and HONE1; *p<0.05,**p<0.01,***p<0.001,****p<0.0001.

[0049] Figure 14 circTP63-N inhibits the proliferation and metastasis of nasopharyngeal carcinoma through the LATS / YAP1 axis;

[0050] A. In situ hybridization of circTP63-N and immunohistochemical detection of Ki-67, LATS1 / 2, YAP1, INHBA, MMP3, and CCNE2 in nude mouse subcutaneous tumors, scale bar = 20 μm; B. Expression scores of circTP63-N, Ki-67, LATS1 / 2, YAP1, INHBA, MMP3, and CCNE2 in nude mouse subcutaneous tumors; C. In situ hybridization of circTP63-N and immunohistochemical detection of LATS1 / 2, YAP1, INHBA, MMP3, and CCNE2 in nude mouse lung metastases, scale bar = 20 μm; D. Expression scores of circTP63-N, LATS1 / 2, YAP1, INHBA, MMP3, and CCNE2 in nude mouse lung metastases; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Detailed Implementation

[0051] The following examples are intended to further illustrate the present invention, but not to limit it.

[0052] This invention collected non-tumor nasopharyngeal epithelial tissue samples from 8 patients with chronic nasopharyngeal inflammation at Xiangya Hospital of Central South University as control samples, and tumor tissue samples from 32 patients diagnosed with nasopharyngeal carcinoma. RNA was extracted from the tissue samples and reverse transcribed for use in quantitative real-time PCR (qRT-PCR) to detect the expression of target molecules. The study was approved by the Ethics Committee of Central South University, and informed consent was obtained from each participant. The diagnoses of all specimens were confirmed by histopathological examination.

[0053] The cell lines used in the cell experiments of this invention include nasopharyngeal carcinoma cell lines: CNE2, HONE1, 5-8F, and HNE2; and human immortalized nasopharyngeal epithelial cells: NP69. All cell lines were cryopreserved in liquid nitrogen in our laboratory.

[0054] Culture conditions for all cell lines: adherent culture in culture dishes / flasks using RPMI 1640 complete medium containing 1% penicillin / streptomycin and 10% fetal bovine serum (FBS), incubated at 37°C in a 5% CO2 cell culture incubator (Thermo Scientific).

[0055] The experimental animals of this invention

[0056] Hunan Silek Jingda Laboratory Animal Co., Ltd. provided the animals required for this invention, a total of 18 Balb / c nude mice, all female, aged 3-4 weeks, and weighing 14±2g. Prior to the animal experiments, this study had been approved by the Animal Use and Welfare Committee of Central South University. The experimental animals underwent quality testing, and those meeting the experimental standards were transferred to a specific pathogen-free (SPF) barrier environment at the Animal Department of Hunan Cancer Hospital for rearing.

[0057] The primers for the circular RNA of this invention are designed differently from those for the linear RNA. They are designed based on both sides of the splice site and designed online on the Primer 3.0 website. The final primer synthesis was commissioned to the Changsha Synthesis Department of Qingke Biotechnology Co., Ltd.

[0058] (1) GAPDH

[0059] Upstream primer: 5'-CAAGGTCATCCATGACAACTTTG-3', see SEQ ID NO.2.

[0060] Downstream primer: 5'-GTCCACCACCCTGTTGCTGTAG-3', see SEQ ID NO.3.

[0061] (2) Primers for real-time quantitative PCR of circular RNA circTP63-N

[0062] Upstream primer: 5'-TCCACCTTCGATGCTCTCTC-3', see SEQ ID NO.4.

[0063] Downstream primer: 5'-TTTGTCTGTGTGCTCTGGGA-3', see SEQ ID NO.5.

[0064] All experimental results in this invention were analyzed using statistical methods: t-tests were used to evaluate differences between two groups. Chi-square tests were used to assess differences in gene expression or non-expression in clinical parameters such as sex, age, tumor stage, clinical stage, and metastasis. p < 0.05 was used to indicate statistical significance, and all p-values ​​were two-tailed tests. Statistical analysis was performed using SPSS 13.0 and Graphpad 7.0 software.

[0065] Example 1: Screening and identification of circTP63-N

[0066] This invention identifies a relatively abundant circRNA in nasopharyngeal carcinoma (NPC), derived from the splicing of exons 2-4 of the TP63 gene, with a full length of 517 nt. Its function and mechanism have not been previously reported, and we have named it circTP63-N. qRT-PCR experiments demonstrated that circTP63-N, formed by the circularization of exons 2-4 of TP63 mRNA, was expressed at a higher abundance in NPC tissue than circTP63 formed by the circularization of exons 10 and 11 of TP63 mRNA. Furthermore, compared to its expression in chronically inflamed nasopharyngeal epithelial tissue, circTP63-N expression was lower in NPC tissue (see [link to circTP63-N expression]). Figure 1 A). Using circTP63-N expression in the human immortalized nasopharyngeal epithelial cell line NP69 as a control, circTP63-N expression was low in nasopharyngeal carcinoma cell lines (CNE2, HONE1, 5-8F, and HNE2). However, circTP63 was virtually undetectable in these nasopharyngeal carcinoma cell lines and NP69 (see [link to relevant documentation]). Figure 1 B).

[0067] Example 2: Sanger sequencing confirmed that circular RNA was formed.

[0068] To prove that circTP63-N forms circular RNA rather than linear RNA, Figure 1The qRT-PCR product in sequence A was recovered and sent to the company for Sanger sequencing (Qingke Technology). The sequences returned by the company were compared with DNASTAR software and the peak chromatogram was viewed using Chroma software to determine the sequencing quality. The results showed that circTP63-N was indeed formed by the circularization of exons 2-4 of the maternal gene TP63 (see...). Figure 2 ).

[0069] Example 3: Expression of circTP63-N in nasopharyngeal carcinoma cells

[0070] 1. Extraction of total RNA from cells

[0071] 1) Preparation: Before the experiment, prepare DNase / RNase-free consumables, disposable headgear, masks and gloves, and clean the experimental table with 75% alcohol before operation to avoid the influence of RNase on the experimental results.

[0072] 2) Collect the cells needed for the experiment and wash them three times with pre-cooled 1×PBS.

[0073] 3) Add 1 mL of total RNA extraction reagent (TRIZOL) to each well of a 6-well plate, lyse the cells for 5-10 min, then add 200 μL of chloroform to each tube, vortex until the cells turn pink, place on ice for about 10 min, and after the cells separate, centrifuge at 12000 rpm for 20 min at 4 °C.

[0074] 4) After centrifugation, carefully aspirate the supernatant aqueous phase into pre-chilled 1.5 mL centrifuge tubes. Add an equal volume of pre-chilled isopropanol to each tube, mix thoroughly by inverting, and incubate at -20°C for at least 1 hour to precipitate RNA. Then, centrifuge at 12,000 rpm for 30 minutes at 4°C using a low-temperature high-speed centrifuge. Discard the supernatant, wash the RNA precipitate with 500 μL of pre-chilled 75% anhydrous ethanol, and centrifuge at 7600 rpm for 5 minutes at 4°C. This step can be repeated twice. Remove any remaining ethanol from the tubes using a pipette, allow to air dry at room temperature for 5-10 minutes to evaporate any residual ethanol, add 50 μL of pre-chilled enzyme-free water to dissolve the RNA, and store temporarily on ice.

[0075] 5) Measure and record the concentration and purity of RNA, and store the RNA at -80°C to avoid degradation.

[0076] 2. circRNA reverse transcription PCR reaction

[0077] RNA reverse transcription experiments were performed using the Novizan reverse transcription kit. First, genomic DNA was removed, and the following reaction mixture was prepared in an enzyme-free environment:

[0078] Table 1. Genomic DNA Removal Reaction System

[0079]

[0080] Incubate at 42℃ for 2 minutes.

[0081] Then add 4 μL of 5×HiScript II qRTSuperMix II reagent and set the following reaction program on the PCR instrument according to the instructions: 50℃, 15 min; 85℃, 5 sec, to carry out reverse transcription reaction.

[0082] After the reverse transcription reaction is completed, the complementary DNA (cDNA) product is stored at -20℃ for later use.

[0083] 3. Real-time quantitative PCR

[0084] This experiment was conducted according to the instructions of the 2×SYBR Green qPCR Master Mix kit (Baimeike), and the entire reaction was carried out in an enzyme-free environment on ice.

[0085] First, prepare the experimental reaction system by adding 1 μL of the forward primer (10 μM) of the target molecule, 1 μL of the reverse primer (10 μM), 10 μL of 2×SYBR Green qPCR Master Mix, 1 μL of cDNA diluted five times, and 7 μL of RNase-free ddH2O to a PCR tube.

[0086] Then, qRT-PCR was performed using the following procedure:

[0087] Table 2 qRT-PCR reaction procedure

[0088]

[0089] After the reaction, the melting curve was observed, and relative quantification was performed based on the Ct (cycle threshold) values ​​of each gene (2). -ΔΔCt ) Calculate the fold change in relative expression.

[0090] Results: The expression of circTP63-N in nasopharyngeal carcinoma cells was significantly lower than that in normal nasopharyngeal epithelial cells (NP69). Figure 1 B). Therefore, circTP63-N is expressed at low levels in nasopharyngeal carcinoma cell lines, and circTP63-N may have important biological functions in the occurrence and development of nasopharyngeal carcinoma. Based on this, circTP63-N overexpression plasmids can be used to treat nasopharyngeal carcinoma.

[0091] Example 4: RNase R digestion experiment

[0092] Total RNA was extracted from cells according to the experimental procedure in Example 3. RNA was treated with RNase R (Gisai Biotechnology) at 37°C for 30 min, and also treated with RNase R at 37°C for 30 min only. Both groups were then incubated at 80°C for 10 min to inactivate RNase R. Reverse transcription and qRT-PCR were then performed to detect the expression levels of circTP63-N and TP63 mRNA, and the expression levels of circTP63-N and TP63 mRNA before and after RNase R treatment were compared. The RNase R digestion experiment showed that circTP63-N was more resistant to digestion by exogenous RNase R (see Example 3). Figure 3 ).

[0093] Example 5: Actinomycin D Treatment Experiment

[0094] Cells were seeded in 6-well plates. When the cell density reached 70%, the medium was replaced with medium containing different concentrations of actinomycin D (final concentrations of 0, 2, 4, and 8 μg / mL), and DMSO was added as a negative control. The medium should not be changed within 24 hours before actinomycin D treatment.

[0095] Cells were collected at 0 and 24 h after actinomycin D treatment, and total RNA was extracted according to the experimental procedure in Example 3. Reverse transcription and qRT-PCR were performed to detect the expression levels of circTP63-N and TP63 mRNA. RNA expression levels at each time point after actinomycin D treatment were compared with the control group to calculate relative expression levels. Degradation curves were plotted using the expression data to analyze the relative stability and half-life of RNA. The actinomycin D treatment experiment showed that the intracellular degradation rate of circTP63-N was slower than that of linear TP63 mRNA (see Example 3). Figure 4 ).

[0096] Example 6: RNA-FISH assay to detect intracellular localization of circTP63-N

[0097] Next, to determine the localization of circTP63-N in nasopharyngeal carcinoma cells, we designed a probe containing digoxigenin at the circTP63-N splicing site for FISH experiments to detect the localization of circTP63-N in nasopharyngeal carcinoma cells CNE2 and HONE1. The results showed that circTP63-N was distributed in both the nucleus and cytoplasm of nasopharyngeal carcinoma cells (see...). Figure 5 ).

[0098] RNA-FISH steps:

[0099] 1) Seed the experimental cells onto cell slides in a 24-well plate, cultured for 24 hours, then aspirate the culture medium and wash the cells with preheated 1×PBS for 3-5 minutes. Repeat 3 times.

[0100] 2) Preheat 4% paraformaldehyde, add about 300 μL of 4% paraformaldehyde to each well to fix cells for about 30 min. Then, wash the cells with 1×PBS for 3-5 min, repeating 3 times.

[0101] 3) Disrupt the cell membrane using 0.25% Triton-100 at room temperature for about 15 minutes. Then, wash the cells with 1×PBS for 3-5 minutes, repeating 3 times.

[0102] 4) After the pre-hybridization, hybridization, washing, and blocking steps, add biotinylated mouse anti-digoxigenin to the slide using the same method as in situ hybridization.

[0103] 5) Add mouse secondary antibody to a glass slide and incubate at 37°C for about 40 minutes. Then, wash the cells with 1×PBS for 3-5 minutes, repeating 3 times.

[0104] 6) Stain cell nuclei with DAPI at room temperature for about 10 minutes. Then wash cells with 1×PBS for 3-5 minutes, repeating 3 times.

[0105] 7) Add 1-2 drops of anti-fluorescence quenching agent to the slide and seal it. Store in the dark at low temperature and observe and photograph using a confocal microscope (Leica).

[0106] Example 7: Detection of circTP63-N overexpression in nasopharyngeal carcinoma cell lines

[0107] The blank control plasmid used in this invention is pcDNA-3.1circRNA Mini vector (purchased from Sangon Biotech). Exons 2-4 of TP63 mRNA are constructed into the pcDNA-3.1circRNA Mini vector. After transfection of the constructed circTP63-N overexpression plasmid vector into cells, circular sequences are spliced ​​together at both ends of the vector's multiple cloning site. Figure 6 A represents the plotted overexpression vector map.

[0108] To detect the circTP63-N circulation efficiency, we first overexpressed the constructed pcDNA3.1(+)CircRNA MiniVector / circTP63-N eukaryotic overexpression vector in nasopharyngeal carcinoma cells. Third and fourth generation nasopharyngeal carcinoma cells CNE2 and HONE1, with good growth, were seeded into 12-well plates. When the cell confluence reached 60%-80%, the endotoxin-free plasmids pcDNA3.1(+)CircRNA Mini Vector empty vector and circTP63-N overexpression vector were transiently transfected into nasopharyngeal carcinoma cells CNE2 and HONE1 using Neofect. Cells were cultured for 36 hours and then collected. Real-time quantitative PCR was used to detect the expression level and circulation efficiency of circTP63-N. The qPCR results showed that compared with cells transfected with the pcDNA3.1(+)CircRNA Mini Vector empty plasmid, the expression level of circTP63-N in cells transfected with the circTP63-N overexpression plasmid was significantly increased, and the results were statistically significant (see [link to qPCR]). Figure 6 B).

[0109] Example 8: MTT and colony formation assays for detecting cell proliferation

[0110] We transiently transfected nasopharyngeal carcinoma cells CNE2 and HONE1 with the endotoxin-free plasmid pcDNA3.1(+)circRNA Mini Vector and the circTP63-N overexpression vector using Neofect. After culturing for 24 hours, we performed an MTT assay to verify their effect on cell proliferation. The results showed that overexpression of circTP63-N significantly inhibited the proliferation of both cell lines (see...). Figure 7 ).

[0111] MTT experimental steps:

[0112] 1) Preparation: In a clean bench, accurately weigh 250 mg of MTT powder. Dissolve the powder in serum-free 1640 or DMEM medium, bring the volume to 50 mL, and shake to ensure complete dissolution. Filter through a 0.22 μm filter sieve for sterilization. The final concentration of the MTT solution is 5 μg / μL. To avoid repeated freeze-thaw cycles, aliquot into 2 mL or 15 mL centrifuge tubes according to experimental requirements. Protect the surface of the centrifuge tubes from light (wrapped in aluminum foil) and store at -20°C. Sterilize the tip, autoclaved D-Hanks pipette, pipette, marker pen, and 15 mL centrifuge tubes with alcohol, then place them in a biosafety cabinet for UV irradiation for 30 min followed by 10 min of ventilation.

[0113] 2) Seeding and transfection: The day before, digest the cells in good condition from the cell culture dish and seed them into a 6-well plate. When the cells grow to about 80-90%, transfect them with the overexpression vector.

[0114] 3) After 24-36 hours of transfection, cells were digested and centrifuged, and cell counts were performed. Five replicates were made per group of cells, and 800-1000 cells were seeded into each well of a 96-well plate. After 6 hours, once the cells had adhered, 20 μL of dissolved MTT solution was added to each well. The cells were incubated at 37°C for 4 hours. The supernatant was discarded, and DMSO was added to dissolve the MTT solution. After vortexing and mixing, the absorbance of each well was measured at 490 nm using a microplate reader. The above steps were repeated daily for a total of 6 days. The cell proliferation capacity was assessed using the data from the first assay as a control (see...). Figure 7 A).

[0115] Cloning experiment steps:

[0116] 1) Cell preparation: Culture the cells in cell culture medium until the logarithmic growth phase (i.e., cell density of 5 × 10⁻⁶). 5 -1×10 6 Wash twice with PBS ( / ml). Digest and centrifuge.

[0117] 2) Prepare cell suspension: Mix tumor cell suspension with cell culture medium and add it to a six-well or 12-well plate under clean and sterile conditions to ensure that the cells are evenly distributed and that the number of cells in each well is the same.

[0118] 3) Place the culture plate in an incubator at 37℃ and incubate for about a week. Change the culture medium every 3-4 days during this period.

[0119] 4) Observe cell growth: After about one week, observe the cell morphology under a microscope. If there are clusters of cells, it indicates that a clone has formed.

[0120] 5) Fixation and staining: Fix the cell smears with paraformaldehyde, then stain with crystal violet solution, and count the number of clones (see [link to documentation]). Figure 7 B).

[0121] Example 9: Cell transwell invasion experiment:

[0122] 1) Prepare the Transwell chamber: Separate the upper and lower chambers of the Transwell chamber. Thaw the matrix gel on ice beforehand. Then, dilute the matrix gel with serum-free medium (such as 1640 or DMEM) at a medium-to-matrix ratio of 8:1. After mixing, gently add 20 μL to the upper chamber of the Transwell chamber and allow it to solidify for 3 hours. Add 20% FBS medium to the lower chamber.

[0123] 2) Cell treatment: Remove serum from the culture medium and wash with 1×PBS. Then digest, centrifuge and resuspend.

[0124] 3) Cell counting: Dilute the cells with 1×PBS to the appropriate cell density and count them using a BIO-RAD cell counter to calculate the number of cells to be placed in each chamber.

[0125] 4) Cell Addition: Add cells to the Transwell chamber in the upper compartment and place the chamber into a 12-well plate containing 20% ​​serum. Before the experiment, ensure that the number of cells in each chamber is the same. Incubation: Incubate at 37°C for 24-48 hours.

[0126] 5) Remove cells from the upper chamber: After incubation, carefully wipe away any uninvaded cells from the upper chamber with a sterile cotton swab.

[0127] 6) Fixation and staining: Remove the chamber, wash it, fix the invading cells in the upper chamber with paraformaldehyde, and stain with crystal violet.

[0128] 7) Image acquisition and analysis: Observe the fixed and stained cells under a microscope and perform counting or image analysis to determine the degree of cell invasion.

[0129] In vitro overexpression of circTP63-N inhibited the invasion of nasopharyngeal carcinoma cells.

[0130] We performed a Transwell matrix gel invasion assay in nasopharyngeal carcinoma cell lines CNE2 and HONE1. Using Neofect, we transiently transfected CNE2 and HONE1 nasopharyngeal carcinoma cells with the endotoxin-free plasmid pcDNA3.1(+)circRNA Mini Vector and the circTP63-N overexpression vector. After 48 hours of culture, we collected the cells and used real-time quantitative PCR to detect the expression level and circularization efficiency of circTP63-N. After confirming the good overexpression effect of the circTP63-N overexpression plasmid, we seeded the cells into matrix gel-coated Transwell chambers. We found that the number of cells in the overexpression plasmid group that invaded the lower surface of the chamber was significantly less than that in the empty vector group, and the trend was consistent between the two cell lines. We randomly took three photos and recorded the cell counts. There were significant and statistically significant differences between the two groups in each cell line (see [link to study]. Figure 8 The above results indicate that overexpression of circTP63-N in nasopharyngeal carcinoma cell lines inhibits the in vitro invasive ability of nasopharyngeal carcinoma cells CNE2 and HONE1.

[0131] Example 10: Cell scratch healing migration experiment

[0132] 1) Cell culture: Culture the cells in DMEM or other medium containing 10% fetal bovine serum and maintain them in a constant temperature incubator at 37°C and 5% CO2.

[0133] 2) Preparation of a uniform cell monolayer: Add 1 mL of culture medium to a 6-well plate and seed 5 x 10^5 cells. Allow cells to adhere and form a monolayer, typically 24-48 hours.

[0134] 3) Scratching: Using a long, thin, pointed object (such as a 200μL pipette tip), draw a straight line along the center of the petri dish to form a "scratching".

[0135] 4) Washing: Rinse once with PBS buffer to remove cell residue.

[0136] 5) Culture: Culture in a medium supplemented with 2% serum (such as DMEM). Generally, after 24-48 hours, the cells will migrate to the scratched area and fill the "scratch".

[0137] 6) Imaging and Analysis: The scratched area is imaged using a microscope to record the integrity and filling status of the scratch. Software can be used to analyze the degree of filling and migration distance, and calculate parameters such as migration speed and filling rate.

[0138] In vitro overexpression of circTP63-N inhibited the migration of nasopharyngeal carcinoma cells.

[0139] We transiently transfected nasopharyngeal carcinoma cells CNE2 and HONE1 with the endotoxin-free plasmid pcDNA3.1(+)CircRNA Mini Vector and the circTP63-N overexpression vector using Neofect. After confirming the good overexpression effect of the circTP63-N overexpression plasmid, we performed a scratch healing assay on the nasopharyngeal carcinoma cell lines CNE2 and HONE1. The scratch healing assay at multiple time points in these cells confirmed that the migration ability of cells in the circTP63-N overexpression plasmid group was significantly reduced compared to the group containing the empty pcDNA3.1(+)CircRNA Mini Vector plasmid. The difference in scratch width was large and statistically significant. These results indicate that overexpression of circTP63-N in the nasopharyngeal carcinoma cell lines can inhibit the in vitro migration ability of nasopharyngeal carcinoma cells CNE2 and HONE1 (see [link to study]). Figure 9 ).

[0140] Example 11: circTP63-N inhibits the proliferation, invasion, and migration of nasopharyngeal carcinoma by binding to HSP90AB1.

[0141] To investigate the mechanism by which circTP63-N inhibits the proliferation, invasion, and migration of nasopharyngeal carcinoma, we transcribed the circTP63-N plasmid in vitro to obtain biotin-labeled linear RNA, which was then transfected into CNE2 cells. The linear RNA formed circTP63-N within the cells. Subsequently, RNA pull-down assays were used to extract circTP63-N and its binding protein. Figure 10 A). RNA pulldown and RNA immunoprecipitation (RIP) experiments further demonstrated that circTP63-N can directly bind to HSP90AB1 protein. Figure 10 BC). FISH (fluorescence in situ hybridization) experiments also confirmed the co-localization of circTP63-N and HSP90AB1. Figure 10 D).

[0142] To further verify whether circTP63-N inhibits the proliferation and invasion of nasopharyngeal carcinoma cells through HSP90AB1, the circTP63-N overexpression vector and siHSP90AB1 were co-transfected into nasopharyngeal carcinoma cells. MTT assays demonstrated that knocking down HSP90AB1 reduced the inhibitory effect of circTP63-N on the proliferation of nasopharyngeal carcinoma cells. Figure 10 E), colony formation assay results showed that knocking down HSP90AB1 reduced the inhibitory effect of circTP63-N on nasopharyngeal carcinoma colony formation. Figure 10 F). Further results from scratch healing and transwell assays indicated that siHSP90AB1 could attenuate the inhibitory effect of circTP63-N on the migration and invasion of nasopharyngeal carcinoma cells. Figure 10 GH).

[0143] Example 12: circTP63-N activates the Hippo pathway via HSP90AB1

[0144] HSP90AB1 (Heat Shock Protein 90 Alpha Family Class B Member 1) is a member of the HSP90 family. Intracellularly, it acts as a molecular chaperone, assisting in the proper assembly and folding of other proteins and helping to stabilize them. Previous studies have shown that the HSP90 inhibitor 17-AAG reduces LATS expression, leading to decreased phosphorylation of the LATS substrate YAP in the cytoplasm, increased YAP nuclear translocation, activation of transcription factor activity, and ultimately induction of tumor progression. However, the specific molecular mechanism remains unclear. Quantitative IP experiments showed that overexpression of circTP63-N enhanced the binding between HSP90AB1, LATS1 / 2, and YAP1. Figure 11A). Western blotting experiments showed that knockdown of HSP90AB1 inhibited the ability of circTP63-N to phosphorylate YAP1 ( Figure 11 B), inhibited the promoting effect of circTP63-N on YAP1 nuclear translocation ( Figure 11 C), and also inhibited the ubiquitination and degradation of YAP1 by circTP63-N ( Figure 11 D). Luciferase experiments demonstrated that knocking down HSP90AB1 inhibited the inhibitory effect of circTP63-N on CTGF promoter activity. Figure 11 E).

[0145] Example 13: circTP63-N inhibits the proliferation and invasion of nasopharyngeal carcinoma by downregulating YAP1.

[0146] To verify whether circTP63-N inhibits the proliferation and invasion of nasopharyngeal carcinoma cells by regulating YAP1, we first simultaneously overexpressed circTP63-N and YAP1 in two nasopharyngeal carcinoma cell lines. MTT and colony formation assays showed that overexpression of YAP1 could improve the inhibitory effect of circTP63-N on the proliferation of nasopharyngeal carcinoma cells. Figure 12 AB), Transwell chamber invasion assay results showed that overexpression of YAP1 could improve the inhibitory effect of circTP63-N on the invasive ability of nasopharyngeal carcinoma cells. Figure 12 C), the scratch healing assay results showed that overexpression of YAP1 could improve the inhibition of circTP63-N on the migration ability of nasopharyngeal carcinoma cells. Figure 12 D).

[0147] Example 14: circTP63-N / YAP1 axis inhibits the expression of INHBA, MMP3, and CCNE2.

[0148] To further investigate the role of YAP1 in the circTP63-N regulatory pathway, we predicted downstream target genes of YAP1 from the CritromeDB database and combined this with genes upregulated (LogFC>1) in the nasopharyngeal carcinoma gene expression microarrays GSE12452 and GSE53819. The intersection of these genes yielded 223 oncogenes that may be regulated by YAP1 in nasopharyngeal carcinoma. Figure 13 A). Pathway enrichment analysis of these 223 genes revealed that the leading pathway was Extracellular matrix organization, followed by mitotic cell cycle process. Figure 13B), qPCR detection revealed that INHBA and MMP3 in the Extracellular Matrix Organization pathway and CCNE2 in the Mitotic Cell Cycle Process pathway were all regulated by the transcription of YAP1 and circTP63-N. Figure 13 Western blotting results showed that overexpression of YAP1 promoted the upregulation of INHBA, MMP3, and CCNE2 protein levels, while knockdown of YAP1 or overexpression of circTP63-N inhibited the protein expression of INHBA, MMP3, and CCNE2. Figure 13 EF). When YAP1 and circTP63-N are simultaneously overexpressed, YAP1 can attenuate the transcription and translation of molecules such as INHBA, MMP3, and CCNE2 by circTP63-N. Figure 13 GH).

[0149] Example 15: circTP63-N inhibits the proliferation and metastasis of nasopharyngeal carcinoma via the LATS / YAP1 axis.

[0150] To investigate the effects of circTP63-N on the YAP1 pathway and downstream molecules, we examined the expression levels of circTP63-N, LATS1 / 2, YAP1, INHBA, MMP3, CCNE2, and Ki-67 in subcutaneous tumor tissues from nude mice. The results showed that overexpression of circTP63-N was effective in subcutaneous tumors. LATS1 / 2 expression was enhanced in the circTP63-N overexpression group, while the expression of YAP1, INHBA, MMP3, CCNE2, and Ki-67 was weakened. Figure 14 AB). In a nude mouse lung metastasis model, immunohistochemical experiments revealed enhanced expression of LATS1 / 2 in the circTP63-N overexpression group, while decreased expression of YAP1, INHBA, MMP3, and CCNE2. Figure 14 These results indicate that circTP63-N inhibits the proliferation and metastasis of nasopharyngeal carcinoma by regulating the YAP1 pathway and downstream molecules.

Claims

1. A circular RNA circTP63-N, the sequence is: tttcgtagaaaccccagctcatttctcttggaaagaaagttattaccgatccaccatgtcccagagcacacagacaaatgaattcctcagtccagaggttttccagcatatctggggat tttctggaacagcctatatgttcagttcagcccattgacttgaactttgtggatgaaccatcagaagatggtgcgacaaacaagattgagattagcatggactgtatccgcatgcaggactcggacctgagtg accccatgtggccacagtacacgaacctggggctcctgaacagcatggaccagcagattcagaacggctcctcgtccaccagtccctataacacagaccacgcgcagaacagcgtcacggcgccctcgcccta cgcacagcccagctccaccttcgatgctctctctccatcacccgccatcccctccaacaccgactacccaggcccgcacagtttcgacgtgtccttccagcagtcgagcaccgccaagtcggccacctggacg.

2. The use of the reagent for detecting the circular RNA circTP63-N as described in claim 1 in the preparation of nasopharyngeal carcinoma diagnostic agents; wherein the reagent for detecting the circular RNA circTP63-N as described in claim 1 includes PCR detection reagents or in situ hybridization detection reagents.

3. The application according to claim 2, characterized in that, The primer sequences for the PCR detection reagent are as follows: upstream primer: 5'- TCCACCTTCGATGCTCTCTC -3'; downstream primer: 5'- TTTGTCTGTGTGCTCTGGGA -3'.

4. The use of the reagent for overexpressing the circular RNA circTP63-N as described in claim 1 in the preparation of nasopharyngeal carcinoma therapeutic agents.

5. The application according to claim 4, characterized in that, The reagent for overexpressing the circular RNA circTP63-N of claim 1 includes a vector for overexpressing the circular RNA circTP63-N.

6. A nasopharyngeal carcinoma treatment agent, characterized in that, The reagent includes a method for overexpressing the circular RNA circTP63-N as described in claim 1.

7. The formulation according to claim 6, characterized in that, The reagent for overexpressing the circular RNA circTP63-N of claim 1 includes a vector for overexpressing the circular RNA circTP63-N.